Nicotinamide mononucleotide ameliorates adriamycin-induced renal damage by epigenetically suppressing the NMN/NAD consumers mediated by Twist2

preprint OA: closed
Full text JSON View at publisher
AI-generated summary by claude@2026-07, 2026-07-17

Nicotinamide mononucleotide treatment mitigated adriamycin-induced kidney damage by epigenetically suppressing NMN/NAD consumers via Twist2, thereby upregulating Sirt1.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-17 · read from full text

This preprint studied whether transient nicotinamide mononucleotide (NMN) treatment protects mice from adriamycin (ADR)-induced focal segmental glomerulosclerosis, using BALB/c mice given NMN intraperitoneally for 14 days followed by assessments up to 28 days. NMN reduced ADR-associated albuminuria, mitigated glomerulosclerosis, preserved podocyte number and podocyte foot-process density, and partially reversed kidney changes in Sirt1 and Claudin-1 expression while restoring histone methylation, increasing Dnmt1, and elevating renal NAD+ levels. Mechanistically, the paper reports that Dnmt1 epigenetically suppresses NAD/NMN-consuming enzymes Nmnat1 and PARP1 by methylating an E-box in the Nmnat1 promoter and repressing PARP1, with NMN downregulating Nmnat1 expression in ADR mice. A major caveat explicitly noted is that it is a preprint not yet peer reviewed. This paper is centrally about endometriosis/adenomyosis only tangentially: it does not discuss endometriosis or adenomyosis directly; it was included in the corpus via keyword match to NAD/Sirt1 metabolic-epigenetic pathways linked in broader endometriosis/adenomyosis literature.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

The activation of nicotinamide adenine dinucleotide (NAD + )-dependent deacetylase, Sirt1, after the administration of nicotinamide mononucleotide (NMN) suppresses many diseases. However, the role of NMN and Sirt1 in focal glomerulosclerosis (FSGS) has not yet been elucidated. This study aimed to assess the protective effect of NMN treatment in mice with adriamycin (ADR)-induced FSGS. Transient short-term NMN treatment was administered to 8-week-old ADR- or saline-treated BALB/c mice (Cont group) for 14 consecutive days. NMN alleviated the increase in urinary albumin excretion in the ADR-treated mice. NMN treatment mitigated glomerulosclerosis and ameliorated the reduced Sirt1 expression and elevated Claudin-1 expression in the kidneys of the mice. Moreover, this treatment improved the decrease in histone methylation and the expression level of Dnmt1 and increased the concentration of NAD + in the kidney. Dnmt1 epigenetically suppressed the expression of the NMN-consuming enzyme nicotinamide mononucleotide adenyltransferase1 (Nmnat1) by methylating the E-box in the promoter region and repressing the NAD-consuming enzyme PARP1. Additionally, NMN downregulated the expression of Nmnat1 in the ADR-treated mice. Short-term NMN treatment in FSGS has epigenetic renal protective effects through the upregulation of Sirt1 and suppression of the NAD and NMN consumers. The present study presents a novel treatment paradigm for FSGS.
Full text 126,495 characters · extracted from preprint-html · click to expand
Nicotinamide mononucleotide ameliorates adriamycin-induced renal damage by epigenetically suppressing the NMN/NAD consumers mediated by Twist2 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Nicotinamide mononucleotide ameliorates adriamycin-induced renal damage by epigenetically suppressing the NMN/NAD consumers mediated by Twist2 Kazuhiro Hasegawa, Yusuke Sakamaki, Masanori Tamaki, Shu Wakino This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1756041/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 8 You are reading this latest preprint version Abstract The activation of nicotinamide adenine dinucleotide (NAD + )-dependent deacetylase, Sirt1, after the administration of nicotinamide mononucleotide (NMN) suppresses many diseases. However, the role of NMN and Sirt1 in focal glomerulosclerosis (FSGS) has not yet been elucidated. This study aimed to assess the protective effect of NMN treatment in mice with adriamycin (ADR)-induced FSGS. Transient short-term NMN treatment was administered to 8-week-old ADR- or saline-treated BALB/c mice (Cont group) for 14 consecutive days. NMN alleviated the increase in urinary albumin excretion in the ADR-treated mice. NMN treatment mitigated glomerulosclerosis and ameliorated the reduced Sirt1 expression and elevated Claudin-1 expression in the kidneys of the mice. Moreover, this treatment improved the decrease in histone methylation and the expression level of Dnmt1 and increased the concentration of NAD + in the kidney. Dnmt1 epigenetically suppressed the expression of the NMN-consuming enzyme nicotinamide mononucleotide adenyltransferase1 (Nmnat1) by methylating the E-box in the promoter region and repressing the NAD-consuming enzyme PARP1. Additionally, NMN downregulated the expression of Nmnat1 in the ADR-treated mice. Short-term NMN treatment in FSGS has epigenetic renal protective effects through the upregulation of Sirt1 and suppression of the NAD and NMN consumers. The present study presents a novel treatment paradigm for FSGS. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Adriamycin (ADR)-induced nephropathy is a murine model of human focal glomerulosclerosis (FSGS), which is characterized by podocyte damage, glomerular sclerosis, and tubulointerstitial fibrosis. 1 In another study, podocyte conditional Sirt1 knockout resulted in aggravated podocyte injury after aldosterone infusion in mice. Lu Z reported that ADR-induced FSGS models presented with podocyte injury due to the downregulation of Sirt1. 2 Nonetheless, whether Sirt1 can rescue FSGS-induced podocyte injury is unknown. We previously demonstrated that Sirt1 knockout in proximal tubular cells decreased its expression in glomerular podocytes and increased the expression of a tight junction protein, Claudin-1, which resulted in albuminuria. 3 FSGS is the leading cause of end-stage renal disease. 1 In a previous study, we demonstrated that Sirt1 inactivation in podocytes upregulated the ectopic expression of Claudin-1, leading to the abrogation of glomerular barrier function via epigenetic mechanisms (reduced methylation of the Claudin-1 gene). 3 In an RNA sequence analysis using human FSGS samples, 4 Claudin-1 ectopic overexpression in the podocyte was reportedly correlated with podocyte damage. Transgenic mice with Claudin-1 overexpression in the podocytes demonstrated both podocyte injury and proteinuria. 5 Sirt1 exerts its effects via the protein deacetylase activity and the histone deacetylase activity. It regulates the expression levels of Claudin-1 3 and various other genes, epigenetically, via the histone deacetylation activity, along with DNA methylation. The upregulation of Claudin-1 might lead to glomerular damage, considering that the epigenetic effects could last for a prolonged period. This gene regulation effect is thought to be involved in the memory or legacy effects observed in diabetic complications, which have been observed in a previous large clinical trial (UKPDS80). 6 Sirt1 activity depends on the cellular levels of NAD + . NAD + concentrations in each organ have been reported to decrease with age and chronic organ damage, which includes CKD or nephrosis in murine models. 7 , 8 Therefore, increases in NAD levels could be used as potential therapeutic targets in these diseases. 9 Several strategies to increase Sirt1 activity, 10 including caloric restriction, 11 administration of resveratrol, 12 and approaches to restore NAD + levels (such as the administration of NAD + metabolites, 13 or the inhibition of NAD consumers), have been reported. 14 In terms of supplementation with NAD + metabolites to increase the NAD + concentration and Sirt1 activity or expression, several substances such as nicotinamide (NAM) riboside (NR), NAM mononucleotide (NMN), and NAM have been reported to have fewer adverse effects and efficiently enhance NAD + biosynthesis. 15–18 However, although the effects of NMN in cisplatin-induced AKI murine and diabetic nephropathy murine models have been published, 19 – 22 they have not been tested in the ADR-induced FSGS model thus far. NMN is an intermediate of the NAD + salvage pathway produced by nicotinamide phosphoribosyltransferase (Nampt) from NAM. In this pathway, NMN is further converted to NAD + by nicotinamide mononucleotide adenylyltransferase (Nmnat), which is then recycled in various metabolic and cellular reactions ( Fig. 1 ) . This study aimed to assess the renoprotective effect of preemptive short-term NMN treatment in mice with ADR-induced FSGS. The results suggested that NAD + and Sirt1 deficit contribute to kidney damage susceptibility. Short-term NMN treatment rescued the FSGS from podocyte damage through the restoration of renal NAD + concentrations, even after the termination of the treatment. Additionally, we observed long-term effects of the dynamics of NAD + metabolites after the treatment, suggesting legacy effects by the reactivation of Sirt1. The present study presents a novel treatment paradigm for FSGS, which could increase the possibility of achieving remission in this model. Results Effect of short-term NMN treatment on kidney function NMN is an NAD + precursor in the salvage pathway (Figure 1) . Transient short-term NMN treatment was administered to 8-week-old ADR-treated BALB/c mice or saline-treated BALB/c mice (Cont group). The ADR-treated mice were administered intraperitoneally with NMN at a dose of 500 mg/kg/day or with normal saline alone for 14 consecutive days (NMN 500 group or ADR group, respectively, Figure 2A ). The body weights of the mice in the NMN500 and Cont groups were greater than those in the ADR group; the weights of the mice in the Cont and NMN500 groups did not differ significantly ( Figure 2B ). On day 14, no significant differences in kidney weights were observed among the three groups, whereas on day 28, the weights in the Cont group and NMN500 group were higher than those in the ADR group ( Figure 2C ). On day 28, serum creatinine levels in the ADR group were higher than those in the Cont and NMN500 groups ( Figure 2D ). Although a decline in glomerular filtration was observed on day 28 in the ADR group, it was reversed in the NMN500 group ( Figure 2E ). Moreover, the ADR group exhibited a significantly higher urinary ACR compared to the Cont group, on days 14 and 28 ( Figure 2F ). The NMN500 group exhibited lower albuminuria levels than the ADR group on days 14 and 28, which suggested an inhibitory effect of NMN on albuminuria, and this effect was sustained for 28 days even after the termination of the short-term NMN intervention. Serum cholesterol levels were significantly higher in the ADR group than in the Cont and NMN500 groups on days 14 and 28 ( Figure 2G ). We further examined the dose-dependent effects of short-term NMN treatment ( Figure 3A ). The effects of short-term treatment with two additional doses of NMN, 100 and 300 mg/kg, on serum cholesterol levels and urine ACR levels, were evaluated on day 28. The cholesterol levels in ADR mice treated with 100 mg/kg NMN (NMN100) and 300 mg/kg NMN (NMN300) were not different from those in the ADR group ( Figure 3B ). Moreover, the NMN300 and NMN500 groups exhibited reduced ACR, whereas the NMN100 group did not show a significant reduction in ACR when compared to the ADR group ( Figure 3C ). Short-term NMN treatment ameliorated the histological changes in ADR-treated mice To histologically assess the effect of NMN on ADR-induced renal damage, the glomerular volume and mesangial expansion were evaluated via PAS staining and the podocyte number was determined using the podocyte marker WT-1 ( Figure 4A ). No significant difference in glomerular surface area was observed among the three groups on day 28 ( Figure 4 B ). The ADR group exhibited more PAS-positive areas than the Cont group on day 28 ( Figures 4A and 4C ). The PAS-positive areas in the NMN500 group were lower than those in the ADR group on day 28 ( Figure 4C ). Furthermore, on day 28, the number of podocytes per glomerular section was lower in the ADR group than that in the Cont group, and this reduction was rescued in the NMN500 group ( Figure 4D ). In terms of the EM findings, we investigated the thickness of the GBM and the density of the foot process of the podocytes ( Figure 4E ). The GBM thickness did not differ among the Cont, ADR, and NMN500 groups ( Figure 4F ), whereas the foot process density was lower in the ADR group than in the Cont group; this reduction was ameliorated in the NMN500 group ( Figure 4G ). Molecular changes in the glomerulus after NMN treatment We have previously shown that decreased Sirt1 in podocytes subsequently increases ectopic Claudin-1 expression and causes foot process effacement in the podocyte, leading to diabetic albuminuria. 3, 22 In the present study, we assessed the levels of expression of several proteins involved in this mechanism via immunohistochemistry in each mice group on day 28 when NMN treatment was terminated 14 days before ( Figure 5A ). Sirt1 expression was decreased in the ADR group compared with the Cont group ( Figure 5B ). Claudin-1 expression was increased ( Figure 5C ), and Synaptopodin expression was decreased in the ADR group ( Figure 5D ) when compared with the Cont group. These changes were ameliorated in the NMN group. We have previously reported that decreased Sirt1 expression causes Claudin-1 expression and podocyte damage through decreased histone H3K9 methylation and decreased Dnmt1 expression in a diabetic glomerular sclerosis background. 3, 22 This NMN effect was assessed in the ADR-induced nephropathy model in the present study. 