Immune Gene-linked EST-SSR Marker Development for Coconut Scale Insects, Aspidiotus Destructor Signoret and Aspidiotus Rigidus Reyne

Immune Gene-linked EST-SSR Marker Development for Coconut Scale Insects, Aspidiotus Destructor Signoret and Aspidiotus Rigidus Reyne | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Immune Gene-linked EST-SSR Marker Development for Coconut Scale Insects, Aspidiotus Destructor Signoret and Aspidiotus Rigidus Reyne Rochelle Escobin Alcasid, Ma. Anita M. Bautista, Darlon V. Lantican, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3404230/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 25 Sep, 2025 Read the published version in International Journal of Tropical Insect Science → Version 1 posted 5 You are reading this latest preprint version Abstract The infestation of coconut scale insects (CSI), Aspidiotus destructor and A. rigidus , resulted in significant economic damages to the Philippine coconut industry in recent years. This incident demands a thorough understanding of the biological information of the insect pests to understand how they thrive and perpetuate despite of adverse ecological conditions. This research explored microsatellite mining, characterization, and marker design on two species of coconut scale insect. Using bioinformatics approaches, predominant dinucleotide repeats units (TA and TC), average length of 40bp and density of 728 SSRs/Mbp were observed in the microsatellite regions of the transcriptomes. A total of 18,480 and 1,681 EST-SSR markers were designed for A. destructor and A. rigidus , respectively. In addition, homology search of 4,369 immune genes from 4IN database against the transcriptome assemblies revealed 22 and 302 orthologs expressed by A. rigidus and A. destructor , respectively. This result provides insights into the expression of genes involved in evolutionarily conserved immune pathways (i.e.,Toll, Imd, JNK, and JAK- STAT) of these two coconut scale insect species. From the vast resource of EST-SSR markers, eight (8) immune gene-linked EST-SSR markers were deduced targeting effete ( eff ), autophagy 8 ( Atg8 ), ras-like GTP-binding protein ( rho1 ) and anterior open ( aop ). The polymorphic EST-SSR markers established in this research can be used for comprehensive genetic analysis of coconut scale insects towards safeguarding the country's vibrant coconut industry. microsatellites genetic marker immune genes armored scale insects Diaspididae Figures Figure 1 Figure 2 Figure 3 INTRODUCTION Coconut, Cocos nucifera L., is an important crop commonly referred to as the "tree of life" due to its multifarious utility ranging from food to cosmetics (Rajesh et al., 2014 ). The Philippines serves as the world’s second top coconut producer for contributing 14.8 million tons coming from 3.6M hectare-land (FAOSTAT, 2023). The coconut industry serves as the 4.8% country’s gross value added (GVA) and as the primary source of livelihood to 2.5 million farmers (PSA, 2022). However, this industry was recently threatened by a miniscule insect pest called coconut scale insect (CSI) or “Cocolisap” (Lesaba, 2012 ; Argana, 2013 ; Ganzon, 2013 ). CSI belongs to the armored scale insect family Diaspididae with two predominant species namely, Aspidiotus destructor Signoret and A. rigidus Reyne. Aspidiotus rigidus can morphologically be differentiated from A. destructor in terms of its extremely tough and rigid cuticle, fewer egg production (10–12 eggs), crescent-shaped egg distribution pattern and 1.5 times longer life cycle duration (Watson et al., 2015 ). According to Kalshoven ( 1981 ), the maximum density can range from 20–30 insect scales per cm 2 leaf, which amounts to 40–60 million scale insects on a coconut tree. Hence, heavy infestations could greatly impair plant transpiration and photosynthetic ability leading to significant chlorosis or necrosis. This substantially results in reduced nut production, dried kernel, and tasteless coconut water (Watson et al., 2015 ). The genetic structure and diversity of coconut scale insect has been explored using gene markers such as cytochrome C oxidase I ( COI ) (Caoili et al., 2014), internal transcribed spacer 2 (ITS2) (Guerrero et al., 2019 ), and 16S ribosomal RNA of its primary endosymbiont ( Uzinura diaspicola ) (Timple et al., 2017 ). These studies have detected significant genetic differentiation among A. destructor , A. rigidus , and A. excisus present in the outbreak and non-outbreak areas of the country. Species-specific marker has also been developed for identification of this pest (Latina, 2022). Furthermore, the transcriptome data of A. destructor and A. rigidus was made available in the National Centre for Biotechnology Information (Bautista et al., 2019 ). These collective efforts have resulted in accurate identification, diversity analysis and molecular characterization of CSI populations in our country. Transcriptomic microsatellites (Expressed Sequence Tags-Simple Sequence Repeats; EST-SSR) are repeat units located in the coding regions of the genome (Eujayl et al., 2003 ; Saha et al., 2006). Hence, it presents higher transferability across species than genomic SSRs (Weng et al., 2007 ). EST-SSRs have already been utilized in various species such as brown planthopper (Jing et al., 2012 ), pond loach (Feng et al., 2018 ), wheat (Gupta et al., 2003 ), quails (Bai et al., 2016 ), and sheep (Zhang et al., 2014 ). It has also been associated with several important traits such as immunity (Duan et al., 2013 ; Zhang et al., 2014 ), resistance (Nie et al., 2013 ), sex determination and reproduction (Che et al., 2014 ; Zhang et al., 2014 ). The insect’s innate immunity functions via three defense mechanisms: physical barrier (integument and peritrophic membrane), cellular immune response (hemocytes and phagocytes), and humoral response (antimicrobial peptides, prophenoloxidase) (Rosales and Vonnie, 2017 ). When invading microorganisms breach the insect cuticle, they are recognized by pattern recognition proteins (PRP) such as peptidoglycan-binding proteins (PGRPs) and Gram-negative bacteria-binding proteins (GNBPs), which initiates immune signal transduction to synthesize peptides having broad spectrum against pathogens (Ruzzante et al., 2022). Through the detailed functional studies using insect model species ( Drosophila and Anopheles) , prominent immunity pathways have been elucidated (Christophides et al., 2002 ). Toll and Imd were identified as the core signaling pathway which triggers the production and release of antimicrobial peptides (AMPs) (Ferrandon et al., 2007 ; Tanji et al., 2007; Viljakainen, 2015 ). JNK and JAK-STAT pathways were identified as complementary immunity pathways in insects. These findings were confirmed by the genome annotation of most insect species, except for Acyrthosiphon pisum (pea aphid) and Pediculus humanus ( body louse) (Gerardo et al., 2010 and Kim et al., 2011). In the case of coconut scale insects, these innate immunity responses are yet to be confirmed and explored. With the availability of the CSI transcriptome database, immune genes and pathways exhibited by Aspidiotus spp. can be elucidated. These IPM-relevant genes can also be used to develop EST-SSR markers for future genetic analysis. Hence, this study focused on the identification of expressed immunes genes and pathway of coconut scale insects ( A. destructor and A. rigidus ). Candidate immune gene-linked EST-SSR markers for future downstream genetic analysis were also developed in this research. METHODOLOGY Transcriptome-wide SSR Mining and Characterization Transcriptome shotgun assembly of Aspidiotus destructor and A. rigidus (Accession Nos. GGKE00000000 and GHKI00000000) were retrieved from National Center for Biotechnology Information (NCBI) ( https://www.ncbi.nlm.nih.gov/ ). Using GMATA v2.0 software (Wang and Wang, 2016 ), EST-SSR loci were identified in the input multi-FASTA files representing the transcriptome assemblies of Aspidiotus destructor and A. rigidus . The following parameters were employed for EST-SSR mining: minimum length (nt) = 2, maximum length (nt) = 10, and minimum repeat-times = 5. The position and information (such as repeat sequence units, repeat motifs, length, frequency, and distribution) of the mined EST-SSR loci in the transcriptomes were saved as .ssr file for further parsing and analysis. Immune Gene-Linked EST-SSR Annotation and Filtering A total of 4,369 immune gene sequences from a wide range of available insect genomes were downloaded from 4IN Database ( http://bf2i300.insa-lyon.fr:443/home ). The compiled gene sequences are associated with 20 immunity responses or pathways (i.e., melanization, autophagy, Eiger-Wengen pathway, JAK-STAT pathway, etc.). These gene sequences were derived from 14 insect model species such as Acyrthosiphon pisum , Aedes aegypti , Apis mellifera , Glossina morsitans , Nasonia vitripennis , Pediculus humanus , Solenopsis invicta , Bombyx mori , Camponotus floridanus , Dendroctonus ponderosae , Drosophila melanogaster , Plutella xylostella and Tribolium castaneum . Immune gene homologs were filtered through Local BLAST (Basic Local Alignment Search Tool) search in a Linux-based computer. The transcriptome assembly of A. destructor and A. rigidus were established as separate BLAST databases, whereas the compiled immune gene sequences from the 4IN Database were utilized as query sequences. EST-SSR Marker Design and PCR amplification After repeat identification, marker design was employed in GMATA using parameters: minimum amplicon size (-smin) = 150 bp, maximum amplicon size (-smax) = 400bp and optimal annealing Tm (-tm) = 60°C. The identified immune gene homologs were searched among overall EST-SSR markers’ target sequences to identify candidate EST-SSR markers. PCR amplification of candidate EST-SSR markers was performed at a final reaction concentration of 1X PCR buffer, 2.5mM MgCl 2 , 0.2mM dNTPs, 0.2 µM each of