High-salt diet promote colorectal cancer progression by inhibiting necroptosis via SGK1 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article High-salt diet promote colorectal cancer progression by inhibiting necroptosis via SGK1 Jiaming Huang, Sheng Guo, Shenggang Huang, Xiaofen Qiu, Li Liu, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6947907/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Introduction : The purpose of this study was to explore the potential mechanism of high salt diet on the progression of colorectal cancer. Methods : Colorectal cancer cells Caco-2 and HT-29 were treated with varying concentrations of sodium chloride. Flow cytometry was used to assess apoptosis in each group, wound healing assays were employed to evaluate cell migration, and Transwell assays were conducted to measure cell invasion. The expression levels of SGK1 in each group were analyzed using qRT-PCR and WB. Subsequently, SGK1 interfering vectors were constructed and transfected into the cells, and their effects on apoptosis, migration, invasion, and the expression of necroptosis-related proteins in colorectal cancer cells were investigated. Finally, the impact of a high-salt diet on tumor growth was examined by analyzing tumor formation in nude mice. Results : High-dose sodium chloride exposure significantly enhances the migration and invasion capabilities of Caco-2 and HT-29 cells while upregulating the expression of SGK1. Introducing an SGK1 interference vector effectively attenuates the sodium chloride-induced increase in migration and invasion abilities of colorectal cancer cells and promotes necroptosis in these cells. In vivo experiments in mice demonstrate that a high-salt diet accelerates the progression of colorectal cancer, whereas treatment with SGK1 inhibitors suppresses tumor growth in mouse models. Conclusion : High-salt diet can enhance the malignant biological behavior of colorectal cancer cells and promote in vivo colorectal cancer growth by upregulating SGK1 expression. high-salt diet colorectal cancer SGK1 necroptosis RIPK1/RIPK3/MLKL signaling pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 INTRODUCTION Colorectal cancer (CRC) is one of the most prevalent digestive tract tumors, accounting for over 10% of all cancer cases globally and ranking as the second leading cause of cancer-related deaths worldwide [ 1 – 2 ]. According to the latest statistics, the incidence of colorectal cancer is increasing annually, with a notable trend toward younger populations [ 3 – 4 ]. More than half of colorectal cancer cases are linked to unhealthy lifestyles, including smoking, alcohol consumption, obesity, and poor dietary habits [ 5 – 7 ]. Prior research has demonstrated that excessive salt intake is strongly associated with the onset and progression of various cancers, particularly gastrointestinal malignancies [ 8 – 10 ]. The prospective population-based study conducted by D'Elia et al. demonstrated a significant direct association between dietary salt intake and gastric cancer risk, with a gradual increase in risk observed as salt intake increased [ 11 ]. Besides, Deng et al. demonstrated that a high-salt diet diminishes the therapeutic efficacy of the chemotherapy drug FOLFOX in an orthotopic colorectal cancer xenograft mouse model by modulating the tryptophan metabolism of the gut microbiota [ 12 ]. However, no studies have reported the effects of high-salt diet on the progression of colorectal cancer both in vivo and in vitro. Therefore, this study aimed to investigate the effects of high-salt diet on the progression of colorectal cancer and investigated its underlying molecular mechanisms. MATERIALS AND METHODS Materials. Human colorectal cancer cell lines Caco-2 and HT-29 were purchased from Wuhan Pricella Biotechnology Co., Ltd (Shanghai, China). Annexin V-FITC apoptosis detection kit were purchased from Solaibao Technology Co., LTD (Beijing, China). Antibodies against SGK1, Ki-67, RIPK1, RIPK3, MLKL, p-MLKL, Caspase8, and β-Actin were purchased from Abcam (Cambridge, United Kingdom). SGK1-IN-4 was purchased from MCE (New Jersey, USA). HE staining solution and CF640 Tunel Cell Apoptosis Detection Kit were purchased from Servicebio (Wuhan, China). sh-SGK1-1, sh-SGK1-2, sh-SGK1-3, and sh-NC were obtained from Sangon Biotech (Shanghai, China). Cell culture and treatment. Human Caco-2 and HT-29 cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin at 37°C in an atmosphere containing 5% CO 2 . Colorectal cancer cells were treated with different doses (20, 40, and 60 mM) of sodium chloride for 24 hours to simulate a high-salt environment in vitro. As for cell transfection, the SGK1 interference vector was transfected into colorectal cancer cells using lipofectamine3000 reagent. And the cell experiment was divided into 4 groups: the Control group, the 40 mM group, the sh-NC group, the sh-SGK1 group. Except for the cells in the Control group, all other groups of cells were treated with 40 mM sodium chloride for 24 hours. Cell apoptosis assay. The collected cells (1×10 6 ) were centrifuged with PBS at 1500 rpm for 3 minutes, followed by two washes. Then, the cells were re-suspended in 300 µL of pre-cooled 1×Annexin V-FITC binding solution. Subsequently, 5 µL of Annexin V-FITC and 10 µL of PI were added to each well. After gentle mixing, the cells were incubated at room temperature for 10 minutes in the dark and subsequently analyzed using NovoCyte flow cytometry. Wound healing assay. Scratch treatment was performed in each well using a 200 µL pipette tip. The wells were washed three times with PBS after discarding the culture medium, and scratches were photographed in incomplete culture medium. Cells were incubated, and scratch images were taken again after 24 hours. Scratch areas at 0 and 24 hours were calculated based on the images, and the wound healing rate of colorectal cancer cells was determined. Cell invasion assay. The cells were collected and re-suspended with serum-free medium. The cells were inoculated into the upper compartment of the transwell chamber covered with matrix glue, and the lower compartment was added with PBS medium. After 24h culture in CO2 incubator at 37°C, remove the cell, discard the medium, and stain with 0.1% crystal violet for 1h. The cells in the chamber were wiped with a cotton swab and observed under a fluorescence microscope. After the photo was taken, the staining solution was removed, 33% acetic acid was added, and the absorbance of each hole was determined by microplate reader at 562nm wavelength. Quantitative real-time PCR (qRT-PCR). Samples were collected and the total RNA was isolated using a Total RNA Miniprep Kit. Subsequently, cDNA synthesis was carried out following the instructions provided by the manufacturer. A q RT-PCR analysis was conducted under the following conditions: initial denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 10 seconds, annealing at 60°C for 30 seconds, extension from 65 to 95°C with a temperature increment of 0.5°C every 5 seconds. After completion of the reaction, average cycle threshold (Ct) values were determined for each gene as well as for the reference gene. The relative expression levels of genes were evaluated using the widely accepted method known as 2 − ΔΔCT . The sequences of the primers were showed in Table 1 . Table 1 Primer sequence Gene symbol Forward Primer Reverse primer SGK1 GCCTGGGTGAACATGCTTTC TTCTTGGATCGGGCTTGGTC GAPDH CTGGGCTACACTGAGCACC AAGTGGTCGTTGAGGGCAATG Western Blotting. Protein concentration was measured using a bicinchoninic acid assay. Separated proteins were transferred to PVDF membranes. After blocking with 5% milk, the membranes were incubated with the corresponding primary antibodies at 4°C overnight. They were then incubated with secondary antibodies at room temperature for 1 hour. Densitometric analysis was performed using image acquisition and analysis software. Images were processed with Image J software and normalized to β-actin. Colorectal cancer model establishment and treatment. Eighteen SPF male Balb/c nude mice aged 4–6 weeks were purchased from Jiangsu Jicui Yaoke Biotechnology Co., LTD (license No. SCXK (Su) 2023-00099). All experiments followed ethical guidelines approved by the Medical Ethics Committee (No. TY-DKY2024-004-01). Modeling commenced for all mice after a 7-day adaptive rearing period. Prior to injection, the cells were resuspended in preparation for subcutaneous inoculation. Specifically, 150 µl of a cell suspension containing HT29 cells at a concentration of 5×10 6 cells/ml was injected into the right axilla of each mouse. Then, the experiment was divided into 3 groups: the HT-29 group, the HSD group, and the SGK1-IN-4 group, with 6 mice in each group. Mice in the HSD group and the SGK1-IN-4 group were fed a high-salt diet containing 8% NaCl for 31 days following the modeling procedure. Besides, after the modeling process, mice in the SGK1-IN-4 group were treated with intraperitoneal injections of the SGK1 inhibitor SGK1-IN-4 at a dose of 20 mg/kg, administered once a week for four consecutive weeks. The other two groups received intraperitoneal injections of the same volume of normal saline as a control. HE Staining. The tumor tissue of mice was