23 To assess other Sirtuin isoforms that are abundantly expressed in the kidney, 24 the expression levels of both Sirt3 and Sirt6 in the glomeruli were determined. No changes in the expressions of Sirt3 were observed between the ADR and NMN500 groups ( Figure 5E, F ). Sirt6 expression was decreased in the ADR group and restored in the NMN500 group ( Figure 5E, G ). The expression of H3K9me2 was decreased in the ADR group as compared to that in the Cont group, but it was maintained in the NMN500 group ( Figure 5E, H ). The expression of Dnmt1 was decreased in the ADR group than in the Cont group; this change was ameliorated in the NMN500 group ( Figure 5E, I ). Effects of NMN treatment on NAD + metabolites and the salvage pathway The concentrations of NAD + in the kidney were determined from 8 to 24 weeks of age in the Cont and ADR groups to evaluate the chronological changes in NAD + metabolites. The ADR group had lower concentrations of NAD + in the kidneys at 12 weeks of age compared with the Cont group. In the ADR group, the NAD + concentrations in the kidney were further decreased at 16, 20, and 24 weeks of age relative to 8 weeks of age in a time-dependent manner ( Figure 6A ). On day 28, the NMN500 group presented with lower concentrations of NAM and NMN in the kidneys compared to the ADR group; no differences in the concentrations of NAM and NMN were observed between the Cont and NMN500 groups ( Figure 6B, 6C ) . The concentration of NAD + in the NMN500 group was higher than that in the ADR group ( Figure 6D ). Immunohistochemistry revealed that Nampt expression was lower in the ADR group than in the Cont group and higher in the NMN500 group compared with the ADR group (Figure 6E, F) . Conversely, Nmnat1 expression was higher in the ADR group than in the Cont g roup, and the upregulation was repressed in the NMN500 group ( Figure 6E, G ). The expression of Poly-ADP-ribose-polymerase 1 ( PARP1), the major NAD+ consumer in cells, 25, 26, 27 was increased in the ADR group compared to the Cont group, which might have caused the reduction in NAD + in this group ( Figure 6E, H ). Consistent with the changes in NAD + levels ( Figure 6D ), PARP1 expression in the kidney was lower in the NMN500 group compared to that in the ADR group ( Figure 6E, H ). Epigenetic regulatory mechanism of NMN-induced Nmnat1 downregulation The murine Nmnat1 gene 5′-flanking region (3 kb) was analyzed using the CpGplot program ( http://www.ebi.ac.uk/emboss/cpgplot/ ). A CpG island located in the promoter flanking the first codon was identified ( Figure 7A ), and four CAGCTG E-boxes were detected within the island ( Figure 7B ). To initially locate the functional regions responsible for regulating Nmnat1 gene expression in podocytes, several 5′ deletion constructs with luciferase as the reporter gene were used for transient transfection studies ( Figure 7C ). Sequence analysis using TRANSFAC software revealed the localization of putative transcription factor binding sites for SP-1, Gata3, Twist2, Klf1, and Lef1 within a 1413-bp region in the Nmnat1 promoter (−1413 to +1) surrounding the major transcriptional start site ( Figure 7C ). Luciferase assays were conducted to measure the ADR-stimulated promoter activities of five deletion constructs (−1413 Luc, −1158 Luc, −866 Luc, −622 Luc, and −305 Luc) cloned upstream from luciferase reporter genes in cultured podocytes. The transcriptional activities of the Nmnat1 promoters were not affected in the −1413 Luc, −11158 Luc, and −866 Luc deletion constructs. Following NMN treatment, similar levels of suppression were observed in cells containing these three promoter constructs. Nevertheless, Nmnat1 promoter activity was markedly suppressed in cells transfected with the promoter that deleted the region from −1808 to −622, demonstrating similar lowered activities with or without NMN. These results implied that the promoter region spanning −866 to −622 is essential for ADR-induced Nmnat1expression and the NMN-induced suppression of Nmnat1 gene expression. The TRANSFAC analysis showed that this ADR or NMN response region (between −866 and −622) contained consensus sites for Twist2 binding ( Figure 7C ), corresponding to the Enhancer Box (E-box) sites. It indicates that Twist2 was the principal DNA-binding component of this protein–DNA complex. Luciferase assays conducted with the mutated Twist2 consensus sites (one or both) showed that both sites were functional ( Figure 7D ). The E-box sites were located within the surrounding CG-rich sequences. Additionally, a computer search indicated that the CpG islands, the well-known targets of epigenetic modifications, resided within the Nmnat1 gene ( Figure 7A ). Thus, the regulation of Nmnat1 expression by NMN appeared to be influenced by the epigenetic mechanisms of DNA methylation. IHC using Twist2 was conducted on day 28 ( Figure 7E ); the expression of Twist2 was increased in the ADR group than in the Cont group but suppressed in the NMN500 group. Dnmt1 repressed Twist2 binding activity in the Nmnat1 E-box Pretreatment of podocytes with 5′-azacytidine followed by incubation with NMN lysate led to a significant recovery of Nmnat1 gene expression ( Figure 8A ). These data suggested that DNA methylation induced by NMN prevented Twist2 from binding to the E-box sites. To confirm the involvement of DNA methyltransferase (Dnmt) in the methylation of CpG sites in the Nmnat1 gene, the podocytes were transfected with siRNA for Dnmt1, Dnmt3a, or Dnmt3b. Methylation was significantly increased in cells treated with NMN when compared with those without NMN treatment. The methylation with NMN was suppressed by a siRNA for Dnmt1 but not for Dnmt3a or Dnmt3b ( Figure 8B, C, D ). Taken together, these findings indicated that Nmnat1 gene expression can be regulated epigenetically through CpG methylation by Dnmt1, which was recruited following the incubation of cells with NMN. The methylation of the Nmnat1 promoter region was low following treatment with ADR; thus Twist2 could bind to the E-box sites and maintain the high expression level of Nmnat1 . In the presence of NMN, the methylation levels in the E-box were elevated by the recruited DNMT1; consequently, Twist2 could not bind to the E-box sites, which resulted in a decreased expression of Nmnat1 (Figure 8E, F) . Discussion In the present study, the administration of NMN ameliorated kidney damage, both functionally and histologically, in the murine ADR-induced nephropathy model. NMN maintained the NAD + levels in the kidneys of the ADR-treated mice and altered the expression levels of Sirt1, Nampt, and Nmnat1. These changes were evident and sustained even after the discontinuation of the short-term NMN treatment, thus indicating that the effects of this treatment protocol were continuous. This study provides a proof of concept for the transient short-term administration of NMN as an effective treatment for proteinuric renal disease in the FSGS model. Fourteen days of NMN treatment led to a persistent reduction in albuminuria in FSGS and an amelioration in histological changes such as foot process effacement and glomerular sclerosis. We have previously shown that decreased Sirt1 in podocytes epigenetically upregulated the level of Claudin-1 (through Dnmt1 activation) and reduced the level of Synaptopodin, subsequently causing foot process effacement and albuminuria. Consistent with the results of our previous study, IHC demonstrated low Sirt1, high Claudin-1, and low Synaptopodin expression levels in the glomeruli of the ADR mice in the present study. Furthermore, the expression levels of H3K9me2 and DNMT1 were lower in the glomeruli of the ADR mice. These unfavorable changes were ameliorated by NMN, even after the termination of the treatment, thereby suggesting that Sirt1 reactivation halts the aggravation of the molecular changes in Sirt1-Claudin-1-Synaptopodin via its long-lasting epigenetic effects. Chronologically decreased NAD + concentrations were observed in the ADR group. Surprisingly, the NAD + levels in the kidneys of the NMN-treated ADR mice were higher on day 28, corresponding to those at 2 weeks after the termination of the treatment period. NMN is rapidly converted to NAD + and disappears from blood and the organs within 15 min; furthermore, the half-life of NAD is less than 10 h. 28 , 29 , 30 Paradoxically, low levels of NMN were observed on day 28 in the NMN500 group, despite prior supplementation. These findings indicate that the short-term treatment modified the salvage pathway for a long period. NMN treatment upregulated Nampt expression and downregulated Nmnat1 expression on day 28. It can be surmised that NMN treatment suppresses the overconsumption of NMN by repressing the NMN consumer, Nmnat1 (Fig. 6 E, G). Moreover, Nmnat1 was shown to directly bind to and activate PARP1. 26 In another study, Nmnat1 was shown to not only synthesize NAD + but also stimulate PARP1 activity independently of NAD + synthesis. 27 Taken together, these findings indicated that NMN treatment blocked the overconsumption of NMN and NAD, which was evoked by podocyte damage caused by ADR. Some studies have reported that lower doses of NMN can improve the pathogenesis to a greater degree than higher doses. 31 In one study, marked improvements in oxygen consumption, energy expenditure, and physical activity were observed with 100 mg/kg of NMN when compared with those with 300 mg/kg NMN. 31 In another report, reduced cell death in the CA1 neurons was best achieved with 62.5 mg/kg of NMN. 32 Conversely, one study reported the dose-dependent effects of NMN treatment on body weight, bone density, and some age-related changes. 31 The dose-response experiment in the present study demonstrated that NMN treatment using dosages of 300 and 500 mg/kg improved albuminuria, whereas a dosage of 100 mg/kg had no effect. Hence, the ideal dosage might vary depending on the organs involved and the pathogenesis. In terms of the adverse, 1 year of treatment with 100 and 300 mg/kg/day of NMN orally appeared to be tolerable by the patients. 31 One study reported that 90 days of treatment with 3000 mg/kg of NR resulted in several adverse metabolic and histological effects, including an increase in kidney weight and the presence of basophilic tubules, tubular atrophy, focal segmental glomerulosclerosis, and monocyte infiltration in the kidneys; nevertheless, treatment with 300 mg/kg of NR for 90 days had no adverse effects. 33 In the present study, the short-term transient treatment was adopted for 2 weeks. Nonetheless, no obvious adverse effects were observed, thus supporting the feasibility of this treatment protocol. Twist2 (dermo-1) is a basic helix-loop-helix (bHLH) transcription factor, which recognizes the E-box. 34 Twist2 has 66% identical homology and an overlapping pattern of cellular expression with the more studied Twist1. 35 The role of Twist1 in renal pathophysiology is emerging. 36 – 38 However, the detailed role of Twist2 in the kidneys has not been fully elucidated. Importantly, we identified a pathological transcription factor, Twist2, which might mediate the FSGS-dependent increase in glomerular sclerosis; additionally, we showed that a reduction in Twist2 expression by NMN is a potential intervention that can attenuate progressive FSGS. The inactivation of Twist2 by an endogenous ligand or exogenous substance like NMN might regulate the expression of Nmnat1 and reduce glomerular sclerosis due to PARP1 suppression. Glomerular sclerosis is known as a pivotal pathway not only in FSGS but also in other kidney diseases leading to the progression of CKD. Hence, further studies are required to evaluate whether a therapeutic strategy that compensates for the downregulation of Nmnat1 , such as NMN administration, would prove effective in protecting against the progression of CKD. In the present study, NMN decreased the level of PARP1, which is directly regulated by Nmnat1. Nmnat1 protein expression via epigenetic regulation of increasing methylation of the Nmnat1 promoter region, an effect mediated by Dnmt1. Furthermore, this study demonstrated that Dnmt1 induces the methylation of the binding site in Twist2, and the subsequent reduction in its binding to the Nmnat1 promoter is the initial step for transcriptional regulation. Additional studies are required to elucidate that Nmnat1 downregulation can attenuate glomerular sclerosis. Details regarding the mechanism by which renal Dnmt1 is activated remain unknown, but reports suggest that the expression and/or activity of Dnmt1 can be increased via Sirt1 activation. 39 , 40 Nampt deficiency leads to the inactivation of Sirtuin. 6 Significant expression levels of Sirt1, Sirt3, and Sirt6 were observed in normal kidneys. Among these isoforms, the ADR-treated mice exhibited a significantly decreased expression of Sirt1 and Sirt6, whereas that of Sirt3 was unaltered. NMN rescued the expression levels of Sirt1 and Sirt6 but did not affect that of Sirt3. These differences in the isoforms of Sirtuin might be associated with differences in the cellular fraction; nonetheless, further investigations are needed. Several studies, including the current study, demonstrated that Sirt6 deficiency induces podocyte damage 41 and renal fibrosis. 6 Thus, the decrease in Sirt6 expression, besides the Sirt1-related pathway, might have led to renal damage in the ADR mice in the present study. In conclusion, supplementation with short-term NMN for two weeks sufficiently restored and maintained NAD + and Sirt1 levels and protected the kidneys from FSGS 2 weeks after the termination of the treatment in mice. This study provides evidence of the long-term effects of NMN treatment; additionally, it demonstrates that short-term NMN supplementation is sufficient to suppress the progression of FSGS. Methods Animal experiment protocols Male BALB/c mice (8 weeks old) were purchased from Japan CLEA Co. (Tokyo, Japan). They were housed at a constant room temperature of 22℃ ± 1℃ under a controlled 12 h light/12 h dark cycle and had free access to water and regular chow. The mice were intravenously injected with a vehicle (normal saline; n = 12) or 11 mg/kg of ADR (n = 24) Santa Cruz Biotechnology Inc., Dallas, TX, USA) on day 0. 23 Twenty mice treated with normal saline were assigned to the non-FSGS control (Cont) group. The ADR-treated mice were randomly assigned to two groups (12 per group) as follows: those treated with vehicle (normal saline; ADR group) and those treated with NMN (500 mg/kg/day) in normal saline (NMN 500 group). The animals were treated every day for 14 consecutive days from day 0 to day 14, as described previously. 22 The survival of the animals was examined every day, and the body weights were estimated every week. Urine samples were collected on days 14 and 28. Serum samples measuring the cholesterol and creatinine levels were collected on days 14 and 28. The kidneys of the animals were harvested to assess the renal histology on day 14 (just after completing the NMN treatment) and day 28 (2 weeks after treatment termination). All the animal studies were approved by the Animal Care Committee and the E thics Committe of the Tokushima University School of Medicine and study was carried out according to the national and regional guidelines . All the studies are reported in accordance with ARRIVE guidelines. Blood and urine examination Urine was collected for 24 h from metabolic cages, and the renal function was evaluated based on the serum creatinine levels and creatinine clearance (Ccr). The Ccr was calculated using the following formula: urinary creatinine × urine volume/serum creatinine/1,440, where 1440 represents the number of minutes in 24 h. Albuminuria was assessed based on the urine albumin to creatinine ratio (ACR). The urine albumin level was assessed by an enzyme-linked immunosorbent assay (ELISA; Albuwell M; Ethos Biosciences, Pennsylvania, USA). The urine and serum creatinine levels were assessed using the QuantiChrom™ Creatinine Assay Kit (BioAssay Systems, California, USA). Serum cholesterol levels were measured with a mouse cholesterol ELISA Kit (Abcam, ab285242). Histology and immunohistochemistry of the kidney Images from at least 20 sequential glomerular cross-sections divided approximately at the glomerular equator were collected for each histological section by blinded observers. PAS-stained samples from 20 consecutive glomeruli per animal were examined. The glomerular surface area was traced along the outline of the capillary loop using Image-Pro Plus 7.0J software (Media Cybernetics, Silver Spring, MD, USA). For the quantitative analysis of the mesangial expansion, the PAS-positive area in the glomeruli was evaluated. Specifically, a minimum hue–saturation–intensity threshold was set on Image-Pro Plus 7.0J (Media Cybernetics), and the area exceeding this threshold was counted as a PAS-positive area. Consequently, the percentage of PAS-positive area per glomeruli was calculated. IHC was performed as described previously. 