forward and reverse primers, 1U Taq polymerase and 100ng DNA using Quanta Biotech thermal cycler. PCR profile conditions involved the following: initial denaturation step at 95°C for 5 mins; 39 cycles of denaturation at 94°C for 1 min, annealing at specific temperature for the EST-SSR marker for 1 min (Table 3) and extension at 72°C for 2 mins; and final extension at 72°C for 10 mins. Samples were resolved in 2% agarose gel electrophoresis at 70V for 45 mins. These were viewed and documented under ultraviolet light of Alpha Imager Mini Gel Doc System (Brand: Protein Simple). RESULTS AND DISCUSSION Transcriptome-wide SSR Mining and Characterization A total of 27,505 and 2,373 microsatellites were detected for A. destructor and A. rigidus , respectively. These regions were utilized as target sequence for primer design, wherein 18,480 and 1,681 EST-SSR markers were generated for A. destructor and A. rigidus , respectively (Table 1). For A. destructor , an average frequency of 937 SSRs/Mb was observed across the transcriptome. The most evident SSR motifs were dimers (14,951, 54%), trimers (10,983, 40%) and tetramers (1,212, 4%) (Fig. 1a). Among dinucleotide repeat units, "TA” (2,253, 8%) was the most evident repeat unit (Fig. 1b). The average SSR length was 46bp, which ranged from 10–120 bp (Fig. 1c). On the other hand, A. rigidus was observed to have an average frequency of 519 SSRs/Mb across its transcriptome. The most evident SSR motifs were also dimers (1,267, 53%), trimers (952, 40%) and tetramers (147, 6%) (Fig. 1a). Among dinucleotide repeat units, "TC” (203, 9%) was the most evident repeat unit (Fig. 1b). The average SSR length was 34 bp, which ranged from 10–66 bp (Fig. 1c). The general findings for the most evident SSR motif (dimer), repeat units (TC and TA) and average lengths (46 and 34bp) for both Aspidiotus species were found congruent to the SSR characteristics from a large-scale analysis covering 136 insect species (Ding et al., 2017 ) Immune Gene-Linked EST-SSR Annotation, Filtering and Marker Design A total of 4,369 gene sequences associated with insect immune responses or pathways were downloaded from 4IN Database ( http://bf2i300.insa-lyon.fr:443/home ). Local BlastN search has identified 22 and 302 immune genes expressed in A. rigidus and A. destructor , respectively (Table 2, Fig. 2). EST-SSRs were identified through the alignment of immune genes to the compiled SSRs of Aspidiotus spp. Among the 324 immune gene homologs, only eight (8) immune genes were associated with microsatellite regions of the transcriptome (Table 3). These candidate markers target immune genes namely effete ( eff ), autophagy-related protein 8 ( Atg8 ), ras-like GTP-binding protein ( Rho1 ) and anterior open ( aop ). The positive amplification of these markers was confirmed and presented in Fig. 3. Arthropods exhibit innate immune mechanisms to fend against harmful bacteria, fungi, virus, and parasite in the environment. Although coconut scale insects are sedentary insects, they elicit powerful defense mechanisms such as physical barrier, cellular immune response, and humoral responses. These mechanisms are confirmed expressed in both Aspidiotus species (Table 2 and Fig. 2). The physical barrier through its rigid scale cover and epithelial cuticle acts as the first line of defense from invaders. Recognition proteins detects the presence of potentially harmful microorganisms in the system, which commences pertinent signaling cascades to elicit appropriate immune responses (Ruzzante et al., 2021 ). The immune deficiency (Imd) and Toll pathway are considered core pathways to regulate the secretion of antimicrobial peptides (AMP) through NF-kB activation via peptidoglycan receptor proteins (PGRP). JNK (c-Jun N-terminal kinase), JAK-STAT (Janus kinase – signal transducer and activatory proteins), and MAKP2-JNK-p38 pathways acts complementary pathways. The overall findings suggest holistic innate immunity mechanisms (physical barrier, cellular and humoral response) of coconut scale insects against pathogenic species. It must be carefully considered that this homology-based analysis was biased toward immune genes discovered in insect model species. Thus, unique, or novel immune genes might have been missed out during immune gene exploration (Sackton et al., 2013). The designed EST-SSR markers target specific immune genes namely: effete ( eff ) which acts as ubiquitin-conjugating enzyme for the selective degradation of short-lived and abnormal proteins in the IMD pathway (Cipressa & Cenca, 2013; autophagy-related protein 8 ( Atg8 ) which is involved in conjugation system for the formation of double-membrane vesicles (autophagosomes) during autophagy or bulk degradation process (Yamaguchi et al., 2010 ); ras-like GTP-binding protein ( Rho1 ) which regulates cell morphology in response to extracellular signals (Hariharan et al., 1995 ); and anterior open ( aop ) which a role in lamellocyte formation for phagocytosis in the MAKP-JNK-p38 pathway (Martin-Blanco, 1997 ) (Table 3 and Fig. 3). These markers can be used for population and evolutionary genetics studies towards better understanding of this economically-important pest. SUMMARY AND CONCLUSION Microsatellites were successfully mined and characterized in the EST database of Aspidiotus destructor Signoret and A. rigidus Reyne. A total of 27,505 microsatellite regions were identified wherein 18,480 markers have been designed for A. destructor . On the other hand, 2,373 microsatellite regions were identified wherein 1, 681 markers have been designed for A. rigidus. The general SSR features of Aspidiotus does not deviate to the general SSR features of other insect species. Immune genes and pathways were also identified through BLASTn search which revealed 22 and 302 immune gene orthologs expressed by A. rigidus and A. destructor , respectively. This analysis has confirmed the presence of evolutionarily conserved immunity pathways such as Toll, Imd, JNK, and JAK-STAT which combat and eliminate potentially harmful microorganisms. Ultimately, eight immune gene-linked EST-SSRs were deduced and amplified in this study. These molecular markers can be used for comprehensive genetic structure and diversity analysis of coconut scale insect populations which can help facilitate the design of effective and targeted IPM strategies against this major pest. Declarations Acknowledgment The authors would like to express sincere gratitude to the DOST-PCAARRD-funded project entitled: Comparative Genomics of Armored Scale Insects, Aspidiotus destructor Signoret and A. rigidus Reyne (Hemiptera: Diaspididae) for the financial support of this research. Author’s Contribution REA conducted the data preparation, analysis, and manuscript write-up. BLC, MAMB, DVL and RAL have contributed to improve the previous versions of the paper. All authors agreed and approved the submission of this work. Competing Interest The authors do not have relevant financial or non-financial competing interests to disclose. Funding This study was financially supported by Department of Science and Technology - Philippine Council for Agriculture, Aquatic and Natural Resources Research and Development (DOST-PCAARRD). References ARGANA RR (2013) That Voracious Pest called Coconut Scale Insect. Retrieved February 5, 2014 from http://www.pcaarrd.dost.gov.ph/home/ssentinel/index.php?option=com_content &view = article&id = 2145:that-voracious-pest-called- coconut- scaleinsect&catid = 1: latest-news BAI JY, PANG YZ, QI YX, ZHANG XH, YUN XY (2016) Development and application of Est-Ssr markers in quails. Brazilian J Poult Sci 18(SPE):27–32 BAUTISTA MAM, EGANA JMC, CLEOFE AS, CAOILI BL (2019) Transcriptome-Based In Silico Survey for Putative Effector Genes Involved in Sap-Feeding of the Coconut Scale Insect, Aspidiotus rigidus Reyne (Hemiptera: Diaspididae). The Philippine Agricultural Scientist Vol. 102 Special Issue (December 2019) LIT CAOILIBL, JR IL, YAP S.A. GUERREROMS (2014) Identification of the Philippine outbreak populations of the coconut scale insects using molecular markers with morphological confirmation CHE R, SUN Y, WANG R, XU T (2014) Transcriptomic analysis of endangered Chinese salamander: identification of immune, sex and reproduction-related genes and genetic markers. PLoS ONE, 9(1), e87940 CHRISTOPHIDES GK, ZDOBNOV E, BARILLAS-MURY C, BIRNEY E, BLANDIN S, BLASS C, BREY PT, COLLINS FH, DIMOPOULOS DANIELLIA, HETRU G, HOA C, HOFFMANN NT, LETUNIC J. A., KANZOK, S. M., LYCETT I., LEVASHINA, E. A., LOUKERIS, T. G., KAFATOS G., MEISTER, S., F. C (2002) Immunity-Related Genes and Gene Families in Anopheles gambiae. Science 298(5591):159–165. https://doi.org/10.1126/science.1077136 CIPRESSA F, CENCI G (2013) Effete, an E2 ubiquitin-conjugating enzyme with multiple roles inDrosophiladevelopment and chromatin organization. Fly 7(4):256–262. https://doi.org/10.4161/fly.26567 DING S, WANG S, HE K, JIANG M, LI F (2017) Large-scale analysis reveals that the genome features of simple sequence repeats are generally conserved at the family level in insects. BMC Genomics 18(1):1–10 DUAN Y, LIU P, LI J, LI J, CHEN P (2013) Immune gene discovery by expressed sequence tag (EST) analysis of hemocytes in the ridgetail white prawn Exopalaemon carinicauda. Fish Shellfish Immunol 34(1):173–182 EUJAYL I, WANG SLEDGEMK, MAY L, CHEKHOVSKIY GD, K., ZWONITZER, J. C.,MIAN, M. A. R (2003) Medicago truncatula EST-SSRs reveal cross species genetic markers for Medicago spp. Theor Appl Genet 108(3):414–422. https://doi.org/10.1007/s00122-0031450-6 FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS (FAO) (2023) FAO Statistical Database. Retrieved 08-23-2023 from https://www.fao.org/faostat/en/ FENG B, YI SV, ZHANG M, ZHOU X (2018) Development of novel EST-SSR markers for ploidy identification based on de novo transcriptome assembly for Misgurnus anguillicaudatus. PLoS ONE, 13(4), e0195829 FERRANDON D, HETRU IMLERJL, C., HOFFMANN JA (2007) The Drosophila systemic immune response: sensing and signalling during bacterial and fungal infections. Nat Rev Immunol 7(11):862–874. https://doi.org/10.1038/nri2194 GANZON T (2013) P41.2M set aside for Calabarzon pest control. Manila Times, 30 May 2013 [WWW document]. URL http://manilatimes.net/ p41-2m-set-aside-for-calabarzon-pest-control/5402/ [accessed on 4 February 2014] GERARDO NM, ANSELME ALTINCICEKB, ATAMIAN C, DE H., BARRIBEAU, S. M., VOS M (2010) … VILCINSKAS, A. Immunity and other defenses in pea aphids, Acyrthosiphon pisum. Genome biology, 11(2), 1–17 GUERRERO MS, LAUDE RP JAVIER, PA AND, ASPIDIOTUS SPP (2019) CAOILI BL. GENETIC DIVERSITY OF COCONUT SCALE INSECT,. (HEMIPTERA: DIASPIDIDAE) FROM OUTBREAK AND NON-OUTBREAK AREAS IN THE PHILIPPINES USING RIBOSOMAL INTERNAL TRANSCRIBED SPACER 2 (ITS2).The Philippine Agricultural Scientist Vol. 102 Special Issue (December 2019) GUPTA PK, RUSTGI S, SHARMA S, SINGH R, KUMAR N, BALYAN HS (2003) Transferable EST-SSR markers for the study of polymorphism and genetic diversity in bread wheat. Mol Genet Genomics 270(4):315–323 HARIHARAN IK, ASHA HUK, QUINTANILLA H, EZZELL A, R. M., SETTLEMAN J (1995) Characterization of rho GTPase family homologues in Drosophila melanogaster: overexpressing Rho1 in retinal cells causes a late developmental defect. EMBO J 14(2):292–302. https://doi.org/10.1002/j.1460-2075.1995.tb07003.x JING S, LIU B, PENG PENGL, ZHU X, L., FU, Q., HE G (2012) Development and use of EST-SSR markers for assessing genetic diversity in the brown planthopper (Nilaparvata lugens Stål). Bull Entomol Res 102(1):113–122 KALSHOVEN LGE (1981) Pests of Crops in Indonesia. P.T. Ichtiar Baru, Indonesia KIM JH, KWON MIN, J. S., KANG, J. S., YOON DH, PITTENDRIGH K. S., STRYCHARZ, J., KOH, Y. H., B. R., CLARK, J. M.,LEE, S. H (2011b) Comparison of the humoral and cellular immune responses between body and head lice following bacterial challenge. Insect Biochem Mol Biol 41(5):332–339. https://doi.org/10.1016/j.ibmb.2011.01.011 LESABA ME (2012) Pests destroy coconut trees in Batangas. Inquirer Southern Luzon, Philippines, 8 June, 2012, 10 1709 82 [WWW document]. URL http://newsinfo.inquirer.net/209397/pestsdestroy-coconut-trees-in-batangas [accessed on 6 March 2014] MARTIN-BLANCO E (1997) Regulation of cell differentiation by the Drosophila Jun kinase cascade. Curr Opin Genet Dev 7(5):666–671. https://doi.org/10.1016/s0959-437x(97)80015-9 NIE Q, YUE X, CHAI X, WANG, H., LIU B (2013) Three vibrio-resistance related EST-SSR markers revealed by selective genotyping in the clam Meretrix meretrix. Fish Shellfish Immunol 35(2):421–428 PHILIPPINE STATISTICS AUTHORITY (PSA) (2022) OpenSTAT - Gross Value Added in Agriculture, Forestry, and Fishing, Percent Share to the Major Industry. Retrieved from https://openstat.psa.gov.ph RAJESH MK, RACHANA KE, NAGANEESWARAN SA, SHAFEEQ R, THOMAS RJ, SHAREEFA M, MERIN B, ANITHA K (2014) Identification of expressed resistance gene analog sequences in coconut leaf transcriptome and their evolutionary analysis. Turkish J Agric Forestry 39(3). 10.3906/tar-1409-75 ROSALES C, VONNIE S (2017) Cellular and molecular mechanisms of insect immunity. Insect Physiology and Ecology. InTeach Publication. CCBY, pp 179–212 RUZZANTE L, FERON R, REIJNDERS MJ, A, T., WATERHOUSE R (2021) Functional constraints on insect immune system components govern their evolutionary trajectories. Cold Spring Harbor Laboratory - BioRxiv. https://doi.org/10.1101/2021.07.02.450559 SACKTON TB, WERREN, J. H., CLARK AG (2013) Characterizing the infection-induced transcriptome of Nasonia vitripennis reveals a preponderance of taxonomically-restricted immune genes. PLoS ONE, 8(12), e83984 SAHA MC, MIAN COOPERJD, M. R., CHEKHOVSKIY, K.,MAY, G. D (2006) Tall fescue genomic SSR markers: development and transferability across multiple grass species. Theor Appl Genet 113(8):1449–1458 TANJI T, HU, X., WEBER, A. N., IP YT (2007) Toll and IMD pathways synergistically activate an innate immune response in Drosophila melanogaster. Mol Cell Biol 27(12):4578–4588 TIMPLE JE, LATINA, R. A., CAOILI BL, MOLECULAR MARKER-BASED DETECTION OF PRIMARY BACTERIAL ENDOSYMBIONT ASSOCIATED WITH THE COCONUT SCALE INSECTS (2017) Aspidiotus destructor Signoret AND Aspidiotus rigidus Reyne (HEMIPTERA: DIASPIDIDAE). Philippine Entomol 31(2):117–127 VILJAKAINEN L (2015) Evolutionary genetics of insect innate immunity. Brief Funct Genomics 14(6):407–412 WANG X, WANG L (2016) GMATA: An Integrated Software Package for Genome-Scale SSR Mining, Marker Development and Viewing. Front Plant Sci. 7 https://doi.org/10.3389/fpls.2016.01350 WATSON GW, SHEPARD ADALLACB, B. M., CARNER GR (2015) Aspidiotus rigidus Reyne (Hemiptera: Diaspididae): a devastating pest of coconut in the Philippines. Agric For Entomol 17:1–8 WENG Y, AZHAGUVEL P, MICHELS GJ, RUDD JJ (2007) Cross-species transferability of microsatellite markers from six aphid (Hemiptera: Aphididae) species and their use for evaluating biotypic diversity in two cereal aphids. Insect Mol Biol. https://doi.org/10.1111/j.1365-2583.2007.00757.x YAMAGUCHI M, KUMETA NODA, N. N., NAKATOGAWA, H., OHSUMI H, Y., INAGAKI F (2010) Autophagy-related Protein 8 (Atg8) Family Interacting Motif in Atg3 Mediates the Atg3-Atg8 Interaction and Is Crucial for the Cytoplasm-to-Vacuole Targeting Pathway. J Biol Chem 285(38):29599–29607. https://doi.org/10.1074/jbc.m110.113670 ZHANG W, WANG Z, ZHAO Z, LI D, JIA, B., ABLEZ N (2014) Correlation analysis of ovine brain and ovary derived EST-SSR markers with litter size and birth weight. Acta Vet et Zootechnica Sinica 45(7):1084–1090 Tables Table 1 EST-SSR mining, characterization and mining using transcriptome shotgun assembly of Aspidiotus destructor ( GGKE01.1 ) and A. rigidus ( GHKI01.1 ) from National Center for Biotechnology Information (NCBI). Parameter Aspidiotus destructor Aspidiotus rigidus Total Input Sequence 310,539 46,644 Total Length (bp) (formatted) 248,347,095 43,622,884 Total SSR Loci 27,505 2,373 Total SSR with Designed SSR Marker 18,480 (67.19%) 1,681 (70.84%) Total SSR without Designed SSR Marker 9,025 (32.81%) 692 (29.16%) Total Number of Unique Markers: 11,818 1,611 Table 2 Identified immune genes and associated pathways of Aspidiotus destructor and A. rigidus through BlastN search of known immune genes from 4IN database against transcriptome assemblies of coconut scale insects. Immune Gene Classification No. of Mapped Query Sequences BlastN hit Detected Microsatellites Designed Marker* A. destructor (GGKE01.1) A. rigidus (GHKI01.1) Antimicrobial peptides 141 0 0 0 - Antimicrobial response 10 0 0 0 - Antiviral defense 119 2 0 0 MK9228 Apoptosis and Autophagy 405 18 1 0 - Cellular Immune Response 209 19 0 2 MK9095 and MK9094 Detoxification 119 1 0 0 - Protease 28 13 2 0 - Serine Proteases 926 17 0 0 - Melanization 93 1 0 0 - Stress Pathway 46 2 0 0 - IDM Pathway 18 18 0 0 - Imd Pathway 427 32 7 4 MK2428, MK836, MK3922 and 8391 JAK-STAT Pathway 192 17 0 0 - JNK Pathway 249 67 2 0 - ProPo Pathway 60 2 1 0 - Toll Pathway 713 43 3 0 - Ros Pathway 351 0 2 0 - Eiger-Wengen Pathway 18 0 0 0 - MAKP-JNK-p38 Pathway 245 45 4 1 MK9600 Other humoral proteins 152 5 0 0 - Total 4,369 302 22 7 8 Table 3 Immune gene-linked EST-SSR markers for genetic diversity analysis of coconut scale insect, Aspidiotus destructor Signoret and A. rigidus Reyne test populations from selected coconut farms in the Philippines. Marker Code SEQUENCE (5'-3') Ta Target Immune Gene SSR Repeat Motif E1 Forward TTGTGTTGCGTAGCGAATGT 52°C Effete (eff) TTA Reverse ACCTATCTCCAGCCCCTTTC E2 Forward GACAGATCGACAGCAACCAA 56°C Autophagy-related protein 8 (Atg8) AT Reverse TCTCTTAGCGACGCAACTCA E3 Forward GCCACCAATAGAGCCAGCTA 54°C Autophagy-related protein 8 (Atg8) CCGGTC Reverse GGAAGCACATGAACCGAGAT E4 Forward TGCTGTTGACGCTGTTAAGG 58°C Ras-like GTP-binding protein (Rho1) CTT Reverse CGCTATGGCTGAGAAAATC E5 Forward TGCTGTTGACGCTGTTAAGG 55°C Ras-like GTP-binding protein (Rho1) CTT Reverse TCTGCCAAAAGCAAGGAAG E6 Forward CCTTCTCTCGTTCCAGCATC 54°C Anterior Open (aop) TA Reverse GCATCGTCTTCGCATATGTT E7 Forward AGACGGCCGAGACAGAGAC 56°C Effete (eff) GCGA Reverse CTCCTCCTTGGTACGGACTG E8 Forward CAAACAAGGAATCGCCCTTA 56°C Effete (eff) TTA Reverse CGGACATTATGCGTTCAAAA Cite Share Download PDF Status: Published Journal Publication published 25 Sep, 2025 Read the published version in International Journal of Tropical Insect Science → Version 1 posted Editorial decision: Major revisions 03 Jan, 2025 Reviewers agreed at journal 24 Jan, 2024 Reviewers invited by journal 03 Jan, 2024 Editor assigned by journal 04 Oct, 2023 First submitted to journal 02 Oct, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3404230","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":265182088,"identity":"d2dae5b6-887d-4b16-9bf2-98ec8526acca","order_by":0,"name":"Rochelle Escobin Alcasid","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIiWNgGAWjYHACxgNAgofheAOIwwxmEwQQLWcOkKiFgeFGApFazNubHxz4UVMnw3fzjdkDhgrrxAbp3gN4tcicOWZwsOfYYR7J2znmBgxn0hMbZM4l4NUiIZFgcJiB7QCPwe0cMwnGtsOJDRI5Bvi1yD//cJjhXx2Pwc0zQC3/iNEiwWNwmLGNmcfgBg9QSwMxWnhyCg729gH9ciat3CDhWLpxm8wZAlrYj2988ONbnT3f8cPbHnyosZbtl+7BrwUZsDEkgEgJojWAtEAsJkHLKBgFo2AUjAgAAIU3Ry51nzpFAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0003-4721-4973","institution":"University of the Philippines Los Baños","correspondingAuthor":true,"prefix":"","firstName":"Rochelle","middleName":"Escobin","lastName":"Alcasid","suffix":""},{"id":265182089,"identity":"5839052a-526d-4f4b-9a3e-89ec32233da6","order_by":1,"name":"Ma. Anita M. Bautista","email":"","orcid":"","institution":"University of the Philippines Diliman","correspondingAuthor":false,"prefix":"","firstName":"Ma.","middleName":"Anita M.","lastName":"Bautista","suffix":""},{"id":265182090,"identity":"83bb3f7d-c459-408f-8d1c-00facf919a47","order_by":2,"name":"Darlon V. Lantican","email":"","orcid":"","institution":"University of the Philippines Los