first subjected to paraffin-embedded sections. Then, the sections were subjected to baking, dewaxing, hydration, and stained with hematoxylin solution for 3–5 minutes. After rinsing with running water, they were differentiated with 1% hydrochloric acid alcohol, counterblue with counterblue solution, and stained with eosin for 3–5 minutes. The sections were dehydrated, sealed, and observed by taking photos under a microscope. Tunel assay. The apoptosis of cells in the tumor tissues of mice was detected using the method described in the tunel cell apoptosis detection kit manual. Immunohistochemistry. The tumor tissues of mice were initially processed for paraffin-embedded sectioning. Following baking, dewaxing, and hydration, the sections were incubated with specific primary antibodies (Ki-67) and horseradish peroxidase-labeled goat anti-rabbit IgG(H + L). Subsequently, color development was performed using DAB. The sections were then dehydrated, mounted, and examined under a microscope after imaging. Statistical Analyses. Statistical analyses were performed using SPSS 22.0. Data were presented as mean ± SEM. One-way ANOVA was used to compare differences between groups. P-values < 0.05 were considered statistically significant. RESULTS High-dose sodium chloride treatment enhances the migratory and invasive capabilities of colorectal cancer cells without significantly affecting their apoptosis. As shown in Fig. 1 A-D, the apoptosis of different Caco-2 and HT-29 cells was detected by flow cytometry. Compared with the 0 mM group, the apoptosis of Caco-2 and HT-29 cells in the 20, 40, 60 mM group showed no significant difference. After that, we further detected the differences in migration and invasion abilities in different groups of Caco-2 and HT-29 cells (Fig. 2 A-J). Compared with the 0 mM group, the migration of Caco-2 and HT-29 cells in the 40 and 60 mM groups was significantly increased, while no significant difference was observed in the 20 mM group. In addition, Compared with the 0 mM group, the invasion of Caco-2 and HT-29 cells in the 20, 40 and 60 mM groups was significantly increased. The above results indicate that high-dose sodium chloride treatment enhances the migratory and invasive capabilities of Caco-2 and HT-29 cells. High-dose sodium chloride treatment promotes the expression of SGK1 in colorectal cancer cells Caco-2 and HT-29. As shown in Fig. 3 A-B, the SGK1 mRNA expression levels in different Caco-2 and HT-29 cells were detected by qRT-PCR. Compared with the 0 mM group, the SGK1 mRNA expression levels of Caco-2 and HT-29 cells in the 40 and 60 mM groups was significantly increased, while no significant difference was observed in the 20 mM group. Additionally, we further employed WB to investigate the differences in SGK1 protein expression among various groups of Caco-2 and HT-29 cells (Fig. 3 C-F). Compared with the 0 mM group, the SGK1 protein expression levels of Caco-2 and HT-29 cells in the 40 and 60 mM groups was significantly increased, while no significant difference was observed in the 20 mM group. Silencing SGK1 reverses the effects of high-dose sodium chloride on the migration and invasion of colorectal cancer cells. Firstly, sh-NC and three different sh-SGK1vectors were transfected into Caco-2 and HT-29 cells, and the silencing effect of SGK1 was verified by qPCR (Fig. 4 A-B) and WB (Fig. 4 C-F). Compared with the sh-NC group, the mRNA and protein expression of SGK1 in sh-SGK1-1, sh-SGK1-2, and sh-SGK1-3 group were significantly decreased in Caco-2 and HT-29 cells. According to the results of silencing SGK1, we used si-SGK1-2 for follow-up experiments. Secondly, To further analyze the role of silencing SGK1 in promoting the apoptosis of Caco-2 and HT-29 cells, we used flow cytometry to analyze the differential apoptosis between different colorectal cancer groups (Fig. 4 G-J). Compared with the sh-NC group, the apoptosis of Caco-2 and HT-29 cells in the sh-SGK1 group was significantly increased. Finally, wound healing assay and transwell assay were used to analyse the differences in migration and invasion abilities in different groups of Caco-2 and HT-29 cells (Fig. 5 A-J). Compared with the sh-NC group, the migration and invasion of Caco-2 and HT-29 cells in the sh-SGK1 groups were all significantly decreased. The above results indicate that silencing SGK1 reverses the effects of high-dose sodium chloride on the migration and invasion of Caco-2 and HT-29 cells. Silencing SGK1 reverses the effects of high-dose sodium chloride on the necroptosis-related protein expression of colorectal cancer cells. Subsequently, WB was used to detect the necroptosis-related protein (RIPK1, RIPK3, p-MLKL/MLKL, and Caspase8) expression of different treated Caco-2 and HT-29 cells (Fig. 6 A-J). Compared with the Control group, the RIPK1, RIPK3, p-MLKL/MLKL, and Caspase8 protein expression of Caco-2 and HT-29 cells in the 40 mM group were all significantly decreased. However, Compared with the sh-NC group, the RIPK1, RIPK3, p-MLKL/MLKL, and Caspase8 protein expression of Caco-2 and HT-29 cells in the sh-SGK1 group were all significantly increased. These results suggest that a high concentration of sodium chloride inhibits necroptosis in colorectal cancer cells, and that intervention with sh-SGK1 can reverse this effect. SGK1-IN-4 reverses the effects high-salt diet on tumor growth in nude mice. As shown in Fig. 7 A-C, the effect of high-salt diet on the growth of colorectal cancer and the intervention effect of SGK1-IN-4 were analyzed in vivo. The results demonstrated that a high-salt diet significantly increased both tumor volume and tumor weight in mice with colorectal cancer. However, intervention with SGK1-IN-4 was able to reverse these effects. After that, the tumor tissues from each group were harvested for HE staining (Fig. 7 D), Tunel assay (Fig. 7 E-F), and Ki-67 immunohistochemical analysis (Fig. 7 G-H). HE staining results showed that, compared with the HT-29 group, tumor cells in the HSD group were more tightly packed with less distinct spacing between them. In contrast, the SGK1-IN-4 group exhibited a significantly reduced number of tumor cells and looser arrangement compared with the HSD group. In addition, Tunel assay results demonstrated that the apoptosis level of tumor cells was significantly lower in the HSD group than in the HT-29 group, whereas the apoptosis level was markedly higher in the SGK1-IN-4 group compared to the HSD group. Finally, immunohistochemical analysis revealed a significant increase in Ki-67 positive cells in the HSD group compared to the HT-29 group. Conversely, a marked reduction in Ki-67 positive cells was observed in the SGK1-IN-4 group relative to the HSD group. The above results indicate that high-salt diet can promote the growth of colorectal cancer tumors in mice, and that intervention with SGK1-IN-4 can reverse this effect. DISCUSSION Colorectal cancer is a tumor disease characterized by high morbidity and mortality. Its occurrence and development are influenced by multiple factors, including genetic predisposition, environmental exposures, and lifestyle choices [ 13 – 15 ]. Diet plays a critical role in the etiology of colorectal cancer. Unhealthy dietary habits, such as excessive alcohol consumption and frequent intake of processed meats, have been identified as significant risk factors contributing to the onset and progression of this disease [ 16 – 18 ]. A high-salt diet has been recognized as a potential risk factor for various types of tumors, particularly gastrointestinal malignancies. However, the precise mechanisms by which a high-salt diet regulates the progression of colorectal cancer remain unclear. Our findings demonstrated that treatment with high concentrations of NaCl significantly enhanced the migratory and invasive capabilities of colorectal cancer cell lines Caco-2 and HT-29. Furthermore, in vivo studies revealed that a high-salt diet promoted tumor growth in colorectal cancer-bearing mice. SGK1 is a serine-threonine protein kinase that plays a pivotal role in the regulation of multiple signal transduction pathways and contributes significantly to the initiation and progression of various tumors [ 19 – 21 ]. SGK1 is frequently overexpressed in numerous types of cancers and is closely associated with malignant behaviors such as proliferation, apoptosis resistance, invasion, and metastasis [ 22 – 23 ]. Sang et al. demonstrated that SGK1 overexpression suppresses ferroptosis in ovarian cancer cells via modulation of the Nrf2 signaling pathway [ 24 ]. Wang et al. revealed that SGK1 functions as an antioxidant factor promoting the survival of cervical cancer cells; inhibiting SGK1 leads to excessive ROS accumulation in tumor cells, thereby enhancing their cytotoxicity [ 25 ]. Liang et al. reported that SGK1 is highly expressed in colon cancer tissues compared to adjacent normal tissues and that its overexpression promotes colorectal cancer development by enhancing cell proliferation, migration, and survival [ 26 ]. Additionally, SGK1 is a salt-sensitive protein capable of regulating the epithelial sodium channel on the cell surface, thus increasing cellular sodium ion uptake [ 27 ]. Notably, our findings indicate that high concentrations of