rAAV-ENO1mAb-5 inhibits cell proliferation and migration by suppressing glycolysis in cervical cancer

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract α-enolase (ENO1), as a plasminogen receptor and a key enzyme of glycolysis, is highly expressed in cervical cancer, Inhibition of ENO1 activity can further inhibit the migration and invasion of tumor cells by inhibiting glycolsis, and inhibiting tumor growth.In this study, adeno-associated virus (rAAV-ENO1mAb-5) with the variable region gene of recombinant ENO1 monoclonal antibody was prepared to mediate the targeted entry of the variable region gene of recombinant ENO1 monoclonal antibody into the cytoplasm to observe its growth inhibition effect on cervical cancer cells. The results showed that the variable region gene of rAAV-ENO1mAb-5, which was highly effective and targeted to load ENO1, entered the cytoplasm and inhibited the proliferation and migration of cervical cancer cells by antagonizing ENO1 enzyme activity, significantly reducing lactate and pyruvate content (P < 0.01). In conclusion, rAAV-ENO1mAb-5 can specifically block ENO1 expression on cell membrane and inhibit ENO1 glycolysis activity in tumor cells, which has therapeutic effect on cervical cancer cells.
Full text 112,062 characters · extracted from preprint-html · click to expand
rAAV-ENO1mAb-5 inhibits cell proliferation and migration by suppressing glycolysis in cervical cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article rAAV-ENO1mAb-5 inhibits cell proliferation and migration by suppressing glycolysis in cervical cancer xiaojuan Yang, yuanfeng Gou, Zhenhao Li, Ruzhen Shuai, Fei Li, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4730015/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract α-enolase (ENO1), as a plasminogen receptor and a key enzyme of glycolysis, is highly expressed in cervical cancer, Inhibition of ENO1 activity can further inhibit the migration and invasion of tumor cells by inhibiting glycolsis, and inhibiting tumor growth.In this study, adeno-associated virus (rAAV-ENO1mAb-5) with the variable region gene of recombinant ENO1 monoclonal antibody was prepared to mediate the targeted entry of the variable region gene of recombinant ENO1 monoclonal antibody into the cytoplasm to observe its growth inhibition effect on cervical cancer cells. The results showed that the variable region gene of rAAV-ENO1mAb-5, which was highly effective and targeted to load ENO1, entered the cytoplasm and inhibited the proliferation and migration of cervical cancer cells by antagonizing ENO1 enzyme activity, significantly reducing lactate and pyruvate content (P < 0.01). In conclusion, rAAV-ENO1mAb-5 can specifically block ENO1 expression on cell membrane and inhibit ENO1 glycolysis activity in tumor cells, which has therapeutic effect on cervical cancer cells. Biological sciences/Cancer/Cancer therapy Biological sciences/Cancer/Cancer therapy/Cancer immunotherapy Biological sciences/Cancer cervical cancer ENO1 glycolysis monoclonal antibody recombinant adeno-associated virus Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Cervical cancer is the fourth most common malignancies of the female genital tract, which seriously threatens the health of women all over the world. According to recent statistical research, there are 569,800 new cases of cervical cancer worldwide every year, and about 314,400 deaths [1] . Persistent HPV infection is generally accepted as being the primary cause of cervical cancer, approximately three-quarters of HPV-related cervical cancer cases are caused by HPV-16 and HPV-18 infections [2] . At present, the treatments for cervical cancer rely mostly on radical surgery, radiation and concurrent chemoradiotherapy therapy [3] . For recurrent and metastatic cervical cancer, the National Comprehensive Cancer Network (NCCN) recommends bevacizumab in conjunction with chemotherapy as the first-line therapy. In addition, immunotherapy presents another solution for cervical cancer treatments [4, 5] . Aberrant glucose metabolism, is one of the hallmarks of human cancer [6] . In the 1920s, Otto Warburg discovered that cancer cells undergo glycolysis even in the presence of ample oxygen, also known as Warburg effect [7, 8] . The Warburg effect can exert a positive environment for cancer cells to uptake nutrients for proliferation and invasion. In tumor cells, as a glycolytic enzyme, α-enolase (ENO1) is upregulated and facilitates anaerobic proliferation [9-11] . The enolase family contains 4 isoforms: α-enolase (ENO1), β-enolase (ENO3), γ-enolase (ENO2) and ENO4 [12, 13] . α-enolase (ENO1) is ubiquitous and expressed in most tissues, while γ-enolase (ENO2) is primarily expressed in nervous tissue and β-enolase (ENO3) in muscular tissues [14] . ENO1 can exert different functions depending on its cell localization. ENO1 is located on the cell surface, is part of a protein complex, including uPA receptor, integrin, and cytoskeletal proteins, that promotes tumor cell invasion and metastasis. Located in the cytoplasm, it can participate in glycolysis. In addition, ENO1 can also be expressed in the nucleus and bind to c-MyC promoter to negatively regulate c-MYC expression and play an anti-tumor role [13, 14] . Studies have shown that ENO1 silencing in tumor cells can further inhibit the migration and invasion of tumor cells by inhibiting glycolysis, thus inhibiting the occurrence and metastasis of tumor, so ENO1 is expected to become an important molecular target for early diagnosis, treatment and prognosis of tumor [15] . ENO1 also served as a stimulator of β-catenin. Therefore, it is urgent to find a new treatment for advanced, recurrent or metastatic cervical cancer. Studies have shown that the invasion and metastasis of tumor cells are decreased after silencing glycolythase related genes or inhibiting glycolythase activity. Therefore, inhibition of glycolysis pathway, reduction of energy supply and synthesis of intermediates in tumor cells, has become a new strategy for anti-tumor therapy in recent years [11] . Studies have reported that inhibition or silencing of glycolysis can inhibit the growth of tumor cells, but gene silencing technology has not been widely applied in clinical practice, and glycolysis inhibitors such as hexokinase inhibitor (3-BrPA) have great side effects, so they have not been widely applied in clinical practice [12] . ENO1 is a multifunctional protein whose function is related to cell localization. ENO1, In recent years, gene therapy technology has achieved significant clinical efficacy. Our research group constructed eukaryotic expression vector and prepared ENO1 monoclonal antibody (ENO1 mAb). In vitro study, ENO1 mAb was found to inhibit the invasion and migration of cervical cancer cells. However, mAb has large molecular weight and impermeable membrane properties. Compared with mAb, variable region gene sequence has the characteristics of low molecular weight, low immunogenicity and high tumor penetration. To overcome this shortcoming, we selected the variable regions of heavy and light chains of ENO1 monoabs with low molecular weight, low immunogenicity and high tumor penetration [16] ,and used the adeno-associated virus(AAV) to package the variable regions of ENO1 antibody to target into cervical cancer cells and specifically bind intracellular ENO1 to play an anti-tumor role. In this study, ENO1 mAb prepared by H5 hybridoma cell line was selected for further study. The variable region genes of ENO1 monoclonal antibody were fenced from the RNA of hybridoma cells (ENO1-H5) using universal primers. After the correct sequence was confirmed, The variable region gene of ENO1 monoclonal antibody was packaged into AAV293 cells to construct rAAV-ENO1mAb-5, which was inserted into the variable region expressing ENO1 monoclonal antibody in Hela cells of cervical cancer. The inhibitory effect of rAAV-ENO1mAb-5 on glycolysis of cervical cancer cells and its anti-cervical cancer effect were studied in vitro. Results Sequencing results of variable region genes in hybridoma cells The heavy chain variable region genes and light chain variable region genes of ENO1 monoclonal antibody were amplified by 5 '-RACE method. The variable region genes of ENO1 monoclonal antibody were sequenced successfully. AAV packages ENO1 monoclonal antibody variable region genes Construction and extraction results of adeno-associated virus associated plasmid (Figure 1). The concentrations were all greater than 1μg/μl, and A 260/280 were in the range of 1.8-2.0, which could be used to package viruses. The transfection results of AAV293 cell culture are shown in the figure below (Figure 2). AAV293 cells are polygonal cells with adherent growth and relatively uniform size. The results showed that the transfection was successful and the transfection efficiency reached 90%. Results of titer determination of recombinant adeno-associated virus The titer was measured by TCID50 method, and the cell state was observed after 5 days of culture at 37℃ with 5%CO 2 . The fluorescence of the cells was observed by an inverted fluorescence microscope, and the fluorescence results of the 96-well plate showed that 3-4 fluorescence displays were observed in each well at the viral dilution of 1:108, and 1 fluorescence display was observed in each well of 4 Wells at the viral dilution of 1:10 (Figure 3). The titers of rAAV-GFP and rAAV-ENO1mAb-5 obtained by TCID50 method were 2.0×10 7 PFU/ ml. Proliferation inhibition of adeno-associated virus with variable region genes of recombinant ENO1 monoclonal antibody MTT assay was used to detect the inhibitory effect of adeno-associated virus with variable region gene of recombinant ENO1 monoclonal antibody on Hela cell proliferation. As shown in Figure 4, with the increase of MOI, when the MOI value of rAAV-ENO1mAb-5 reached 80MOI (Table 2), the proliferation rate of Hela cells were (48.38±3.94) %, which was significantly different from that of the empty vector control group (rAAV-GFP) and PBS group (P<0.001). rAAV-GFP did not inhibit the proliferation of Hela cells. Therefore, these results suggestted that rAAV-ENO1mAb-5 can cross the cell membrane and inhibit tumor cell proliferation. Table 2 relative proliferation rate of Hela cells incubated with adeno-associated virus with variable region gene of recombinant ENO1 monoclonal antibody for 24h (n=3, X±S) rAAV-ENO1mAb-5 (X̄±S ) rAAV-GFP (X̄±S ) P 1MOI (131.40±3.10)% (174.83±3.33)% P <0.01 20MOI (68.13±6.64)% (106.38±6.64)% P <0.001 80MOI (48.38±3.94)% (108.57±3.29)% P <0.001 Inhibition of glycolysis in Hela cells by adeno-associated virus with variable region gene of recombinant ENO1 monoclonal antibody in vitro After adeno-associated virus mediated ENO1mAb variable region gene enters cervical cancer cells, it may inhibit ENO1 activity in the cytoplasm. We used a glycolysis kit to investigate the effect of adeno-associated virus with variable region gene of recombinant ENO1 monoclonal antibody on glycolysis level of Hela cells. 3-BrPA is a pyruvate analogue that inhibits key glycolysis enzymes including hexokinase II.3-BrPA has strong cytotoxic activity against most cancer cells and is a promising candidate for anticancer drugs [17] . In this study, 3-BrPA was used as a positive control. As shown in Figure 5, When rAAV-ENO1mAb-5 was co-incubated with Hela cells for 24h, the pyruvate content of glycolysis product in rAAV-ENO1mAb-5 and 3-BrPA groups were 0.15±0.002 μmol/mL and 0.13±0.005 μmol/mL, respectively. Compared with the negative control group (0.34±0.03) μmol/mL (P< 0.001), in addition, rAAV-ENO1mAb-5 group and rAAV-GFP group had statistical differences (P<0.05). The 24h lactate content of rAAV-ENO1mAb-5 and 3-BrPA groups were 7.39±0.08 mmol/gprot and 4.28±0.12mmol/gprot, respectively, which were significantly different from that of negative control group (14.48±0.41) mmol/gprot (P<0.01). Therefore, these results suggestted that rAAV-ENO1mAb-5 could enter the variable region of ENO1 antibody expression in Hela cells and significantly inhibitted glycolysis. Effect of adeno-associated virus with variable region gene of recombinant ENO1 monoclonal antibody on Hela cell migration There is increasing evidence that metabolism is the main driver of tumor metastasis. Once glycolysis is inhibited, it would lead to a reduced extracellular acidification, which affects the invasion and migration of tumor cells [18] .Therefore, we evaluated the effects of adeno-associated virus with the variable region gene of recombinant ENO1 monoclonal antibody on Hela cells migration by wound healing assay. The results showed that when the recombinant adeno-associated virus was co-incubated with Hela cells for 6h, the mobility of Hela cells in rAAV-ENO1mAb-5 group was (1.77±0.87) %. Compared with the no-load control group (rAAV-GFP group) (7.26±0.81) % and the negative control group (PBS group) (10.49±2.95) %, there were statistically significant differences (P 0.01). The results of cell scratches at 24h were consistent with those at 6h and 12h(Figure 6 and Figure7). Discussion Cervical cancer is one of the most common malignant tumors of female reproductive tract. In recent years, blocking the energy metabolism of tumor cells may become a new strategy for the treatment of cervical cancer. ENO1 is one of the rate-limiting enzymes of glycolysis and is closely related to the occurrence and development of various tumors. In order to overcome the disadvantages of ENO1mAb's large molecular weight and weak tissue penetration, the variable region genes of selected ENO1 monoclonal antibody were sequenced in this study to determine the correct sequence. The variable region gene of ENO1 monoclonal antibody was used to prepare rAAV-ENO1mAb-5 by using AAV's ability to infect cells. After purification and concentration, rAAV-ENO1mAb-5 with high titer was obtained, and its therapeutic effects were observed in vitro. In our study, we found that rAAV-ENO1mAb-5 can target into cervical cancer Hela cells and make it enter the variable region of ENO1 antibody expression in cells, thereby inhibiting the glycolysis, migration and proliferation of cervical cancer cells. 