Banos","correspondingAuthor":false,"prefix":"","firstName":"Darlon","middleName":"V.","lastName":"Lantican","suffix":""},{"id":265182091,"identity":"c416dcbe-fdfd-4c11-a4ff-e6afca9b23c2","order_by":3,"name":"Romnick A. Latina","email":"","orcid":"","institution":"University of the Philippines Los Banos","correspondingAuthor":false,"prefix":"","firstName":"Romnick","middleName":"A.","lastName":"Latina","suffix":""},{"id":265182092,"identity":"eb90cf49-5451-4403-994e-95e54d81209d","order_by":4,"name":"Barbara L. Caoili","email":"","orcid":"","institution":"University of the Philippines Los Banos","correspondingAuthor":false,"prefix":"","firstName":"Barbara","middleName":"L.","lastName":"Caoili","suffix":""}],"badges":[],"createdAt":"2023-10-02 08:37:00","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3404230/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3404230/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s42690-025-01615-3","type":"published","date":"2025-09-25T15:56:57+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":49300993,"identity":"648220e3-0114-4a2d-af94-745ca50efd52","added_by":"auto","created_at":"2024-01-08 09:36:03","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":51981,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDistribution of different EST-SSR motif and classes across transcriptome shotgun assembly of coconut scale insects \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAspidiotus destructor \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eSignoret and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA. rigidus \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eReyne.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3404230/v1/196853c7d3767f2181d08359.png"},{"id":49300992,"identity":"0eb49cc6-a6c8-4f2c-b60b-7f014415e50e","added_by":"auto","created_at":"2024-01-08 09:36:03","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":80155,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFrequency of expressed immunity genes of adult female coconut scale insects, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAspidiotus destructor\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA. rigidus, \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eidentified through homology-based approach using same set of sequences.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3404230/v1/f989d1fd9c381701d7452091.png"},{"id":49300994,"identity":"ee272e43-63db-4c7f-a13a-02df7cfe3859","added_by":"auto","created_at":"2024-01-08 09:36:04","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":232031,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePCR amplification of the eight (8) candidate EST-SSR markers using individual coconut scale insect sample.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3404230/v1/83f04aa34e10d87d024b0b5a.png"},{"id":92430422,"identity":"4ee176a0-1c68-4b03-8003-2ce23258ae9f","added_by":"auto","created_at":"2025-09-29 16:03:03","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1475857,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3404230/v1/4663cabd-e66a-4ade-9c58-2d7f89270062.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eImmune Gene-linked EST-SSR Marker Development for Coconut Scale Insects, Aspidiotus Destructor Signoret and Aspidiotus Rigidus Reyne\u003c/p\u003e","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eCoconut, \u003cem\u003eCocos nucifera\u003c/em\u003e L., is an important crop commonly referred to as the \"tree of life\" due to its multifarious utility ranging from food to cosmetics (Rajesh et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The Philippines serves as the world\u0026rsquo;s second top coconut producer for contributing 14.8\u0026nbsp;million tons coming from 3.6M hectare-land (FAOSTAT, 2023). The coconut industry serves as the 4.8% country\u0026rsquo;s gross value added (GVA) and as the primary source of livelihood to 2.5\u0026nbsp;million farmers (PSA, 2022). However, this industry was recently threatened by a miniscule insect pest called coconut scale insect (CSI) or \u0026ldquo;Cocolisap\u0026rdquo; (Lesaba, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Argana, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Ganzon, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCSI belongs to the armored scale insect family Diaspididae with two predominant species namely, \u003cem\u003eAspidiotus destructor\u003c/em\u003e Signoret and \u003cem\u003eA. rigidus\u003c/em\u003e Reyne. \u003cem\u003eAspidiotus rigidus\u003c/em\u003e can morphologically be differentiated from \u003cem\u003eA. destructor\u003c/em\u003e in terms of its extremely tough and rigid cuticle, fewer egg production (10\u0026ndash;12 eggs), crescent-shaped egg distribution pattern and 1.5 times longer life cycle duration (Watson et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). According to Kalshoven (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e1981\u003c/span\u003e), the maximum density can range from 20\u0026ndash;30 insect scales per cm\u003csup\u003e2\u003c/sup\u003e leaf, which amounts to 40\u0026ndash;60\u0026nbsp;million scale insects on a coconut tree. Hence, heavy infestations could greatly impair plant transpiration and photosynthetic ability leading to significant chlorosis or necrosis. This substantially results in reduced nut production, dried kernel, and tasteless coconut water (Watson et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe genetic structure and diversity of coconut scale insect has been explored using gene markers such as \u003cem\u003ecytochrome C oxidase I\u003c/em\u003e (\u003cem\u003eCOI\u003c/em\u003e) (Caoili et al., 2014), internal transcribed spacer 2 (ITS2) (Guerrero et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), and 16S ribosomal RNA of its primary endosymbiont (\u003cem\u003eUzinura diaspicola\u003c/em\u003e) (Timple et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). These studies have detected significant genetic differentiation among \u003cem\u003eA. destructor\u003c/em\u003e, \u003cem\u003eA. rigidus\u003c/em\u003e, and \u003cem\u003eA. excisus\u003c/em\u003e present in the outbreak and non-outbreak areas of the country. Species-specific marker has also been developed for identification of this pest (Latina, 2022). Furthermore, the transcriptome data of \u003cem\u003eA. destructor\u003c/em\u003e and \u003cem\u003eA. rigidus\u003c/em\u003e was made available in the National Centre for Biotechnology Information (Bautista et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). These collective efforts have resulted in accurate identification, diversity analysis and molecular characterization of CSI populations in our country.\u003c/p\u003e \u003cp\u003eTranscriptomic microsatellites (Expressed Sequence Tags-Simple Sequence Repeats; EST-SSR) are repeat units located in the coding regions of the genome (Eujayl et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Saha et al., 2006). Hence, it presents higher transferability across species than genomic SSRs (Weng et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). EST-SSRs have already been utilized in various species such as brown planthopper (Jing et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2012\u003c/span\u003e), pond loach (Feng et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), wheat (Gupta et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2003\u003c/span\u003e), quails (Bai et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), and sheep (Zhang et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). It has also been associated with several important traits such as immunity (Duan et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Zhang et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), resistance (Nie et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), sex determination and reproduction (Che et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Zhang et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe insect\u0026rsquo;s innate immunity functions via three defense mechanisms: physical barrier (integument and peritrophic membrane), cellular immune response (hemocytes and phagocytes), and humoral response (antimicrobial peptides, prophenoloxidase) (Rosales and Vonnie, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). When invading microorganisms breach the insect cuticle, they are recognized by pattern recognition proteins (PRP) such as peptidoglycan-binding proteins (PGRPs) and Gram-negative bacteria-binding proteins (GNBPs), which initiates immune signal transduction to synthesize peptides having broad spectrum against pathogens (Ruzzante et al., 2022). Through the detailed functional studies using insect model species (\u003cem\u003eDrosophila\u003c/em\u003e and \u003cem\u003eAnopheles)\u003c/em\u003e, prominent immunity pathways have been elucidated (Christophides et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). Toll and Imd were identified as the core signaling pathway which triggers the production and release of antimicrobial peptides (AMPs) (Ferrandon et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Tanji et al., 2007; Viljakainen, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). JNK and JAK-STAT pathways were identified as complementary immunity pathways in insects. These findings were confirmed by the genome annotation of most insect species, except for \u003cem\u003eAcyrthosiphon pisum\u003c/em\u003e (pea aphid) and \u003cem\u003ePediculus humanus (\u003c/em\u003ebody louse) (Gerardo et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2010\u003c/span\u003e and Kim et al., 2011). In the case of coconut scale insects, these innate immunity responses are yet to be confirmed and explored.