NaCl can upregulate SGK1 mRNA and protein expression in colorectal cancer cell lines Caco-2 and HT-29. Silencing SGK1 in colorectal cancer cells reduces high-salt-induced migration and invasion, while SGK1 inhibition using SGK1-in-4 suppresses tumor growth in mice with high-salt diet-induced colorectal cancer. Necroptosis is neither necrosis nor apoptosis. It is a type of programmed cell death mediated by RIPK1 and RIPK3, exhibiting characteristics that resemble both apoptosis and necrosis [ 28 – 30 ]. Unlike apoptosis, which is marked by cell shrinkage and the formation of apoptotic bodies, necroptosis is characterized by cell swelling, cytoplasmic vacuolization, disruption of organelle membranes, lysosomal swelling and rupture, release of cytoplasmic contents, triggering innate and adaptive immune responses, and removal of necrotic cells via giant pinosomes [ 31 – 33 ]. Previous studies have demonstrated that a high-salt diet can activate epithelial necroptosis in mice with inflammatory bowel disease, thereby accelerating disease progression [ 34 ]. Wang et al. also reported that a high-salt diet significantly upregulated the expression of RIPK1, RIPK3, and MLKL, key regulators of necroptosis, in Dahl salt-sensitive rats [ 35 ]. However, no studies to date have explored the relationship between high-salt diet, necroptosis, and tumor development. Our findings indicate that high-dose NaCl treatment significantly suppressed the expression of RIPK1, RIPK3, p-MLKL/MLKL, and Caspase8, critical components of necroptosis, in colorectal cancer cell lines Caco-2 and HT-29. Furthermore, silencing SGK1 in high-salt-treated colorectal cancer cells (Caco-2 and HT-29) enhanced necroptosis. These results suggest that a high-salt diet may inhibit necroptosis in colorectal cancer cells by promoting SGK1 expression, thereby facilitating colorectal cancer progression. Taken together, our results indicate that high-salt diet can facilitate the progression of colorectal cancer by enhancing the expression of SGK1. However, this study also has some limitations. Although in vitro studies have confirmed that SGK1 can regulate necroptosis in colorectal cancer cells, further in vivo mouse experiments are warranted to validate these findings. In subsequent studies, we will further validate this at the in vivo level by generating SGK1 knockout mice. Declarations Author contributions : Jiaming Huang and Sheng Guo drafted the manuscript and conducted the experiments. Shenggang Huang, Xiaofen Qiu, Li Liu, and Chunping Zhu conducted the experiments and performed data analysis. Yingfeng Wei designed the experiments and revised the manuscript. All authors reviewed the manuscript. Funding : This research was supported by grants from the National Natural Science Foundation of China [grant numbers: 82260526]. Data availability: The data that support the findings of this study are available from the corresponding author upon reasonable request. Ethical Approval : This article does not contain any studies with human participants (Clinical trial number: not applicable). Besides, animals were housed and operated in strict compliance with the ethical principles of animal experimentation, and the operations were ratified by the animal ethics committee of Ganzhou People's Hospital (approval number: TY-DKY2024-004-01). All animal experiments complied with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals. According to the Animal Ethics and Welfare Committee of the Ganzhou People's Hospital, the weight of the tumor in this mouse experiment did not exceed 10% of the normal body weight, and the diameter of the tumor on the body surface of adult mice did not exceed 15 mm in any direction. Consent to participate: Not applicable. Consent for publication : Not applicable. Competing interests : The authors declare no competing financial interest. References Matsuda T, Fujimoto A, Igarashi Y. Colorectal Cancer: Epidemiology, Risk Factors, and Public Health Strategies. Digestion. 2025;106:91–9. Bai X, Duan Z, Deng J, Zhang Z, Fu R, Zhu C, Fan D. Ginsenoside Rh4 inhibits colorectal cancer via the modulation of gut microbiota-mediated bile acid metabolism. J Adv Res. 2025;72:37–52. Ge X, Feng Y, Tan S, Mao W, Wang Y, Zhu J, Chen Q. Gestational colorectal cancer: Mechanisms, treatments, and prognosis. Int J Cancer. 2025;157:416–26. Dagnaw GG, Dejene H. Colorectal cancer in Ethiopia: Epidemiological trends, diagnostic and laboratory capacities, and challenges. Semin Oncol. 2025;52:19–26. Li X, Chang Z, Wang J, Ding K, Pan S, Hu H, Tang Q. Unhealthy lifestyle factors and the risk of colorectal cancer: a Mendelian randomization study. Sci Rep. 2024;14:13825. Xu N, Cong X, Sun R, Yin L, Zhang J, Pu Y. Metabolic risk factors link unhealthy lifestyles to the risk of colorectal polyps in China. Prev Med Rep. 2023;35:102314. Diao X, Guo C, Jin Y, Li B, Gao X, Du X, Chen Z, Jo M, Zeng Y, Ding C, et al. Cancer situation in China: an analysis based on the global epidemiological data released in 2024. Cancer Commun (Lond). 2025;45(2):178–97. Wu X, Chen L, Cheng J, Qian J, Fang Z, Wu J. Effect of Dietary Salt Intake on Risk of Gastric Cancer: A Systematic Review and Meta-Analysis of Case-Control Studies. Nutrients. 2022;14:4260. Tucker L, Ali U, Zent R, Lannigan DA, Rathmell JC, Tiriveedhi V. Chronic High-Salt Diet Activates Tumor-Initiating Stem Cells Leading to Breast Cancer Proliferation. Cells. 2024;13:912. Scirgolea C, Sottile R, De Luca M, Susana A, Carnevale S, Puccio S, Ferrari V, Lise V, Contarini G, Scarpa A, et al. NaCl enhances CD8 + T cell effector functions in cancer immunotherapy. Nat Immunol. 2024;25:1845–57. D'Elia L, Rossi G, Ippolito R, Cappuccio FP, Strazzullo P. Habitual salt intake and risk of gastric cancer: a meta-analysis of prospective studies. Clin Nutr. 2012;31:489–98. Deng Y, Hou X, Fang Q, Wang H, Li X, Hu Z, Liu Z, Fan L, Liu Y, Fu Z, et al. High-salt diet decreases FOLFOX efficacy via gut bacterial tryptophan metabolism in colorectal cancer. Mol Med. 2025;31:66. Baidoun F, Elshiwy K, Elkeraie Y, Merjaneh Z, Khoudari G, Sarmini MT, Gad M, Al-Husseini M, Saad A. Colorectal Cancer Epidemiology: Recent Trends and Impact on Outcomes. Curr Drug Targets. 2021;22:998–1009. Roshandel G, Ghasemi-Kebria F, Malekzadeh R. Colorectal Cancer: Epidemiology, Risk Factors, and Prevention. Cancers (Basel). 2024;16:1530. Baima G, Minoli M, Michaud DS, Aimetti M, Sanz M, Loos BG, Romandini M. Periodontitis and risk of cancer: Mechanistic evidence. Periodontol. 2000. 2024;96:83–94. Bagnardi V, Rota M, Botteri E, Tramacere I, Islami F, Fedirko V, Scotti L, Jenab M, Turati F, Pasquali E, et al. Alcohol consumption and site-specific cancer risk: a comprehensive dose-response meta-analysis. Br J Cancer. 2015;112:580–93. Huang S, Yu L, Xiong F, Zhang B, Ruan S. Alcohol consumption and risk of early onset colorectal cancer: A systematic review and meta-analysis. Colorectal Dis. 2025;27:e70046. Farvid MS, Sidahmed E, Spence ND, Mante Angua K, Rosner BA, Barnett JB. Consumption of red meat and processed meat and cancer incidence: a systematic review and meta-analysis of prospective studies. Eur J Epidemiol. 2021;36:937–51. Ghani MJ. SGK1, autophagy and cancer: an overview. Mol Biol Rep. 2022;49:675–85. Sang Y, Kong P, Zhang S, Zhang L, Cao Y, Duan X, Sun T, Tao Z, Liu W. SGK1 in Human Cancer: Emerging Roles and Mechanisms. Front Oncol. 2021;10:608722. Wu J, Gong L, Li Y, Liu T, Sun R, Jia K, Liu R, Dong F, Gu X, Li X. SGK1 aggravates idiopathic pulmonary fibrosis by triggering H3k27ac-mediated macrophage reprogramming and disturbing immune homeostasis. Int J Biol Sci. 2024;20:968–86. Zhu R, Yang G, Cao Z, Shen K, Zheng L, Xiao J, You L, Zhang T. The prospect of serum and glucocorticoid-inducible kinase 1 (SGK1) in cancer therapy: a rising star. Ther Adv Med Oncol. 2020;12:1758835920940946. Liu W, Wang X, Wang Y, Dai Y, Xie Y, Ping Y, Yin B, Yu P, Liu Z, Duan X, et al. SGK1 inhibition-induced autophagy impairs prostate cancer metastasis by reversing EMT. J Exp Clin Cancer Res. 2018;37:73. Sang X, Han J, Wang Z, Cai W, Liao X, Kong Z, Yu Z, Cheng H, Liu P. SGK1 suppresses ferroptosis in ovarian cancer via NRF2-dependent and -independent pathways. Oncogene. 2024;43:3335–47. Wang M, Xue Y, Shen L, Qin P, Sang X, Tao Z, Yi J, Wang J, Liu P, Cheng H. Inhibition of SGK1 confers vulnerability to redox dysregulation in cervical cancer. Redox Biol. 2019;24:101225. Liang X, Lan C, Jiao G, Fu W, Long X, An Y, Wang K, Zhou J, Chen T, Li Y, et al. Therapeutic inhibition of SGK1 suppresses colorectal cancer. Exp Mol Med. 2017;49:e399. Wu C, Yosef N, Thalhamer T, Zhu C, Xiao S, Kishi Y, Regev A, Kuchroo VK. Induction of pathogenic TH17 cells by inducible salt-sensing kinase SGK1. Nature. 2013;496:513–7. Yan J, Wan P, Choksi S, Liu ZG. Necroptosis and tumor progression. Trends Cancer. 2022;8:21–7. Morgan MJ, Kim YS. RIPK3 in necroptosis and cancer. Mol Cells. 2025;48:100199. Dabravolski SA, Kalmykov VA, Maksaeva AO, Rozhkova UV, Lapshina KO, Orekhov AN. Necroptosis in myocardial ischaemia-reperfusion injury: current update on mechanisms, therapeutic targets, and translational potential. Apoptosis. 2025;30:1216–34. Balusu S, De Strooper B. The necroptosis cell death pathway drives neurodegeneration in Alzheimer's disease. Acta Neuropathol. 