3 Briefly, paraffin sections (4 mm) were fixed in 3% formaldehyde and stained with the primary antibodies for Claudin-1 (Invitrogen, 51-9000, 1:50), Sirt1 (Sigma-Aldrich, 07-131, 1:100), Synaptopodin (Fitzgerald, 10R-S125A, undiluted), WT-1 (Santa Cruz, C-19, 1:200), Nampt (Bethyl Laboratories, A300-372A, 1:500), Nmnat1 (Proteintech, 11399-1AP, 1:500), Sirt3 (Cell Signaling, C73E3, 1:50), Sirt6 (LSBio, aa250-334, 1:2500), DNMT1 (Cell Signaling Technology, #5032, 1:100), PARP1 (Proteintech, 13371-1-AP, 1:200), Twist2 (Abcam, ab66031, 1:200), and H3K9me2 (Abcam; mAbcam 1220, 1:200). Goat antirabbit IgG (Nichirei, 414341) and goat antimouse IgG (Nichirei, 414321) antibodies were used as the secondary antibodies. All sections were examined under a light microscope (Olympus BX53 microscope) and digitized with a high-resolution camera. For the quantitative analysis of the staining for Sirt1, Claudin-1, Synaptopodin, Sirt3, Sirt6, H3K9me2, and DNMT1, the DAB-stained area per glomerular surface area was calculated using Image-Pro Plus 7.0J. The Definiens Tissue Studio software (Definiens, Munich, Germany) was used to calculate the DAB-stained area per section per kidney for the quantitative analysis of the Nampt, Nmnat1, PARP1, and Twist2 immunostaining. All assessments were performed in a blinded manner, and four kidneys were examined in each group. Electron microscopy For the electron microscopy (EM) evaluation, the kidney tissues were harvested and fixed overnight at 4℃ with 2% paraformaldehyde and 2% glutaraldehyde (GA) in 0.1 M phosphate buffer (PB; pH 7.4). After fixation, the samples were washed three times with 0.1 M PB for 30 min each and post-fixed with 2% osmium tetroxide (OsO4) in 0.1 M PB at 4℃ for 2 h. The fixed tissue blocks were embedded in Epon epoxy resin. The average number of podocyte foot processes was counted and divided by the glomerular basement membrane (GBM) length (mm) to determine the densities of the foot processes as described previously 22 . The counts were performed on 105 micrographs from at least three glomeruli in each mouse. Using Image-Pro Plus 7.0J, the length and thickness of the GBM were measured. NAD + metabolite measurement Levels of NAD + metabolites were measured using LC/MS/MS as described previously 3 with minor modifications. Briefly, t hree volumes of methanol containing 6% perchloric acid and 4% phosphoric acid were used to homogenize the tissues. Subsequently, three volumes of methanol (including the deuterated internal standard) were added to the tissue homogenate or in serum samples; this mixture was vortexed and centrifuged. The supernatant was diluted with water and LC/MS/MS was used to analyze it. The Shimadzu Nexera UHPLC system (Shimadzu, Kyoto, Japan)—consisting of an LC-30 AD pump, a DGU-20A5R degasser, a CTO-20AC column oven, and a SIL-30ACMP autosampler—was used. At 50°C, separation was carried out using a Triart C18 column (3.0 150 mm, 5 m, YMC, Kyoto, Japan). Mobile phase A included water/formic acid/undecafluorohexanoic acid (1000/0.1/0.2, v/v/v), and mobile phase B included methanol. The chromatographic conditions were 0–4 min (5%–80% B, 0.5 mL/min), 4–4.01 min (80%–95% B, 0.5–1.0 mL/min), 4.01–7 min (95% B, 1.0 mL/min), 7–7.01 min (95%–5% B, 1.0–0.5 mL/min), and 7.01–13 min (5% B, 0.5 mL/min). An API5000 triple quadrupole mass spectrometer (SCIEX, Framingham, MA, USA) with electrospray ionization (ESI) in the positive ion mode was used for mass spectrometric detection. Standard solutions were used to optimize the ESI-MS/MS settings for each analyte. Quantitation was performed using multiple reaction monitoring with the following transitions: m/z 123 → 80 for NAM, m/z 335 → 123 for NMN, and m/z 664 →136 for NAD + . Nmnat1 CpG methylation in vitro by methylation-specific polymerase chain reaction (MSP) and real-time MSP Total genomic DNA from cultured podocytes was extracted using the DNeasy Kit (Qiagen Japan, Tokyo, Japan). Bisulfite conversion of genomic DNA was performed using a Zymo EZ DNA Methylation Gold kit (Zymo Research Corp., Orange, CA, USA). MSP was performed to determine the methylation status of the Nmnat1 gene and real-time MSP was performed to quantitatively analyze the methylation of the gene, as described previously. 24 Supplementary table 1 lists the specific methylated or unmethylated sequences of the primer sets. Three independent MSPs and real-time MSPs were performed. Luciferase assay A 1414-bp fragment (−1413 to +1) of the 5′ flanking region of Nmnat1 was isolated from the murine BAC genomic clone using the restriction endonucleases Bal I and EcoT14I . Plasmids −1158, −866, −622, and −305 Luc were prepared by subcloning the BglI , ClaI , HindIII , and Sca I inserts from −1413 Luc. These Nmnat1/pGL3 plasmids (−1413 Luc, −1158 Luc, −866 Luc, −622 Luc, and −305 Luc) containing the murine Nmnat1 promoter sequences between −1413, −1158, −866, −622, and −305 and +1 were fused to a pGL3 vector, a firefly luciferase reporter plasmid, and then transfected with Lipofectamine 2000 (Invitrogen). NMN and ADR were added and pRL-CMV (Renilla luciferase reporter vector; Promega, Madison, WI, USA) was cotransfected into the cells. M urine podocyte cells have been described previously. 5 Podocyte cells were treated with 0.2 μg/ml of ADR in a regular medium, and the medium was harvested at 24 h after treatment. The luciferase activity was measured as described previously. 24 The mutagenesis primers were generated from the −866 luciferase reporter plasmid by mutating CAGCTGA to CCCTTTA using in vitro mutagenesis. Culture of podocytes Conditionally immortalized mouse podocytes were donated by P. Mundel (Mt. Sinai School of Medicine, New York, NY, USA) and K. Asanuma (Chiba University, Chiba, Japan). The podocytes were seeded at a density of 5 × 10 5 per 100 mm 2 , incubated for 7 days (differentiation), and used for further experiments. The differentiation of the cells was confirmed as described previously. 5 The cells were treated with 5 μM 5-aza-dC (Sigma-Aldrich) for 96 h. For the Dnmt siRNA treatment, a Dnmt siRNA duplex was purchased from Sigma-Aldrich. The sense sequences were 5′-[dT] GGAAUGGCAGAUGCCAACAGC [dT]-3′ for Dnmt1, 5′-[dT] GAAAGCGAAGGUCAUUGCA [dT]-3′ for Dnmt3a and 5′-[dT] GCUAGCGAAGGUCAUUGCA [dT]-3′ for Dnmt3b. The control siRNA consisted of a scrambled siRNA construct encoding a nonspecific siRNA without mammalian homology. These siRNAs (100 pmol μl −1 ) were transfected using Lipofectamine 2000 (Invitrogen) for 24 h. Statistical analyses GraphPad Prism 8 software (GraphPad Software, CA, USA) was used to perform the statistical analyses. Data are expressed as means ± standard error of the mean. Comparisons among several groups were analyzed using a one-way analysis of variance and Tukey’s post hoc test. A P- value of <0.05 was considered statistically significant. Declarations Acknowledgments The authors wish to thank P. Mundel and K. Asanuma for providing cultured podocytes. This work was supported by the Scientific Research Fund of the Ministry of Education, Culture, Sports, Science, and Technology of Japan (Grant no. 22K0835400). Author contributions KH, MT, and SW designed the experiments and the study. KH and YS collected data or performed experiments for the study. KH, MT, YS, and SW analyzed the data and contributed to writing the paper. Data availability statement The data that support the findings of this study are avail-able in the methods of this article. Further information and requests for resources and reagents are available from the corresponding author ( [email protected] ). Competing Interests The authors declare no conflicts of interest. References Lee VW, Harris DC. Adriamycin nephropathy. a model of focal segmental glomerulosclerosis. Nephrology (Carlton) 16 , 30–38 (2011). Lu Z. et al. METTL14 aggravates podocyte injury and glomerulopathy progression through N 6 -methyladenosine-dependent downregulating of Sirt1. Cell Death Dis. 27 , 12(10), 881 (2021). 3..Hasegawa K. et al. Renal tubular Sirt1 attenuates diabetic albuminuria by epigenetically suppressing Claudin-1 overexpression in podocytes. Nat Med 19 , 1496–1504 (2013). Bukosza EN. et al. Podocyte RNA sequencing reveals Wnt- and ECM-associated genes as central in FSGS. PLoS One 17 , 15, e0231898 (2020). Gong Y. et al. Inducible expression of claudin-1 in glomerular podocytes generates aberrant tight junctions and proteinuria through slit diaphragm destabilization. J Am Soc Nephrol 28 , 106–117 (2017). Holman RR. et al. 10-year follow-up of intensive glucose control in type 2 diabetes. N Engl J Med 359 , 1577–1589 (2008). Khadka D. et al. Augmentation of NAD levels by enzymatic action of NAD(P)H quinone oxidoreductase 1 attenuates adriamycin-induced cardiac dysfunction in mice. J Mol Cell Cardiol 45 – 57 (2018). Liu X. et al. Impaired nicotinamide adenine dinucleotide biosynthesis in the kidney of chronic kidney disease. Front Physiol 12 , 723690 (2021). Dai H. et al. Sirtuin activators and inhibitors: Promises, achievements, and challenges. Pharmacol Ther 188 , 140–154 (2018). Elhassan YS, Philp AA, Lavery GG. Targeting NAD + in metabolic disease: new insights into an old molecule. J Endocr Soc 1 , 816–835 (2017). Kume S. et al. Calorie restriction enhances cell adaptation to hypoxia through Sirt1-dependent mitochondrial autophagy in mouse aged kidney. J. Clin. Invest. 120 , 1043–1055 (2010). Kim MY. et al. Resveratrol prevents renal lipotoxicity and inhibits mesangial cell glucotoxicity in a manner dependent on the AMPK-SIRT1-PGC1α axis in ADR mice. Diabetologia 56 , 204–217 (2013). Yoshino J, Baur JA, Imai SI. NAD + Intermediates: The biology and therapeutic potential of NMN and NR. Cell Metab 27 , 513–528 (2018). Bai P. et al. PARP-1 inhibition increases mitochondrial metabolism through SIRT1 activation. Cell Metab 13 , 461–468 (2011). Benyó Z. et al. GPR109A (PUMA-G/HM74A) mediates nicotinic acid-induced flushing. J Clin Invest 115 , (2005). Benyó Z. et al. Nicotinic acid-induced flushing is mediated by activation of epidermal langerhans cells. Mol Pharmacol 70 , 1844 LP–1849 (2006). Zackheim HS. et al. Reactions to niacinamide. J. Am. Acad. Dermatol 4 , 736–737 (1981). Trammell SAAJ. et al. Nicotinamide riboside is uniquely and orally bioavailable in mice and humans. Nat. Commun 7 , 1–14 (2016). Guan Y. et al. Nicotinamide mononucleotide, an NAD + precursor, rescues age-associated susceptibility to AKI in a Sirtuin 1–dependent manner. J Am Soc Nephrol 28 , 2337–2352 (2017). Chen Y. et al. Endogenous nampt upregulation is associated with diabetic nephropathy inflammatory-fibrosis through the NF-κB p65 and Sirt1 pathway; NMN alleviates diabetic nephropathy inflammatory-fibrosis by inhibiting endogenous Nampt. Exp Ther Med 14 , 4181–4193 (2017) Lynch MR. et al. TFEB-driven lysosomal biogenesis is pivotal for PGC1α-dependent renal stress resistance. JCI Insight 4 , (2019). Yasuda I. et al. Pre-emptive short-term nicotinamide mononucleotide treatment in a mouse model of diabetic Nephropathy. J Am Soc Nephrol 32 , 1355–1370 (2021). Wang Y. et al. Progressive adriamycin nephropathy in mice: sequence of histologic and immunohistochemical events. Kidney Int 58 , 1797–1804 (2000). Muraoka H. et al. Role of Nampt-Sirt6 axis in renal proximal tubules in extracellular matrix deposition in diabetic nephropathy. Cell Rep 27 , 199–212.e5 (2019). Murata MM. et al. NAD + consumption by PARP1 in response to DNA damage triggers metabolic shift critical for damaged cell survival. Mol Biol Cell 15 , 2584–2597 (2020). Zhang X. et al. Structural characterization of a human cytosolic NMN/NaMN adenylyltransferase and implication in human NAD biosynthesis. J Biol Chem 278 , 13503–13511 (2003). Zang T. et al. Regulation of poly(ADP-ribose) polymerase-1-dependent gene expression through promoter-directed recruitment of a nuclear NAD + synthase. J Biol Chem 287 , 12405–12416 (2012). Revollo JR. et al. Nampt/PBEF/Visfatin regulates insulin secretion in β cells as a systemic NAD biosynthetic enzyme. Cell Metab 6 , 363–375 (2007). Stein LR, Imai SI. Specific ablation of Nampt in adult neural stem cells recapitulates their functional defects during aging. EMBO J 33 , 1321–1340 (2014). Yoshino J. et al. Nicotinamide mononucleotide, a key NAD + intermediate, treats the pathophysiology of diet- and age-induced diabetes in mice. Cell Metab 14 , 528–536 (2011). Mills KF. et al. Long-term administration of nicotinamide mononucleotide mitigates age-associated physiological decline in mice. Cell Metab 24 , 795–806 (2016). Park JH. et al. Nicotinamide mononucleotide inhibits post-ischemic NAD + degradation and dramatically ameliorates brain damage following global cerebral ischemia. Neurobiol Dis 95 , 102–110 (2016). Conze DB, Crespo-Barreto J, Kruger CL. Safety assessment of nicotinamide riboside, a form of vitamin B3. Hum Exp Toxicol 35 , 1149–1160 (2016). Franco HL. et al. Redundant or separate entities? – roles of Twist1 and Twist2 as molecular switches during gene transcription. Nucleic Acid Res 39 , 1177–1186 (2011). Bialek P. et al. A twist code determines the onset of osteoblast differentiation. Dev Cell 6 , 423–435 (2004). Yang J. et al. Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell 117 , 927–939 (2004). Kida Y. et al. Twist relates to tubular epithelial-mesenchymal transition and interstitial fibrogenesis in the obstructed kidney. J Histochem Cytochem 55(7), 661–673 (2007). Lovisa S. et al. Epithelialto-mesenchymal transition induces cell cycle arrest and parenchymal damage in renal fibrosis. Nat Med 21 , 998–1009 (2015). Gan H. et al. B cell Sirt1 deacetylates histone and non-histone proteins for epigenetic modulation of AID expression and the antibody response. Sci Adv 6 , eaay2793 (2020). Peng L. et al. SIRT1 deacetylates the DNA methyltransferase 1 (DNMT1) protein and alters its activities. Mol Cell Biol 31 , 4720–4734 (2011). Liu M. et al. Sirt6 deficiency exacerbates podocyte injury and proteinuria through targeting Notch signaling. Nat Commun 8 , 413 (2017). Additional Declarations No competing interests reported. Supplementary Files 0612SciRepHasegawa.Suppletable1.pdf Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major revision 11 Jul, 2022 Reviews received at journal 03 Jul, 2022 Reviewers agreed at journal 25 Jun, 2022 Reviewers invited by journal 24 Jun, 2022 Editor assigned by journal 21 Jun, 2022 Editor invited by journal 21 Jun, 2022 Submission checks completed at journal 21 Jun, 2022 First submitted to journal 14 Jun, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1756041","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":115157687,"identity":"90a9d7a5-5487-4c4c-8a93-011a68ddcf08","order_by":0,"name":"Kazuhiro Hasegawa","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDElEQVRIie3QMUvEMBTA8RcKmd7RNSVSP4HQEiiCcH6VHIFz9MDV4eAgtzkX1O8gCM6FQFyErgeK3i2dHJxuKmKuB04NRzeR/KFkKD/eSwBCoT8Yc18EGUC8OwEq/P1F5gdIoocRV2b35PBiyfK54bPZeyo+FkZg+3Z0sqwog+sxRLf9YzjKKS+zK1FYqtRIN1i8SEesAnLXPzIFaTlmcvJkUZjR3GBRXW4Z0ApIKftJvNEdedSOYOtIvXZTvv2EM0U78kBRKKSOrNxiRPtJUjbRmSOC2anK7/WOrKPTyY1C311YfbF5xVam8cIY9tma86KWZPW1Hae558U8uZUwL4eIrmM2mIRCodD/7Act7VWIXBlHFgAAAABJRU5ErkJggg==","orcid":"","institution":"Tokushima University Graduate School of Biomedical Sciences","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Kazuhiro","middleName":"","lastName":"Hasegawa","suffix":""},{"id":115157688,"identity":"655dc6b1-9976-494b-b839-dacdc8f29f13","order_by":1,"name":"Yusuke Sakamaki","email":"","orcid":"","institution":"Tokyo Dental College Ichikawa General Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yusuke","middleName":"","lastName":"Sakamaki","suffix":""},{"id":115157690,"identity":"2a8167a3-40e8-4f81-8e26-012406265e14","order_by":2,"name":"Masanori Tamaki","email":"","orcid":"","institution":"Tokushima University Graduate School of Biomedical Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Masanori","middleName":"","lastName":"Tamaki","suffix":""},{"id":115157692,"identity":"5e82ee72-cd73-4d96-b711-9edbc946d531","order_by":3,"name":"Shu Wakino","email":"","orcid":"","institution":"Tokushima University Graduate School of Biomedical Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shu","middleName":"","lastName":"Wakino","suffix":""}],"badges":[],"createdAt":"2022-06-14 06:59:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1756041/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1756041/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":23135822,"identity":"0db7c5a7-eb21-4262-861b-6dd821dd8573","added_by":"auto","created_at":"2022-06-27 16:31:23","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1060834,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic diagram showing the NAD\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e+ \u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003emetabolic pathway\u003c/strong\u003e. \u003c/p\u003e\u003cp\u003eNpt, nicotinic acid phosphoribosyltransferase; Nmnat, nicotinamide mononucleotide adenylyl transferase; NRK, nicotinamide riboside kinase; 5′-NT, 5′-nucleotidase; iNampt, intracellular NAM phosphoribosyl transferase; Sirt1, Sirtuin1; Cyp2E1, Cytochrome P450 2E1; Nnmt, nicotinamide N-Methyltransferase; Aox, aldehyde oxidase; NaNM, nicotinic acid mononucleotide; NAR, nicotinic acid riboside; NAM, nicotinamide; NMN, nicotinamide mononucleotide; NR, nicotinamide riboside; NAD, nicotinamide adenine dinucleotide; NNO, NAM N-oxide; MNA, N1-methylniacinamide; 2py, N1-methyl-2-pyridone-5-carboxamide; 4py, N1-methyl-4-pyridone-3-carboxamide;\u003cstrong\u003e \u003c/strong\u003ePARP1, poly ADP-ribose polymerase 1.\u0026nbsp;\u003c/p\u003e","description":"","filename":"0612SciRepHasegawa.MainFIgure1.png","url":"https://assets-eu.researchsquare.com/files/rs-1756041/v1/c9bb2916052ee37af2b029af.png"},{"id":23135826,"identity":"1dc970ba-19e7-4a9b-8562-e271030091a8","added_by":"auto","created_at":"2022-06-27 16:31:24","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1022504,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of short-term NMN treatment on kidney functions and survival. \u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Schematic diagram of the NMN treatment protocol. \u003cstrong\u003e(B)\u003c/strong\u003e Temporal changes in the body weights of the mice in the three groups (Cont, \u003cem\u003eADR\u003c/em\u003e, and NMN500; n = 10). *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 Cont vs. ADR. †\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 Cont vs. NMN500. \u003cstrong\u003e(C)\u003c/strong\u003e The weights of the\u003cstrong\u003e \u003c/strong\u003ekidneys on days 14 and 28 in the three groups (Cont, \u003cem\u003eADR\u003c/em\u003e, and NMN500; \u003cem\u003en\u003c/em\u003e = 10). \u003cstrong\u003e(D)\u003c/strong\u003e Serum creatinine levels were measured on day 28 in the three groups (Cont, \u003cem\u003eADR\u003c/em\u003e, and NMN500; \u003cem\u003en\u003c/em\u003e = 10). \u003cstrong\u003e(E)\u003c/strong\u003e Creatinine clearance on day 28 in the three groups (Cont, \u003cem\u003eADR\u003c/em\u003e, and NMN500; \u003cem\u003en\u003c/em\u003e = 10). \u003cstrong\u003e(F)\u003c/strong\u003e Urine ACR on day 14 (n = 10) and 28 (n = 10) in the three groups (Cont, \u003cem\u003eADR\u003c/em\u003e, and NMN500). \u003cstrong\u003e(G)\u003c/strong\u003e Serum cholesterol levels on day 14 (n = 10), and 28 (n = 10) in the three groups (Cont, \u003cem\u003eADR\u003c/em\u003e, and NMN500).\u0026nbsp;\u003c/p\u003e","description":"","filename":"0612SciRepHasegawa.MainFIgure2.png","url":"https://assets-eu.researchsquare.com/files/rs-1756041/v1/82d52c36938272b2a6e3e2a1.png"},{"id":23136114,"identity":"4a97dc48-39b5-4ce2-851b-3ae961fab822","added_by":"auto","created_at":"2022-06-27 16:36:24","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1015311,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDose-response study of NMN treatment. \u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Schematic diagram illustrating the dose-response study. \u003cstrong\u003e(B)\u003c/strong\u003e Cholesterol levels on day 28 in the five groups (Cont, \u003cem\u003eADR\u003c/em\u003e, NMN100, NMN300, and NMN500; \u003cem\u003en\u003c/em\u003e = 15). Statistical significance is represented by an asterisk. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 vs \u003cem\u003eCont\u003c/em\u003e. \u003cstrong\u003e(C)\u003c/strong\u003e Urine ACR on day 28 in the five groups (\u003cem\u003eCont\u003c/em\u003e, \u003cem\u003eADR\u003c/em\u003e, NMN100, NMN300, and NMN500; \u003cem\u003en\u003c/em\u003e = 15). All data are shown as mean ± standard error of the mean. Statistical significance between each group is represented by a horizontal bar. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"0612SciRepHasegawa.MainFIgure3.png","url":"https://assets-eu.researchsquare.com/files/rs-1756041/v1/8b6253711ff7b23da10112da.png"},{"id":23136113,"identity":"0fae2f38-2dc5-44f5-a943-e7d60636934b","added_by":"auto","created_at":"2022-06-27 16:36:23","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2912387,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eShort-term NMN treatment ameliorated the histological changes in FSGS\u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Representative images of PAS and WT1 immunostaining in the glomeruli of the mice from the Cont, ADR, and NMN500 groups (scale bar, 500 µm). \u003cstrong\u003e(B)\u003c/strong\u003e Graph showing the glomerular surface area. \u003cstrong\u003e(C)\u003c/strong\u003e Graph showing the\u003cstrong\u003e \u003c/strong\u003ePAS positivity in the glomerular area within the PAS-stained kidney sections; \u003cem\u003en\u003c/em\u003e = 20 sections per group. \u003cstrong\u003e(D)\u003c/strong\u003e Graph showing the number of podocytes per glomerulus detected using the antibodies to WT1. \u003cstrong\u003e(E)\u003c/strong\u003e Representative EM images of GBM in the \u003cem\u003eCont\u003c/em\u003e, \u003cem\u003eADR\u003c/em\u003e, and NMN500 groups. The GBM and foot processes are indicated (scale bar, 1 µm). \u003cstrong\u003e(F)\u003c/strong\u003e Graph showing the GBM thickness obtained from 20 measurements per group. \u003cstrong\u003e(G)\u003c/strong\u003e Graph showing the density of the foot process per micron of GBM obtained from approximately 20 measurements per group. All data are shown as mean ± standard error of the mean. Statistical significance between each group is represented by a horizontal bar. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"0612SciRepHasegawa.MainFIgure4.png","url":"https://assets-eu.researchsquare.com/files/rs-1756041/v1/584a3248c46360e5b2f66615.png"},{"id":23135825,"identity":"f5f55ff4-b722-4558-a480-dace58f98cb7","added_by":"auto","created_at":"2022-06-27 16:31:24","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1900505,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMolecular changes in the glomerulus after NMN treatment.\u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Representative images showing immunostaining for Sirt1, Claudin-1, and Synaptopodin in the glomeruli of the animals in the Cont, ADR, and NMN500 groups. Left, low-magnification images (scale bar, 50 µm); right, high-magnification images (scale bar, 500 µm). \u003cstrong\u003e(B–D)\u003c/strong\u003e The proportional areas of Sirt1 \u003cstrong\u003e(B) \u003c/strong\u003eClaudin-1 \u003cstrong\u003e(C)\u003c/strong\u003e, and Synaptopodin \u003cstrong\u003e(D)\u003c/strong\u003e staining (\u003cem\u003en\u003c/em\u003e = 20 sections per group). \u003cstrong\u003e(E)\u003c/strong\u003e Representative images showing immunostaining for Sirt3, Sirt6, H3K9me2, and Dnmt1 in the glomeruli (scale bar, 50 µm). \u003cstrong\u003e(F–I)\u003c/strong\u003e The proportional areas of Sirt3 \u003cstrong\u003e(F)\u003c/strong\u003e, Sirt6 \u003cstrong\u003e(G)\u003c/strong\u003e, H3K9me2 \u003cstrong\u003e(H)\u003c/strong\u003e, and Dnmt1 \u003cstrong\u003e(I)\u003c/strong\u003e staining determined by the Image-Pro Plus 7.0J software (\u003cem\u003en\u003c/em\u003e = 20 sections per group). All data are shown as mean ± standard error of the mean. Statistical significance between each group is represented by a horizontal bar. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 by ANOVA with Tukey’s post hoc test.\u003c/p\u003e","description":"","filename":"0612SciRepHasegawa.MainFIgure5.png","url":"https://assets-eu.researchsquare.com/files/rs-1756041/v1/e80158de42d8b3687e6378dd.png"},{"id":23135829,"identity":"39e0b623-5d81-47b8-829a-6911d535f7e5","added_by":"auto","created_at":"2022-06-27 16:31:24","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1242703,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of NMN treatment on NAD\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e metabolites and the salvage pathway.\u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Temporal changes in NAD\u003csup\u003e+\u003c/sup\u003e concentrations in the kidneys of mice in the Cont and ADR groups (\u003cem\u003en\u003c/em\u003e = 6). \u003cstrong\u003e(B–D)\u003c/strong\u003e Renal tissue concentrations of NAD\u003csup\u003e+\u003c/sup\u003e metabolites, NAM \u003cstrong\u003e(B)\u003c/strong\u003e, NMN \u003cstrong\u003e(C)\u003c/strong\u003e, and NAD\u003csup\u003e+\u003c/sup\u003e \u003cstrong\u003e(D)\u003c/strong\u003e in the salvage pathway on day 28 in the Cont, ADR, and NMN500 groups (\u003cem\u003en\u003c/em\u003e = 6). \u003cstrong\u003e(E)\u003c/strong\u003e Representative images of sections immunostained with Nampt, Nmnat1 in the kidneys of the Cont, ADR, and NMN500 groups (scale bar, 50 µm). \u003cstrong\u003e(F–H)\u003c/strong\u003e Proportional staining areas for\u003cstrong\u003e \u003c/strong\u003eNampt \u003cstrong\u003e(F)\u003c/strong\u003e, Nmnat1 \u003cstrong\u003e(G)\u003c/strong\u003e, and PARP1 \u003cstrong\u003e(H) \u003c/strong\u003e(\u003cem\u003en\u003c/em\u003e = 20 sections/group). All data are shown as mean ± standard error of the mean. Statistical significance between each group is represented by a horizontal bar. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"0612SciRepHasegawa.MainFIgure6.png","url":"https://assets-eu.researchsquare.com/files/rs-1756041/v1/38c6a42254d9c710a2191cac.png"},{"id":23136350,"identity":"a2db3388-bdb6-482d-af19-36cd6a05e6a7","added_by":"auto","created_at":"2022-06-27 16:41:24","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1825473,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNmnat1 epigenetic gene regulation by NMN and Twist2\u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eLocalization and nucleotide sequence in the murine Nmnat1 promoter region. The blue characters represent the putative CpG island mediating effects of ADR or NMN on \u003cem\u003eNmnat1\u003c/em\u003e transcription. The transcription start sites are indicated in\u0026nbsp;red.\u003cstrong\u003e (B) \u003c/strong\u003eSchematic representation of the murine \u003cem\u003eNmnat1\u003c/em\u003e gene and promoter. The solid boxes\u0026nbsp;indicate four E-boxes (E1 to E4) in the CpG island, highlighted in\u0026nbsp;yellow or green. \u003cstrong\u003e(C)\u003c/strong\u003e The schematic diagram describes five deletion mutants in the \u003cem\u003eNmnat1\u003c/em\u003e promoter sequences (−1413, −1158, −866, −622, and −305) that were cloned upstream from a luciferase reporter gene. The bar graphs show the results of transient transfection of the cultured podocytes, illustrating the promoter activities with each deletion. Luciferase activity is shown relative to that of the −1413 Luc vector in the control vector-transfected cells. Values are expressed as the mean\u0026nbsp;±\u0026nbsp;the standard error of the mean. *\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.05\u0026nbsp;\u003cem\u003evs.\u003c/em\u003e\u0026nbsp;each Luc transfected podocyte (\u003cem\u003en\u003c/em\u003e\u0026nbsp;=\u0026nbsp;3 independent experiments). \u003cstrong\u003e(D) \u003c/strong\u003eMutation analysis of \u003cem\u003eNmnat1\u003c/em\u003e promoter activity in podocyte cells. −866 Luc, WT \u003cem\u003eNmnat1\u003c/em\u003epromoter; M1, distal E3 mutation; M2, proximal E4 mutation; M3, mutation in both E3 and E4 corresponding to the Twist2 binding sites. *\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt; 0.05\u0026nbsp;\u003cem\u003evs.\u003c/em\u003e\u0026nbsp;–866 Luc in control cells;\u0026nbsp;§P\u0026lt; 0.05\u0026nbsp;\u003cem\u003evs.\u003c/em\u003e\u0026nbsp;–866 Luc in M1 cells; ¶\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt; 0.05\u0026nbsp;\u003cem\u003evs.\u003c/em\u003e\u0026nbsp;−866 Luc in M2 cells (\u003cem\u003en \u003c/em\u003e= 3 independent experiments). \u003cstrong\u003e(E)\u003c/strong\u003e Representative images showing immunostaining for Twist2 in the kidneys of mice from the Cont, ADR, and NMN500 groups (scale bar, 50 µm). Proportional staining areas for\u003cstrong\u003e \u003c/strong\u003eTwist2 (\u003cem\u003en\u003c/em\u003e = 20 sections/group). Statistical significance between each group is represented. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 by ANOVA with Tukey’s posthoc test.