\u003c/p\u003e \u003cp\u003eWith the availability of the CSI transcriptome database, immune genes and pathways exhibited by \u003cem\u003eAspidiotus\u003c/em\u003e spp. can be elucidated. These IPM-relevant genes can also be used to develop EST-SSR markers for future genetic analysis. Hence, this study focused on the identification of expressed immunes genes and pathway of coconut scale insects (\u003cem\u003eA. destructor\u003c/em\u003e and \u003cem\u003eA. rigidus\u003c/em\u003e). Candidate immune gene-linked EST-SSR markers for future downstream genetic analysis were also developed in this research.\u003c/p\u003e"},{"header":"METHODOLOGY","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eTranscriptome-wide SSR Mining and Characterization\u003c/h2\u003e \u003cp\u003eTranscriptome shotgun assembly of \u003cem\u003eAspidiotus destructor\u003c/em\u003e and \u003cem\u003eA. rigidus\u003c/em\u003e (Accession Nos. GGKE00000000 and GHKI00000000) were retrieved from National Center for Biotechnology Information (NCBI) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e).\u003c/span\u003e Using GMATA v2.0 software (Wang and Wang, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), EST-SSR loci were identified in the input multi-FASTA files representing the transcriptome assemblies of \u003cem\u003eAspidiotus destructor\u003c/em\u003e and \u003cem\u003eA. rigidus\u003c/em\u003e. The following parameters were employed for EST-SSR mining: minimum length (nt)\u0026thinsp;=\u0026thinsp;2, maximum length (nt)\u0026thinsp;=\u0026thinsp;10, and minimum repeat-times\u0026thinsp;=\u0026thinsp;5. The position and information (such as repeat sequence units, repeat motifs, length, frequency, and distribution) of the mined EST-SSR loci in the transcriptomes were saved as .ssr file for further parsing and analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eImmune Gene-Linked EST-SSR Annotation and Filtering\u003c/h2\u003e \u003cp\u003eA total of 4,369 immune gene sequences from a wide range of available insect genomes were downloaded from 4IN Database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://bf2i300.insa-lyon.fr:443/home\u003c/span\u003e\u003cspan address=\"http://bf2i300.insa-lyon.fr:443/home\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The compiled gene sequences are associated with 20 immunity responses or pathways (i.e., melanization, autophagy, Eiger-Wengen pathway, JAK-STAT pathway, etc.). These gene sequences were derived from 14 insect model species such as \u003cem\u003eAcyrthosiphon pisum\u003c/em\u003e, \u003cem\u003eAedes aegypti\u003c/em\u003e, \u003cem\u003eApis mellifera\u003c/em\u003e, \u003cem\u003eGlossina morsitans\u003c/em\u003e, \u003cem\u003eNasonia vitripennis\u003c/em\u003e, \u003cem\u003ePediculus humanus\u003c/em\u003e, \u003cem\u003eSolenopsis invicta\u003c/em\u003e, \u003cem\u003eBombyx mori\u003c/em\u003e, \u003cem\u003eCamponotus floridanus\u003c/em\u003e, \u003cem\u003eDendroctonus ponderosae\u003c/em\u003e, \u003cem\u003eDrosophila melanogaster\u003c/em\u003e, \u003cem\u003ePlutella xylostella\u003c/em\u003e and \u003cem\u003eTribolium castaneum\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eImmune gene homologs were filtered through Local BLAST (Basic Local Alignment Search Tool) search in a Linux-based computer. The transcriptome assembly of \u003cem\u003eA. destructor\u003c/em\u003e and \u003cem\u003eA. rigidus\u003c/em\u003e were established as separate BLAST databases, whereas the compiled immune gene sequences from the 4IN Database were utilized as query sequences.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eEST-SSR Marker Design and PCR amplification\u003c/h2\u003e \u003cp\u003eAfter repeat identification, marker design was employed in GMATA using parameters: minimum amplicon size (-smin)\u0026thinsp;=\u0026thinsp;150 bp, maximum amplicon size (-smax)\u0026thinsp;=\u0026thinsp;400bp and optimal annealing Tm (-tm)\u0026thinsp;=\u0026thinsp;60\u0026deg;C. The identified immune gene homologs were searched among overall EST-SSR markers\u0026rsquo; target sequences to identify candidate EST-SSR markers.\u003c/p\u003e \u003cp\u003ePCR amplification of candidate EST-SSR markers was performed at a final reaction concentration of 1X PCR buffer, 2.5mM MgCl\u003csub\u003e2\u003c/sub\u003e, 0.2mM dNTPs, 0.2 \u0026micro;M each of forward and reverse primers, 1U Taq polymerase and 100ng DNA using Quanta Biotech thermal cycler. PCR profile conditions involved the following: initial denaturation step at 95\u0026deg;C for 5 mins; 39 cycles of denaturation at 94\u0026deg;C for 1 min, annealing at specific temperature for the EST-SSR marker for 1 min (Table\u0026nbsp;3) and extension at 72\u0026deg;C for 2 mins; and final extension at 72\u0026deg;C for 10 mins. Samples were resolved in 2% agarose gel electrophoresis at 70V for 45 mins. These were viewed and documented under ultraviolet light of Alpha Imager Mini Gel Doc System (Brand: Protein Simple).\u003c/p\u003e \u003c/div\u003e"},{"header":"RESULTS AND DISCUSSION","content":"\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eTranscriptome-wide SSR Mining and Characterization\u003c/h2\u003e \u003cp\u003eA total of 27,505 and 2,373 microsatellites were detected for \u003cem\u003eA. destructor\u003c/em\u003e and \u003cem\u003eA. rigidus\u003c/em\u003e, respectively. These regions were utilized as target sequence for primer design, wherein 18,480 and 1,681 EST-SSR markers were generated for \u003cem\u003eA. destructor\u003c/em\u003e and \u003cem\u003eA. rigidus\u003c/em\u003e, respectively (Table\u0026nbsp;1).\u003c/p\u003e \u003cp\u003eFor \u003cem\u003eA. destructor\u003c/em\u003e, an average frequency of 937 SSRs/Mb was observed across the transcriptome. The most evident SSR motifs were dimers (14,951, 54%), trimers (10,983, 40%) and tetramers (1,212, 4%) (Fig.\u0026nbsp;1a). Among dinucleotide repeat units, \"TA\u0026rdquo; (2,253, 8%) was the most evident repeat unit (Fig.\u0026nbsp;1b). The average SSR length was 46bp, which ranged from 10\u0026ndash;120 bp (Fig.\u0026nbsp;1c). On the other hand, \u003cem\u003eA. rigidus\u003c/em\u003e was observed to have an average frequency of 519 SSRs/Mb across its transcriptome. The most evident SSR motifs were also dimers (1,267, 53%), trimers (952, 40%) and tetramers (147, 6%) (Fig.\u0026nbsp;1a). Among dinucleotide repeat units, \"TC\u0026rdquo; (203, 9%) was the most evident repeat unit (Fig.\u0026nbsp;1b). The average SSR length was 34 bp, which ranged from 10\u0026ndash;66 bp (Fig.\u0026nbsp;1c).\u003c/p\u003e \u003cp\u003eThe general findings for the most evident SSR motif (dimer), repeat units (TC and TA) and average lengths (46 and 34bp) for both \u003cem\u003eAspidiotus\u003c/em\u003e species were found congruent to the SSR characteristics from a large-scale analysis covering 136 insect species (Ding et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2017\u003c/span\u003e)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eImmune Gene-Linked EST-SSR Annotation, Filtering and Marker Design\u003c/h2\u003e \u003cp\u003eA total of 4,369 gene sequences associated with insect immune responses or pathways were downloaded from 4IN Database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://bf2i300.insa-lyon.fr:443/home\u003c/span\u003e\u003cspan address=\"http://bf2i300.insa-lyon.fr:443/home\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Local BlastN search has identified 22 and 302 immune genes expressed in \u003cem\u003eA. rigidus\u003c/em\u003e and \u003cem\u003eA. destructor\u003c/em\u003e, respectively (Table\u0026nbsp;2, Fig.\u0026nbsp;2). EST-SSRs were identified through the alignment of immune genes to the compiled SSRs of \u003cem\u003eAspidiotus\u003c/em\u003e spp. Among the 324 immune gene homologs, only eight (8) immune genes were associated with microsatellite regions of the transcriptome (Table\u0026nbsp;3). These candidate markers target immune genes namely \u003cem\u003eeffete\u003c/em\u003e (\u003cem\u003eeff\u003c/em\u003e), \u003cem\u003eautophagy-related protein 8\u003c/em\u003e (\u003cem\u003eAtg8\u003c/em\u003e), \u003cem\u003eras-like GTP-binding protein\u003c/em\u003e (\u003cem\u003eRho1\u003c/em\u003e) and \u003cem\u003eanterior open\u003c/em\u003e (\u003cem\u003eaop\u003c/em\u003e). The positive amplification of these markers was confirmed and presented in Fig.\u0026nbsp;3.\u003c/p\u003e \u003cp\u003eArthropods exhibit innate immune mechanisms to fend against harmful bacteria, fungi, virus, and parasite in the environment. Although coconut scale insects are sedentary insects, they elicit powerful defense mechanisms such as physical barrier, cellular immune response, and humoral responses. These mechanisms are confirmed expressed in both \u003cem\u003eAspidiotus\u003c/em\u003e species (Table\u0026nbsp;2 and Fig.\u0026nbsp;2). The physical barrier through its rigid scale cover and epithelial cuticle acts as the first line of defense from invaders. Recognition proteins detects the presence of potentially harmful microorganisms in the system, which commences pertinent signaling cascades to elicit appropriate immune responses (Ruzzante et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The immune deficiency (Imd) and Toll pathway are considered core pathways to regulate the secretion of antimicrobial peptides (AMP) through NF-kB activation via peptidoglycan receptor proteins (PGRP). JNK (c-Jun N-terminal kinase), JAK-STAT (Janus kinase \u0026ndash; signal transducer and activatory proteins), and MAKP2-JNK-p38 pathways acts complementary pathways. The overall findings suggest holistic innate immunity mechanisms (physical barrier, cellular and humoral response) of coconut scale insects against pathogenic species. It must be carefully considered that this homology-based analysis was biased toward immune genes discovered in insect model species. Thus, unique, or novel immune genes might have been missed out during immune gene exploration (Sackton et al., 2013).