1. Inhibition of glycolysis by adeno-associated virus with variable region gene of recombinant ENO1 monoclonal antibody ENO1 is a multifunctional protein whose functions are related to cell localization. Studies have shown that ENO1 expressed in cytoplasm mainly participates in the glycolysis pathway as a glycolysis rate-limiting enzyme, inhibited its activity and reduced the glycolysis rate, thus inhibited the growth of tumor cells. In this study, rAAV-ENO1mAb-5 induced the variable region of ENO1 monoclonal antibody into Hela cells by viral infection to cervical cancer cells, and was expressed in Hela cells, thereby inhibiting glycolysis of Hela cells by inhibiting ENO1 activity. After the application of rAAV-ENO1mAb-5, the contents of pyruvate and lactic acid of glycolytic products were significantly decreased. It was proved that rAAV-ENO1mAb-5 could directly inhibited the activity of glycolytic enzyme ENO1 through specific binding of antibody variable region cytoplasmic ENO1. 2. Study on the anti-cervical cancer effect of adeno-associated virus with variable region gene of recombinant ENO1 monoclonal antibody Warburg effect is a key factor in tumor cells growth. compared with healthy cells, in order to meet the energy and substances required for the rapid metabolism of cell proliferation, even under aerobic conditions, tumor cells still use glycolysis to produce nucleic acids, proteins and lipids and other precursors [19, 20] ,the high metabolic demand and the accumulation of H+ in the tumor microenvironment maintain the acidic microenvironment of tumor cells, which can promote the rapid proliferation and distant metastasis of tumor cells [21] . Studies have shown that inhibition of glycolysis is crucial to tumor proliferation, invasion and metastasis [13] . Therefore, inhibition of glycolytic enzyme is a very promising method for anticancer therapy, and targeted inhibition of glycolytic pathway has become a hot treatment for cancer in recent years [22] .Yi et al found that silencing pyruvate kinase isoenzyme 2 (PKM2) during glycolysis can inhibit ovarian cancer glycolysis and significantly inhibit cell proliferation, migration and invasion [23] . Song et al found that targeted ENO1 inhibitor (ENO1i) can specifically enhance the activity of NK cells against autologous tumor cells and improve the prognosis of patients with multiple myeloma [24] . Lin et al selectively killed eno1-deficient glioma cells with an ENO1 inhibitor (POMHEX) [15] . In this study, we prepared adeno-associated virus with variable region gene of recombinant ENO1 monoclonal antibody. MTT assay showed that rAAV-GFP (empty vector control group) had no significant inhibitory effect on the proliferation of Hela cells, while when the MOI value of rAAV-ENO1mAb-5 reached 80, the relative proliferation rate of Hela cells decreased significantly. The results showed that rAAV-ENO1mAb-5 could cross cell membrane and inhibited the proliferation of tumor cells. (1) rAAV-ENO1mAb-5 inhibited the proliferation of cervical cancer cells ENO1 is a multifunctional protein, mainly acting as enzyme and plasminogen receptor, playing a crucial role in tumor proliferation, metastasis and diffusion [25] . Its enzymological function is to participate in pyruvate synthesis through glycolysis pathway, and to participate in the maintenance of "aerobic glycolysis" in tumor ENO1 [26] .It also acts as a c-myc promoter binding protein (MBP-1) in the nucleus and binds to the c-myc P2 promoter as a transcription inhibitor [27] . Similar to ENO1, MBP-1 inhibits the formation, migration and invasion of cell colonies by regulating the expression of c-Myc, COX-2 and other genes in vertebrates [28] .Studies have shown that HPV integration and c-myc gene amplification by FISH can be used in clinical practice as a useful auxiliary screening method for the early diagnosis of progression of squamous intraepithelial diseases, and c-myc gene can be a new molecular biomarker for the early diagnosis of progression of cervical diseases [29, 30] .Wu etal. retrospectively analyzed cervical cancer tissues by immunohistochemistry and found that high expression of c-Myc gene can promote the invasion and metastasis of cervical cancer cells [31] . Therefore, the entry of rAAV-ENO1mAb-5 into the cytoplasm inhibited the proliferation of tumor cells. Besides inhibiting glycolysis, the mechanism may also be related to MBP-1 expression, which needs further experimental verification. (2) rAAV-ENO1mAb-5 inhibited invasion and metastasis of cervical cancer cells On the surface of tumor cells, ENO1 induces invasion and metastasis by mediating plasminase activation and extracellular matrix degradation. Our scratch test showed that rAAV-ENO1mAb-5 significantly reduced the migration ability of Hela cells, indicated that rAAV-ENO1mAb-5 blocked the binding of ENO1 to plasminogen by binding to ENO1 on the surface of cell membrane, inhibited the activation of the plasminogen system, and then inhibited the invasion and metastasis of tumor cells. Wang et al found that ENO1 silencing reduced the invasion and migration ability of pancreatic duct cells, and ENO1 surface blocking by monoclonal antibody could effectively inhibit the proliferation and accumulation of myeloid cells in the primary tumor of pancreatic cancer and inhibit the anti-tumor response [32 ].Cappello et al found that T cells of pancreatic cancer patients also recognize ENO1, and ENO1 DNA inoculated mice with pancreatic cancer can effectively delay the invasion of pancreatic cancer cells, delay tumor development and significantly prolong the survival of mice [33] . At the same time, studies have found that monoclonal antibody surface blocking ENO1 can effectively inhibit the proliferation of pancreatic cancer in primary tumors and the accumulation of myeloid cells, and inhibit the anti-tumor response [34] . EMT is the mechanism of tumor invasion and metastasis [35] . Taniguchi et al found that CD44v9 expression induced EMT of esophageal squamous cell carcinoma by transforming growth factor-β. In addition, inhibition of CD44v9 expression reduced the migration and invasiveness of esophageal squamous cell carcinoma [36] .Overexpression of ADAM12(a kind of deintegrin and metalloproteinase) is related to tumor invasion of pituitary adenoma. Wang et al silencing ADAM12 in pituitary adenoma cells can significantly inhibit EMT process and inhibit cell migration, invasion and proliferation [37] . Therefore, rAAV-ENO1mAb-5 prepared by us can inhibit the migration of cervical cancer Hela cells, and the mechanism may be related to EMT. Cancer stem cells (CSCs) have the function of self-renewal, infinite proliferation and multidirectional differentiation. Most CSCs exhibit enhanced Warburg effect to maintain tumor cell dryness [38] .CD44 can be used as a marker of cancer stem cells, which are associated with epithelial-mesenchymal transformation (EMT) in cancer. Wang et al found that membrane protein EMP1 promotes invasion, migration and dry acquisition of glioma cells by inhibiting the PI3K-AKT signaling pathway and the potential mechanism of CD44 activation.FOXM1 is highly expressed in CD133 CD24 Huh-7 cells [39] . Chen et al found that silencing FOXM1 inhibits the proliferation, migration, invasion and EMT of HCC stem cells [40] . Yang et al found that ENO1 can enhance stem-like features of gastric cancer, including self-renewal ability, cell invasion, migration and tumorigenicity [41] . Therefore, the mechanism by which rAAV-ENO1mAb-5 reduces Hela cell migration may be related to tumor cell dryness. (3) ENO1 participates in multiple signaling pathways to promote proliferation, invasion and metastasis of cervical cancer cells ENO1 is involved in tumor development through a variety of signaling pathways. Chen et al found that ENO1 promotes glioma glycolysis activity, cell proliferation and migration through the PI3K/AKT pathway [42] . Zhan et al found that ENO1 overexpressed can promote the proliferation, invasion and migration of colon cancer cells in vitro, and promote tumor formation and metastasis in vivo, and its mechanism is related to AMPK/mTOR signaling pathway [43] . Therefore, whether the anti-tumor effect of rAAV-ENO1mAb-5 in vitro is related to the signaling pathway needs further experiments. (3) rAAV-ENO1mAb-5 can play a synergistic antitumor effect in combination with other drugs (1) Target dual metabolic phenotype The anti-cervical cancer effect of rAAV-ENO1mAb-5 is associated with a variety of mechanisms. The main mechanism is that the variable region gene of ENO1 monoclonal antibody targets into cervical cancer Hela cells and inhibits the glycolysis pathway, that is, inhibits the activation of the fibrinolytic system, and thus inhibits the occurrence and development of cervical cancer cells and tumor cells invasion and metastasis, and may also be regulated by MBP-1. EMT and the acquisition of tumor cell dryness. Studies have found that the growth of tumor cells mainly depends on glycolysis to provide the required energy, and the environment for tumor growth is usually acidic microenvironment. Excessive lactic acid and H+ excretion will intensify extracellular acidification and further inhibit glycolysis [44] .Tumor cells have a bimetabolic phenotype, that is, a biphasic transformation between aerobic glycolysis and non-glycolysis to meet the needs of tumor metabolism. Li et al found that silencing long intergene non-protein-coding RNA 184 (LINC00184) can inhibit the proliferation, migration, invasion and colony formation of esophageal cancer cells, but restoring mitochondrial OXPHOS can promote the survival of esophageal cancer cells, and double inhibition can inhibit the growth of tumor cells [45] . Therefore, targeting the dual metabolic phenotype of tumor cells may more effectively block the production pathway of tumor cells, and then block the growth of tumor cells, which may be a new strategy for tumor treatment. (2) Targeting tumor-matrix metabolic coupling Metabolic plasticity allows tumor cells to switch between glycolysis and OXPHOS. Metabolic phenotype metabolic heterogeneity is a characteristic of tumors. Some tumor cells maintain a glycolysis phenotype, while some tumor cells primarily utilize OXPHOS. The "anti-Warburg effect" describes the metabolic support of adjacent cancer cells by glycolysis in the stroma associated with cancer. The transfer of such metabolites induces matrix-cancer metabolic coupling, produces ATP, promotes tumor cell proliferation and inhibits apoptosis [46] .Therefore, targeting tumor-matrix metabolic coupling may be a therapeutic target for cancer. (3) rAAV-ENO1mAb-5 combined with radiotherapy and chemotherapy Tumor cells have metabolic heterogeneity, and metabolic reprogramming can occur to promote tumor cell survival. Therefore, targeting glycolysis may be a more effective therapeutic strategy. In this study, adeno-associated virus with variable region gene of ENO1 monoclonal antibody was used to study its antitumor effect on cervical cancer Hela cells. Studies have shown that rAAV-ENO1mAb-5 can exert glycolytic inhibition through the specific binding of cytoplasmic ENO1 in the variable region of antibody, and then inhibit the proliferation and migration of Hela cells, inhibit the energy supply of tumor cells, and induce the apoptosis of tumor cells. Qian et al found that ENO1 expression increased in cisplatin-resistant gastric cancer cells, and metabolic reprogramming of cisplatin-resistant cells showed increased glycolysis dependence, and inhibition of glycolysis by 2-DG could significantly reverse drug resistance [47] .At the same time, several literatures have reported that glycolysis inhibitors can enhance the sensitivity of chemotherapy [48, 49] , so the combination of rAAV-ENO1mAb-5 and chemotherapy may be a strategy for the treatment of cervical cancer. In addition, the antitumor effects of rAAV-ENO1mAb-5 in vitro may involve EMT, tumor cell stem and a variety of signaling pathways, so its mechanism of action needs to be further studied to provide new targets and laboratory evidence for the treatment of advanced, recurrent and metastatic cervical cancer. In conclusion, rAAV-ENO1mAb-5 can block the highly expressed plasminogen receptor on the cell membrane of cervical cancer cells and inhibit the migration and invasion of tumor cells. In addition, rAAV-ENO1mAb-5 can mediate the entry of ENO1 variable region genes into the cytoplasm and inhibit glycolysis, which helps to reduce the proliferation of cervical cancer cells. The in vivo antitumor effect of ENO1mAb needs to be further studied. Materials and methods Materials The hybridoma cell lines H1-H5 were prepared by AtaGenix Laboratories (Wuhan, China) and stored in Lanzhou University (Lanzhou, China). Hybridoma cell line H1-H5 was prepared and stored in AtaGenix Laboratory(Wuhan, China). The human cervical cancer cell line Hela was provided by the Institute of Pathogen Biology, School of Basic Medical Sciences, Lanzhou University (Lanzhou, China). The plasmid AAV-ENO1mAb-5 and adeno-associated virus vector system were purchased from BGI and stored in Lanzhou University (Lanzhou, China).DMEM medium was obtained from Thermo Fisher Scientific (USA). The test kits of lactic acid, pyruvate, glucose and ATP were from Nanjing Jian cheng Biological Co., Ltd (Nanjing, China). 