\u003c/p\u003e","description":"","filename":"0612SciRepHasegawa.MainFIgure7.png","url":"https://assets-eu.researchsquare.com/files/rs-1756041/v1/516aa79a0a285c1e587c0602.png"},{"id":23135830,"identity":"c510e845-d4eb-46e2-8271-82b9acd2de75","added_by":"auto","created_at":"2022-06-27 16:31:24","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1267951,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNmnat1 epigenetic gene regulation by NMN and Dnmt1.\u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Promoter methylation downregulated \u003cem\u003eNmnat1 \u003c/em\u003egene expression after\u0026nbsp;NMN administration. The cells were treated with 5′-azacytidine (1 µM) for 4 days before incubation with\u0026nbsp;NMN (100 µM) for 24 h. The\u0026nbsp;\u003cem\u003eNmnat1\u003c/em\u003e gene expression level was quantified by real-time polymerase chain reaction (PCR);\u003cstrong\u003e \u003c/strong\u003e\u003cem\u003en \u003c/em\u003e= 3 independent experiments. The positions of primers used for MSP. UMF, unmethylated forward primer; UMR, unmethylated reverse primer;\u003cstrong\u003e \u003c/strong\u003eMF, methylated forward primer; MR, methylated reverse primer.\u003cstrong\u003e (B, C, D)\u003c/strong\u003e The promoter methylation levels were examined by methylation-specific PCR (MSP). Methylation of the \u003cem\u003eNmnat1\u003c/em\u003e promoter with or without NMN and a siRNA for \u003cem\u003eDnmt1\u003c/em\u003e\u003cstrong\u003e\u003cem\u003e \u003c/em\u003e(B)\u003c/strong\u003e, \u003cem\u003eDnmt3a\u003c/em\u003e\u003cstrong\u003e (C)\u003c/strong\u003e, and \u003cem\u003eDnmt3b\u003c/em\u003e \u003cstrong\u003e(D)\u003c/strong\u003e. The upper panels show representative bands of MSP and the lower panels show the results of real-time MSP. \u003cstrong\u003e(\u003c/strong\u003e\u003cem\u003en \u003c/em\u003e= 3 independent experiments)\u003cstrong\u003e (E)\u003c/strong\u003e Schema depicting the epigenetic regulation of the expression of \u003cem\u003eNmnat1 \u003c/em\u003eby Dnmt1. In the FSGS state or after adriamycin treatment, the methylation level of the \u003cem\u003eNmnat1\u003c/em\u003e promoter region was low. Thus, Twist2 could bind to the E-box sites and maintain the high expression level of \u003cem\u003eNmnat1\u003c/em\u003e. In the presence of NMN, the methylation in this region is increased by Dnmt1. Consequently, the expression level of \u003cem\u003eNmnat1 \u003c/em\u003eis\u003cem\u003e \u003c/em\u003edecreased because Twist2 cannot bind to the E-box sites. Statistical significance between each group is represented. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 by ANOVA with Tukey’s post hoc test. (\u003cstrong\u003eF\u003c/strong\u003e) Schematic model of NMN action in ADR-induced FSGS. In this study, we investigated the effect of a preemptive short-term NMN treatment on ADR-induced FSGS. This transient treatment reduced albuminuria immediately after treatment until 2 weeks after the treatment. We further demonstrated that NMN treatment retained the levels of NAD\u003csup\u003e+\u003c/sup\u003e in the kidney by suppressing the NMN consumer Nmnat1 and the NAD consumer PARP1 in the NAD\u003csup\u003e+\u003c/sup\u003e salvage pathway. Furthermore, NMN treatment increased Sirt1 expression and downregulated Claudin-1 expression, leading to the attenuation of the downregulation of Synaptopodin and the effacement of the podocyte foot processes. Therefore, this method could be a preventive strategy against FSGS.\u0026nbsp;\u003c/p\u003e","description":"","filename":"0612SciRepHasegawa.MainFIgure8.png","url":"https://assets-eu.researchsquare.com/files/rs-1756041/v1/b610a46781412bb868ec9bce.png"},{"id":23136351,"identity":"4d0a2ad2-65f2-4cfe-bf06-a5b874809eb4","added_by":"auto","created_at":"2022-06-27 16:41:27","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":659616,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1756041/v1/289371cb-c9c6-4257-a56e-eabc851ca7fc.pdf"},{"id":23135823,"identity":"a72bc3e1-730c-49e2-a825-d7372ab95ce3","added_by":"auto","created_at":"2022-06-27 16:31:23","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":91598,"visible":true,"origin":"","legend":"","description":"","filename":"0612SciRepHasegawa.Suppletable1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1756041/v1/8adfc0d87497ba4c15717afb.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Nicotinamide mononucleotide ameliorates adriamycin-induced renal damage by epigenetically suppressing the NMN/NAD consumers mediated by Twist2","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAdriamycin (ADR)-induced nephropathy is a murine model of human focal glomerulosclerosis (FSGS), which is characterized by podocyte damage, glomerular sclerosis, and tubulointerstitial fibrosis.\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e In another study, podocyte conditional Sirt1 knockout resulted in aggravated podocyte injury after aldosterone infusion in mice. Lu Z reported that ADR-induced FSGS models presented with podocyte injury due to the downregulation of Sirt1.\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e Nonetheless, whether Sirt1 can rescue FSGS-induced podocyte injury is unknown. We previously demonstrated that Sirt1 knockout in proximal tubular cells decreased its expression in glomerular podocytes and increased the expression of a tight junction protein, Claudin-1, which resulted in albuminuria.\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eFSGS is the leading cause of end-stage renal disease.\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e In a previous study, we demonstrated that Sirt1 inactivation in podocytes upregulated the ectopic expression of Claudin-1, leading to the abrogation of glomerular barrier function via epigenetic mechanisms (reduced methylation of the Claudin-1 gene).\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e In an RNA sequence analysis using human FSGS samples,\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e Claudin-1 ectopic overexpression in the podocyte was reportedly correlated with podocyte damage. Transgenic mice with Claudin-1 overexpression in the podocytes demonstrated both podocyte injury and proteinuria.\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e Sirt1 exerts its effects via the protein deacetylase activity and the histone deacetylase activity. It regulates the expression levels of Claudin-1\u003csup\u003e3\u003c/sup\u003e and various other genes, epigenetically, via the histone deacetylation activity, along with DNA methylation. The upregulation of Claudin-1 might lead to glomerular damage, considering that the epigenetic effects could last for a prolonged period. This gene regulation effect is thought to be involved in the memory or legacy effects observed in diabetic complications, which have been observed in a previous large clinical trial (UKPDS80).\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eSirt1 activity depends on the cellular levels of NAD\u003csup\u003e+\u003c/sup\u003e. NAD\u003csup\u003e+\u003c/sup\u003e concentrations in each organ have been reported to decrease with age and chronic organ damage, which includes CKD or nephrosis in murine models.\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e Therefore, increases in NAD levels could be used as potential therapeutic targets in these diseases.\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e Several strategies to increase Sirt1 activity,\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e including caloric restriction,\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e administration of resveratrol,\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e and approaches to restore NAD\u003csup\u003e+\u003c/sup\u003e levels (such as the administration of NAD\u003csup\u003e+\u003c/sup\u003e metabolites,\u003csup\u003e13\u003c/sup\u003e or the inhibition of NAD consumers), have been reported.\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e In terms of supplementation with NAD\u003csup\u003e+\u003c/sup\u003e metabolites to increase the NAD\u003csup\u003e+\u003c/sup\u003e concentration and Sirt1 activity or expression, several substances such as nicotinamide (NAM) riboside (NR), NAM mononucleotide (NMN), and NAM have been reported to have fewer adverse effects and efficiently enhance NAD\u003csup\u003e+\u003c/sup\u003e biosynthesis.\u003csup\u003e15\u0026ndash;18\u003c/sup\u003e However, although the effects of NMN in cisplatin-induced AKI murine and diabetic nephropathy murine models have been published,\u003csup\u003e\u003cspan additionalcitationids=\"CR20 CR21\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e they have not been tested in the ADR-induced FSGS model thus far. NMN is an intermediate of the NAD\u003csup\u003e+\u003c/sup\u003e salvage pathway produced by nicotinamide phosphoribosyltransferase (Nampt) from NAM. In this pathway, NMN is further converted to NAD\u003csup\u003e+\u003c/sup\u003e by nicotinamide mononucleotide adenylyltransferase (Nmnat), which is then recycled in various metabolic and cellular reactions \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThis study aimed to assess the renoprotective effect of preemptive short-term NMN treatment in mice with ADR-induced FSGS. The results suggested that NAD\u003csup\u003e+\u003c/sup\u003e and Sirt1 deficit contribute to kidney damage susceptibility. Short-term NMN treatment rescued the FSGS from podocyte damage through the restoration of renal NAD\u003csup\u003e+\u003c/sup\u003e concentrations, even after the termination of the treatment. Additionally, we observed long-term effects of the dynamics of NAD\u003csup\u003e+\u003c/sup\u003e metabolites after the treatment, suggesting legacy effects by the reactivation of Sirt1. The present study presents a novel treatment paradigm for FSGS, which could increase the possibility of achieving remission in this model.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eEffect of short-term NMN treatment on kidney function \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNMN is an NAD\u003csup\u003e+\u003c/sup\u003e precursor in the salvage pathway \u003cstrong\u003e(Figure 1)\u003c/strong\u003e. Transient short-term NMN treatment was administered to 8-week-old ADR-treated BALB/c\u003cem\u003e \u003c/em\u003emice or saline-treated BALB/c\u003cem\u003e \u003c/em\u003emice (Cont group). The ADR-treated mice were administered intraperitoneally with NMN at a dose of 500 mg/kg/day or with normal saline alone for 14 consecutive days (NMN 500 group or ADR group, respectively, \u003cstrong\u003eFigure 2A\u003c/strong\u003e). The body weights of the mice in the\u003cem\u003e \u003c/em\u003eNMN500 and Cont groups were greater than those in the ADR group; the weights of the mice in the Cont and NMN500 groups did not differ significantly (\u003cstrong\u003eFigure 2B\u003c/strong\u003e). On day 14, no significant differences in kidney weights were observed among the three groups, whereas on day 28, the weights in the Cont group and NMN500 group were higher than those in the ADR\u003cstrong\u003e \u003c/strong\u003egroup (\u003cstrong\u003eFigure 2C\u003c/strong\u003e). On day 28, serum creatinine levels in the ADR group were higher than those in the Cont and NMN500 groups (\u003cstrong\u003eFigure 2D\u003c/strong\u003e). Although a decline in glomerular filtration was observed on day 28 in the ADR group, it was reversed in the NMN500 group (\u003cstrong\u003eFigure 2E\u003c/strong\u003e). Moreover, the\u003cstrong\u003e \u003c/strong\u003eADR group exhibited a significantly higher urinary ACR compared to the Cont group, on days 14 and 28 (\u003cstrong\u003eFigure 2F\u003c/strong\u003e). The NMN500 group exhibited lower albuminuria levels than the ADR group on days 14 and 28, which suggested an inhibitory effect of NMN on albuminuria, and this effect was sustained for 28 days even after the termination of the short-term NMN intervention. Serum\u003cstrong\u003e \u003c/strong\u003echolesterol levels were significantly higher in the ADR group than in the Cont and NMN500 groups on days 14 and 28 (\u003cstrong\u003eFigure 2G\u003c/strong\u003e). \u003c/p\u003e\n\u003cp\u003eWe further examined the dose-dependent effects of short-term NMN treatment (\u003cstrong\u003eFigure 3A\u003c/strong\u003e). The effects of short-term treatment with two additional doses of NMN, 100 and 300 mg/kg, on serum cholesterol levels and urine ACR levels, were evaluated on day 28. The cholesterol levels in ADR mice treated with 100 mg/kg NMN (NMN100) and 300 mg/kg NMN (NMN300) were not different from those in the ADR group (\u003cstrong\u003eFigure 3B\u003c/strong\u003e). Moreover, the NMN300 and NMN500 groups exhibited reduced ACR, whereas the NMN100 group did not show a significant reduction in ACR when compared to the ADR group (\u003cstrong\u003eFigure 3C\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eShort-term NMN treatment ameliorated the histological changes in ADR-treated mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo histologically assess the effect of NMN on ADR-induced renal damage, the glomerular volume and mesangial expansion were evaluated via PAS staining and the podocyte number was determined using the podocyte marker WT-1 (\u003cstrong\u003eFigure 4A\u003c/strong\u003e). No significant difference in glomerular surface area was observed among the three groups on day 28 (\u003cstrong\u003eFigure 4\u003c/strong\u003e\u003cstrong\u003e\u003cspan lang=\"\"\u003eB\u003c/span\u003e\u003c/strong\u003e). The ADR group exhibited more PAS-positive areas than the Cont group on day 28 (\u003cstrong\u003eFigures 4A and 4C\u003c/strong\u003e). The PAS-positive areas in the NMN500 group were lower than those in the ADR group on day 28 (\u003cstrong\u003eFigure 4C\u003c/strong\u003e). Furthermore, on day 28, the number of podocytes per glomerular section was lower in the ADR group than that in the Cont group, and this reduction was rescued in the NMN500 group (\u003cstrong\u003eFigure 4D\u003c/strong\u003e). In terms of the EM findings, we investigated the thickness of the GBM and the density of the foot process of the podocytes (\u003cstrong\u003eFigure 4E\u003c/strong\u003e). The GBM thickness did not differ among the Cont, ADR, and NMN500 groups (\u003cstrong\u003eFigure 4F\u003c/strong\u003e), whereas the foot process density was lower in the ADR group than in the Cont group; this reduction was ameliorated in the NMN500 group (\u003cstrong\u003eFigure 4G\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular changes in the glomerulus after NMN treatment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe have previously shown that decreased Sirt1 in podocytes subsequently increases ectopic Claudin-1 expression and causes foot process effacement in the podocyte, leading to diabetic albuminuria.