2024;147:96. Meier P, Legrand AJ, Adam D, Silke J. Immunogenic cell death in cancer: targeting necroptosis to induce antitumour immunity. Nat Rev Cancer. 2024;24:299–315. Zhou Y, Cai Z, Zhai Y, Yu J, He Q, He Y, Jitkaew S, Cai Z. Necroptosis inhibitors: mechanisms of action and therapeutic potential. Apoptosis. 2024;29:22–44. Qi J, Wang J, Zhang Y, Long H, Dong L, Wan P, Zuo Z, Chen W, Song Z. High-Salt-Diet (HSD) aggravates the progression of Inflammatory Bowel Disease (IBD) via regulating epithelial necroptosis. Mol Biomed. 2023;4:28. Wang Y, Jia H, Gao K, Du MF, Chu C, Wang D, Ma Q, Hu GL, Zhang X, Sun Y, et al. Renalase alleviates salt-induced kidney necroptosis and inflammation. Hypertens Res. 2024;47:2811–25. Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterials.pptx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6947907","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":502217358,"identity":"9e18e299-094b-43e5-bb1b-77d4d7b0f89c","order_by":0,"name":"Jiaming Huang","email":"","orcid":"","institution":"Ganzhou People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jiaming","middleName":"","lastName":"Huang","suffix":""},{"id":502217359,"identity":"a9b405b5-8d06-4dfc-a2b0-a6f7653245c4","order_by":1,"name":"Sheng Guo","email":"","orcid":"","institution":"the Fifth People's Hospital of Ganzhou","correspondingAuthor":false,"prefix":"","firstName":"Sheng","middleName":"","lastName":"Guo","suffix":""},{"id":502217360,"identity":"42536e3e-4e58-42f1-aa02-dc73532e6275","order_by":2,"name":"Shenggang Huang","email":"","orcid":"","institution":"Ganzhou People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Shenggang","middleName":"","lastName":"Huang","suffix":""},{"id":502217362,"identity":"97a6d7af-cdb0-4ba0-ac00-7dbaa9c04601","order_by":3,"name":"Xiaofen Qiu","email":"","orcid":"","institution":"Ganzhou People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xiaofen","middleName":"","lastName":"Qiu","suffix":""},{"id":502217365,"identity":"f35ff883-0312-440a-be07-1a60491490a9","order_by":4,"name":"Li Liu","email":"","orcid":"","institution":"Ganzhou People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Liu","suffix":""},{"id":502217367,"identity":"0863f566-cfb1-44c0-bf26-39234ea5573c","order_by":5,"name":"Chunping Zhu","email":"","orcid":"","institution":"Ganzhou People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Chunping","middleName":"","lastName":"Zhu","suffix":""},{"id":502217369,"identity":"622f5127-3652-49cc-b172-73b488e05f71","order_by":6,"name":"Yingfeng Wei","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyklEQVRIiWNgGAWjYFACxgcHPlTYyDGwMzYQq4XZ8OCMM2nGDMwkaDE+zNt2OLGBmVgNBjeSGQ7znElL729mbpPm3cEgzy92gLCWg3MqbHJnHGYEajnDYDhzdgJ+LWY38g8ceHMmLbcBrKWNIcHgNkEtyQwHgH5JlydJy0GglgQDorXYn3nMAApkw42HGZst57ZJEPaLZHsy8wdgVMrLHW9/eONtm408vzQBLQwCCAUsEgwMEgSUgwD/ATiT+QMR6kfBKBgFo2AEAgAhJUlYPnegcAAAAABJRU5ErkJggg==","orcid":"","institution":"Ganzhou People's Hospital","correspondingAuthor":true,"prefix":"","firstName":"Yingfeng","middleName":"","lastName":"Wei","suffix":""}],"badges":[],"createdAt":"2025-06-22 06:08:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6947907/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6947907/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":89614312,"identity":"12e1e564-50d4-4818-a38f-c87b51387f9c","added_by":"auto","created_at":"2025-08-22 02:21:54","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":176132,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of high-concentration sodium chloride on the apoptosis of colorectal cancer cells Caco-2 and HT-29. (\u003cstrong\u003eA-B\u003c/strong\u003e) Flow cytometry was used to detect the apoptosis levels of colorectal cancer cells in different groups, \u003cstrong\u003e(A) \u003c/strong\u003eCaco-2, \u003cstrong\u003e(B)\u003c/strong\u003e HT-29, (\u003cstrong\u003eC-D\u003c/strong\u003e) Quantitative analysis of apoptosis levels in Caco-2 and HT-29 cells. Data are presented as the mean±SD. ns indicates P \u0026gt; 0.05.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-6947907/v1/135b3a410bf9fcabc633876d.png"},{"id":89614786,"identity":"5d62068d-1e15-455e-a6b6-02539b91c68a","added_by":"auto","created_at":"2025-08-22 02:29:54","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":513137,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of high-concentration sodium chloride on migration and invasion of Caco-2 and HT-29 cells. (\u003cstrong\u003eA\u003c/strong\u003e) The migration of Caco-2 cells was detected by wound healing assay, (\u003cstrong\u003eB\u003c/strong\u003e) The migration of HT-29 cells was detected by wound healing assay, (\u003cstrong\u003eC-D\u003c/strong\u003e) Quantitative analysis of cell migration in Caco-2cells at 24h and 48h, (\u003cstrong\u003eE-F\u003c/strong\u003e) Quantitative analysis of cell migration in HT-29 cells at 24h and 48h, (\u003cstrong\u003eG\u003c/strong\u003e) The invasion of Caco-2 cells was detected by transwell assay, (\u003cstrong\u003eH\u003c/strong\u003e) The invasion of HT-29 cells was detected by transwell assay, (\u003cstrong\u003eI\u003c/strong\u003e) Quantitative analysis of cell invasion in Caco-2 cells, (\u003cstrong\u003eJ\u003c/strong\u003e) Quantitative analysis of cell invasion in HT-29 cells. Data are presented as the mean±SD. ns indicates P \u0026gt; 0.05, * indicates P \u0026lt;0.05, ** indicates P \u0026lt;0.01, *** indicates P \u0026lt;0.001, **** indicates P \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-6947907/v1/c445804fd2e7810c52cb97b5.png"},{"id":89614308,"identity":"430c5e69-408e-4973-b3b9-3650c80b5224","added_by":"auto","created_at":"2025-08-22 02:21:54","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":101084,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of high-concentration sodium chloride on SGK1 mRNA and protein expression in Caco-2 and HT-29 cells. (\u003cstrong\u003eA\u003c/strong\u003e) The SGK1 mRNA expression in Caco-2 cells were detected by qRT-PCR, (\u003cstrong\u003eB\u003c/strong\u003e) The SGK1 mRNA expression in HT-29 cells were detected by qRT-PCR, (\u003cstrong\u003eC-F\u003c/strong\u003e) The SGK1 protein expression in Caco-2 and HT-29 cells were detected by WB. Data are presented as the mean±SD. ns indicates P \u0026gt; 0.05, * indicates P \u0026lt;0.05, ** indicates P \u0026lt;0.01, *** indicates P \u0026lt;0.001.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-6947907/v1/085e7772a7918531f91392d9.png"},{"id":89614318,"identity":"b615f768-a367-4d90-9fed-47070d947d8c","added_by":"auto","created_at":"2025-08-22 02:21:54","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":272082,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of silencing SGK1 on the apoptosis of Caco-2 and HT-29 cells treated with high-concentration sodium chloride. (\u003cstrong\u003eA-B\u003c/strong\u003e) Transfection efficiency of SGK1 silencing vector in Caco-2 and HT-29 cells were verified by qRT-PCR, \u003cstrong\u003e(C-F)\u003c/strong\u003e Transfection efficiency of SGK1 silencing vector in Caco-2 and HT-29 cells were verified by WB, (\u003cstrong\u003eG-H\u003c/strong\u003e) Flow cytometry was used to detect the apoptosis levels of colorectal cancer cells in different groups, \u003cstrong\u003e(G) \u003c/strong\u003eCaco-2, \u003cstrong\u003e(H)\u003c/strong\u003e HT-29, (\u003cstrong\u003eI-J\u003c/strong\u003e) Quantitative analysis of apoptosis levels in Caco-2 and HT-29 cells. Data are presented as the mean±SD. ns indicates P \u0026gt; 0.05, * indicates P \u0026lt;0.05, ** indicates P \u0026lt;0.01, *** indicates P \u0026lt;0.001, **** indicates P \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-6947907/v1/550ca07c4ce9303703606bc5.png"},{"id":89614788,"identity":"d767f2d6-96d3-4f05-99b2-c97024f27db3","added_by":"auto","created_at":"2025-08-22 02:29:54","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":520714,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of silencing SGK1 on migration and invasion of Caco-2 and HT-29 cells treated with high-concentration sodium chloride. (\u003cstrong\u003eA\u003c/strong\u003e) The migration of Caco-2 cells was detected by wound healing assay, (\u003cstrong\u003eB\u003c/strong\u003e) The migration of HT-29 cells was detected by wound healing assay, (\u003cstrong\u003eC-D\u003c/strong\u003e) Quantitative analysis of cell migration in Caco-2cells at 24h and 48h, (\u003cstrong\u003eE-F\u003c/strong\u003e) Quantitative analysis of cell migration in HT-29 cells at 24h and 48h, (\u003cstrong\u003eG\u003c/strong\u003e) The invasion of Caco-2 cells was detected by transwell assay, (\u003cstrong\u003eH\u003c/strong\u003e) The invasion of HT-29 cells was detected by transwell assay, (\u003cstrong\u003eI\u003c/strong\u003e) Quantitative analysis of cell invasion in Caco-2 cells, (\u003cstrong\u003eJ\u003c/strong\u003e) Quantitative analysis of cell invasion in HT-29 cells. Data are presented as the mean±SD. * indicates P \u0026lt;0.05, ** indicates P \u0026lt;0.01, *** indicates P \u0026lt;0.001.