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and bicinchoninic acid (BCA) protein assay kit were from Beijing Solarbio Technology Co., Ltd (Beijing, China). Cell culture plates and bottles were from Corning Biological Co., Ltd (USA). Methods ENO1 monoclonal antibody variable region gene sequencing On the basis of previous laboratory work, the variable region genes of ENO1 monoclonal antibody were obtained from RNA of ENO1 hybridoma H5 cell lines (ENO1-H5) using primer sequences (Table 1), and the obtained variable region genes of antibody were sequenced. (Synthesized by BGI and verified by sequencing). Table 1 Primer sequences gene Primer sequences Heavy chain R GATTACGCCAAGCTTGCTGGACAGGGATCCAGAGTTCC Light chain R GATTACGCCAAGCTTCACGACTGAGGCACCTCCAGATGTTAACTG AAV vector packages ENO1 monoclonal antibody variable region genes (1) Construction and extraction of adeno-associated virus related plasmids The variable region sequences of light chain and heavy chain of ENO1 monoclonal antibody H5, which can significantly inhibit the migration and invasion of cervical cancer cells, were selected as the restriction sites Xba I and Hind III, and Linker--(GGGGS)3 was used in the middle, and cloned into pAAV2-MCS vector (synthesized by Huada Company). AAV-ENO1mAb-5 plasmid was obtained. AAV-ENO1mAb-5 and AAV-assisted pHelPer and pAAV-RC were inoculated in 200ml LB liquid medium (including Amp+) for bacterial expansion. Then a large amount of extraction were performed with endotoxin-free plasmid extraction kit. The concentration was determined to be greater than 1μg/μl. A260/280 can be used to package viruses between 1.8-2.0. (2) Cell preparation and transfection AAV293 cells at logarithmic growth stage were placed in a 10cm dish with 1×10 6 cells. DMEM medium containing 10% fetal bovine serum were added and incubated at 37℃ with 5%CO 2 . Transfection was performed after the cell adhesion reached 70% coverage.. Discard the medium and washed the petri dish with 1×PBS for 3 times before transfection 1-2 hours, and added serum-free DMEM medium. Then, the plasmids were transfected according to the specific steps of PEI transfection kit. At the same time,pAAV-IRES-ZsGreen5 with green fluorescent protein was transferred into AAV293 cells as empty vector control (rAAV-GFP). (3) Collection and concentration of recombinant adeno-associated virus 48h after transfection, the supernatant and the transfected cells were centrifuged at 1000rpm for 3min, and the supernatant and cell precipitation were separated. The cell precipitation suspended in 1mL 1×PBS were frozen and thawed repeatedly in a liquid nitrogen bath at 37℃ for 4 times. Then centrifuged at 10,000 RPM for 5 min. Then the supernatant was collected and sterilized with a 0.45μm filter.1 M NaCl,10%PEG 8000 solution: the supernatant was pressed by 1: 2 volume ratio were added into the supernatant collection tube, mixed and centrifuged at 12,000 RPM for 120min at 4℃ overnight, dissolved with an appropriate amount of 1×PBS, then filtered with a 0.22μm filter to collect the virus precipitates. (4) Titer determination of recombinant adeno-associated virus AAV293 cells at the logarithmic growth stage were laid in 96-well plates with 1×10 4 cells per well, incubated at 37℃ with 5%CO 2 . When the cell growth rate reached more than 80%, the culture medium was sucked and discarded. Then, a DMEM medium containing 5% FBS (called maintenance solution) were prepared, and the recombinant adeno-associated virus diluted by maintenance solution was added to the 96-well plate from left to right (the dilution of virus from left to right was 1:10 1 , 1:10 2 ... 1:10 11 ), At the same dilution gradient, The same dilution gradient was set with 3 multiple holes, and maintenance solution was added to 3 more double holes as negative control. Culture were continued at 5%CO 2 and 37℃, and cell fluorescence was observed with inverted fluorescence microscope. Cytotoxicity test Hela cells in logarithmic phase were plated in 96-well culture plates with a density of 5×10 3 cells per well, and incubated overnight at 37 ℃ with 5 % CO 2. The cells were slowly washed with PBS for 3 times after the medium was discarded, and the concentrated recombinant adeno-associated virus (rAAV-ENO1mAb-5、rAAV-GFP) with different MOI gradients were added to the cells for further incubation for 24h and 48h. Then 20μl MTT solution was added, incubated at 37℃ with 5%CO2 for 4h, and 150μl DMSO solution was added to each well. Absorbance was measured at 490 nm using a microplate reader. Untreated cells were taken as a negative control with 100 % viability and cells without addition of MTT were used as blank to calibrate the spectrophotometer to zero absorbance. Cell survival rate was calculated: cell survival rate = (experimental group OD- blank group OD) / (control group OD- blank group OD) ´100 %. The inhibitory effect on Hela cells proliferation was analyzed. Inhibition of glycolysis in vitro 1×10 6 Hela cells per well were laid on 6-well plates, incubated at 37℃ with 5%CO 2 . The recombinant adeno-associated disease venom and 3-BrPA prepared with phenol-free red DMEM medium and 10% FBS were added, respectively. Each group had 3 compound holes, and the supernatant were collected and cultured 24 hours later. The content of lactic acid and pyruvate in supernatant was determined according to the instructions of lactic acid kit and pyruvate kit, respectively. Total protein was extracted and the concentration was determined by BCA protein assay kit. A test of wound healing Laied 1×10 5 Hela cells in each well on 6-well plates, incubated overnight at 37℃ with 5%CO 2 until the cells were completely lined at the bottom of the well and adhered to the wall. Draw a straight line perpendicular to the 6-well plate with the tip of 10μl sterile pipette gun. Then the shed cells were washed with 1×PBS for 3 times, and serum-free DMEM medium was added, and then rAAV-ENO1mAb-5 and rAAV-GFP were added respectively. Another PBS group was set with 3 compound holes in each group. The cells were incubated at 37℃ with 5%CO 2. The movement of cells into the wound area was observed with an inverted microscope and photographed within 24 hours. Image J software was used to calculate the scratch area and analyze the average mobility. Statistical analysis All experiments were repeated at least three times. The experimental data were expressed as mean ± SEM (X±S). Statistical analysis was performed using SPSS statistical package (SPSS 25.0).. Differences between two groups were analyzed by Student’s t test. and one-way variance (ANOVA) was used for comparison of multiple groups after homogeneity of variance test. With α=0.05 as the test level, P<0.05 was considered statistically significant. Declarations Funds National Natural Science Foundation of China, 82260557 Gansu Province Science Foundation for Youths, 22JR11RA245 References Lancet, T., GLOBOCAN 2018: counting the toll of cancer. Lancet, 2018. 392(10152). Sun, L., et al., Alpha-enolase promotes gastric cancer cell proliferation and metastasis via regulating AKT signaling pathway. European Journal of Pharmacology, 2018. Ji, M., et al., Up-regulated ENO1 promotes the bladder cancer cell growth and proliferation via regulating β-catenin. Bioscience Reports, 2019. 39(9). Liu, Y., et al., PD-1/PD-L1 Inhibitors in Cervical Cancer. Frontiers in Pharmacology, 2019. 10. Moreno-Acosta, P., et al., Persistent High-Risk HPV Infection and Molecular Changes Related to the Development of Cervical Cancer. Case Reports in Obstetrics and Gynecology, 2020. 17: p. 1-6. Marquina, G., A. Manzano, and A. Casado, Targeted Agents in Cervical Cancer: Beyond Bevacizumab. Current Oncology Reports, 2018. 20(5): p. 40. Minion, et al., Cervical cancer - State of the science: From angiogenesis blockade to checkpoint inhibition. Gynecologic Oncology: An International Journal, 2018. Yang, W., et al., Increased expression of programmed death (PD)‐1 and its ligand PD‐L1 correlates with impaired cell‐mediated immunity in high‐risk human papillomavirus‐related cervical intraepithelial neoplasia. Immunology, 2013. 139(4): p. 513-522. Roszik, J., et al., Gene Expression Analysis Identifies Novel Targets for Cervical Cancer Therapy. Frontiers in Immunology, 2018. 9. Bounds, P.L., C.V. Dang, and W.H. Koppenol, Otto Warburg's contributions to current concepts of cancer metabolism. 2013. Abdel-Wahab, A.F., W. Mahmoud, and R.M. Al-Harizy, Targeting glucose metabolism to suppress cancer progression: prospective of anti-glycolytic cancer therapy. Pharmacological Research, 2019. 150: p. 104511. Zhang, D., et al., 2-Deoxy-D-glucose targeting of glucose metabolism in cancer cells as a potential therapy. Cancer Letters, 2014. 355(2): p. 176-183. Progress in the biological function of alpha-enolase. 2016(1): p. 6. Kang, H.J., et al., Structure of human alpha-enolase (hENO1), a multifunctional glycolytic enzyme. Acta Crystallographica, 2008. 64(6): p. 651-657. Nakamura, N., et al., Disruption of a spermatogenic cell-specific mouse enolase 4 (eno4) gene causes sperm structural defects and male infertility. Biology of Reproduction, 2013. 88(4). Prabha, S., et al., RNA interference technology with emphasis on delivery vehicles—prospects and limitations. Artificial Cells Nanomedicine & Biotechnology, 2015: p. 1. Cal, M., et al., The Anticancer Drug 3-Bromopyruvate Induces DNA Damage Potentially Through Reactive Oxygen Species in Yeast and in Human Cancer Cells. Cells, 2020. 9(5): p. 1161. Payen, V.L., et al., Metabolic changes associated with tumor metastasis, part 1: tumor pH, glycolysis and the pentose phosphate pathway. Cellular & Molecular Life Sciences, 2016. 73(7): p. 1333-1348. Zhou, J., et al., CircRNA-ENO1 promoted glycolysis and tumor progression in lung adenocarcinoma through upregulating its host gene ENO1. Cell Death & Disease, 2019. 10(12): p. 885. Hanahan, D. and R.A. Weinberg, Hallmarks of cancer: the next generation. Cell, 2011. 144(5): p. 646. Kobayashi, Y., et al., Warburg effect in Gynecologic cancers. Journal of Obstetrics and Gynaecology Research, 2018. Corbet, C. and O. Feron, Tumour acidosis: from the passenger to the driver's seat. Nature Reviews Cancer, 2017. Sheng, et al., Glycolysis Inhibitors for Anticancer Therapy: A Review of Recent Patents. Recent Patents on Anti-Cancer Drug Discovery, 2016. 11(3): p. 297-308. Miao, Y., et al., Inhibition of Proliferation, Migration, and Invasion by Knockdown of Pyruvate Kinase-M2 (PKM2) in Ovarian Cancer SKOV3 and OVCAR3 Cells. Oncology Research, 2016. 24(6): p. 463. Ray, A., et al., Preclinical validation of Alpha-Enolase (ENO1) as a novel immunometabolic target in multiple myeloma. Oncogene. Capello, M., et al., α-enolase: a promising therapeutic and diagnostic tumor target. febs journal, 2011. 278(7): p. 1064-1074. Lyssiotis, C., et al., Abstract A51: Oncogenic Kras is required for pancreatic tumor maintenance through the regulation of anabolic glucose metabolism. Cancer Research, 2012. 72(14 Supplement): p. A51-A51. The Biological Significance and Regulatory Mechanism of c-Myc Binding Protein 1 (MBP-1). International journal of molecular sciences, 2018. Gimenes, F., et al., Simultaneous detection of human papillomavirus integration and c-MYC gene amplification in cervical lesions: an emerging marker for the risk to progression. Archives of Gynecology & Obstetrics, 2016. 293(4): p. 857-863. Zhao, W.H., et al., c-myc Gene Copy Number Variation in Cervical Exfoliated Cells Detected on Fluorescence in situ Hybridization for Cervical Cancer Screening. Gynecol Obstet Invest, 2016. 81(5): p. 416. Shou-Heng, et al., [The Expression and Significance of c-myc and bcat1 in Cervical Cancer]. Sichuan da xue xue bao. Yi xue ban = Journal of Sichuan University. Medical science edition, 2018. 49(5): p. 725-730. Cancemi, P., et al., Expression of Alpha-Enolase (ENO1), Myc Promoter-Binding Protein-1 (MBP-1) and Matrix Metalloproteinases (MMP-2 and MMP-9) Reflect the Nature and Aggressiveness of Breast Tumors. International Journal of Molecular Sciences, 2019. 20(16): p. 3952-. Wang, X., et al., Effect of a synthetic inhibitor of urokinase plasminogen activator on the migration and invasion of human cervical cancer cells in vitro. Molecular Medicine Reports, 2018. Lin, Y.H., et al., An enolase inhibitor for the targeted treatment of ENO1-deleted cancers. Nature Metabolism, 2020: p. 1-14. Paola, et al., Vaccination With Prolongs Survival of Genetically Engineered Mice With Pancreatic Cancer. Gastroenterology, 2013. Taniguchi, D., et al., CD44v9 is associated with epithelial﹎esenchymal transition and poor outcomes in esophageal squamous cell carcinoma. Cancer Medicine, 2018. 