\u003csup\u003e3, 22\u003c/sup\u003e In the present study, we assessed the levels of expression of several proteins involved in this mechanism via immunohistochemistry in each mice group on day 28 when NMN treatment was terminated 14 days before (\u003cstrong\u003eFigure 5A\u003c/strong\u003e). Sirt1 expression was decreased in the ADR group compared with the Cont group (\u003cstrong\u003eFigure 5B\u003c/strong\u003e). Claudin-1 expression was increased (\u003cstrong\u003eFigure 5C\u003c/strong\u003e), and Synaptopodin expression was decreased in the ADR group (\u003cstrong\u003eFigure 5D\u003c/strong\u003e) when compared with the Cont group. These changes were ameliorated in the NMN group. We have previously reported that decreased Sirt1 expression causes Claudin-1 expression and podocyte damage through decreased histone H3K9 methylation and decreased Dnmt1 expression in a diabetic glomerular sclerosis background.\u003csup\u003e3,\u003c/sup\u003e \u003csup\u003e22\u003c/sup\u003e This NMN effect was assessed in the ADR-induced nephropathy model in the present study.\u003csup\u003e23 \u003c/sup\u003eTo assess other Sirtuin isoforms that are abundantly expressed in the kidney,\u003csup\u003e24\u003c/sup\u003e the expression levels of both Sirt3 and Sirt6 in the glomeruli were determined. No changes in the expressions of Sirt3 were observed between the ADR and NMN500 groups (\u003cstrong\u003eFigure 5E, F\u003c/strong\u003e). Sirt6 expression was decreased in the ADR group and restored in the NMN500 group (\u003cstrong\u003eFigure 5E, G\u003c/strong\u003e). The expression of H3K9me2 was decreased in the ADR group as compared to that in the Cont group, but it was maintained in the NMN500 group (\u003cstrong\u003eFigure 5E, H\u003c/strong\u003e). The expression of Dnmt1 was decreased in the ADR group than in the Cont group; this change was ameliorated in the NMN500 group\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eFigure 5E, I\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffects of NMN treatment on NAD\u003csup\u003e+\u003c/sup\u003e metabolites and the salvage pathway\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe concentrations of NAD\u003csup\u003e+\u003c/sup\u003e in the kidney were determined from 8 to 24 weeks of age in the Cont and ADR groups to evaluate the chronological changes in NAD\u003csup\u003e+\u003c/sup\u003e metabolites. The ADR group had lower concentrations of NAD\u003csup\u003e+\u003c/sup\u003e in the kidneys at 12 weeks of age compared with the Cont group. In the ADR group, the NAD\u003csup\u003e+\u003c/sup\u003e concentrations in the kidney were further decreased at 16, 20, and 24 weeks of age relative to 8 weeks of age in a time-dependent manner (\u003cstrong\u003eFigure 6A\u003c/strong\u003e). On day 28, the NMN500 group presented with lower concentrations of NAM and NMN in the kidneys compared to the ADR group; no differences in the concentrations of NAM and NMN were observed between the Cont and NMN500 groups \u003cspan lang=\"\"\u003e(\u003cstrong\u003eFigure 6B, 6C\u003c/strong\u003e)\u003c/span\u003e. The concentration of NAD\u003csup\u003e+\u003c/sup\u003e in the NMN500 group was higher than that in the ADR group (\u003cstrong\u003eFigure 6D\u003c/strong\u003e). Immunohistochemistry revealed that Nampt expression was lower in the ADR group than in the Cont group and higher in the NMN500 group compared with the ADR group \u003cstrong\u003e(Figure 6E, F)\u003c/strong\u003e. Conversely, Nmnat1 expression was higher in the ADR group than in the Cont \u003cem\u003eg\u003c/em\u003eroup, and the upregulation was repressed in the NMN500 group (\u003cstrong\u003eFigure 6E, G\u003c/strong\u003e). The expression of \u003cspan lang=\"\"\u003ePoly-ADP-ribose-polymerase 1 (\u003c/span\u003ePARP1), \u003cspan lang=\"\"\u003ethe major NAD+ consumer in cells,\u003csup\u003e25,\u003c/sup\u003e\u003c/span\u003e\u003csup\u003e \u003c/sup\u003e\u003csup\u003e\u003cspan lang=\"\"\u003e26,\u003c/span\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003e\u003csup\u003e\u003cspan lang=\"\"\u003e27\u003c/span\u003e\u003c/sup\u003e\u003cspan lang=\"\"\u003e \u003c/span\u003ewas increased in the ADR group compared to the Cont group, which might have caused the reduction in NAD\u003csup\u003e+\u003c/sup\u003e in this group (\u003cstrong\u003eFigure 6E, H\u003c/strong\u003e). Consistent with the changes in NAD\u003csup\u003e+\u003c/sup\u003e levels (\u003cstrong\u003eFigure 6D\u003c/strong\u003e), PARP1 expression in the kidney was lower in the NMN500 group compared to that in the ADR group (\u003cstrong\u003eFigure 6E, H\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEpigenetic regulatory mechanism of NMN-induced Nmnat1 downregulation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe murine Nmnat1 gene 5\u0026prime;-flanking region (3 kb) was analyzed using the CpGplot program (\u003cspan lang=\"\"\u003ehttp://www.ebi.ac.uk/emboss/cpgplot/\u003c/span\u003e). A CpG island located in the promoter flanking the first codon was identified (\u003cspan lang=\"\"\u003e\u003cstrong\u003eFigure 7A\u003c/strong\u003e\u003c/span\u003e), and four CAGCTG E-boxes were detected within the island (\u003cstrong\u003eFigure 7B\u003c/strong\u003e). To initially locate the functional regions responsible for regulating Nmnat1 gene expression in podocytes, several 5\u0026prime; deletion constructs with luciferase as the reporter gene were used for transient transfection studies (\u003cstrong\u003eFigure 7C\u003c/strong\u003e). Sequence analysis using TRANSFAC software revealed the localization of putative transcription factor binding sites for SP-1, Gata3, Twist2, Klf1, and Lef1 within a 1413-bp region in the Nmnat1 promoter (\u0026minus;1413 to +1) surrounding the major transcriptional start site\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eFigure 7C\u003c/strong\u003e). Luciferase assays were conducted to measure the ADR-stimulated promoter activities of five deletion constructs (\u0026minus;1413 Luc, \u0026minus;1158 Luc, \u0026minus;866 Luc, \u0026minus;622 Luc, and \u0026minus;305 Luc) cloned upstream from luciferase reporter genes in cultured podocytes. The transcriptional activities of the Nmnat1 promoters were not affected in the \u0026minus;1413 Luc, \u0026minus;11158 Luc, and \u0026minus;866 Luc deletion constructs. Following NMN treatment, similar levels of suppression were observed in cells containing these three promoter constructs. Nevertheless, Nmnat1 promoter activity was markedly suppressed in cells transfected with the promoter that deleted the region from \u0026minus;1808 to \u0026minus;622, demonstrating similar lowered activities with or without NMN. These results implied that the promoter region spanning \u0026minus;866 to \u0026minus;622 is essential for ADR-induced Nmnat1expression and the NMN-induced suppression of Nmnat1 gene expression. The TRANSFAC analysis showed that this ADR or NMN response region (between \u0026minus;866 and \u0026minus;622) contained consensus sites for Twist2 binding (\u003cstrong\u003eFigure 7C\u003c/strong\u003e), corresponding to the Enhancer Box (E-box) sites. It indicates that Twist2 was the principal DNA-binding component of this protein\u0026ndash;DNA complex. Luciferase assays conducted with the mutated Twist2 consensus sites (one or both) showed that both sites were functional\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eFigure 7D\u003c/strong\u003e). The E-box sites were located within the surrounding CG-rich sequences. Additionally, a computer search indicated that the CpG islands, the well-known targets of epigenetic modifications, resided within the Nmnat1 gene (\u003cstrong\u003eFigure 7A\u003c/strong\u003e). Thus, the regulation of Nmnat1 expression by NMN appeared to be influenced by the epigenetic mechanisms of DNA methylation. IHC using Twist2 was conducted on day 28 (\u003cstrong\u003eFigure 7E\u003c/strong\u003e); the expression of Twist2 was increased in the ADR group than in the Cont group but suppressed in the NMN500 group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDnmt1 repressed Twist2 binding activity in the Nmnat1 E-box\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePretreatment of podocytes with 5\u0026prime;-azacytidine followed by incubation with NMN lysate led to a significant recovery of Nmnat1 gene expression (\u003cstrong\u003eFigure 8A\u003c/strong\u003e). These data suggested that DNA methylation induced by NMN prevented Twist2 from binding to the E-box sites. To confirm the involvement of DNA methyltransferase (Dnmt) in the methylation of CpG sites in the Nmnat1 gene, the podocytes were transfected with siRNA for Dnmt1, Dnmt3a, or Dnmt3b. Methylation was significantly increased in cells treated with NMN when compared with those without NMN treatment. The methylation with NMN was suppressed by a siRNA for Dnmt1 but not for Dnmt3a or Dnmt3b (\u003cstrong\u003eFigure 8B, C, D\u003c/strong\u003e). Taken together, these findings indicated that Nmnat1 gene expression can be regulated epigenetically through CpG methylation by Dnmt1, which was recruited following the incubation of cells with NMN. The methylation of the Nmnat1 promoter region was low following treatment with ADR; thus Twist2 could bind to the E-box sites and maintain the high expression level of \u003cem\u003eNmnat1\u003c/em\u003e. In the presence of NMN, the methylation levels in the E-box were elevated by the recruited DNMT1; consequently, Twist2 could not bind to the E-box sites, which resulted in a decreased expression of \u003cem\u003eNmnat1\u003c/em\u003e \u003cstrong\u003e(Figure 8E, F)\u003c/strong\u003e.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the present study, the administration of NMN ameliorated kidney damage, both functionally and histologically, in the murine ADR-induced nephropathy model. NMN maintained the NAD\u003csup\u003e+\u003c/sup\u003e levels in the kidneys of the ADR-treated mice and altered the expression levels of Sirt1, Nampt, and Nmnat1. These changes were evident and sustained even after the discontinuation of the short-term NMN treatment, thus indicating that the effects of this treatment protocol were continuous. This study provides a proof of concept for the transient short-term administration of NMN as an effective treatment for proteinuric renal disease in the FSGS model.\u003c/p\u003e \u003cp\u003eFourteen days of NMN treatment led to a persistent reduction in albuminuria in FSGS and an amelioration in histological changes such as foot process effacement and glomerular sclerosis. We have previously shown that decreased Sirt1 in podocytes epigenetically upregulated the level of Claudin-1 (through Dnmt1 activation) and reduced the level of Synaptopodin, subsequently causing foot process effacement and albuminuria. Consistent with the results of our previous study, IHC demonstrated low Sirt1, high Claudin-1, and low Synaptopodin expression levels in the glomeruli of the ADR mice in the present study. Furthermore, the expression levels of H3K9me2 and DNMT1 were lower in the glomeruli of the ADR mice. These unfavorable changes were ameliorated by NMN, even after the termination of the treatment, thereby suggesting that Sirt1 reactivation halts the aggravation of the molecular changes in Sirt1-Claudin-1-Synaptopodin via its long-lasting epigenetic effects.\u003c/p\u003e \u003cp\u003eChronologically decreased NAD\u003csup\u003e+\u003c/sup\u003e concentrations were observed in the ADR group. Surprisingly, the NAD\u003csup\u003e+\u003c/sup\u003e levels in the kidneys of the NMN-treated ADR mice were higher on day 28, corresponding to those at 2 weeks after the termination of the treatment period. NMN is rapidly converted to NAD\u003csup\u003e+\u003c/sup\u003e and disappears from blood and the organs within 15 min; furthermore, the half-life of NAD is less than 10 h.\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e Paradoxically, low levels of NMN were observed on day 28 in the NMN500 group, despite prior supplementation. These findings indicate that the short-term treatment modified the salvage pathway for a long period. NMN treatment upregulated Nampt expression and downregulated Nmnat1 expression on day 28. It can be surmised that NMN treatment suppresses the overconsumption of NMN by repressing the NMN consumer, Nmnat1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE, G). Moreover, Nmnat1 was shown to directly bind to and activate PARP1.\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e In another study, Nmnat1 was shown to not only synthesize NAD\u003csup\u003e+\u003c/sup\u003e but also stimulate PARP1 activity independently of NAD\u003csup\u003e+\u003c/sup\u003e synthesis.\u003csup\u003e27\u003c/sup\u003e Taken together, these findings indicated that NMN treatment blocked the overconsumption of NMN and NAD, which was evoked by podocyte damage caused by ADR.\u003c/p\u003e \u003cp\u003eSome studies have reported that lower doses of NMN can improve the pathogenesis to a greater degree than higher doses.\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e In one study, marked improvements in oxygen consumption, energy expenditure, and physical activity were observed with 100 mg/kg of NMN when compared with those with 300 mg/kg NMN.\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e In another report, reduced cell death in the CA1 neurons was best achieved with 62.5 mg/kg of NMN.\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e Conversely, one study reported the dose-dependent effects of NMN treatment on body weight, bone density, and some age-related changes.\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e The dose-response experiment in the present study demonstrated that NMN treatment using dosages of 300 and 500 mg/kg improved albuminuria, whereas a dosage of 100 mg/kg had no effect. Hence, the ideal dosage might vary depending on the organs involved and the pathogenesis. In terms of the adverse, 1 year of treatment with 100 and 300 mg/kg/day of NMN orally appeared to be tolerable by the patients.\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e One study reported that 90 days of treatment with 3000 mg/kg of NR resulted in several adverse metabolic and histological effects, including an increase in kidney weight and the presence of basophilic tubules, tubular atrophy, focal segmental glomerulosclerosis, and monocyte infiltration in the kidneys; nevertheless, treatment with 300 mg/kg of NR for 90 days had no adverse effects.\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e In the present study, the short-term transient treatment was adopted for 2 weeks. Nonetheless, no obvious adverse effects were observed, thus supporting the feasibility of this treatment protocol.\u003c/p\u003e \u003cp\u003eTwist2 (dermo-1) is a basic helix-loop-helix (bHLH) transcription factor, which recognizes the E-box.\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e Twist2 has 66% identical homology and an overlapping pattern of cellular expression with the more studied Twist1.\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e The role of Twist1 in renal pathophysiology is emerging.