\u003c/p\u003e \u003cp\u003eThe designed EST-SSR markers target specific immune genes namely: \u003cem\u003eeffete\u003c/em\u003e (\u003cem\u003eeff\u003c/em\u003e) which acts as ubiquitin-conjugating enzyme for the selective degradation of short-lived and abnormal proteins in the IMD pathway (Cipressa \u0026amp; Cenca, 2013; \u003cem\u003eautophagy-related protein 8\u003c/em\u003e (\u003cem\u003eAtg8\u003c/em\u003e) which is involved in conjugation system for the formation of double-membrane vesicles (autophagosomes) during autophagy or bulk degradation process (Yamaguchi et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2010\u003c/span\u003e); \u003cem\u003eras-like GTP-binding protein\u003c/em\u003e (\u003cem\u003eRho1\u003c/em\u003e) which regulates cell morphology in response to extracellular signals (Hariharan et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e1995\u003c/span\u003e); and \u003cem\u003eanterior open\u003c/em\u003e (\u003cem\u003eaop\u003c/em\u003e) which a role in lamellocyte formation for phagocytosis in the MAKP-JNK-p38 pathway (Martin-Blanco, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e1997\u003c/span\u003e) (Table\u0026nbsp;3 and Fig.\u0026nbsp;3). These markers can be used for population and evolutionary genetics studies towards better understanding of this economically-important pest.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e "},{"header":"SUMMARY AND CONCLUSION","content":"\u003cp\u003eMicrosatellites were successfully mined and characterized in the EST database of \u003cem\u003eAspidiotus destructor\u003c/em\u003e Signoret and \u003cem\u003eA. rigidus\u003c/em\u003e Reyne. A total of 27,505 microsatellite regions were identified wherein 18,480 markers have been designed for \u003cem\u003eA. destructor\u003c/em\u003e. On the other hand, 2,373 microsatellite regions were identified wherein 1, 681 markers have been designed for \u003cem\u003eA. rigidus.\u003c/em\u003e The general SSR features of \u003cem\u003eAspidiotus\u003c/em\u003e does not deviate to the general SSR features of other insect species. Immune genes and pathways were also identified through BLASTn search which revealed 22 and 302 immune gene orthologs expressed by \u003cem\u003eA. rigidus\u003c/em\u003e and \u003cem\u003eA. destructor\u003c/em\u003e, respectively. This analysis has confirmed the presence of evolutionarily conserved immunity pathways such as Toll, Imd, JNK, and JAK-STAT which combat and eliminate potentially harmful microorganisms. Ultimately, eight immune gene-linked EST-SSRs were deduced and amplified in this study. These molecular markers can be used for comprehensive genetic structure and diversity analysis of coconut scale insect populations which can help facilitate the design of effective and targeted IPM strategies against this major pest.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to express sincere gratitude to the DOST-PCAARRD-funded project entitled: Comparative Genomics of Armored Scale Insects, \u003cem\u003eAspidiotus destructor\u003c/em\u003e Signoret and \u003cem\u003eA. rigidus\u003c/em\u003e Reyne (Hemiptera: Diaspididae) for the financial support of this research.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eAuthor\u0026rsquo;s Contribution\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eREA conducted the data preparation, analysis, and manuscript write-up. BLC, MAMB, DVL and RAL have contributed to improve the previous versions of the paper. All authors agreed and approved the submission of this work.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eThe authors do not have relevant financial or non-financial competing interests to disclose.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eThis study was financially supported by\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eDepartment of Science and Technology - Philippine Council for Agriculture, Aquatic and Natural Resources Research and Development (DOST-PCAARRD).\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eARGANA RR (2013) That Voracious Pest called Coconut Scale Insect. Retrieved February 5, 2014 from \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.pcaarrd.dost.gov.ph/home/ssentinel/index.php?option=com_content \u0026amp;view = article\u0026amp;id = 2145:that-voracious-pest-called- coconut-\u003c/span\u003e\u003cspan address=\"http://www.pcaarrd.dost.gov.ph/home/ssentinel/index.php?option=com_content \u0026amp;view = article\u0026amp;id = 2145:that-voracious-pest-called- coconut-\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003escaleinsect\u0026amp;catid = 1: latest-news\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBAI JY, PANG YZ, QI YX, ZHANG XH, YUN XY (2016) Development and application of Est-Ssr markers in quails. Brazilian J Poult Sci 18(SPE):27\u0026ndash;32\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBAUTISTA MAM, EGANA JMC, CLEOFE AS, CAOILI BL (2019) Transcriptome-Based In Silico Survey for Putative Effector Genes Involved in Sap-Feeding of the Coconut Scale Insect, Aspidiotus rigidus Reyne (Hemiptera: Diaspididae). The Philippine Agricultural Scientist Vol. 102 Special Issue (December 2019)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLIT CAOILIBL, JR IL, YAP S.A. GUERREROMS (2014) Identification of the Philippine outbreak populations of the coconut scale insects using molecular markers with morphological confirmation\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCHE R, SUN Y, WANG R, XU T (2014) Transcriptomic analysis of endangered Chinese salamander: identification of immune, sex and reproduction-related genes and genetic markers. PLoS ONE, 9(1), e87940\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCHRISTOPHIDES GK, ZDOBNOV E, BARILLAS-MURY C, BIRNEY E, BLANDIN S, BLASS C, BREY PT, COLLINS FH, DIMOPOULOS DANIELLIA, HETRU G, HOA C, HOFFMANN NT, LETUNIC J. A., KANZOK, S. M., LYCETT I., LEVASHINA, E. A., LOUKERIS, T. G., KAFATOS G., MEISTER, S., F. C (2002) Immunity-Related Genes and Gene Families in Anopheles gambiae. Science 298(5591):159\u0026ndash;165. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.1077136\u003c/span\u003e\u003cspan address=\"10.1126/science.1077136\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCIPRESSA F, CENCI G (2013) Effete, an E2 ubiquitin-conjugating enzyme with multiple roles inDrosophiladevelopment and chromatin organization. Fly 7(4):256\u0026ndash;262. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4161/fly.26567\u003c/span\u003e\u003cspan address=\"10.4161/fly.26567\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDING S, WANG S, HE K, JIANG M, LI F (2017) Large-scale analysis reveals that the genome features of simple sequence repeats are generally conserved at the family level in insects. BMC Genomics 18(1):1\u0026ndash;10\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDUAN Y, LIU P, LI J, LI J, CHEN P (2013) Immune gene discovery by expressed sequence tag (EST) analysis of hemocytes in the ridgetail white prawn Exopalaemon carinicauda. Fish Shellfish Immunol 34(1):173\u0026ndash;182\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEUJAYL I, WANG SLEDGEMK, MAY L, CHEKHOVSKIY GD, K., ZWONITZER, J. C.,MIAN, M. A. R (2003) Medicago truncatula EST-SSRs reveal cross species genetic markers for Medicago spp. Theor Appl Genet 108(3):414\u0026ndash;422. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00122-0031450-6\u003c/span\u003e\u003cspan address=\"10.1007/s00122-0031450-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS (FAO) (2023) FAO Statistical Database. Retrieved 08-23-2023 from \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.fao.org/faostat/en/\u003c/span\u003e\u003cspan address=\"https://www.fao.org/faostat/en/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFENG B, YI SV, ZHANG M, ZHOU X (2018) Development of novel EST-SSR markers for ploidy identification based on de novo transcriptome assembly for Misgurnus anguillicaudatus. PLoS ONE, 13(4), e0195829\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFERRANDON D, HETRU IMLERJL, C., HOFFMANN JA (2007) The Drosophila systemic immune response: sensing and signalling during bacterial and fungal infections. Nat Rev Immunol 7(11):862\u0026ndash;874. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nri2194\u003c/span\u003e\u003cspan address=\"10.1038/nri2194\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGANZON T (2013) P41.2M set aside for Calabarzon pest control. Manila Times, 30 May 2013 [WWW document]. URL \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://manilatimes.net/ p41-2m-set-aside-for-calabarzon-pest-control/5402/\u003c/span\u003e\u003cspan address=\"http://manilatimes.net/ p41-2m-set-aside-for-calabarzon-pest-control/5402/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e [accessed on 4 February 2014]\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGERARDO NM, ANSELME ALTINCICEKB, ATAMIAN C, DE H., BARRIBEAU, S. M., VOS M (2010) \u0026hellip; VILCINSKAS, A. Immunity and other defenses in pea aphids, Acyrthosiphon pisum. Genome biology, 11(2), 1\u0026ndash;17\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGUERRERO MS, LAUDE RP JAVIER, PA AND, ASPIDIOTUS SPP (2019) CAOILI BL. GENETIC DIVERSITY OF COCONUT SCALE INSECT,. (HEMIPTERA: DIASPIDIDAE) FROM OUTBREAK AND NON-OUTBREAK AREAS IN THE PHILIPPINES USING RIBOSOMAL INTERNAL TRANSCRIBED SPACER 2 (ITS2).The Philippine Agricultural Scientist Vol.\u0026nbsp;102 Special Issue (December 2019)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGUPTA PK, RUSTGI S, SHARMA S, SINGH R, KUMAR N, BALYAN HS (2003) Transferable EST-SSR markers for the study of polymorphism and genetic diversity in bread wheat. Mol Genet Genomics 270(4):315\u0026ndash;323\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHARIHARAN IK, ASHA HUK, QUINTANILLA H, EZZELL A, R. M., SETTLEMAN J (1995) Characterization of rho GTPase family homologues in Drosophila melanogaster: overexpressing Rho1 in retinal cells causes a late developmental defect. EMBO J 14(2):292\u0026ndash;302. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/j.1460-2075.1995.tb07003.x\u003c/span\u003e\u003cspan address=\"10.1002/j.1460-2075.1995.tb07003.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJING S, LIU B, PENG PENGL, ZHU X, L., FU, Q., HE G (2012) Development and use of EST-SSR markers for assessing genetic diversity in the brown planthopper (Nilaparvata lugens St\u0026aring;l). Bull Entomol Res 102(1):113\u0026ndash;122\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKALSHOVEN LGE (1981) Pests of Crops in Indonesia. P.T. Ichtiar Baru, Indonesia\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKIM JH, KWON MIN, J. S., KANG, J. S., YOON DH, PITTENDRIGH K. S., STRYCHARZ, J., KOH, Y. H., B. R., CLARK, J. M.,LEE, S. H (2011b) Comparison of the humoral and cellular immune responses between body and head lice following bacterial challenge. Insect Biochem Mol Biol 41(5):332\u0026ndash;339. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ibmb.2011.01.011\u003c/span\u003e\u003cspan address=\"10.1016/j.ibmb.2011.01.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLESABA ME (2012) Pests destroy coconut trees in Batangas. Inquirer Southern Luzon, Philippines, 8 June, 2012, 10 1709 82 [WWW document]. URL \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://newsinfo.inquirer.net/209397/pestsdestroy-coconut-trees-in-batangas\u003c/span\u003e\u003cspan address=\"http://newsinfo.inquirer.net/209397/pestsdestroy-coconut-trees-in-batangas\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e [accessed on 6 March 2014]\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMARTIN-BLANCO E (1997) Regulation of cell differentiation by the Drosophila Jun kinase cascade. Curr Opin Genet Dev 7(5):666\u0026ndash;671. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s0959-437x(97)80015-9\u003c/span\u003e\u003cspan address=\"10.1016/s0959-437x(97)80015-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNIE Q, YUE X, CHAI X, WANG, H., LIU B (2013) Three vibrio-resistance related EST-SSR markers revealed by selective genotyping in the clam Meretrix meretrix. Fish Shellfish Immunol 35(2):421\u0026ndash;428\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePHILIPPINE STATISTICS AUTHORITY (PSA) (2022) OpenSTAT - Gross Value Added in Agriculture, Forestry, and Fishing, Percent Share to the Major Industry. Retrieved from \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://openstat.psa.gov.ph\u003c/span\u003e\u003cspan address=\"https://openstat.psa.gov.ph\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRAJESH MK, RACHANA KE, NAGANEESWARAN SA, SHAFEEQ R, THOMAS RJ, SHAREEFA M, MERIN B, ANITHA K (2014) Identification of expressed resistance gene analog sequences in coconut leaf transcriptome and their evolutionary analysis. Turkish J Agric Forestry 39(3). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3906/tar-1409-75\u003c/span\u003e\u003cspan address=\"10.3906/tar-1409-75\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eROSALES C, VONNIE S (2017) Cellular and molecular mechanisms of insect immunity. Insect Physiology and Ecology. InTeach Publication. CCBY, pp 179\u0026ndash;212\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRUZZANTE L, FERON R, REIJNDERS MJ, A, T., WATERHOUSE R (2021) Functional constraints on insect immune system components govern their evolutionary trajectories. Cold Spring Harbor Laboratory - BioRxiv. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/2021.07.02.450559\u003c/span\u003e\u003cspan address=\"10.1101/2021.07.02.450559\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSACKTON TB, WERREN, J. H., CLARK AG (2013) Characterizing the infection-induced transcriptome of Nasonia vitripennis reveals a preponderance of taxonomically-restricted immune genes. PLoS ONE, 8(12), e83984\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSAHA MC, MIAN COOPERJD, M. R., CHEKHOVSKIY, K.,MAY, G. D (2006) Tall fescue genomic SSR markers: development and transferability across multiple grass species. Theor Appl Genet 113(8):1449\u0026ndash;1458\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTANJI T, HU, X., WEBER, A. N., IP YT (2007) Toll and IMD pathways synergistically activate an innate immune response in Drosophila melanogaster. Mol Cell Biol 27(12):4578\u0026ndash;4588\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTIMPLE JE, LATINA, R. A., CAOILI BL, MOLECULAR MARKER-BASED DETECTION OF PRIMARY BACTERIAL ENDOSYMBIONT ASSOCIATED WITH THE COCONUT SCALE INSECTS (2017) Aspidiotus destructor Signoret AND Aspidiotus rigidus Reyne (HEMIPTERA: DIASPIDIDAE). Philippine Entomol 31(2):117\u0026ndash;127\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVILJAKAINEN L (2015) Evolutionary genetics of insect innate immunity. Brief Funct Genomics 14(6):407\u0026ndash;412\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWANG X, WANG L (2016) GMATA: An Integrated Software Package for Genome-Scale SSR Mining, Marker Development and Viewing. Front Plant Sci. 7\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2016.01350\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2016.01350\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWATSON GW, SHEPARD ADALLACB, B. M., CARNER GR (2015) Aspidiotus rigidus Reyne (Hemiptera: Diaspididae): a devastating pest of coconut in the Philippines. Agric For Entomol 17:1\u0026ndash;8\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWENG Y, AZHAGUVEL P, MICHELS GJ, RUDD JJ (2007) Cross-species transferability of microsatellite markers from six aphid (Hemiptera: Aphididae) species and their use for evaluating biotypic diversity in two cereal aphids. Insect Mol Biol. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1365-2583.2007.00757.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1365-2583.2007.00757.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYAMAGUCHI M, KUMETA NODA, N. N., NAKATOGAWA, H., OHSUMI H, Y., INAGAKI F (2010) Autophagy-related Protein 8 (Atg8) Family Interacting Motif in Atg3 Mediates the Atg3-Atg8 Interaction and Is Crucial for the Cytoplasm-to-Vacuole Targeting Pathway. J Biol Chem 285(38):29599\u0026ndash;29607. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.m110.113670\u003c/span\u003e\u003cspan address=\"10.1074/jbc.m110.113670\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHANG W, WANG Z, ZHAO Z, LI D, JIA, B., ABLEZ N (2014) Correlation analysis of ovine brain and ovary derived EST-SSR markers with litter size and birth weight. Acta Vet et Zootechnica Sinica 45(7):1084\u0026ndash;1090\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEST-SSR mining, characterization and mining using transcriptome shotgun assembly of \u003cem\u003eAspidiotus destructor\u003c/em\u003e (\u003cem\u003eGGKE01.1\u003c/em\u003e) and \u003cem\u003eA. rigidus\u003c/em\u003e (\u003cem\u003eGHKI01.1\u003c/em\u003e) from National Center for Biotechnology Information (NCBI).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eParameter\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eAspidiotus destructor\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eAspidiotus rigidus\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal Input Sequence\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e310,539\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e46,644\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal Length (bp) (formatted)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e248,347,095\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e43,622,884\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal SSR Loci\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e27,505\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2,373\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal SSR with Designed SSR Marker\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e18,480 (67.19%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1,681 (70.84%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal SSR without Designed SSR Marker\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9,025 (32.81%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e692 (29.16%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal Number of Unique Markers:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11,818\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1,611\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eIdentified immune genes and associated pathways of \u003cem\u003eAspidiotus destructor\u003c/em\u003e and \u003cem\u003eA. rigidus\u003c/em\u003e through BlastN search of known immune genes from 4IN database against transcriptome assemblies of coconut scale insects.