7(12). Wang, et al., ADAM12 induces EMT and promotes cell migration, invasion and proliferation in pituitary adenomas via EGFR/ERK signaling pathway. Biomedecine & Pharmacotherapie, 2018. Fan, H., et al., MiR-150 alleviates EMT and cell invasion of colorectal cancer through targeting Gli1. 2017. Gwangwa, M.V., A.M. Joubert, and M.H. Visagie, Crosstalk between the Warburg effect, redox regulation and autophagy induction in tumourigenesis. Cellular & Molecular Biology Letters, 2018. 23(1): p. 20. Chen, L., et al., Silencing transcription factor FOXM1 represses proliferation, migration, and invasion while inducing apoptosis of liver cancer stem cells by regulating the expression of ALDH2. IUBMB Life, 2020. Yang, T., et al., Enolase 1 Regulates Stem Cell-Like Properties in Gastric Cancer Cells by Stimulating Glycolysis. Cell Death & Disease. EMP1 regulates cell proliferation, migration, and stemness in gliomas through PI3K‐AKT signaling and CD44. Journal of Cellular Biochemistry, 2019. 120(10). Capello, M., et al., Targeting the Warburg effect in cancer cells through ENO1 knockdown rescues oxidative phosphorylation and induces growth arrest. Oncotarget, 2016. 7(5): p. 5598-5612. Mboge, M.Y., et al., A non-catalytic function of carbonic anhydrase IX contributes to the glycolytic phenotype and pH regulation in human breast cancer cells. Biochemical Journal, 2019. 476(10): p. BCJ20190177. Li, W., et al., LINC00184 silencing inhibits glycolysis and restores mitochondrial oxidative phosphorylation in esophageal cancer through demethylation of PTEN. EBioMedicine, 2019. 44: p. 298-310. Wilde, L., et al., Metabolic coupling and the Reverse Warburg Effect in cancer: Implications for novel biomarker and anticancer agent development. Seminars in Oncology, 2017: p. 198. Qian, X., et al., Enolase 1 stimulates glycolysis to promote chemoresistance in gastric cancer. Oncotarget, 2017. 8(29): p. 47691-47708. Chen, S., et al., WW domain-binding protein 2 acts as an oncogene by modulating the activity of the glycolytic enzyme ENO1 in glioma. Cell Death & Disease, 2018. 9 (3). Zheng, Y., et al., Inhibition of pyruvate dehydrogenase kinase 1 enhances the anti-cancer effect of EGFR tyrosine kinase inhibitors in non-small cell lung cancer. European Journal of Pharmacology, 2018: p. S0014299918305338-. Additional Declarations No competing interests reported. Supplementary Files dataCellmobility.sav datalacticacid.sav dataCellmobility12h.sav dataCellmobility24h.sav data.MTTcellviability80moi.sav datapyruvatecontent.sav data.MTTcellviability20moi.sav dataMTTcellviability.sav dataanalysis.spv Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4730015","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":341116107,"identity":"00201fc5-f359-4d04-af23-9aa61f3a97ac","order_by":0,"name":"xiaojuan Yang","email":"","orcid":"","institution":"Gansu Provincial Hospital","correspondingAuthor":false,"prefix":"","firstName":"xiaojuan","middleName":"","lastName":"Yang","suffix":""},{"id":341116108,"identity":"0d03b207-a980-4747-a865-f43140b7ac1a","order_by":1,"name":"yuanfeng Gou","email":"","orcid":"","institution":"Shanxi University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"yuanfeng","middleName":"","lastName":"Gou","suffix":""},{"id":341116109,"identity":"58d0d484-8ab1-4b29-8476-2d3f897ff342","order_by":2,"name":"Zhenhao Li","email":"","orcid":"","institution":"Gansu Provincial Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zhenhao","middleName":"","lastName":"Li","suffix":""},{"id":341116110,"identity":"3e30848e-7c50-487c-8f25-a5cbd2c2a956","order_by":3,"name":"Ruzhen Shuai","email":"","orcid":"","institution":"Gansu Provincial Hospital","correspondingAuthor":false,"prefix":"","firstName":"Ruzhen","middleName":"","lastName":"Shuai","suffix":""},{"id":341116111,"identity":"ae63a0d8-d7a3-49ac-b571-39350ebdce93","order_by":4,"name":"Fei Li","email":"","orcid":"","institution":"Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Fei","middleName":"","lastName":"Li","suffix":""},{"id":341116112,"identity":"d4331a99-4d37-4ac7-b7a5-ce777bef28ed","order_by":5,"name":"Xiaqin Huo","email":"","orcid":"","institution":"Gansu Provincial Maternal and Child Health Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xiaqin","middleName":"","lastName":"Huo","suffix":""},{"id":341116113,"identity":"2d98a8ac-81c5-4999-9193-c3df24d0c198","order_by":6,"name":"Na Li","email":"","orcid":"","institution":"Gansu Provincial Maternal and Child Health Hospital","correspondingAuthor":false,"prefix":"","firstName":"Na","middleName":"","lastName":"Li","suffix":""},{"id":341116114,"identity":"95aec43f-c505-4946-af1a-ac7218fef37e","order_by":7,"name":"Yaping Pei","email":"","orcid":"","institution":"Gansu Provincial Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yaping","middleName":"","lastName":"Pei","suffix":""},{"id":341116115,"identity":"899a5213-9747-43b3-a1ca-a34100ed0196","order_by":8,"name":"Xue Han","email":"","orcid":"","institution":"Gansu Provincial Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xue","middleName":"","lastName":"Han","suffix":""},{"id":341116116,"identity":"824184a3-b24d-4039-ba94-7517c519d11f","order_by":9,"name":"peng ning Ran","email":"","orcid":"","institution":"Bai yin First People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"peng","middleName":"ning","lastName":"Ran","suffix":""},{"id":341116117,"identity":"1df1291c-a6ad-45b9-9a09-c93da113a83a","order_by":10,"name":"huiling Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2UlEQVRIiWNgGAWjYBACPmYGNgYGAwseBgb+7x8+GNjYEdTCBtEiAdTCYMY4oyAtmbAWMGKQALHNmHk+HGJsIKiFncfsMU+BhIw5/4K0xzYGB5gZ2A8f3YDfYTzmxjxAh1nOeHDcOMfgDh8DT1raDQJazKRBWgxuHGyQzjF4xswgwWNGrJbDDNIWBocZG4jXcr6NTZqBOC1sZZJzwLbwMBv2GKQlsxHyCz//4W0Sb/7Y2BucP8P44McfGzt+9sPH8GpBAIkEqL3EKQfbd4B4taNgFIyCUTCyAABh5TrgUxSc9gAAAABJRU5ErkJggg==","orcid":"","institution":"Gansu Provincial Hospital","correspondingAuthor":true,"prefix":"","firstName":"huiling","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2024-07-12 11:44:02","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4730015/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4730015/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":63029112,"identity":"70a18374-e909-4c49-a131-689cd932e14f","added_by":"auto","created_at":"2024-08-22 09:04:53","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":91279,"visible":true,"origin":"","legend":"\u003cp\u003ePlasmid extraction results\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4730015/v1/a404c7afba4dea17697359e4.png"},{"id":63029119,"identity":"24c731a0-e3ab-409d-911c-87d258e44e90","added_by":"auto","created_at":"2024-08-22 09:04:53","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":413347,"visible":true,"origin":"","legend":"\u003cp\u003eFluorescence microscopy of AAV293 cells transfected with rAAV-GFP\u003c/p\u003e\n\u003cp\u003eA: bright field, B: fluorescent field\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4730015/v1/7261b550a84bd63bf627d87c.png"},{"id":63030094,"identity":"738c5367-5aea-48dc-adf5-29cd4a3747a2","added_by":"auto","created_at":"2024-08-22 09:12:53","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":236295,"visible":true,"origin":"","legend":"\u003cp\u003eInverted fluorescence microscope observation of AAV293 cells 5 days after transfection with rAAV-GFP\u003c/p\u003e\n\u003cp\u003eA: bright field, B: fluorescent field\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4730015/v1/c1cc230f07be7877ddc75d89.png"},{"id":63029127,"identity":"ff9c21cd-4fc5-4b79-b9cd-e608a0e84831","added_by":"auto","created_at":"2024-08-22 09:04:53","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":83364,"visible":true,"origin":"","legend":"\u003cp\u003erelative proliferation rate of Hela cells incubated with adeno-associated virus with variable region gene of recombinant ENO1 monoclonal antibody for 24h\u003c/p\u003e\n\u003cp\u003e(X̄±S,n=3,\u003cem\u003e* P\u003c/em\u003e\u0026lt;0.05,\u003cem\u003e** P\u003c/em\u003e \u0026lt;0.01,\u003cem\u003e*** P\u003c/em\u003e\u0026lt;0.001)\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4730015/v1/d3ab64de945163a00f99a790.png"},{"id":63029123,"identity":"7cce7997-e431-414c-9a58-aa24d7b5b1aa","added_by":"auto","created_at":"2024-08-22 09:04:53","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":60513,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of adeno-associated virus with variable region gene of recombinant ENO1 monoclonal antibody on extracellular glycolysis level of Hela cells in vitro\u003c/p\u003e\n\u003cp\u003eA. Pyruvate content; B. Lactic acid content\u003c/p\u003e\n\u003cp\u003e(X̄±S,n=3,* P \u0026lt;0.05,** P \u0026lt;0.01,*** P \u0026lt;0.001)\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4730015/v1/830d6c68cb1468cae3153ea7.png"},{"id":63029125,"identity":"55258292-f334-4c44-bcf6-bf5b396a2d02","added_by":"auto","created_at":"2024-08-22 09:04:53","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":333174,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of rAAV-ENO1mAb-5 and rAAV-GFP on migration distance of Hela cells at 6h, 12h and 24h\u003c/p\u003e\n\u003cp\u003e(X̄±S,n=3,* P \u0026lt;0.05,** P \u0026lt;0.01,*** P \u0026lt;0.001)\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4730015/v1/a3ffde41fe7c997562a46b6a.png"},{"id":63030739,"identity":"d0f65183-fe75-4a6f-84ad-e059e0e4eb8a","added_by":"auto","created_at":"2024-08-22 09:20:53","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":76742,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of rAAV-ENO1mAb-5 and rAAV-GFP on migration distance of Hela cells at 6h, 12h and 24h\u003c/p\u003e\n\u003cp\u003e(X̄±S,n=3,* P \u0026lt;0.05,** P \u0026lt;0.01,*** P \u0026lt;0.001)\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-4730015/v1/096f1d0687fe7832e13b4f55.png"},{"id":66546103,"identity":"04c9599c-2d44-4bc9-bd10-d5b0f3ce6bfa","added_by":"auto","created_at":"2024-10-14 08:24:28","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2168972,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4730015/v1/1af84cdf-87e9-4fbb-87ad-7bf339c14d5d.pdf"},{"id":63029114,"identity":"ef8e6a25-a1a8-4dae-89e1-05d494174035","added_by":"auto","created_at":"2024-08-22 09:04:53","extension":"sav","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":816,"visible":true,"origin":"","legend":"","description":"","filename":"dataCellmobility.sav","url":"https://assets-eu.researchsquare.com/files/rs-4730015/v1/36c922ca7df2a81c4e0c857c.sav"},{"id":63030092,"identity":"1b19f08c-b724-47f2-a97a-5e6fb078ccd8","added_by":"auto","created_at":"2024-08-22 09:12:53","extension":"sav","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":848,"visible":true,"origin":"","legend":"","description":"","filename":"datalacticacid.sav","url":"https://assets-eu.researchsquare.com/files/rs-4730015/v1/c309e83eb62da0dc73327421.sav"},{"id":63030737,"identity":"4073bc47-b170-4052-b664-4b8de1fc0117","added_by":"auto","created_at":"2024-08-22 09:20:53","extension":"sav","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":816,"visible":true,"origin":"","legend":"","description":"","filename":"dataCellmobility12h.sav","url":"https://assets-eu.researchsquare.com/files/rs-4730015/v1/e79b221314077f08429f2d90.sav"},{"id":63029116,"identity":"b895b095-7914-4897-a14e-05cd280fce02","added_by":"auto","created_at":"2024-08-22 09:04:53","extension":"sav","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":816,"visible":true,"origin":"","legend":"","description":"","filename":"dataCellmobility24h.sav","url":"https://assets-eu.researchsquare.com/files/rs-4730015/v1/fa63b1fcd6c92652b9fa3d31.sav"},{"id":63030099,"identity":"677619e7-7542-4fb0-a7f3-90f3d792a5b2","added_by":"auto","created_at":"2024-08-22 09:12:53","extension":"sav","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":726,"visible":true,"origin":"","legend":"","description":"","filename":"data.MTTcellviability80moi.sav","url":"https://assets-eu.researchsquare.com/files/rs-4730015/v1/f8605ac4a548918bc3e33a52.sav"},{"id":63029121,"identity":"293e276f-3826-4220-a770-ae388cd83118","added_by":"auto","created_at":"2024-08-22 09:04:53","extension":"sav","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":870,"visible":true,"origin":"","legend":"","description":"","filename":"datapyruvatecontent.sav","url":"https://assets-eu.researchsquare.com/files/rs-4730015/v1/be3d2b1deabfed931558da15.sav"},{"id":63030095,"identity":"db33fd91-eea5-401b-8270-830b1e9112f6","added_by":"auto","created_at":"2024-08-22 09:12:53","extension":"sav","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":726,"visible":true,"origin":"","legend":"","description":"","filename":"data.MTTcellviability20moi.sav","url":"https://assets-eu.researchsquare.com/files/rs-4730015/v1/92efd8b8740862beb0c10a0e.sav"},{"id":63031429,"identity":"002918b4-600c-4097-842f-bc5a5ba6b038","added_by":"auto","created_at":"2024-08-22 09:28:53","extension":"sav","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":742,"visible":true,"origin":"","legend":"","description":"","filename":"dataMTTcellviability.sav","url":"https://assets-eu.researchsquare.com/files/rs-4730015/v1/03a51c681aad650266d783d0.sav"},{"id":63030098,"identity":"412daa1e-2e0f-40d7-a326-fce06c76562a","added_by":"auto","created_at":"2024-08-22 