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-6947907/v1/012d5c30b403fbd7a22453ca.png"},{"id":89614313,"identity":"ab7a0040-fb7e-4411-8a75-abaec82d7920","added_by":"auto","created_at":"2025-08-22 02:21:54","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":249621,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of silencing SGK1 on necroptosis-related protein expression of Caco-2 and HT-29 cells treated with high-concentration sodium chloride. (\u003cstrong\u003eA-E\u003c/strong\u003e) The necroptosis-related protein (RIPK1, RIPK3, p-MLKL/MLKL, Caspase8) expression in Caco-2 cells were detected by WB, (\u003cstrong\u003eF-J\u003c/strong\u003e) The necroptosis-related protein (RIPK1, RIPK3, p-MLKL/MLKL, Caspase8) expression in HT-29 cells were detected by WB. Data are presented as the mean±SD. * indicates P \u0026lt;0.05, ** indicates P \u0026lt;0.01, *** indicates P \u0026lt;0.001, **** indicates P \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-6947907/v1/0810450028dc2d122261cc8a.png"},{"id":89614333,"identity":"f43fbf40-f0dd-4e51-956e-bfcd38d252e6","added_by":"auto","created_at":"2025-08-22 02:21:54","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":861285,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of SGK1-IN-4 on tumor growth in nude mice treated with high-salt diet. (\u003cstrong\u003eA\u003c/strong\u003e) The growth curves of tumors in mice of different groups, (\u003cstrong\u003eB\u003c/strong\u003e) Photography results of tumor tissues in mice of different groups, (\u003cstrong\u003eC\u003c/strong\u003e) The weight of tumor tissues in mice of different groups, (\u003cstrong\u003eD\u003c/strong\u003e) HE staining of tumor tissues from different mice, (\u003cstrong\u003eE-F\u003c/strong\u003e) Tunel assay of tumor tissues from different mice, (\u003cstrong\u003eG-H\u003c/strong\u003e) Immunohistochemistry was used to detect the expression of Ki-67 in tumor tissues from different mice. Data are presented as the mean±SD. * indicates P \u0026lt;0.05, *** indicates P \u0026lt;0.001, **** indicates P \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-6947907/v1/a616585e473ca3b7939f71ed.png"},{"id":92571484,"identity":"f67f8642-ac1a-4daa-b49e-182be31b6415","added_by":"auto","created_at":"2025-10-01 07:53:19","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3594210,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6947907/v1/52e7e258-402f-4b66-b568-172330406ef9.pdf"},{"id":89614323,"identity":"4b5e7602-ceb4-4e62-b218-813a132295e1","added_by":"auto","created_at":"2025-08-22 02:21:54","extension":"pptx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":7382099,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterials.pptx","url":"https://assets-eu.researchsquare.com/files/rs-6947907/v1/56e079c69d21b603e111c9b1.pptx"}],"financialInterests":"No competing interests reported.","formattedTitle":"High-salt diet promote colorectal cancer progression by inhibiting necroptosis via SGK1","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eColorectal cancer (CRC) is one of the most prevalent digestive tract tumors, accounting for over 10% of all cancer cases globally and ranking as the second leading cause of cancer-related deaths worldwide [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. According to the latest statistics, the incidence of colorectal cancer is increasing annually, with a notable trend toward younger populations [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. More than half of colorectal cancer cases are linked to unhealthy lifestyles, including smoking, alcohol consumption, obesity, and poor dietary habits [\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Prior research has demonstrated that excessive salt intake is strongly associated with the onset and progression of various cancers, particularly gastrointestinal malignancies [\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The prospective population-based study conducted by D'Elia et al. demonstrated a significant direct association between dietary salt intake and gastric cancer risk, with a gradual increase in risk observed as salt intake increased [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Besides, Deng et al. demonstrated that a high-salt diet diminishes the therapeutic efficacy of the chemotherapy drug FOLFOX in an orthotopic colorectal cancer xenograft mouse model by modulating the tryptophan metabolism of the gut microbiota [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. However, no studies have reported the effects of high-salt diet on the progression of colorectal cancer both in vivo and in vitro. Therefore, this study aimed to investigate the effects of high-salt diet on the progression of colorectal cancer and investigated its underlying molecular mechanisms.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003e\u003cb\u003eMaterials.\u003c/b\u003e Human colorectal cancer cell lines Caco-2 and HT-29 were purchased from Wuhan Pricella Biotechnology Co., Ltd (Shanghai, China). Annexin V-FITC apoptosis detection kit were purchased from Solaibao Technology Co., LTD (Beijing, China). Antibodies against SGK1, Ki-67, RIPK1, RIPK3, MLKL, p-MLKL, Caspase8, and β-Actin were purchased from Abcam (Cambridge, United Kingdom). SGK1-IN-4 was purchased from MCE (New Jersey, USA). HE staining solution and CF640 Tunel Cell Apoptosis Detection Kit were purchased from Servicebio (Wuhan, China). sh-SGK1-1, sh-SGK1-2, sh-SGK1-3, and sh-NC were obtained from Sangon Biotech (Shanghai, China).\u003c/p\u003e\u003cp\u003e\u003cb\u003eCell culture and treatment.\u003c/b\u003e Human Caco-2 and HT-29 cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin at 37\u0026deg;C in an atmosphere containing 5% CO\u003csub\u003e2\u003c/sub\u003e. Colorectal cancer cells were treated with different doses (20, 40, and 60 mM) of sodium chloride for 24 hours to simulate a high-salt environment in vitro. As for cell transfection, the SGK1 interference vector was transfected into colorectal cancer cells using lipofectamine3000 reagent. And the cell experiment was divided into 4 groups: the Control group, the 40 mM group, the sh-NC group, the sh-SGK1 group. Except for the cells in the Control group, all other groups of cells were treated with 40 mM sodium chloride for 24 hours.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCell apoptosis assay.\u003c/b\u003e The collected cells (1\u0026times;10\u003csup\u003e6\u003c/sup\u003e) were centrifuged with PBS at 1500 rpm for 3 minutes, followed by two washes. Then, the cells were re-suspended in 300 \u0026micro;L of pre-cooled 1\u0026times;Annexin V-FITC binding solution. Subsequently, 5 \u0026micro;L of Annexin V-FITC and 10 \u0026micro;L of PI were added to each well. After gentle mixing, the cells were incubated at room temperature for 10 minutes in the dark and subsequently analyzed using NovoCyte flow cytometry.\u003c/p\u003e\u003cp\u003e\u003cb\u003eWound healing assay.\u003c/b\u003e Scratch treatment was performed in each well using a 200 \u0026micro;L pipette tip. The wells were washed three times with PBS after discarding the culture medium, and scratches were photographed in incomplete culture medium. Cells were incubated, and scratch images were taken again after 24 hours. Scratch areas at 0 and 24 hours were calculated based on the images, and the wound healing rate of colorectal cancer cells was determined.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCell invasion assay.\u003c/b\u003e The cells were collected and re-suspended with serum-free medium. The cells were inoculated into the upper compartment of the transwell chamber covered with matrix glue, and the lower compartment was added with PBS medium. After 24h culture in CO2 incubator at 37\u0026deg;C, remove the cell, discard the medium, and stain with 0.1% crystal violet for 1h. The cells in the chamber were wiped with a cotton swab and observed under a fluorescence microscope. After the photo was taken, the staining solution was removed, 33% acetic acid was added, and the absorbance of each hole was determined by microplate reader at 562nm wavelength.\u003c/p\u003e\u003cp\u003e\u003cb\u003eQuantitative real-time PCR (qRT-PCR).\u003c/b\u003e Samples were collected and the total RNA was isolated using a Total RNA Miniprep Kit. Subsequently, cDNA synthesis was carried out following the instructions provided by the manufacturer. A q RT-PCR analysis was conducted under the following conditions: initial denaturation at 95\u0026deg;C for 5 minutes, followed by denaturation at 95\u0026deg;C for 10 seconds, annealing at 60\u0026deg;C for 30 seconds, extension from 65 to 95\u0026deg;C with a temperature increment of 0.5\u0026deg;C every 5 seconds. After completion of the reaction, average cycle threshold (Ct) values were determined for each gene as well as for the reference gene. The relative expression levels of genes were evaluated using the widely accepted method known as 2\u003csup\u003e\u0026minus; ΔΔCT\u003c/sup\u003e. The sequences of the primers were showed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequence\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene symbol\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward Primer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse primer\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSGK1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCCTGGGTGAACATGCTTTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTCTTGGATCGGGCTTGGTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTGGGCTACACTGAGCACC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAAGTGGTCGTTGAGGGCAATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eWestern Blotting.