\u003csup\u003e\u003cspan additionalcitationids=\"CR37\" citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e However, the detailed role of Twist2 in the kidneys has not been fully elucidated. Importantly, we identified a pathological transcription factor, Twist2, which might mediate the FSGS-dependent increase in glomerular sclerosis; additionally, we showed that a reduction in Twist2 expression by NMN is a potential intervention that can attenuate progressive FSGS. The inactivation of Twist2 by an endogenous ligand or exogenous substance like NMN might regulate the expression of \u003cem\u003eNmnat1\u003c/em\u003e and reduce glomerular sclerosis due to PARP1 suppression. Glomerular sclerosis is known as a pivotal pathway not only in FSGS but also in other kidney diseases leading to the progression of CKD. Hence, further studies are required to evaluate whether a therapeutic strategy that compensates for the downregulation of \u003cem\u003eNmnat1\u003c/em\u003e, such as NMN administration, would prove effective in protecting against the progression of CKD.\u003c/p\u003e \u003cp\u003eIn the present study, NMN decreased the level of PARP1, which is directly regulated by Nmnat1. Nmnat1 protein expression via epigenetic regulation of increasing methylation of the \u003cem\u003eNmnat1\u003c/em\u003e promoter region, an effect mediated by Dnmt1. Furthermore, this study demonstrated that Dnmt1 induces the methylation of the binding site in Twist2, and the subsequent reduction in its binding to the Nmnat1 promoter is the initial step for transcriptional regulation. Additional studies are required to elucidate that Nmnat1 downregulation can attenuate glomerular sclerosis. Details regarding the mechanism by which renal Dnmt1 is activated remain unknown, but reports suggest that the expression and/or activity of Dnmt1 can be increased via Sirt1 activation.\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eNampt deficiency leads to the inactivation of Sirtuin.\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e Significant expression levels of Sirt1, Sirt3, and Sirt6 were observed in normal kidneys. Among these isoforms, the ADR-treated mice exhibited a significantly decreased expression of Sirt1 and Sirt6, whereas that of Sirt3 was unaltered. NMN rescued the expression levels of Sirt1 and Sirt6 but did not affect that of Sirt3. These differences in the isoforms of Sirtuin might be associated with differences in the cellular fraction; nonetheless, further investigations are needed. Several studies, including the current study, demonstrated that Sirt6 deficiency induces podocyte damage\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e and renal fibrosis.\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e Thus, the decrease in Sirt6 expression, besides the Sirt1-related pathway, might have led to renal damage in the ADR mice in the present study.\u003c/p\u003e \u003cp\u003eIn conclusion, supplementation with short-term NMN for two weeks sufficiently restored and maintained NAD\u003csup\u003e+\u003c/sup\u003e and Sirt1 levels and protected the kidneys from FSGS 2 weeks after the termination of the treatment in mice. This study provides evidence of the long-term effects of NMN treatment; additionally, it demonstrates that short-term NMN supplementation is sufficient to suppress the progression of FSGS.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eAnimal experiment protocols\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMale BALB/c mice (8 weeks old) were purchased from Japan CLEA Co. (Tokyo, Japan). They were housed at a constant room temperature of 22℃ \u0026plusmn; 1℃ under a controlled 12 h light/12 h dark cycle and had free access to water and regular chow. The mice were intravenously injected with a vehicle (normal saline; n = 12) or 11 mg/kg of ADR (n = 24) Santa Cruz Biotechnology Inc., Dallas, TX, USA) on day 0.\u003csup\u003e23\u003c/sup\u003e Twenty mice treated with normal saline were assigned to the non-FSGS control (Cont) group. The ADR-treated mice were randomly assigned to two groups (12 per group) as follows: those treated with vehicle (normal saline; ADR group) and those treated with NMN (500 mg/kg/day) in normal saline (NMN 500 group). The animals were treated every day for 14 consecutive days from day 0 to day 14, as described previously.\u003csup\u003e22\u003c/sup\u003e The survival of the animals was examined every day, and the body weights were estimated every week. Urine samples were collected on days 14 and 28. Serum samples measuring the cholesterol and creatinine levels were collected on days 14 and 28. The kidneys of the animals were harvested to assess the renal histology on day 14 (just after completing the NMN treatment) and day 28 (2 weeks after treatment termination). \u003cspan lang=\"\"\u003eAll the animal studies were approved by the Animal Care Committee and the \u003c/span\u003eE\u003cspan lang=\"\"\u003ethics Committe of the Tokushima University School of Medicine and study was carried out according to the national and regional guidelines\u003c/span\u003e. All\u003cspan lang=\"\"\u003e the studies are reported in accordance with ARRIVE guidelines. \u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBlood and urine examination\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUrine was collected for 24 h from metabolic cages, and the renal function was evaluated based on the serum creatinine levels and creatinine clearance (Ccr). The Ccr was calculated using the following formula: urinary creatinine \u0026times; urine volume/serum creatinine/1,440, where 1440 represents the number of minutes in 24 h. Albuminuria was assessed based on the urine albumin to creatinine ratio (ACR). The urine albumin level was assessed by an enzyme-linked immunosorbent assay (ELISA; Albuwell M; Ethos Biosciences, Pennsylvania, USA). The urine and serum creatinine levels were assessed using the QuantiChrom\u0026trade; Creatinine Assay Kit (BioAssay Systems, California, USA). Serum cholesterol levels were measured with a mouse cholesterol ELISA Kit (Abcam, ab285242).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistology and immunohistochemistry of the kidney\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eImages from at least 20 sequential glomerular cross-sections divided approximately at the glomerular equator were collected for each histological section by blinded observers. PAS-stained samples from 20 consecutive glomeruli per animal were examined. The glomerular surface area was traced along the outline of the capillary loop using Image-Pro Plus 7.0J software (Media Cybernetics, Silver Spring, MD, USA). For the quantitative analysis of the mesangial expansion, the PAS-positive area in the glomeruli was evaluated. Specifically, a minimum hue\u0026ndash;saturation\u0026ndash;intensity threshold was set on Image-Pro Plus 7.0J (Media Cybernetics), and the area exceeding this threshold was counted as a PAS-positive area. Consequently, the percentage of PAS-positive area per glomeruli was calculated. IHC was performed as described previously.\u003csup\u003e3\u003c/sup\u003e Briefly, paraffin sections (4 mm) were fixed in 3% formaldehyde and stained with the primary antibodies for Claudin-1 (Invitrogen, 51-9000, 1:50), Sirt1 (Sigma-Aldrich, 07-131, 1:100), Synaptopodin (Fitzgerald, 10R-S125A, undiluted), WT-1 (Santa Cruz, C-19, 1:200), Nampt (Bethyl Laboratories, A300-372A, 1:500), Nmnat1 (Proteintech, 11399-1AP, 1:500), Sirt3 (Cell Signaling, C73E3, 1:50), Sirt6 (LSBio, aa250-334, 1:2500), DNMT1 (Cell Signaling Technology, #5032, 1:100), PARP1 (Proteintech, \u003cspan lang=\"\"\u003e13371-1-AP, 1:200), Twist2 (Abcam, ab66031, 1:200), \u003c/span\u003eand H3K9me2 (Abcam; mAbcam 1220, 1:200). Goat antirabbit IgG (Nichirei, 414341) and goat antimouse IgG (Nichirei, 414321) antibodies were used as the secondary antibodies. All sections were examined under a light microscope (Olympus BX53 microscope) and digitized with a high-resolution camera. For the quantitative analysis of the staining for Sirt1, Claudin-1, Synaptopodin, Sirt3, Sirt6, H3K9me2, and DNMT1, the DAB-stained area per glomerular surface area was calculated using Image-Pro Plus 7.0J. The Definiens Tissue Studio software (Definiens, Munich, Germany) was used to calculate the DAB-stained area per section per kidney for the quantitative analysis of the Nampt, Nmnat1, PARP1, and Twist2 immunostaining. All assessments were performed in a blinded manner, and four kidneys were examined in each group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eElectron microscopy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor the electron microscopy (EM) evaluation, the kidney tissues were harvested and fixed overnight at 4℃ with 2% paraformaldehyde and 2% glutaraldehyde (GA) in 0.1 M phosphate buffer (PB; pH 7.4). After fixation, the samples were washed three times with 0.1 M PB for 30 min each and post-fixed with 2% osmium tetroxide (OsO4) in 0.1 M PB at 4℃ for 2 h. The fixed tissue blocks were embedded in Epon epoxy resin. The average number of podocyte foot processes was counted and divided by the glomerular basement membrane (GBM) length (mm) to determine the densities of the foot processes as described previously\u003csup\u003e22\u003c/sup\u003e. The counts were performed on 105 micrographs from at least three glomeruli in each mouse. Using Image-Pro Plus 7.0J, the length and thickness of the GBM were measured. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNAD\u003csup\u003e+\u003c/sup\u003e metabolite measurement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cspan lang=\"\"\u003eLevels of NAD\u003csup\u003e+ \u003c/sup\u003emetabolites were measured using LC/MS/MS as described previously\u003csup\u003e3\u003c/sup\u003e with minor modifications. Briefly, t\u003c/span\u003ehree volumes of methanol containing 6% perchloric acid and 4% phosphoric acid were used to homogenize the tissues. Subsequently, three volumes of methanol (including the deuterated internal standard) were added to the tissue homogenate or in serum samples; this mixture was vortexed and centrifuged. The supernatant was diluted with water and LC/MS/MS was used to analyze it. The Shimadzu Nexera UHPLC system (Shimadzu, Kyoto, Japan)\u0026mdash;consisting of an LC-30 AD pump, a DGU-20A5R degasser, a CTO-20AC column oven, and a SIL-30ACMP autosampler\u0026mdash;was used. At 50\u0026deg;C, separation was carried out using a Triart C18 column (3.0 150 mm, 5 m, YMC, Kyoto, Japan). Mobile phase A included water/formic acid/undecafluorohexanoic acid (1000/0.1/0.2, v/v/v), and mobile phase B included methanol. The chromatographic conditions were 0\u0026ndash;4 min (5%\u0026ndash;80% B, 0.5 mL/min), 4\u0026ndash;4.01 min (80%\u0026ndash;95% B, 0.5\u0026ndash;1.0 mL/min), 4.01\u0026ndash;7 min (95% B, 1.0 mL/min), 7\u0026ndash;7.01 min (95%\u0026ndash;5% B, 1.0\u0026ndash;0.5 mL/min), and 7.01\u0026ndash;13 min (5% B, 0.5 mL/min). An API5000 triple quadrupole mass spectrometer (SCIEX, Framingham, MA, USA) with electrospray ionization (ESI) in the positive ion mode was used for mass spectrometric detection. Standard solutions were used to optimize the ESI-MS/MS settings for each analyte. Quantitation was performed using multiple reaction monitoring with the following transitions: m/z 123 \u0026rarr; 80 for NAM, m/z 335 \u0026rarr; 123 for NMN, and m/z 664 \u0026rarr;136 for NAD\u003csup\u003e+\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eNmnat1\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e CpG methylation \u003cem\u003ein vitro\u003c/em\u003e by methylation-specific polymerase chain reaction (MSP) and real-time MSP\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal genomic DNA from cultured podocytes was extracted using the DNeasy Kit (Qiagen Japan, Tokyo, Japan). Bisulfite conversion of genomic DNA was performed using a Zymo EZ DNA Methylation Gold kit (Zymo Research Corp., Orange, CA, USA). MSP was performed to determine the methylation status of the \u003cem\u003eNmnat1\u003c/em\u003e gene and real-time MSP was performed to quantitatively analyze the methylation of the gene, as described previously.\u003csup\u003e24\u003c/sup\u003e \u003cstrong\u003eSupplementary table 1\u003c/strong\u003e lists the specific methylated or unmethylated sequences of the primer sets. Three independent MSPs and real-time MSPs were performed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cspan lang=\"\"\u003eLuciferase assay\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cspan lang=\"\"\u003eA 1414-bp fragment (\u0026minus;1413 to +1) of the 5\u0026prime; flanking region of \u003c/span\u003e\u003cem\u003e\u003cspan lang=\"\"\u003eNmnat1\u003c/span\u003e\u003c/em\u003e\u003cspan lang=\"\"\u003e was isolated from the murine BAC genomic clone using the restriction endonucleases \u003cem\u003eBal\u003c/em\u003eI and \u003c/span\u003e\u003cem\u003eEcoT14I\u003c/em\u003e\u003cspan lang=\"\"\u003e. Plasmids \u0026minus;1158, \u0026minus;866, \u0026minus;622, and \u0026minus;305 Luc were prepared by subcloning the \u003cem\u003eBglI\u003c/em\u003e, \u003cem\u003eClaI\u003c/em\u003e, \u003cem\u003eHindIII\u003c/em\u003e, and \u003cem\u003eSca\u003c/em\u003eI inserts from \u0026minus;1413 Luc. These Nmnat1/pGL3 plasmids (\u0026minus;1413 Luc, \u0026minus;1158 Luc, \u0026minus;866 Luc, \u0026minus;622 Luc, and \u0026minus;305 Luc) containing the murine Nmnat1 promoter sequences between \u0026minus;1413, \u0026minus;1158, \u0026minus;866, \u0026minus;622, and \u0026minus;305 and +1 were fused to a pGL3 vector, a firefly luciferase reporter plasmid, and then transfected with Lipofectamine 2000 (Invitrogen). NMN and ADR were added and pRL-CMV (Renilla luciferase reporter vector; Promega, Madison, WI, USA) was cotransfected into the cells. M\u003c/span\u003eurine podocyte cells have been described previously.\u003csup\u003e5\u003c/sup\u003e Podocyte cells were treated with 0.2 \u0026mu;g/ml of ADR in a regular medium, and the medium was harvested at 24 h after treatment. The \u003cspan lang=\"\"\u003eluciferase activity was measured as described previously.\u003csup\u003e24\u003c/sup\u003e The mutagenesis primers were\u003c/span\u003e generated from the \u0026minus;866 luciferase reporter plasmid by mutating CAGCTGA to CCCTTTA using \u003cem\u003ein vitro\u003c/em\u003e mutagenesis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCulture of podocytes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConditionally immortalized mouse podocytes were donated by P. Mundel (Mt. Sinai School of Medicine, New York, NY, USA) and K. Asanuma (Chiba University, Chiba, Japan). The podocytes were seeded at a density of 5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e per 100 mm\u003csup\u003e2\u003c/sup\u003e, incubated for 7 days (differentiation), and used for further experiments. The differentiation of the cells was confirmed as described previously.