09:12:53","extension":"spv","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":51222,"visible":true,"origin":"","legend":"","description":"","filename":"dataanalysis.spv","url":"https://assets-eu.researchsquare.com/files/rs-4730015/v1/7daf7c1dc5bbc41cae37952b.spv"}],"financialInterests":"No competing interests reported.","formattedTitle":"rAAV-ENO1mAb-5 inhibits cell proliferation and migration by suppressing glycolysis in cervical cancer","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCervical cancer is the fourth most common malignancies of the female genital tract, which seriously threatens the health of women all over the world. According to recent statistical research, there are 569,800 new cases of cervical cancer worldwide every year, and about 314,400 deaths\u003csup\u003e[1]\u003c/sup\u003e. Persistent HPV infection is generally accepted as being the primary cause of cervical cancer, approximately three-quarters of HPV-related cervical cancer cases are caused by HPV-16 and HPV-18 infections\u003csup\u003e[2]\u003c/sup\u003e. At present, the treatments for cervical cancer rely mostly on radical surgery, radiation and concurrent chemoradiotherapy therapy\u003csup\u003e[3]\u003c/sup\u003e. For recurrent and metastatic cervical cancer, the National Comprehensive Cancer Network (NCCN) recommends bevacizumab in conjunction with chemotherapy as the first-line therapy. In addition, immunotherapy presents another solution for cervical cancer treatments\u003csup\u003e[4, 5]\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAberrant glucose metabolism, is one of the hallmarks of human cancer\u003csup\u003e[6]\u003c/sup\u003e. In the 1920s, Otto Warburg discovered that cancer cells undergo glycolysis even in the presence of ample oxygen, also known as Warburg effect\u003csup\u003e[7, 8]\u003c/sup\u003e. The Warburg effect can exert a positive environment for cancer cells to uptake nutrients for proliferation and invasion. In tumor cells, as a glycolytic enzyme, \u0026alpha;-enolase (ENO1) is upregulated and facilitates anaerobic proliferation\u003csup\u003e[9-11]\u003c/sup\u003e. The enolase family contains 4 isoforms: \u0026alpha;-enolase (ENO1), \u0026beta;-enolase (ENO3), \u0026gamma;-enolase (ENO2) and ENO4\u003csup\u003e[12, 13]\u003c/sup\u003e. \u0026alpha;-enolase (ENO1) is ubiquitous and expressed in most tissues, while \u0026gamma;-enolase (ENO2) is primarily expressed in nervous tissue and \u0026beta;-enolase (ENO3) in muscular tissues\u003csup\u003e[14]\u003c/sup\u003e. ENO1 can exert different functions depending on its cell localization.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eENO1 is located on the cell surface, is part of a protein complex, including uPA receptor, integrin, and cytoskeletal proteins, that promotes tumor cell invasion and metastasis. Located in the cytoplasm, it can participate in glycolysis. In addition, ENO1 can also be expressed in the nucleus and bind to c-MyC promoter to negatively regulate c-MYC expression and play an anti-tumor role\u003csup\u003e[13, 14]\u003c/sup\u003e. Studies have shown that ENO1 silencing in tumor cells can further inhibit the migration and invasion of tumor cells by inhibiting glycolysis, thus inhibiting the occurrence and metastasis of tumor, so ENO1 is expected to become an important molecular target for early diagnosis, treatment and prognosis of tumor\u003csup\u003e[15]\u003c/sup\u003e. ENO1 also served as a stimulator of \u0026beta;-catenin.\u003c/p\u003e\n\u003cp\u003eTherefore, it is urgent to find a new treatment for advanced, recurrent or metastatic cervical cancer. Studies have shown that the invasion and metastasis of tumor cells are decreased after silencing glycolythase related genes or inhibiting glycolythase activity. Therefore, inhibition of glycolysis pathway, reduction of energy supply and synthesis of intermediates in tumor cells, has become a new strategy for anti-tumor therapy in recent years\u003csup\u003e[11]\u003c/sup\u003e. Studies have reported that inhibition or silencing of glycolysis can inhibit the growth of tumor cells, but gene silencing technology has not been widely applied in clinical practice, and glycolysis inhibitors such as hexokinase inhibitor (3-BrPA) have great side effects, so they have not been widely applied in clinical practice\u003csup\u003e\u0026nbsp;\u003c/sup\u003e\u003csup\u003e[12]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eENO1 is a multifunctional protein whose function is related to cell localization. ENO1, \u0026nbsp;In recent years, gene therapy technology has achieved significant clinical efficacy. Our research group constructed eukaryotic expression vector and prepared ENO1 monoclonal antibody (ENO1 mAb). In vitro study, ENO1 mAb was found to inhibit the invasion and migration of cervical cancer cells. However, mAb has large molecular weight and impermeable membrane properties. Compared with mAb, variable region gene sequence has the characteristics of low molecular weight, low immunogenicity and high tumor penetration. To overcome this shortcoming, we selected the variable regions of heavy and light chains of ENO1 monoabs with low molecular weight, low immunogenicity and high tumor penetration\u003csup\u003e[16]\u003c/sup\u003e,and used the adeno-associated virus(AAV)\u0026nbsp;to package the variable regions of ENO1 antibody to target into cervical cancer cells and specifically bind intracellular ENO1 to play an anti-tumor role.\u003c/p\u003e\n\u003cp\u003eIn this study, ENO1 mAb prepared by H5 hybridoma cell line was selected for further study. The variable region genes of ENO1 monoclonal antibody were fenced from the RNA of hybridoma cells (ENO1-H5) using universal primers. After the correct sequence was confirmed, The variable region gene of ENO1 monoclonal antibody was packaged into AAV293 cells to construct rAAV-ENO1mAb-5, which was inserted into the variable region expressing ENO1 monoclonal antibody in Hela cells of cervical cancer. The inhibitory effect of rAAV-ENO1mAb-5 on glycolysis of cervical cancer cells and its anti-cervical cancer effect were studied in vitro.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eSequencing results of variable region genes in hybridoma cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe heavy chain variable region genes and light chain variable region genes of ENO1 monoclonal antibody were amplified by 5 \u0026apos;-RACE method. The variable region genes of ENO1 monoclonal antibody were sequenced successfully.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAAV packages ENO1 monoclonal antibody variable region genes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConstruction and extraction results of adeno-associated virus associated plasmid (Figure 1). The concentrations were all greater than 1\u0026mu;g/\u0026mu;l, and A 260/280 were in the range of 1.8-2.0, which could be used to package viruses.\u003c/p\u003e\n\u003cp\u003eThe transfection results of AAV293 cell culture are shown in the figure below (Figure 2). AAV293 cells are polygonal cells with adherent growth and relatively uniform size. The results showed that the transfection was successful and the transfection efficiency reached 90%.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults of titer determination of recombinant adeno-associated virus\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe titer was measured by TCID50 method, and the cell state was observed after 5 days of culture at 37℃ with 5%CO\u003csub\u003e2\u003c/sub\u003e. The fluorescence of the cells was observed by an inverted fluorescence microscope, and the fluorescence results of the 96-well plate showed that 3-4 fluorescence displays were observed in each well at the viral dilution of 1:108, and 1 fluorescence display was observed in each well of 4 Wells at the viral dilution of 1:10 (Figure 3). The titers of\u0026nbsp;rAAV-GFP\u0026nbsp;and\u0026nbsp;rAAV-ENO1mAb-5\u0026nbsp;obtained by TCID50 method were 2.0\u0026times;10\u003csup\u003e7\u003c/sup\u003e PFU/ ml.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProliferation inhibition of adeno-associated virus with variable region genes of recombinant ENO1 monoclonal antibody\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMTT assay was used to detect the inhibitory effect of adeno-associated virus with variable region gene of recombinant ENO1 monoclonal antibody on Hela cell proliferation. As shown in Figure 4, with the increase of MOI, when the MOI value of\u0026nbsp;rAAV-ENO1mAb-5\u0026nbsp;reached 80MOI (Table 2), the proliferation rate of Hela cells were (48.38\u0026plusmn;3.94) %, which was significantly different from that of the empty vector control group (rAAV-GFP) and PBS group (P\u0026lt;0.001).\u0026nbsp;rAAV-GFP\u0026nbsp;did not inhibit the proliferation of Hela cells. Therefore, these results suggestted that\u0026nbsp;rAAV-ENO1mAb-5\u0026nbsp;can cross the cell membrane and inhibit tumor cell proliferation.\u003c/p\u003e\n\u003cp\u003eTable 2\u0026nbsp;relative proliferation rate of Hela cells incubated with adeno-associated virus with variable region gene of recombinant ENO1 monoclonal antibody for 24h (n=3, X\u0026plusmn;S)\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"508\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.244094488188978%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.787401574803148%\" valign=\"top\"\u003e\n \u003cp\u003erAAV-ENO1mAb-5\u003c/p\u003e\n \u003cp\u003e(X̄\u0026plusmn;S )\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.46456692913386%\" valign=\"top\"\u003e\n \u003cp\u003erAAV-GFP\u003c/p\u003e\n \u003cp\u003e(X̄\u0026plusmn;S )\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.503937007874015%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.244094488188978%\" valign=\"top\"\u003e\n \u003cp\u003e1MOI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.787401574803148%\" valign=\"top\"\u003e\n \u003cp\u003e(131.40\u0026plusmn;3.10)%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.46456692913386%\" valign=\"top\"\u003e\n \u003cp\u003e(174.83\u0026plusmn;3.33)%\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.503937007874015%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt;0.01\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.244094488188978%\" valign=\"top\"\u003e\n \u003cp\u003e20MOI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.787401574803148%\" valign=\"top\"\u003e\n \u003cp\u003e(68.13\u0026plusmn;6.64)%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.46456692913386%\" valign=\"top\"\u003e\n \u003cp\u003e(106.38\u0026plusmn;6.64)%\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.503937007874015%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt;0.001\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.244094488188978%\" valign=\"top\"\u003e\n \u003cp\u003e80MOI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.787401574803148%\" valign=\"top\"\u003e\n \u003cp\u003e(48.38\u0026plusmn;3.94)%\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.46456692913386%\" valign=\"top\"\u003e\n \u003cp\u003e(108.57\u0026plusmn;3.29)%\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.503937007874015%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eInhibition of glycolysis in Hela cells by adeno-associated virus with variable region gene of recombinant ENO1 monoclonal antibody in vitro\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter adeno-associated virus mediated ENO1mAb variable region gene enters cervical cancer cells, it may inhibit ENO1 activity in the cytoplasm. We used a glycolysis kit to investigate the effect of adeno-associated virus with variable region gene of recombinant ENO1 monoclonal antibody on glycolysis level of Hela cells.\u0026nbsp;3-BrPA\u0026nbsp;is a pyruvate analogue that inhibits key glycolysis enzymes including hexokinase II.3-BrPA\u0026nbsp;has strong cytotoxic activity against most cancer cells and is a promising candidate for anticancer drugs\u003csup\u003e[17]\u003c/sup\u003e. In this study, 3-BrPA was used as a positive control. As shown in Figure 5, When rAAV-ENO1mAb-5 was co-incubated with Hela cells for 24h, the pyruvate content of glycolysis product in rAAV-ENO1mAb-5 and 3-BrPA groups were 0.15\u0026plusmn;0.002 \u0026mu;mol/mL and 0.13\u0026plusmn;0.005 \u0026mu;mol/mL, respectively. Compared with the negative control group (0.34\u0026plusmn;0.03) \u0026mu;mol/mL (P\u0026lt; 0.001), in addition, rAAV-ENO1mAb-5 group and rAAV-GFP group had statistical differences (P\u0026lt;0.05). The 24h lactate content of rAAV-ENO1mAb-5 and 3-BrPA groups were 7.39\u0026plusmn;0.08 mmol/gprot and 4.28\u0026plusmn;0.12mmol/gprot, respectively, which were significantly different from that of negative control group (14.48\u0026plusmn;0.41) mmol/gprot (P\u0026lt;0.01). Therefore, these results suggestted that rAAV-ENO1mAb-5 could enter the variable region of ENO1 antibody expression in Hela cells and significantly inhibitted glycolysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of adeno-associated virus with variable region gene of recombinant ENO1 monoclonal antibody on Hela cell migration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere is increasing evidence that metabolism is the main driver of tumor metastasis. Once glycolysis is inhibited, it would lead to a reduced extracellular acidification, which affects the invasion and migration of tumor cells\u003csup\u003e[18]\u003c/sup\u003e.Therefore, we evaluated the effects of adeno-associated virus with the variable region gene of recombinant ENO1 monoclonal antibody on Hela cells migration by wound healing assay. The results showed that when the recombinant adeno-associated virus was co-incubated with Hela cells for 6h, the mobility of Hela cells in rAAV-ENO1mAb-5 group was (1.77\u0026plusmn;0.87) %. Compared with the no-load control group (rAAV-GFP group) (7.26\u0026plusmn;0.81) % and the negative control group (PBS group) (10.49\u0026plusmn;2.95) %, there were statistically significant differences (P \u0026lt;0.01), but there was almost no migration inhibition in rAAV-GFP group and PBS group (P \u0026gt;0.01). The results of cell scratches at 24h were consistent with those at 6h and 12h(Figure 6 and Figure7).