\u003c/b\u003e Protein concentration was measured using a bicinchoninic acid assay. Separated proteins were transferred to PVDF membranes. After blocking with 5% milk, the membranes were incubated with the corresponding primary antibodies at 4\u0026deg;C overnight. They were then incubated with secondary antibodies at room temperature for 1 hour. Densitometric analysis was performed using image acquisition and analysis software. Images were processed with Image J software and normalized to β-actin.\u003c/p\u003e\u003cp\u003e\u003cb\u003eColorectal cancer model establishment and treatment.\u003c/b\u003e Eighteen SPF male Balb/c nude mice aged 4\u0026ndash;6 weeks were purchased from Jiangsu Jicui Yaoke Biotechnology Co., LTD (license No. SCXK (Su) 2023-00099). All experiments followed ethical guidelines approved by the Medical Ethics Committee (No. TY-DKY2024-004-01). Modeling commenced for all mice after a 7-day adaptive rearing period. Prior to injection, the cells were resuspended in preparation for subcutaneous inoculation. Specifically, 150 \u0026micro;l of a cell suspension containing HT29 cells at a concentration of 5\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells/ml was injected into the right axilla of each mouse. Then, the experiment was divided into 3 groups: the HT-29 group, the HSD group, and the SGK1-IN-4 group, with 6 mice in each group. Mice in the HSD group and the SGK1-IN-4 group were fed a high-salt diet containing 8% NaCl for 31 days following the modeling procedure. Besides, after the modeling process, mice in the SGK1-IN-4 group were treated with intraperitoneal injections of the SGK1 inhibitor SGK1-IN-4 at a dose of 20 mg/kg, administered once a week for four consecutive weeks. The other two groups received intraperitoneal injections of the same volume of normal saline as a control.\u003c/p\u003e\u003cp\u003e\u003cb\u003eHE Staining.\u003c/b\u003e The tumor tissue of mice was first subjected to paraffin-embedded sections. Then, the sections were subjected to baking, dewaxing, hydration, and stained with hematoxylin solution for 3\u0026ndash;5 minutes. After rinsing with running water, they were differentiated with 1% hydrochloric acid alcohol, counterblue with counterblue solution, and stained with eosin for 3\u0026ndash;5 minutes. The sections were dehydrated, sealed, and observed by taking photos under a microscope.\u003c/p\u003e\u003cp\u003e\u003cb\u003eTunel assay.\u003c/b\u003e The apoptosis of cells in the tumor tissues of mice was detected using the method described in the tunel cell apoptosis detection kit manual.\u003c/p\u003e\u003cp\u003e\u003cb\u003eImmunohistochemistry.\u003c/b\u003e The tumor tissues of mice were initially processed for paraffin-embedded sectioning. Following baking, dewaxing, and hydration, the sections were incubated with specific primary antibodies (Ki-67) and horseradish peroxidase-labeled goat anti-rabbit IgG(H\u0026thinsp;+\u0026thinsp;L). Subsequently, color development was performed using DAB. The sections were then dehydrated, mounted, and examined under a microscope after imaging.\u003c/p\u003e\u003cp\u003e\u003cb\u003eStatistical Analyses.\u003c/b\u003e Statistical analyses were performed using SPSS 22.0. Data were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. One-way ANOVA was used to compare differences between groups. P-values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered statistically significant.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cb\u003eHigh-dose sodium chloride treatment enhances the migratory and invasive capabilities of colorectal cancer cells without significantly affecting their apoptosis.\u003c/b\u003e As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-D, the apoptosis of different Caco-2 and HT-29 cells was detected by flow cytometry. Compared with the 0 mM group, the apoptosis of Caco-2 and HT-29 cells in the 20, 40, 60 mM group showed no significant difference.\u003c/p\u003e\u003cp\u003eAfter that, we further detected the differences in migration and invasion abilities in different groups of Caco-2 and HT-29 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-J). Compared with the 0 mM group, the migration of Caco-2 and HT-29 cells in the 40 and 60 mM groups was significantly increased, while no significant difference was observed in the 20 mM group. In addition, Compared with the 0 mM group, the invasion of Caco-2 and HT-29 cells in the 20, 40 and 60 mM groups was significantly increased. The above results indicate that high-dose sodium chloride treatment enhances the migratory and invasive capabilities of Caco-2 and HT-29 cells.\u003c/p\u003e\u003cp\u003e\u003cb\u003eHigh-dose sodium chloride treatment promotes the expression of SGK1 in colorectal cancer cells Caco-2 and HT-29.\u003c/b\u003e As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B, the SGK1 mRNA expression levels in different Caco-2 and HT-29 cells were detected by qRT-PCR. Compared with the 0 mM group, the SGK1 mRNA expression levels of Caco-2 and HT-29 cells in the 40 and 60 mM groups was significantly increased, while no significant difference was observed in the 20 mM group. Additionally, we further employed WB to investigate the differences in SGK1 protein expression among various groups of Caco-2 and HT-29 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-F). Compared with the 0 mM group, the SGK1 protein expression levels of Caco-2 and HT-29 cells in the 40 and 60 mM groups was significantly increased, while no significant difference was observed in the 20 mM group.\u003c/p\u003e\u003cp\u003e\u003cb\u003eSilencing SGK1 reverses the effects of high-dose sodium chloride on the migration and invasion of colorectal cancer cells.\u003c/b\u003e Firstly, sh-NC and three different sh-SGK1vectors were transfected into Caco-2 and HT-29 cells, and the silencing effect of SGK1 was verified by qPCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-B) and WB (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC-F). Compared with the sh-NC group, the mRNA and protein expression of SGK1 in sh-SGK1-1, sh-SGK1-2, and sh-SGK1-3 group were significantly decreased in Caco-2 and HT-29 cells. According to the results of silencing SGK1, we used si-SGK1-2 for follow-up experiments. Secondly, To further analyze the role of silencing SGK1 in promoting the apoptosis of Caco-2 and HT-29 cells, we used flow cytometry to analyze the differential apoptosis between different colorectal cancer groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG-J). Compared with the sh-NC group, the apoptosis of Caco-2 and HT-29 cells in the sh-SGK1 group was significantly increased. Finally, wound healing assay and transwell assay were used to analyse the differences in migration and invasion abilities in different groups of Caco-2 and HT-29 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-J). Compared with the sh-NC group, the migration and invasion of Caco-2 and HT-29 cells in the sh-SGK1 groups were all significantly decreased. The above results indicate that silencing SGK1 reverses the effects of high-dose sodium chloride on the migration and invasion of Caco-2 and HT-29 cells.\u003c/p\u003e\u003cp\u003e\u003cb\u003eSilencing SGK1 reverses the effects of high-dose sodium chloride on the necroptosis-related protein expression of colorectal cancer cells.\u003c/b\u003e Subsequently, WB was used to detect the necroptosis-related protein (RIPK1, RIPK3, p-MLKL/MLKL, and Caspase8) expression of different treated Caco-2 and HT-29 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-J). Compared with the Control group, the RIPK1, RIPK3, p-MLKL/MLKL, and Caspase8 protein expression of Caco-2 and HT-29 cells in the 40 mM group were all significantly decreased. However, Compared with the sh-NC group, the RIPK1, RIPK3, p-MLKL/MLKL, and Caspase8 protein expression of Caco-2 and HT-29 cells in the sh-SGK1 group were all significantly increased. These results suggest that a high concentration of sodium chloride inhibits necroptosis in colorectal cancer cells, and that intervention with sh-SGK1 can reverse this effect.\u003c/p\u003e\u003cp\u003e\u003cb\u003eSGK1-IN-4 reverses the effects high-salt diet on tumor growth in nude mice.