\u003csup\u003e5\u003c/sup\u003e The cells were treated with 5 \u0026mu;M 5-aza-dC (Sigma-Aldrich) for 96 h. For the \u003cem\u003eDnmt\u003c/em\u003e siRNA treatment, a \u003cem\u003eDnmt\u003c/em\u003e siRNA duplex was purchased from Sigma-Aldrich. The sense sequences were 5\u0026prime;-[dT] GGAAUGGCAGAUGCCAACAGC [dT]-3\u0026prime; for Dnmt1, 5\u0026prime;-[dT] GAAAGCGAAGGUCAUUGCA [dT]-3\u0026prime; for Dnmt3a and 5\u0026prime;-[dT] GCUAGCGAAGGUCAUUGCA [dT]-3\u0026prime; for Dnmt3b. The control siRNA consisted of a scrambled siRNA construct encoding a nonspecific siRNA without mammalian homology. These siRNAs (100 pmol \u0026mu;l\u003csup\u003e\u0026minus;1\u003c/sup\u003e) were transfected using Lipofectamine 2000 (Invitrogen) for 24 h.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analyses\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGraphPad Prism 8 software (GraphPad Software, CA, USA) was used to perform the statistical analyses. Data are expressed as means \u0026plusmn; standard error of the mean. Comparisons among several groups were analyzed using a one-way analysis of variance and Tukey\u0026rsquo;s post hoc test. A \u003cem\u003eP-\u003c/em\u003evalue of \u0026lt;0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors wish to thank P. Mundel and K. Asanuma for providing cultured podocytes.\u0026nbsp;This work was supported by the Scientific Research Fund of the Ministry of Education, Culture, Sports, Science, and Technology of Japan (Grant no. 22K0835400).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eKH, MT, and SW designed the experiments and the study. KH and YS collected data or performed experiments for the study. KH, MT, YS, and SW analyzed the data and contributed to writing the paper.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are avail-able in the methods of this article. Further information and requests for resources and reagents are available from the corresponding author ([email protected]). \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors\u0026nbsp;declare\u0026nbsp;no\u0026nbsp;conflicts\u0026nbsp;of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLee VW, Harris DC. Adriamycin nephropathy. a model of focal segmental glomerulosclerosis. Nephrology (Carlton) \u003cb\u003e16\u003c/b\u003e, 30\u0026ndash;38 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu Z. et al. METTL14 aggravates podocyte injury and glomerulopathy progression through N\u003csup\u003e6\u003c/sup\u003e-methyladenosine-dependent downregulating of Sirt1. Cell Death Dis. \u003cb\u003e27\u003c/b\u003e, 12(10), 881 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e3..Hasegawa K. et al. Renal tubular Sirt1 attenuates diabetic albuminuria by epigenetically suppressing Claudin-1 overexpression in podocytes. Nat Med \u003cb\u003e19\u003c/b\u003e, 1496\u0026ndash;1504 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBukosza EN. et al. Podocyte RNA sequencing reveals Wnt- and ECM-associated genes as central in FSGS. PLoS One \u003cb\u003e17\u003c/b\u003e, 15, e0231898 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGong Y. et al. Inducible expression of claudin-1 in glomerular podocytes generates aberrant tight junctions and proteinuria through slit diaphragm destabilization. J Am Soc Nephrol \u003cb\u003e28\u003c/b\u003e, 106\u0026ndash;117 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHolman RR. et al. 10-year follow-up of intensive glucose control in type 2 diabetes. N Engl J Med \u003cb\u003e359\u003c/b\u003e, 1577\u0026ndash;1589 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhadka D. et al. Augmentation of NAD levels by enzymatic action of NAD(P)H quinone oxidoreductase 1 attenuates adriamycin-induced cardiac dysfunction in mice. \u003cem\u003eJ Mol Cell Cardiol\u003c/em\u003e \u003cb\u003e45\u003c/b\u003e\u0026ndash;\u003cb\u003e57\u003c/b\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu X. et al. Impaired nicotinamide adenine dinucleotide biosynthesis in the kidney of chronic kidney disease. Front Physiol \u003cb\u003e12\u003c/b\u003e, 723690 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDai H. et al. Sirtuin activators and inhibitors: Promises, achievements, and challenges. Pharmacol Ther \u003cb\u003e188\u003c/b\u003e, 140\u0026ndash;154 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElhassan YS, Philp AA, Lavery GG. Targeting NAD + in metabolic disease: new insights into an old molecule. J Endocr Soc \u003cb\u003e1\u003c/b\u003e, 816\u0026ndash;835 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKume S. et al. Calorie restriction enhances cell adaptation to hypoxia through Sirt1-dependent mitochondrial autophagy in mouse aged kidney. J. Clin. Invest. \u003cb\u003e120\u003c/b\u003e, 1043\u0026ndash;1055 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim MY. et al. Resveratrol prevents renal lipotoxicity and inhibits mesangial cell glucotoxicity in a manner dependent on the AMPK-SIRT1-PGC1α axis in ADR mice. Diabetologia \u003cb\u003e56\u003c/b\u003e, 204\u0026ndash;217 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoshino J, Baur JA, Imai SI. NAD + Intermediates: The biology and therapeutic potential of NMN and NR. Cell Metab \u003cb\u003e27\u003c/b\u003e, 513\u0026ndash;528 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBai P. et al. PARP-1 inhibition increases mitochondrial metabolism through SIRT1 activation. Cell Metab \u003cb\u003e13\u003c/b\u003e, 461\u0026ndash;468 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeny\u0026oacute; Z. et al. GPR109A (PUMA-G/HM74A) mediates nicotinic acid-induced flushing. J Clin Invest \u003cb\u003e115\u003c/b\u003e, (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeny\u0026oacute; Z. et al. Nicotinic acid-induced flushing is mediated by activation of epidermal langerhans cells. Mol Pharmacol \u003cb\u003e70\u003c/b\u003e, 1844 LP\u0026ndash;1849 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZackheim HS. et al. Reactions to niacinamide. J. Am. Acad. Dermatol \u003cb\u003e4\u003c/b\u003e, 736\u0026ndash;737 (1981).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrammell SAAJ. et al. Nicotinamide riboside is uniquely and orally bioavailable in mice and humans. Nat. Commun \u003cb\u003e7\u003c/b\u003e, 1\u0026ndash;14 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuan Y. et al. Nicotinamide mononucleotide, an NAD \u003csup\u003e+\u003c/sup\u003e precursor, rescues age-associated susceptibility to AKI in a Sirtuin 1\u0026ndash;dependent manner. J Am Soc Nephrol \u003cb\u003e28\u003c/b\u003e, 2337\u0026ndash;2352 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y. et al. Endogenous nampt upregulation is associated with diabetic nephropathy inflammatory-fibrosis through the NF-κB p65 and Sirt1 pathway; NMN alleviates diabetic nephropathy inflammatory-fibrosis by inhibiting endogenous Nampt. Exp Ther Med \u003cb\u003e14\u003c/b\u003e, 4181\u0026ndash;4193 (2017)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLynch MR. et al. TFEB-driven lysosomal biogenesis is pivotal for PGC1α-dependent renal stress resistance. JCI Insight \u003cb\u003e4\u003c/b\u003e, (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYasuda I. et al. Pre-emptive short-term nicotinamide mononucleotide treatment in a mouse model of diabetic Nephropathy. J Am Soc Nephrol \u003cb\u003e32\u003c/b\u003e, 1355\u0026ndash;1370 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y. et al. Progressive adriamycin nephropathy in mice: sequence of histologic and immunohistochemical events. Kidney Int \u003cb\u003e58\u003c/b\u003e, 1797\u0026ndash;1804 (2000).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMuraoka H. et al. Role of Nampt-Sirt6 axis in renal proximal tubules in extracellular matrix deposition in diabetic nephropathy. Cell Rep \u003cb\u003e27\u003c/b\u003e, 199\u0026ndash;212.e5 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurata MM. et al. NAD + consumption by PARP1 in response to DNA damage triggers metabolic shift critical for damaged cell survival. Mol Biol Cell \u003cb\u003e15\u003c/b\u003e, 2584\u0026ndash;2597 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang X. et al. Structural characterization of a human cytosolic NMN/NaMN adenylyltransferase and implication in human NAD biosynthesis. J Biol Chem \u003cb\u003e278\u003c/b\u003e, 13503\u0026ndash;13511 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZang T. et al. Regulation of poly(ADP-ribose) polymerase-1-dependent gene expression through promoter-directed recruitment of a nuclear NAD\u003csup\u003e+\u003c/sup\u003e synthase. J Biol Chem \u003cb\u003e287\u003c/b\u003e, 12405\u0026ndash;12416 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRevollo JR. et al. Nampt/PBEF/Visfatin regulates insulin secretion in β cells as a systemic NAD biosynthetic enzyme. Cell Metab \u003cb\u003e6\u003c/b\u003e, 363\u0026ndash;375 (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStein LR, Imai SI. Specific ablation of Nampt in adult neural stem cells recapitulates their functional defects during aging. EMBO J \u003cb\u003e33\u003c/b\u003e, 1321\u0026ndash;1340 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoshino J. et al. Nicotinamide mononucleotide, a key NAD + intermediate, treats the pathophysiology of diet- and age-induced diabetes in mice. Cell Metab \u003cb\u003e14\u003c/b\u003e, 528\u0026ndash;536 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMills KF. et al. Long-term administration of nicotinamide mononucleotide mitigates age-associated physiological decline in mice. Cell Metab \u003cb\u003e24\u003c/b\u003e, 795\u0026ndash;806 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark JH. et al. Nicotinamide mononucleotide inhibits post-ischemic NAD + degradation and dramatically ameliorates brain damage following global cerebral ischemia. Neurobiol Dis \u003cb\u003e95\u003c/b\u003e, 102\u0026ndash;110 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eConze DB, Crespo-Barreto J, Kruger CL. Safety assessment of nicotinamide riboside, a form of vitamin B3. Hum Exp Toxicol \u003cb\u003e35\u003c/b\u003e, 1149\u0026ndash;1160 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFranco HL. et al. Redundant or separate entities? \u0026ndash; roles of Twist1 and Twist2 as molecular switches during gene transcription. Nucleic Acid Res \u003cb\u003e39\u003c/b\u003e, 1177\u0026ndash;1186 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBialek P. et al. A twist code determines the onset of osteoblast differentiation. Dev Cell \u003cb\u003e6\u003c/b\u003e, 423\u0026ndash;435 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang J. et al. Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell \u003cb\u003e117\u003c/b\u003e, 927\u0026ndash;939 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKida Y. et al. Twist relates to tubular epithelial-mesenchymal transition and interstitial fibrogenesis in the obstructed kidney. J Histochem Cytochem 55(7), 661\u0026ndash;673 (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLovisa S. et al. Epithelialto-mesenchymal transition induces cell cycle arrest and parenchymal damage in renal fibrosis. Nat Med \u003cb\u003e21\u003c/b\u003e, 998\u0026ndash;1009 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGan H. et al. B cell Sirt1 deacetylates histone and non-histone proteins for epigenetic modulation of AID expression and the antibody response. Sci Adv \u003cb\u003e6\u003c/b\u003e, eaay2793 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng L. et al. SIRT1 deacetylates the DNA methyltransferase 1 (DNMT1) protein and alters its activities. Mol Cell Biol \u003cb\u003e31\u003c/b\u003e, 4720\u0026ndash;4734 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu M. et al. Sirt6 deficiency exacerbates podocyte injury and proteinuria through targeting Notch signaling. Nat Commun \u003cb\u003e8\u003c/b\u003e, 413 (2017).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-1756041/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1756041/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe activation of nicotinamide adenine dinucleotide (NAD\u003csup\u003e+\u003c/sup\u003e)-dependent deacetylase, Sirt1, after the administration of nicotinamide mononucleotide (NMN) suppresses many diseases. However, the role of NMN and Sirt1 in focal glomerulosclerosis (FSGS) has not yet been elucidated. This study aimed to assess the protective effect of NMN treatment in mice with adriamycin (ADR)-induced FSGS. Transient short-term NMN treatment was administered to 8-week-old ADR- or saline-treated BALB/c mice (Cont group) for 14 consecutive days. NMN alleviated the increase in urinary albumin excretion in the ADR-treated mice. NMN treatment mitigated glomerulosclerosis and ameliorated the reduced Sirt1 expression and elevated Claudin-1 expression in the kidneys of the mice. Moreover, this treatment improved the decrease in histone methylation and the expression level of Dnmt1 and increased the concentration of NAD\u003csup\u003e+\u003c/sup\u003e in the kidney. Dnmt1 epigenetically suppressed the expression of the NMN-consuming enzyme nicotinamide mononucleotide adenyltransferase1 (Nmnat1) by methylating the E-box in the promoter region and repressing the NAD-consuming enzyme PARP1. Additionally, NMN downregulated the expression of Nmnat1 in the ADR-treated mice. Short-term NMN treatment in FSGS has epigenetic renal protective effects through the upregulation of Sirt1 and suppression of the NAD and NMN consumers. The present study presents a novel treatment paradigm for FSGS.\u003c/p\u003e","manuscriptTitle":"Nicotinamide mononucleotide ameliorates adriamycin-induced renal damage by epigenetically suppressing the NMN/NAD consumers mediated by Twist2","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-06-27 16:31:21","doi":"10.21203/rs.3.rs-1756041/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2022-07-11T06:18:03+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2022-07-03T22:05:47+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"3aab39ba-fd9b-4aa7-b6d7-5abab1721062","date":"2022-06-25T05:38:20+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-06-24T22:25:42+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-06-21T13:00:38+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2022-06-21T05:48:09+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2022-06-21T05:45:03+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2022-06-14T06:45:45+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"85f7db32-35dd-4c57-9a82-cdad3cd8fc30","owner":[],"postedDate":"June 27th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2022-08-05T09:59:12+00:00","versionOfRecord":[],"versionCreatedAt":"2022-06-27 16:31:21","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1756041","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1756041","identity":"rs-1756041","version":["v1"]},"buildId":"FbvkV6FR0MCFSLy54lSbu","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00