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eCervical cancer is one of the most common malignant tumors of female reproductive tract. In recent years, blocking the energy metabolism of tumor cells may become a new strategy for the treatment of cervical cancer. ENO1 is one of the rate-limiting enzymes of glycolysis and is closely related to the occurrence and development of various tumors. In order to overcome the disadvantages of ENO1mAb\u0026apos;s large molecular weight and weak tissue penetration, the variable region genes of selected ENO1 monoclonal antibody were sequenced in this study to determine the correct sequence. The variable region gene of ENO1 monoclonal antibody was used to prepare rAAV-ENO1mAb-5 by using AAV\u0026apos;s ability to infect cells. After purification and concentration, rAAV-ENO1mAb-5 with high titer was obtained, and its therapeutic effects were observed in vitro. In our study, we found that rAAV-ENO1mAb-5 can target into cervical cancer Hela cells and make it enter the variable region of ENO1 antibody expression in cells, thereby inhibiting the glycolysis, migration and proliferation of cervical cancer cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e1. Inhibition of glycolysis by adeno-associated virus with variable region gene of recombinant ENO1 monoclonal antibody\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eENO1 is a multifunctional protein whose functions are related to cell localization. Studies have shown that ENO1 expressed in cytoplasm mainly participates in the glycolysis pathway as a glycolysis rate-limiting enzyme, inhibited its activity and reduced the glycolysis rate, thus inhibited the growth of tumor cells. In this study,\u0026nbsp;rAAV-ENO1mAb-5\u0026nbsp;induced the variable region of ENO1 monoclonal antibody into Hela cells by viral infection to cervical cancer cells, and was expressed in Hela cells, thereby inhibiting glycolysis of Hela cells by inhibiting ENO1 activity. After the application of\u0026nbsp;rAAV-ENO1mAb-5, the contents of pyruvate and lactic acid\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;of glycolytic products were significantly decreased. It was proved that rAAV-ENO1mAb-5 could directly inhibited the activity of glycolytic enzyme ENO1 through specific binding of antibody variable region cytoplasmic ENO1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2. Study on the anti-cervical cancer effect of adeno-associated virus with variable region gene of recombinant ENO1 monoclonal antibody\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWarburg effect is a key factor in tumor cells growth. compared with healthy cells, in order to meet the energy and substances required for the rapid metabolism of cell proliferation, even under aerobic conditions, tumor cells still use glycolysis to produce nucleic acids, proteins and lipids and other precursors\u003csup\u003e[19, 20]\u003c/sup\u003e,the high metabolic demand and the accumulation of H+ in the tumor microenvironment maintain the acidic microenvironment of tumor cells, which can promote the rapid proliferation and distant metastasis of tumor cells\u003csup\u003e[21]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eStudies have shown that inhibition of glycolysis is crucial to tumor proliferation, invasion and metastasis\u003csup\u003e[13]\u003c/sup\u003e. Therefore, inhibition of glycolytic enzyme is a very promising method for anticancer therapy, and targeted inhibition of glycolytic pathway has become a hot treatment for cancer in recent years\u003csup\u003e[22]\u003c/sup\u003e.Yi et al found that silencing pyruvate kinase isoenzyme 2 (PKM2) during glycolysis can inhibit ovarian cancer glycolysis and significantly inhibit cell proliferation, migration and invasion\u003csup\u003e[23]\u003c/sup\u003e. Song et al found that targeted ENO1 inhibitor (ENO1i) can specifically enhance the activity of NK cells against autologous tumor cells and improve the prognosis of patients with multiple myeloma\u003csup\u003e[24]\u003c/sup\u003e. Lin et al selectively killed eno1-deficient glioma cells with an ENO1 inhibitor (POMHEX)\u003csup\u003e[15]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eIn this study, we prepared adeno-associated virus with variable region gene of recombinant ENO1 monoclonal antibody. MTT assay showed that rAAV-GFP (empty vector control group) had no significant inhibitory effect on the proliferation of Hela cells, while when the MOI value of\u0026nbsp;rAAV-ENO1mAb-5\u0026nbsp;reached 80, the relative proliferation rate of Hela cells decreased significantly. The results showed that\u0026nbsp;rAAV-ENO1mAb-5\u0026nbsp;could cross cell membrane and inhibited the proliferation of tumor cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(1) rAAV-ENO1mAb-5 inhibited the proliferation of cervical cancer cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eENO1 is a multifunctional protein, mainly acting as enzyme and plasminogen receptor, playing a crucial role in tumor proliferation, metastasis and diffusion\u003csup\u003e[25]\u003c/sup\u003e. Its enzymological function is to participate in pyruvate synthesis through glycolysis pathway, and to participate in the maintenance of \u0026quot;aerobic glycolysis\u0026quot; in tumor ENO1\u003csup\u003e[26]\u003c/sup\u003e.It also acts as a c-myc promoter binding protein (MBP-1) in the nucleus and binds to the c-myc P2 promoter as a transcription inhibitor\u003csup\u003e[27]\u003c/sup\u003e. Similar to ENO1, MBP-1 inhibits the formation, migration and invasion of cell colonies by regulating the expression of \u0026nbsp;c-Myc, COX-2 and other genes in vertebrates\u003csup\u003e[28]\u003c/sup\u003e.Studies have shown that HPV integration and c-myc gene amplification by FISH can be used in clinical practice as a useful auxiliary screening method for the early diagnosis of progression of squamous intraepithelial diseases, and c-myc gene can be a new molecular biomarker for the early diagnosis of progression of cervical diseases\u003csup\u003e[29, 30]\u003c/sup\u003e.Wu etal. retrospectively analyzed cervical cancer tissues by immunohistochemistry and found that high expression of c-Myc gene can promote the invasion and metastasis of cervical cancer cells\u003csup\u003e[31]\u003c/sup\u003e. Therefore, the entry of rAAV-ENO1mAb-5 into the cytoplasm inhibited the proliferation of tumor cells. Besides inhibiting glycolysis, the mechanism may also be related to MBP-1 expression, which needs further experimental verification.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(2) rAAV-ENO1mAb-5 inhibited invasion and metastasis of cervical cancer cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOn the surface of tumor cells, ENO1 induces invasion and metastasis by mediating plasminase activation and extracellular matrix degradation. Our scratch test showed that rAAV-ENO1mAb-5 significantly reduced the migration ability of Hela cells, indicated that rAAV-ENO1mAb-5 blocked the binding of ENO1 to plasminogen by binding to ENO1 on the surface of cell membrane, inhibited the activation of the plasminogen system, and \u0026nbsp;then \u0026nbsp;inhibited the invasion and metastasis of tumor cells.\u003c/p\u003e\n\u003cp\u003eWang et al found that ENO1 silencing reduced the invasion and migration ability of pancreatic duct cells, and ENO1 surface blocking by monoclonal antibody could effectively inhibit the proliferation and accumulation of myeloid cells in the primary tumor of pancreatic cancer and inhibit the anti-tumor response\u003csup\u003e[32\u003c/sup\u003e].Cappello et al found that T cells of pancreatic cancer patients also recognize ENO1, and ENO1 DNA inoculated mice with pancreatic cancer can effectively delay the invasion of pancreatic cancer cells, delay tumor development and significantly prolong the survival of mice\u003csup\u003e[33]\u003c/sup\u003e. At the same time, studies have found that monoclonal antibody surface blocking ENO1 can effectively inhibit the proliferation of pancreatic cancer in primary tumors and the accumulation of myeloid cells, and inhibit the anti-tumor response\u003csup\u003e[34]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eEMT is the mechanism of tumor invasion and metastasis\u003csup\u003e[35]\u003c/sup\u003e. Taniguchi et al found that CD44v9 expression induced EMT of esophageal squamous cell carcinoma by transforming growth factor-\u0026beta;. In addition, inhibition of CD44v9 expression reduced the migration and invasiveness of esophageal squamous cell carcinoma\u003csup\u003e[36]\u003c/sup\u003e.Overexpression of ADAM12(a kind of deintegrin and metalloproteinase) is related to tumor invasion of pituitary adenoma. Wang et al silencing ADAM12 in pituitary adenoma cells can significantly inhibit EMT process and inhibit cell migration, invasion and proliferation\u003csup\u003e[37]\u003c/sup\u003e. Therefore, rAAV-ENO1mAb-5 prepared by us can inhibit the migration of cervical cancer Hela cells, and the mechanism may be related to EMT.\u003c/p\u003e\n\u003cp\u003eCancer stem cells (CSCs) have the function of self-renewal, infinite proliferation and multidirectional differentiation. Most CSCs exhibit enhanced Warburg effect to maintain tumor cell dryness\u003csup\u003e[38]\u003c/sup\u003e.CD44 can be used as a marker of cancer stem cells, which are associated with epithelial-mesenchymal transformation (EMT) in cancer. Wang et al found that membrane protein EMP1 promotes invasion, migration and dry acquisition of glioma cells by inhibiting the PI3K-AKT signaling pathway and the potential mechanism of CD44 activation.FOXM1 is highly expressed in CD133 CD24 Huh-7 cells\u003csup\u003e[39]\u003c/sup\u003e. Chen et al found that silencing FOXM1 inhibits the proliferation, migration, invasion and EMT of HCC stem cells\u003csup\u003e[40]\u003c/sup\u003e. Yang et al found that ENO1 can enhance stem-like features of gastric cancer, including self-renewal ability, cell invasion, migration and tumorigenicity\u003csup\u003e[41]\u003c/sup\u003e. Therefore, the mechanism by which rAAV-ENO1mAb-5 reduces Hela cell migration may be related to tumor cell dryness.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(3) ENO1 participates in multiple signaling pathways to promote proliferation, invasion and metastasis of cervical cancer cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eENO1 is involved in tumor development through a variety of signaling pathways. Chen et al found that ENO1 promotes glioma glycolysis activity, cell proliferation and migration through the PI3K/AKT pathway\u003csup\u003e[42]\u003c/sup\u003e. Zhan et al found that ENO1 overexpressed can promote the proliferation, invasion and migration of colon cancer cells in vitro, and promote tumor formation and metastasis in vivo, and its mechanism is related to AMPK/mTOR signaling pathway\u003csup\u003e[43]\u003c/sup\u003e. Therefore, whether the anti-tumor effect of rAAV-ENO1mAb-5 in vitro is related to the signaling pathway needs further experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(3) rAAV-ENO1mAb-5 can play a synergistic antitumor effect in combination with other drugs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(1) Target dual metabolic phenotype\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe anti-cervical cancer effect of rAAV-ENO1mAb-5 is associated with a variety of mechanisms. The main mechanism is that the variable region gene of ENO1 monoclonal antibody targets into cervical cancer Hela cells and inhibits the glycolysis pathway, that is, inhibits the activation of the fibrinolytic system, and thus inhibits the occurrence and development of cervical cancer cells and tumor cells invasion and metastasis, and may also be regulated by MBP-1. EMT and the acquisition of tumor cell dryness.