\u003c/b\u003e As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA-C, the effect of high-salt diet on the growth of colorectal cancer and the intervention effect of SGK1-IN-4 were analyzed in vivo. The results demonstrated that a high-salt diet significantly increased both tumor volume and tumor weight in mice with colorectal cancer. However, intervention with SGK1-IN-4 was able to reverse these effects. After that, the tumor tissues from each group were harvested for HE staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD), Tunel assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE-F), and Ki-67 immunohistochemical analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eG-H). HE staining results showed that, compared with the HT-29 group, tumor cells in the HSD group were more tightly packed with less distinct spacing between them. In contrast, the SGK1-IN-4 group exhibited a significantly reduced number of tumor cells and looser arrangement compared with the HSD group. In addition, Tunel assay results demonstrated that the apoptosis level of tumor cells was significantly lower in the HSD group than in the HT-29 group, whereas the apoptosis level was markedly higher in the SGK1-IN-4 group compared to the HSD group. Finally, immunohistochemical analysis revealed a significant increase in Ki-67 positive cells in the HSD group compared to the HT-29 group. Conversely, a marked reduction in Ki-67 positive cells was observed in the SGK1-IN-4 group relative to the HSD group. The above results indicate that high-salt diet can promote the growth of colorectal cancer tumors in mice, and that intervention with SGK1-IN-4 can reverse this effect.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eColorectal cancer is a tumor disease characterized by high morbidity and mortality. Its occurrence and development are influenced by multiple factors, including genetic predisposition, environmental exposures, and lifestyle choices [\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Diet plays a critical role in the etiology of colorectal cancer. Unhealthy dietary habits, such as excessive alcohol consumption and frequent intake of processed meats, have been identified as significant risk factors contributing to the onset and progression of this disease [\u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. A high-salt diet has been recognized as a potential risk factor for various types of tumors, particularly gastrointestinal malignancies. However, the precise mechanisms by which a high-salt diet regulates the progression of colorectal cancer remain unclear. Our findings demonstrated that treatment with high concentrations of NaCl significantly enhanced the migratory and invasive capabilities of colorectal cancer cell lines Caco-2 and HT-29. Furthermore, in vivo studies revealed that a high-salt diet promoted tumor growth in colorectal cancer-bearing mice.\u003c/p\u003e\u003cp\u003eSGK1 is a serine-threonine protein kinase that plays a pivotal role in the regulation of multiple signal transduction pathways and contributes significantly to the initiation and progression of various tumors [\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. SGK1 is frequently overexpressed in numerous types of cancers and is closely associated with malignant behaviors such as proliferation, apoptosis resistance, invasion, and metastasis [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Sang et al. demonstrated that SGK1 overexpression suppresses ferroptosis in ovarian cancer cells via modulation of the Nrf2 signaling pathway [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Wang et al. revealed that SGK1 functions as an antioxidant factor promoting the survival of cervical cancer cells; inhibiting SGK1 leads to excessive ROS accumulation in tumor cells, thereby enhancing their cytotoxicity [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Liang et al. reported that SGK1 is highly expressed in colon cancer tissues compared to adjacent normal tissues and that its overexpression promotes colorectal cancer development by enhancing cell proliferation, migration, and survival [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Additionally, SGK1 is a salt-sensitive protein capable of regulating the epithelial sodium channel on the cell surface, thus increasing cellular sodium ion uptake [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Notably, our findings indicate that high concentrations of NaCl can upregulate SGK1 mRNA and protein expression in colorectal cancer cell lines Caco-2 and HT-29. Silencing SGK1 in colorectal cancer cells reduces high-salt-induced migration and invasion, while SGK1 inhibition using SGK1-in-4 suppresses tumor growth in mice with high-salt diet-induced colorectal cancer.\u003c/p\u003e\u003cp\u003eNecroptosis is neither necrosis nor apoptosis. It is a type of programmed cell death mediated by RIPK1 and RIPK3, exhibiting characteristics that resemble both apoptosis and necrosis [\u003cspan additionalcitationids=\"CR29\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Unlike apoptosis, which is marked by cell shrinkage and the formation of apoptotic bodies, necroptosis is characterized by cell swelling, cytoplasmic vacuolization, disruption of organelle membranes, lysosomal swelling and rupture, release of cytoplasmic contents, triggering innate and adaptive immune responses, and removal of necrotic cells via giant pinosomes [\u003cspan additionalcitationids=\"CR32\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Previous studies have demonstrated that a high-salt diet can activate epithelial necroptosis in mice with inflammatory bowel disease, thereby accelerating disease progression [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Wang et al. also reported that a high-salt diet significantly upregulated the expression of RIPK1, RIPK3, and MLKL, key regulators of necroptosis, in Dahl salt-sensitive rats [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. However, no studies to date have explored the relationship between high-salt diet, necroptosis, and tumor development. Our findings indicate that high-dose NaCl treatment significantly suppressed the expression of RIPK1, RIPK3, p-MLKL/MLKL, and Caspase8, critical components of necroptosis, in colorectal cancer cell lines Caco-2 and HT-29. Furthermore, silencing SGK1 in high-salt-treated colorectal cancer cells (Caco-2 and HT-29) enhanced necroptosis. These results suggest that a high-salt diet may inhibit necroptosis in colorectal cancer cells by promoting SGK1 expression, thereby facilitating colorectal cancer progression. Taken together, our results indicate that high-salt diet can facilitate the progression of colorectal cancer by enhancing the expression of SGK1. However, this study also has some limitations. Although in vitro studies have confirmed that SGK1 can regulate necroptosis in colorectal cancer cells, further in vivo mouse experiments are warranted to validate these findings. In subsequent studies, we will further validate this at the in vivo level by generating SGK1 knockout mice.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJiaming Huang and Sheng Guo drafted the manuscript and conducted the experiments. Shenggang Huang, Xiaofen Qiu, Li Liu, and Chunping Zhu conducted the experiments and performed data analysis. Yingfeng Wei designed the experiments and revised the manuscript. All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e:\u003c/p\u003e\n\u003cp\u003eThis research was supported by grants from the National Natural Science Foundation of China [grant numbers: 82260526].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis article does not contain any studies with human participants (Clinical trial number: not applicable). Besides, animals were housed and operated in strict compliance with the ethical principles of animal experimentation, and the operations were ratified by the animal ethics committee of Ganzhou People\u0026apos;s Hospital (approval number: TY-DKY2024-004-01). All animal experiments complied with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals. According to the Animal Ethics and Welfare Committee of the Ganzhou People\u0026apos;s Hospital, the weight of the tumor in this mouse experiment did not exceed 10% of the normal body weight, and the diameter of the tumor on the body surface of adult mice did not exceed 15 mm in any direction.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing financial interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMatsuda T, Fujimoto A, Igarashi Y. Colorectal Cancer: Epidemiology, Risk Factors, and Public Health Strategies. Digestion. 2025;106:91\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBai X, Duan Z, Deng J, Zhang Z, Fu R, Zhu C, Fan D. Ginsenoside Rh4 inhibits colorectal cancer via the modulation of gut microbiota-mediated bile acid metabolism. J Adv Res. 2025;72:37\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGe X, Feng Y, Tan S, Mao W, Wang Y, Zhu J, Chen Q. Gestational colorectal cancer: Mechanisms, treatments, and prognosis. Int J Cancer. 2025;157:416\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDagnaw GG, Dejene H. Colorectal cancer in Ethiopia: Epidemiological trends, diagnostic and laboratory capacities, and challenges. Semin Oncol. 2025;52:19\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi X, Chang Z, Wang J, Ding K, Pan S, Hu H, Tang Q. Unhealthy lifestyle factors and the risk of colorectal cancer: a Mendelian randomization study. Sci Rep. 2024;14:13825.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu N, Cong X, Sun R, Yin L, Zhang J, Pu Y. Metabolic risk factors link unhealthy lifestyles to the risk of colorectal polyps in China. Prev Med Rep. 2023;35:102314.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDiao X, Guo C, Jin Y, Li B, Gao X, Du X, Chen Z, Jo M, Zeng Y, Ding C, et al. Cancer situation in China: an analysis based on the global epidemiological data released in 2024. Cancer Commun (Lond). 