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eImmune Gene Classification\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNo. of Mapped Query Sequences\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eBlastN hit\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDetected Microsatellites\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDesigned Marker*\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eA. destructor\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003e(GGKE01.1)\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eA. rigidus\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003e(GHKI01.1)\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntimicrobial peptides\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e141\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntimicrobial response\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntiviral defense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e119\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMK9228\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eApoptosis and Autophagy\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e405\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCellular Immune Response\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e209\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMK9095 and MK9094\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDetoxification\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e119\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProtease\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSerine Proteases\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e926\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMelanization\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStress Pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIDM Pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eImd Pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e427\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMK2428, MK836, MK3922 and 8391\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eJAK-STAT Pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eJNK Pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e249\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProPo Pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eToll Pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e713\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRos Pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e351\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEiger-Wengen Pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMAKP-JNK-p38 Pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e245\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMK9600\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOther humoral proteins\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e152\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e4,369\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e302\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e22\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e7\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eImmune gene-linked EST-SSR markers for genetic diversity analysis of coconut scale insect, \u003cem\u003eAspidiotus destructor\u003c/em\u003e Signoret and \u003cem\u003eA. rigidus\u003c/em\u003e Reyne test populations from selected coconut farms in the Philippines.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMarker Code\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eSEQUENCE (5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTa\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTarget Immune Gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSSR Repeat Motif\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eE1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGTGTTGCGTAGCGAATGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e52\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eEffete (eff)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCTATCTCCAGCCCCTTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eE2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACAGATCGACAGCAACCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e56\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAutophagy-related protein 8 (Atg8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTCTTAGCGACGCAACTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eE3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCACCAATAGAGCCAGCTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e54\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAutophagy-related protein 8 (Atg8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCCGGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAAGCACATGAACCGAGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eE4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCTGTTGACGCTGTTAAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e58\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eRas-like GTP-binding protein (Rho1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCTATGGCTGAGAAAATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eE5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCTGTTGACGCTGTTAAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e55\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eRas-like GTP-binding protein (Rho1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTGCCAAAAGCAAGGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eE6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTTCTCTCGTTCCAGCATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e54\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAnterior Open (aop)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCATCGTCTTCGCATATGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eE7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGACGGCCGAGACAGAGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e56\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eEffete (eff)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGCGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCCTCCTTGGTACGGACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eE8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAAACAAGGAATCGCCCTTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e56\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eEffete (eff)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGGACATTATGCGTTCAAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"international-journal-of-tropical-insect-science","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jtis","sideBox":"Learn more about [International Journal of Tropical Insect Science](http://link.springer.com/journal/42690)","snPcode":"42690","submissionUrl":"https://www.editorialmanager.com/jtis/default2.aspx","title":"International Journal of Tropical Insect Science","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"microsatellites, genetic marker, immune genes, armored scale insects, Diaspididae","lastPublishedDoi":"10.21203/rs.3.rs-3404230/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3404230/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe infestation of coconut scale insects (CSI), \u003cem\u003eAspidiotus destructor\u003c/em\u003e and \u003cem\u003eA. rigidus\u003c/em\u003e, resulted in significant economic damages to the Philippine coconut industry in recent years. This incident demands a thorough understanding of the biological information of the insect pests to understand how they thrive and perpetuate despite of adverse ecological conditions. This research explored microsatellite mining, characterization, and marker design on two species of coconut scale insect. Using bioinformatics approaches, predominant dinucleotide repeats units (TA and TC), average length of 40bp and density of 728 SSRs/Mbp were observed in the microsatellite regions of the transcriptomes. A total of 18,480 and 1,681 EST-SSR markers were designed for \u003cem\u003eA. destructor\u003c/em\u003e and \u003cem\u003eA. rigidus\u003c/em\u003e, respectively. In addition, homology search of 4,369 immune genes from 4IN database against the transcriptome assemblies revealed 22 and 302 orthologs expressed by \u003cem\u003eA. rigidus\u003c/em\u003e and \u003cem\u003eA. destructor\u003c/em\u003e, respectively. This result provides insights into the expression of genes involved in evolutionarily conserved immune pathways (i.e.,Toll, Imd, JNK, and JAK- STAT) of these two coconut scale insect species. From the vast resource of EST-SSR markers, eight (8) immune gene-linked EST-SSR markers were deduced targeting \u003cem\u003eeffete\u003c/em\u003e (\u003cem\u003eeff\u003c/em\u003e), \u003cem\u003eautophagy 8\u003c/em\u003e (\u003cem\u003eAtg8\u003c/em\u003e), \u003cem\u003eras-like GTP-binding protein\u003c/em\u003e (\u003cem\u003erho1\u003c/em\u003e) and \u003cem\u003eanterior open\u003c/em\u003e (\u003cem\u003eaop\u003c/em\u003e). The polymorphic EST-SSR markers established in this research can be used for comprehensive genetic analysis of coconut scale insects towards safeguarding the country's vibrant coconut industry.\u003c/p\u003e","manuscriptTitle":"Immune Gene-linked EST-SSR Marker Development for Coconut Scale Insects, Aspidiotus Destructor Signoret and Aspidiotus Rigidus Reyne","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-08 09:35:59","doi":"10.21203/rs.3.rs-3404230/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revisions","date":"2025-01-03T15:22:26+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2024-01-25T03:27:20+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-01-03T16:42:12+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2023-10-04T10:20:25+00:00","index":"","fulltext":""},{"type":"submitted","content":"International Journal of Tropical Insect Science","date":"2023-10-02T04:36:44+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"international-journal-of-tropical-insect-science","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jtis","sideBox":"Learn more about [International Journal of Tropical Insect Science](http://link.springer.com/journal/42690)","snPcode":"42690","submissionUrl":"https://www.editorialmanager.com/jtis/default2.aspx","title":"International Journal of Tropical Insect Science","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"219b3986-7fa3-41b2-84b5-55e59566ba7c","owner":[],"postedDate":"January 8th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-09-29T15:59:09+00:00","versionOfRecord":{"articleIdentity":"rs-3404230","link":"https://doi.org/10.1007/s42690-025-01615-3","journal":{"identity":"international-journal-of-tropical-insect-science","isVorOnly":false,"title":"International Journal of Tropical Insect Science"},"publishedOn":"2025-09-25 15:56:57","publishedOnDateReadable":"September 25th, 2025"},"versionCreatedAt":"2024-01-08 09:35:59","video":"","vorDoi":"10.1007/s42690-025-01615-3","vorDoiUrl":"https://doi.org/10.1007/s42690-025-01615-3","workflowStages":[]},"version":"v1","identity":"rs-3404230","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3404230","identity":"rs-3404230","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}