\u003c/p\u003e\n\u003cp\u003eStudies have found that the growth of tumor cells mainly depends on glycolysis to provide the required energy, and the environment for tumor growth is usually acidic microenvironment. Excessive lactic acid and H+ excretion will intensify extracellular acidification and further inhibit glycolysis\u003csup\u003e[44]\u003c/sup\u003e.Tumor cells have a bimetabolic phenotype, that is, a biphasic transformation between aerobic glycolysis and non-glycolysis to meet the needs of tumor metabolism. Li et al found that silencing long intergene non-protein-coding RNA 184 (LINC00184) can inhibit the proliferation, migration, invasion and colony formation of esophageal cancer cells, but restoring mitochondrial OXPHOS can promote the survival of esophageal cancer cells, and double inhibition can inhibit the growth of tumor cells\u003csup\u003e[45]\u003c/sup\u003e. Therefore, targeting the dual metabolic phenotype of tumor cells may more effectively block the production pathway of tumor cells, and then block the growth of tumor cells, which may be a new strategy for tumor treatment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(2) Targeting tumor-matrix metabolic coupling\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMetabolic plasticity allows tumor cells to switch between glycolysis and OXPHOS. Metabolic phenotype metabolic heterogeneity is a characteristic of tumors. Some tumor cells maintain a glycolysis phenotype, while some tumor cells primarily utilize OXPHOS. The \u0026quot;anti-Warburg effect\u0026quot; describes the metabolic support of adjacent cancer cells by glycolysis in the stroma associated with cancer. The transfer of such metabolites induces matrix-cancer metabolic coupling, produces ATP, promotes tumor cell proliferation and inhibits apoptosis\u003csup\u003e[46]\u003c/sup\u003e.Therefore, targeting tumor-matrix metabolic coupling may be a therapeutic target for cancer.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(3) rAAV-ENO1mAb-5\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ecombined with radiotherapy and chemotherapy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTumor cells have metabolic heterogeneity, and metabolic reprogramming can occur to promote tumor cell survival. Therefore, targeting glycolysis may be a more effective therapeutic strategy. In this study, adeno-associated virus with variable region gene of ENO1 monoclonal antibody was used to study its antitumor effect on cervical cancer Hela cells. Studies have shown that\u0026nbsp;rAAV-ENO1mAb-5\u0026nbsp;can exert glycolytic inhibition through the specific binding of cytoplasmic ENO1 in the variable region of antibody, and then inhibit the proliferation and migration of Hela cells, inhibit the energy supply of tumor cells, and induce the apoptosis of tumor cells. Qian et al found that ENO1 expression increased in cisplatin-resistant gastric cancer cells, and metabolic reprogramming of cisplatin-resistant cells showed increased glycolysis dependence, and inhibition of glycolysis by 2-DG could significantly reverse drug resistance\u003csup\u003e[47]\u003c/sup\u003e.At the same time, several literatures have reported that glycolysis inhibitors can enhance the sensitivity of chemotherapy\u003csup\u003e[48, 49]\u003c/sup\u003e, so the combination of\u0026nbsp;rAAV-ENO1mAb-5\u0026nbsp;and chemotherapy may be a strategy for the treatment of cervical cancer. In addition, the antitumor effects of\u0026nbsp;rAAV-ENO1mAb-5\u0026nbsp;in vitro may involve EMT, tumor cell stem and a variety of signaling pathways, so its mechanism of action needs to be further studied to provide new targets and laboratory evidence for the treatment of advanced, recurrent and metastatic cervical cancer.\u003c/p\u003e\n\u003cp\u003eIn conclusion,\u0026nbsp;rAAV-ENO1mAb-5\u0026nbsp;can block the highly expressed plasminogen receptor on the cell membrane of cervical cancer cells and inhibit the migration and invasion of tumor cells. In addition,\u0026nbsp;rAAV-ENO1mAb-5\u0026nbsp;can mediate the entry of ENO1 variable region genes into the cytoplasm and inhibit glycolysis, which helps to reduce the proliferation of cervical cancer cells. The \u003cem\u003ein vivo\u003c/em\u003e antitumor effect of ENO1mAb needs to be further studied.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cstrong\u003eMaterials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe hybridoma cell lines H1-H5 were prepared by AtaGenix Laboratories (Wuhan, China) and stored in Lanzhou University (Lanzhou, China). Hybridoma cell line H1-H5 was prepared and stored in AtaGenix Laboratory(Wuhan, China).\u0026nbsp;The human cervical cancer cell line Hela was provided by the Institute of Pathogen Biology, School of Basic Medical Sciences, Lanzhou University\u0026nbsp;(Lanzhou, China).\u0026nbsp;The plasmid\u0026nbsp;AAV-ENO1mAb-5\u0026nbsp;and adeno-associated virus vector system were purchased from BGI and stored in Lanzhou University (Lanzhou, China).DMEM medium was obtained from Thermo Fisher Scientific (USA). The test kits of lactic acid, pyruvate, glucose and ATP were from Nanjing Jian cheng Biological Co., Ltd (Nanjing, China).\u003c/p\u003e\n\u003cp\u003e3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and bicinchoninic acid (BCA) protein assay kit were from Beijing Solarbio Technology Co., Ltd (Beijing, China). Cell culture plates and bottles were from Corning Biological Co., Ltd (USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eENO1 monoclonal antibody variable region gene sequencing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOn the basis of previous laboratory work, the variable region genes of ENO1 monoclonal antibody were obtained from RNA of ENO1 hybridoma H5 cell lines (ENO1-H5) using primer sequences (Table 1), and the obtained variable region genes of antibody were sequenced. (Synthesized by BGI and verified by sequencing).\u003c/p\u003e\n\u003cp\u003eTable 1 Primer sequences\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.07233273056058%\" valign=\"top\"\u003e\n \u003cp\u003egene\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"79.92766726943943%\" valign=\"top\"\u003e\n \u003cp\u003ePrimer sequences\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.07233273056058%\" valign=\"top\"\u003e\n \u003cp\u003eHeavy chain R\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"79.92766726943943%\" valign=\"top\"\u003e\n \u003cp\u003eGATTACGCCAAGCTTGCTGGACAGGGATCCAGAGTTCC\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.07233273056058%\" valign=\"top\"\u003e\n \u003cp\u003eLight chain R \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"79.92766726943943%\" valign=\"top\"\u003e\n \u003cp\u003eGATTACGCCAAGCTTCACGACTGAGGCACCTCCAGATGTTAACTG\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eAAV vector packages ENO1 monoclonal antibody variable region genes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(1) Construction and extraction of adeno-associated virus related plasmids\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe variable region sequences of light chain and heavy chain of ENO1 monoclonal antibody H5, which can significantly inhibit the migration and invasion of cervical cancer cells, were selected as the restriction sites Xba I and Hind III, and Linker--(GGGGS)3 was used in the middle, and cloned into\u0026nbsp;pAAV2-MCS\u0026nbsp;vector (synthesized by Huada Company). AAV-ENO1mAb-5 plasmid was obtained.\u0026nbsp;AAV-ENO1mAb-5\u0026nbsp;and AAV-assisted\u0026nbsp;pHelPer\u0026nbsp;and\u0026nbsp;pAAV-RC\u0026nbsp;were inoculated in 200ml LB liquid medium (including Amp+) for bacterial expansion. Then a large amount of extraction were performed with endotoxin-free plasmid extraction kit. The concentration was determined to be greater than 1\u0026mu;g/\u0026mu;l. A260/280 can be used to package viruses between 1.8-2.0.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(2) Cell preparation and transfection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAAV293 cells at logarithmic growth stage were placed in a 10cm dish with 1\u0026times;10\u003csup\u003e6\u0026nbsp;\u003c/sup\u003ecells. DMEM medium containing 10% fetal bovine serum were added and incubated at 37℃ with 5%CO\u003csub\u003e2\u003c/sub\u003e. Transfection was performed after the cell adhesion reached 70% coverage.. \u0026nbsp;Discard the medium and washed the petri dish with 1\u0026times;PBS for 3 times before transfection 1-2 hours, and added serum-free DMEM medium. \u0026nbsp;Then, the plasmids were transfected according to the specific steps of PEI transfection kit. At the same time,pAAV-IRES-ZsGreen5 with green fluorescent protein was transferred into AAV293 cells as empty vector control (rAAV-GFP).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(3) Collection and concentration of recombinant adeno-associated virus\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e48h after transfection, the supernatant and the transfected cells were centrifuged at 1000rpm for 3min, and the supernatant and cell precipitation were separated. The cell precipitation suspended in 1mL 1\u0026times;PBS were frozen and thawed repeatedly in a liquid nitrogen bath at 37℃\u0026nbsp;for 4 times. Then centrifuged at 10,000 RPM for 5 min. Then the supernatant was collected and sterilized with a 0.45\u0026mu;m filter.1 M NaCl,10%PEG 8000\u0026nbsp;solution: the supernatant was pressed by 1: 2 volume ratio were added into the supernatant collection tube, mixed and centrifuged at 12,000 RPM for 120min at 4℃ overnight, dissolved with an appropriate amount of 1\u0026times;PBS, then filtered with a 0.22\u0026mu;m filter to collect the virus precipitates.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(4) Titer determination of recombinant adeno-associated virus\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAAV293 cells at the logarithmic growth stage were laid in 96-well plates with 1\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells per well, incubated at 37℃ with 5%CO\u003csub\u003e2\u003c/sub\u003e. When the cell growth rate reached more than 80%, the culture medium was sucked and discarded. Then, a DMEM medium containing 5% FBS (called maintenance solution) were \u0026nbsp;prepared, and the recombinant adeno-associated virus diluted by maintenance solution was added to the 96-well plate from left to right (the dilution of virus from left to right was 1:10\u003csup\u003e1\u003c/sup\u003e, 1:10\u003csup\u003e2\u003c/sup\u003e...\u0026nbsp;1:10\u003csup\u003e11\u003c/sup\u003e), At the same dilution gradient, The same dilution gradient was set with 3 multiple holes, and maintenance solution was added to 3 more double holes as negative control. Culture were \u0026nbsp;continued at 5%CO\u003csub\u003e2\u003c/sub\u003e and 37℃, and cell fluorescence was observed with inverted fluorescence microscope.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCytotoxicity test\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHela cells in logarithmic phase\u0026nbsp;were plated in 96-well culture plates with a density of\u0026nbsp;5\u0026times;10\u003csup\u003e3\u003c/sup\u003e\u003csup\u003e\u0026nbsp;\u003c/sup\u003ecells\u003csup\u003e\u0026nbsp;\u003c/sup\u003eper well, and incubated overnight at 37\u0026nbsp;℃\u0026nbsp;with 5 % CO\u003csub\u003e2.\u003c/sub\u003e\u003c/p\u003e\n\u003cp\u003eThe cells were slowly washed with PBS for 3 times after the medium was discarded, and the concentrated recombinant adeno-associated virus (rAAV-ENO1mAb-5、rAAV-GFP) with different MOI gradients were added to the cells for further incubation for 24h and 48h. Then 20\u0026mu;l MTT solution was added, incubated at 37℃\u0026nbsp;with 5%CO2 for 4h, and 150\u0026mu;l DMSO solution was added to each well.\u0026nbsp;Absorbance was measured at 490 nm using a microplate reader.\u0026nbsp;Untreated cells were taken as a negative control with 100 % viability and cells without addition of MTT were used as blank to calibrate the spectrophotometer to zero absorbance. Cell survival rate was calculated: cell survival rate = (experimental group OD- blank group OD) / (control group OD- blank group OD)\u0026nbsp;\u0026acute;100 %. The inhibitory effect on Hela cells proliferation was analyzed.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInhibition of glycolysis in vitro\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e1\u0026times;10\u003csup\u003e6\u003c/sup\u003e Hela cells per well were laid on 6-well plates, incubated at 37℃ with 5%CO\u003csub\u003e2\u003c/sub\u003e. \u0026nbsp;The recombinant adeno-associated disease venom and\u0026nbsp;3-BrPA\u0026nbsp;prepared with phenol-free red DMEM medium and 10% FBS were added, respectively. Each group \u0026nbsp;had 3 compound holes, and the supernatant were collected and cultured 24 hours later. The content of lactic acid and pyruvate in supernatant was determined according to the instructions of lactic acid kit and pyruvate kit, respectively. Total protein was extracted and the concentration was determined by BCA protein assay kit.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA test of wound healing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLaied 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e Hela cells in each well on 6-well plates, incubated overnight at 37℃ with 5%CO\u003csub\u003e2\u0026nbsp;\u003c/sub\u003euntil the cells were completely lined at the bottom of the well and adhered to the wall. Draw a straight line perpendicular to the 6-well plate with the tip of 10\u0026mu;l sterile pipette gun. Then the shed cells were washed with 1\u0026times;PBS for 3 times, and serum-free DMEM medium was added, and then\u0026nbsp;rAAV-ENO1mAb-5\u0026nbsp;and\u0026nbsp;rAAV-GFP\u0026nbsp;were added respectively. Another PBS group was set with 3 compound holes in each group. The cells were incubated at 37℃ with 5%CO\u003csub\u003e2.