2025;45(2):178\u0026ndash;97.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu X, Chen L, Cheng J, Qian J, Fang Z, Wu J. Effect of Dietary Salt Intake on Risk of Gastric Cancer: A Systematic Review and Meta-Analysis of Case-Control Studies. Nutrients. 2022;14:4260.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTucker L, Ali U, Zent R, Lannigan DA, Rathmell JC, Tiriveedhi V. Chronic High-Salt Diet Activates Tumor-Initiating Stem Cells Leading to Breast Cancer Proliferation. Cells. 2024;13:912.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eScirgolea C, Sottile R, De Luca M, Susana A, Carnevale S, Puccio S, Ferrari V, Lise V, Contarini G, Scarpa A, et al. NaCl enhances CD8\u0026thinsp;+\u0026thinsp;T cell effector functions in cancer immunotherapy. Nat Immunol. 2024;25:1845\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eD'Elia L, Rossi G, Ippolito R, Cappuccio FP, Strazzullo P. Habitual salt intake and risk of gastric cancer: a meta-analysis of prospective studies. Clin Nutr. 2012;31:489\u0026ndash;98.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDeng Y, Hou X, Fang Q, Wang H, Li X, Hu Z, Liu Z, Fan L, Liu Y, Fu Z, et al. High-salt diet decreases FOLFOX efficacy via gut bacterial tryptophan metabolism in colorectal cancer. Mol Med. 2025;31:66.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBaidoun F, Elshiwy K, Elkeraie Y, Merjaneh Z, Khoudari G, Sarmini MT, Gad M, Al-Husseini M, Saad A. Colorectal Cancer Epidemiology: Recent Trends and Impact on Outcomes. Curr Drug Targets. 2021;22:998\u0026ndash;1009.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRoshandel G, Ghasemi-Kebria F, Malekzadeh R. Colorectal Cancer: Epidemiology, Risk Factors, and Prevention. Cancers (Basel). 2024;16:1530.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBaima G, Minoli M, Michaud DS, Aimetti M, Sanz M, Loos BG, Romandini M. Periodontitis and risk of cancer: Mechanistic evidence. Periodontol. 2000. 2024;96:83\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBagnardi V, Rota M, Botteri E, Tramacere I, Islami F, Fedirko V, Scotti L, Jenab M, Turati F, Pasquali E, et al. Alcohol consumption and site-specific cancer risk: a comprehensive dose-response meta-analysis. Br J Cancer. 2015;112:580\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuang S, Yu L, Xiong F, Zhang B, Ruan S. Alcohol consumption and risk of early onset colorectal cancer: A systematic review and meta-analysis. Colorectal Dis. 2025;27:e70046.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFarvid MS, Sidahmed E, Spence ND, Mante Angua K, Rosner BA, Barnett JB. Consumption of red meat and processed meat and cancer incidence: a systematic review and meta-analysis of prospective studies. Eur J Epidemiol. 2021;36:937\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGhani MJ. SGK1, autophagy and cancer: an overview. Mol Biol Rep. 2022;49:675\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSang Y, Kong P, Zhang S, Zhang L, Cao Y, Duan X, Sun T, Tao Z, Liu W. SGK1 in Human Cancer: Emerging Roles and Mechanisms. Front Oncol. 2021;10:608722.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu J, Gong L, Li Y, Liu T, Sun R, Jia K, Liu R, Dong F, Gu X, Li X. SGK1 aggravates idiopathic pulmonary fibrosis by triggering H3k27ac-mediated macrophage reprogramming and disturbing immune homeostasis. Int J Biol Sci. 2024;20:968\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhu R, Yang G, Cao Z, Shen K, Zheng L, Xiao J, You L, Zhang T. The prospect of serum and glucocorticoid-inducible kinase 1 (SGK1) in cancer therapy: a rising star. Ther Adv Med Oncol. 2020;12:1758835920940946.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu W, Wang X, Wang Y, Dai Y, Xie Y, Ping Y, Yin B, Yu P, Liu Z, Duan X, et al. SGK1 inhibition-induced autophagy impairs prostate cancer metastasis by reversing EMT. J Exp Clin Cancer Res. 2018;37:73.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSang X, Han J, Wang Z, Cai W, Liao X, Kong Z, Yu Z, Cheng H, Liu P. SGK1 suppresses ferroptosis in ovarian cancer via NRF2-dependent and -independent pathways. Oncogene. 2024;43:3335\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang M, Xue Y, Shen L, Qin P, Sang X, Tao Z, Yi J, Wang J, Liu P, Cheng H. Inhibition of SGK1 confers vulnerability to redox dysregulation in cervical cancer. Redox Biol. 2019;24:101225.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiang X, Lan C, Jiao G, Fu W, Long X, An Y, Wang K, Zhou J, Chen T, Li Y, et al. Therapeutic inhibition of SGK1 suppresses colorectal cancer. Exp Mol Med. 2017;49:e399.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu C, Yosef N, Thalhamer T, Zhu C, Xiao S, Kishi Y, Regev A, Kuchroo VK. Induction of pathogenic TH17 cells by inducible salt-sensing kinase SGK1. Nature. 2013;496:513\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYan J, Wan P, Choksi S, Liu ZG. Necroptosis and tumor progression. Trends Cancer. 2022;8:21\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMorgan MJ, Kim YS. RIPK3 in necroptosis and cancer. Mol Cells. 2025;48:100199.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDabravolski SA, Kalmykov VA, Maksaeva AO, Rozhkova UV, Lapshina KO, Orekhov AN. Necroptosis in myocardial ischaemia-reperfusion injury: current update on mechanisms, therapeutic targets, and translational potential. Apoptosis. 2025;30:1216\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBalusu S, De Strooper B. The necroptosis cell death pathway drives neurodegeneration in Alzheimer's disease. Acta Neuropathol. 2024;147:96.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMeier P, Legrand AJ, Adam D, Silke J. Immunogenic cell death in cancer: targeting necroptosis to induce antitumour immunity. Nat Rev Cancer. 2024;24:299\u0026ndash;315.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhou Y, Cai Z, Zhai Y, Yu J, He Q, He Y, Jitkaew S, Cai Z. Necroptosis inhibitors: mechanisms of action and therapeutic potential. Apoptosis. 2024;29:22\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQi J, Wang J, Zhang Y, Long H, Dong L, Wan P, Zuo Z, Chen W, Song Z. High-Salt-Diet (HSD) aggravates the progression of Inflammatory Bowel Disease (IBD) via regulating epithelial necroptosis. Mol Biomed. 2023;4:28.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang Y, Jia H, Gao K, Du MF, Chu C, Wang D, Ma Q, Hu GL, Zhang X, Sun Y, et al. Renalase alleviates salt-induced kidney necroptosis and inflammation. Hypertens Res. 2024;47:2811\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"high-salt diet, colorectal cancer, SGK1, necroptosis, RIPK1/RIPK3/MLKL signaling pathway","lastPublishedDoi":"10.21203/rs.3.rs-6947907/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6947907/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cb\u003eIntroduction\u003c/b\u003e: The purpose of this study was to explore the potential mechanism of high salt diet on the progression of colorectal cancer.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMethods\u003c/b\u003e: Colorectal cancer cells Caco-2 and HT-29 were treated with varying concentrations of sodium chloride. Flow cytometry was used to assess apoptosis in each group, wound healing assays were employed to evaluate cell migration, and Transwell assays were conducted to measure cell invasion. The expression levels of SGK1 in each group were analyzed using qRT-PCR and WB. Subsequently, SGK1 interfering vectors were constructed and transfected into the cells, and their effects on apoptosis, migration, invasion, and the expression of necroptosis-related proteins in colorectal cancer cells were investigated. Finally, the impact of a high-salt diet on tumor growth was examined by analyzing tumor formation in nude mice.\u003c/p\u003e\u003cp\u003e\u003cb\u003eResults\u003c/b\u003e: High-dose sodium chloride exposure significantly enhances the migration and invasion capabilities of Caco-2 and HT-29 cells while upregulating the expression of SGK1. Introducing an SGK1 interference vector effectively attenuates the sodium chloride-induced increase in migration and invasion abilities of colorectal cancer cells and promotes necroptosis in these cells. In vivo experiments in mice demonstrate that a high-salt diet accelerates the progression of colorectal cancer, whereas treatment with SGK1 inhibitors suppresses tumor growth in mouse models.\u003c/p\u003e\u003cp\u003e\u003cb\u003eConclusion\u003c/b\u003e: High-salt diet can enhance the malignant biological behavior of colorectal cancer cells and promote in vivo colorectal cancer growth by upregulating SGK1 expression.\u003c/p\u003e","manuscriptTitle":"High-salt diet promote colorectal cancer progression by inhibiting necroptosis via SGK1","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-22 02:21:49","doi":"10.21203/rs.3.rs-6947907/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c6b54422-1a24-4c12-b5d5-09023814b486","owner":[],"postedDate":"August 22nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-01T07:53:09+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-22 02:21:49","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6947907","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6947907","identity":"rs-6947907","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.