\u003c/sub\u003e The movement of cells into the wound area was observed with an inverted microscope and photographed within 24 hours. Image J software was used to calculate the scratch area and analyze the average mobility.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments were repeated at least three times.\u0026nbsp;The experimental data were expressed as mean \u0026plusmn; SEM\u0026nbsp;(X\u0026plusmn;S). Statistical analysis was performed using SPSS statistical package (SPSS 25.0)..\u0026nbsp;Differences between two groups were analyzed by Student\u0026rsquo;s \u003cem\u003et\u0026nbsp;\u003c/em\u003etest. and one-way variance (ANOVA) was used for comparison of multiple groups after homogeneity of variance test. With \u0026alpha;=0.05 as the test level, P\u0026lt;0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunds\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cul type=\"disc\"\u003e\n \u003cli\u003eNational Natural Science Foundation of China, 82260557\u003c/li\u003e\n \u003cli\u003eGansu Province Science Foundation for Youths, 22JR11RA245\u003c/li\u003e\n\u003c/ul\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLancet, T., GLOBOCAN 2018: counting the toll of cancer. Lancet, 2018. 392(10152).\u003c/li\u003e\n\u003cli\u003eSun, L., et al., Alpha-enolase promotes gastric cancer cell proliferation and metastasis via regulating AKT signaling pathway. European Journal of Pharmacology, 2018.\u003c/li\u003e\n\u003cli\u003eJi, M., et al., Up-regulated ENO1 promotes the bladder cancer cell growth and proliferation via regulating \u0026beta;-catenin. Bioscience Reports, 2019. 39(9).\u003c/li\u003e\n\u003cli\u003eLiu, Y., et al., PD-1/PD-L1 Inhibitors in Cervical Cancer. Frontiers in Pharmacology, 2019. 10.\u003c/li\u003e\n\u003cli\u003eMoreno-Acosta, P., et al., Persistent High-Risk HPV Infection and Molecular Changes Related to the Development of Cervical Cancer. Case Reports in Obstetrics and Gynecology, 2020. 17: p. 1-6.\u003c/li\u003e\n\u003cli\u003eMarquina, G., A. Manzano, and A. Casado, Targeted Agents in Cervical Cancer: Beyond Bevacizumab. Current Oncology Reports, 2018. 20(5): p. 40.\u003c/li\u003e\n\u003cli\u003eMinion, et al., Cervical cancer - State of the science: From angiogenesis blockade to checkpoint inhibition. Gynecologic Oncology: An International Journal, 2018.\u003c/li\u003e\n\u003cli\u003eYang, W., et al., Increased expression of programmed death (PD)‐1 and its ligand PD‐L1 correlates with impaired cell‐mediated immunity in high‐risk human papillomavirus‐related cervical intraepithelial neoplasia. Immunology, 2013. 139(4): p. 513-522.\u003c/li\u003e\n\u003cli\u003eRoszik, J., et al., Gene Expression Analysis Identifies Novel Targets for Cervical Cancer Therapy. Frontiers in Immunology, 2018. 9.\u003c/li\u003e\n\u003cli\u003eBounds, P.L., C.V. Dang, and W.H. Koppenol, Otto Warburg\u0026apos;s contributions to current concepts of cancer metabolism. 2013.\u003c/li\u003e\n\u003cli\u003eAbdel-Wahab, A.F., W. Mahmoud, and R.M. Al-Harizy, Targeting glucose metabolism to suppress cancer progression: prospective of anti-glycolytic cancer therapy. Pharmacological Research, 2019. 150: p. 104511.\u003c/li\u003e\n\u003cli\u003eZhang, D., et al., 2-Deoxy-D-glucose targeting of glucose metabolism in cancer cells as a potential therapy. Cancer Letters, 2014. 355(2): p. 176-183.\u003c/li\u003e\n\u003cli\u003eProgress in the biological function of alpha-enolase. 2016(1): p. 6.\u003c/li\u003e\n\u003cli\u003eKang, H.J., et al., Structure of human alpha-enolase (hENO1), a multifunctional glycolytic enzyme. Acta Crystallographica, 2008. 64(6): p. 651-657.\u003c/li\u003e\n\u003cli\u003eNakamura, N., et al., Disruption of a spermatogenic cell-specific mouse enolase 4 (eno4) gene causes sperm structural defects and male infertility. Biology of Reproduction, 2013. 88(4).\u003c/li\u003e\n\u003cli\u003ePrabha, S., et al., RNA interference technology with emphasis on delivery vehicles\u0026mdash;prospects and limitations. Artificial Cells Nanomedicine \u0026amp; Biotechnology, 2015: p. 1.\u003c/li\u003e\n\u003cli\u003eCal, M., et al., The Anticancer Drug 3-Bromopyruvate Induces DNA Damage Potentially Through Reactive Oxygen Species in Yeast and in Human Cancer Cells. Cells, 2020. 9(5): p. 1161.\u003c/li\u003e\n\u003cli\u003ePayen, V.L., et al., Metabolic changes associated with tumor metastasis, part 1: tumor pH, glycolysis and the pentose phosphate pathway. Cellular \u0026amp; Molecular Life Sciences, 2016. 73(7): p. 1333-1348.\u003c/li\u003e\n\u003cli\u003eZhou, J., et al., CircRNA-ENO1 promoted glycolysis and tumor progression in lung adenocarcinoma through upregulating its host gene ENO1. Cell Death \u0026amp; Disease, 2019. 10(12): p. 885.\u003c/li\u003e\n\u003cli\u003eHanahan, D. and R.A. Weinberg, Hallmarks of cancer: the next generation. Cell, 2011. 144(5): p. 646.\u003c/li\u003e\n\u003cli\u003eKobayashi, Y., et al., Warburg effect in Gynecologic cancers. Journal of Obstetrics and Gynaecology Research, 2018.\u003c/li\u003e\n\u003cli\u003eCorbet, C. and O. Feron, Tumour acidosis: from the passenger to the driver\u0026apos;s seat. Nature Reviews Cancer, 2017.\u003c/li\u003e\n\u003cli\u003eSheng, et al., Glycolysis Inhibitors for Anticancer Therapy: A Review of Recent Patents. Recent Patents on Anti-Cancer Drug Discovery, 2016. 11(3): p. 297-308.\u003c/li\u003e\n\u003cli\u003eMiao, Y., et al., Inhibition of Proliferation, Migration, and Invasion by Knockdown of Pyruvate Kinase-M2 (PKM2) in Ovarian Cancer SKOV3 and OVCAR3 Cells. Oncology Research, 2016. 24(6): p. 463.\u003c/li\u003e\n\u003cli\u003eRay, A., et al., Preclinical validation of Alpha-Enolase (ENO1) as a novel immunometabolic target in multiple myeloma. Oncogene.\u003c/li\u003e\n\u003cli\u003eCapello, M., et al., \u0026alpha;-enolase: a promising therapeutic and diagnostic tumor target. febs journal, 2011. 278(7): p. 1064-1074.\u003c/li\u003e\n\u003cli\u003eLyssiotis, C., et al., Abstract A51: Oncogenic Kras is required for pancreatic tumor maintenance through the regulation of anabolic glucose metabolism. Cancer Research, 2012. 72(14 Supplement): p. A51-A51.\u003c/li\u003e\n\u003cli\u003eThe Biological Significance and Regulatory Mechanism of c-Myc Binding Protein 1 (MBP-1). International journal of molecular sciences, 2018.\u003c/li\u003e\n\u003cli\u003eGimenes, F., et al., Simultaneous detection of human papillomavirus integration and c-MYC gene amplification in cervical lesions: an emerging marker for the risk to progression. Archives of Gynecology \u0026amp; Obstetrics, 2016. 293(4): p. 857-863.\u003c/li\u003e\n\u003cli\u003eZhao, W.H., et al., c-myc Gene Copy Number Variation in Cervical Exfoliated Cells Detected on Fluorescence in situ Hybridization for Cervical Cancer Screening. Gynecol Obstet Invest, 2016. 81(5): p. 416.\u003c/li\u003e\n\u003cli\u003eShou-Heng, et al., [The Expression and Significance of c-myc and bcat1 in Cervical Cancer]. Sichuan da xue xue bao. Yi xue ban = Journal of Sichuan University. Medical science edition, 2018. 49(5): p. 725-730.\u003c/li\u003e\n\u003cli\u003eCancemi, P., et al., Expression of Alpha-Enolase (ENO1), Myc Promoter-Binding Protein-1 (MBP-1) and Matrix Metalloproteinases (MMP-2 and MMP-9) Reflect the Nature and Aggressiveness of Breast Tumors. International Journal of Molecular Sciences, 2019. 20(16): p. 3952-.\u003c/li\u003e\n\u003cli\u003eWang, X., et al., Effect of a synthetic inhibitor of urokinase plasminogen activator on the migration and invasion of human cervical cancer cells in vitro. Molecular Medicine Reports, 2018.\u003c/li\u003e\n\u003cli\u003eLin, Y.H., et al., An enolase inhibitor for the targeted treatment of ENO1-deleted cancers. Nature Metabolism, 2020: p. 1-14.\u003c/li\u003e\n\u003cli\u003ePaola, et al., Vaccination With Prolongs Survival of Genetically Engineered Mice With Pancreatic Cancer. Gastroenterology, 2013.\u003c/li\u003e\n\u003cli\u003eTaniguchi, D., et al., CD44v9 is associated with epithelial﹎esenchymal transition and poor outcomes in esophageal squamous cell carcinoma. Cancer Medicine, 2018. 7(12).\u003c/li\u003e\n\u003cli\u003eWang, et al., ADAM12 induces EMT and promotes cell migration, invasion and proliferation in pituitary adenomas via EGFR/ERK signaling pathway. Biomedecine \u0026amp; Pharmacotherapie, 2018.\u003c/li\u003e\n\u003cli\u003eFan, H., et al., MiR-150 alleviates EMT and cell invasion of colorectal cancer through targeting Gli1. 2017.\u003c/li\u003e\n\u003cli\u003eGwangwa, M.V., A.M. Joubert, and M.H. Visagie, Crosstalk between the Warburg effect, redox regulation and autophagy induction in tumourigenesis. Cellular \u0026amp; Molecular Biology Letters, 2018. 23(1): p. 20.\u003c/li\u003e\n\u003cli\u003eChen, L., et al., Silencing transcription factor FOXM1 represses proliferation, migration, and invasion while inducing apoptosis of liver cancer stem cells by regulating the expression of ALDH2. IUBMB Life, 2020.\u003c/li\u003e\n\u003cli\u003eYang, T., et al., Enolase 1 Regulates Stem Cell-Like Properties in Gastric Cancer Cells by Stimulating Glycolysis. Cell Death \u0026amp; Disease.\u003c/li\u003e\n\u003cli\u003eEMP1 regulates cell proliferation, migration, and stemness in gliomas through PI3K‐AKT signaling and CD44. Journal of Cellular Biochemistry, 2019. 120(10).\u003c/li\u003e\n\u003cli\u003eCapello, M., et al., Targeting the Warburg effect in cancer cells through ENO1 knockdown rescues oxidative phosphorylation and induces growth arrest. Oncotarget, 2016. 7(5): p. 5598-5612.\u003c/li\u003e\n\u003cli\u003eMboge, M.Y., et al., A non-catalytic function of carbonic anhydrase IX contributes to the glycolytic phenotype and pH regulation in human breast cancer cells. Biochemical Journal, 2019. 476(10): p. BCJ20190177.\u003c/li\u003e\n\u003cli\u003eLi, W., et al., LINC00184 silencing inhibits glycolysis and restores mitochondrial oxidative phosphorylation in esophageal cancer through demethylation of PTEN. EBioMedicine, 2019. 44: p. 298-310.\u003c/li\u003e\n\u003cli\u003eWilde, L., et al., Metabolic coupling and the Reverse Warburg Effect in cancer: Implications for novel biomarker and anticancer agent development. Seminars in Oncology, 2017: p. 198.\u003c/li\u003e\n\u003cli\u003eQian, X., et al., Enolase 1 stimulates glycolysis to promote chemoresistance in gastric cancer. Oncotarget, 2017. 8(29): p. 47691-47708.\u003c/li\u003e\n\u003cli\u003eChen, S., et al., WW domain-binding protein 2 acts as an oncogene by modulating the activity of the glycolytic enzyme ENO1 in glioma. Cell Death \u0026amp; Disease, 2018. \u003cstrong\u003e9\u003c/strong\u003e(3).\u003c/li\u003e\n\u003cli\u003eZheng, Y., et al., Inhibition of pyruvate dehydrogenase kinase 1 enhances the anti-cancer effect of EGFR tyrosine kinase inhibitors in non-small cell lung cancer. European Journal of Pharmacology, 2018: p. S0014299918305338-.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"cervical cancer, ENO1, glycolysis, monoclonal antibody, recombinant adeno-associated virus","lastPublishedDoi":"10.21203/rs.3.rs-4730015/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4730015/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"α-enolase (ENO1), as a plasminogen receptor and a key enzyme of glycolysis, is highly expressed in cervical cancer, Inhibition of ENO1 activity can further inhibit the migration and invasion of tumor cells by inhibiting glycolsis, and inhibiting tumor growth.In this study, adeno-associated virus (rAAV-ENO1mAb-5) with the variable region gene of recombinant ENO1 monoclonal antibody was prepared to mediate the targeted entry of the variable region gene of recombinant ENO1 monoclonal antibody into the cytoplasm to observe its growth inhibition effect on cervical cancer cells. The results showed that the variable region gene of rAAV-ENO1mAb-5, which was highly effective and targeted to load ENO1, entered the cytoplasm and inhibited the proliferation and migration of cervical cancer cells by antagonizing ENO1 enzyme activity, significantly reducing lactate and pyruvate content (P \u003c 0.01). In conclusion, rAAV-ENO1mAb-5 can specifically block ENO1 expression on cell membrane and inhibit ENO1 glycolysis activity in tumor cells, which has therapeutic effect on cervical cancer cells.","manuscriptTitle":"rAAV-ENO1mAb-5 inhibits cell proliferation and migration by suppressing glycolysis in cervical cancer","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-22 09:04:48","doi":"10.21203/rs.3.rs-4730015/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cd35472c-1d26-497f-b7e6-633abff3bdc8","owner":[],"postedDate":"August 22nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":36144351,"name":"Biological sciences/Cancer/Cancer therapy"},{"id":36144352,"name":"Biological sciences/Cancer/Cancer therapy/Cancer immunotherapy"},{"id":36144353,"name":"Biological sciences/Cancer"}],"tags":[],"updatedAt":"2024-10-14T08:23:57+00:00","versionOfRecord":[],"versionCreatedAt":"2024-08-22 09:04:48","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4730015","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4730015","identity":"rs-4730015","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00