Canine Dirofilaria immitis Infection in a Tropical Area Recently Colonized by the parasite

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract In Brazil, the nematode Dirofilaria immitis is endemic throughout the coastal region, but the distribution pattern has changed in recent years in places previously without occurrence or with low prevalence. The Baixada Fluminense in the state of Rio de Janeiro, Brazil, once considered a region free of canine heartworm disease, has raised growing concerns about the etiological profile of D. immitis . The region, known for its ecological diversity, has favorable conditions for the maintenance and spread of the nematode, providing important insights into the endemicity of the disease in relation to the socio-environmental determinants of the area. The aim was to evaluate the risk factors related to the circulation of dogs susceptible to Dirofilaria immitis infection that influence prevalence in the municipalities of Duque de Caxias and Magé, Baixada Fluminense, RJ. Between 2022 and 2024, active search was carried out on dogs living near environmental conservation areas. A total of 260 blood samples were collected and sent for serological, parasitological and molecular analysis. The seroprevalence of filarioids in dogs was 20% (52/260), confirming the species D. immitis and Acanthocheilonema reconditum by molecular analysis (42.3%; 22/52). Only 9 microfilaremic samples were antigen negative, therefore 23.5% (61/260) of the dogs were infected by D. immitis . Health education ef-forts should be undertaken to increase awareness of canine heartworm disease among professionals and pet owners.
Full text 99,896 characters · extracted from preprint-html · click to expand
Canine Dirofilaria immitis Infection in a Tropical Area Recently Colonized by the parasite | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Canine Dirofilaria immitis Infection in a Tropical Area Recently Colonized by the parasite Viviane Marques Andrade Vieira, Priscila Pinho Silva, Victor Souza Leão, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8996842/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 8 You are reading this latest preprint version Abstract In Brazil, the nematode Dirofilaria immitis is endemic throughout the coastal region, but the distribution pattern has changed in recent years in places previously without occurrence or with low prevalence. The Baixada Fluminense in the state of Rio de Janeiro, Brazil, once considered a region free of canine heartworm disease, has raised growing concerns about the etiological profile of D. immitis . The region, known for its ecological diversity, has favorable conditions for the maintenance and spread of the nematode, providing important insights into the endemicity of the disease in relation to the socio-environmental determinants of the area. The aim was to evaluate the risk factors related to the circulation of dogs susceptible to Dirofilaria immitis infection that influence prevalence in the municipalities of Duque de Caxias and Magé, Baixada Fluminense, RJ. Between 2022 and 2024, active search was carried out on dogs living near environmental conservation areas. A total of 260 blood samples were collected and sent for serological, parasitological and molecular analysis. The seroprevalence of filarioids in dogs was 20% (52/260), confirming the species D. immitis and Acanthocheilonema reconditum by molecular analysis (42.3%; 22/52). Only 9 microfilaremic samples were antigen negative, therefore 23.5% (61/260) of the dogs were infected by D. immitis . Health education ef-forts should be undertaken to increase awareness of canine heartworm disease among professionals and pet owners. Dirofilaria immitis risk-factors seroprevalence Enzootic cycle Modified Knott Immunochromatography Baixada Fluminense Introduction The nematode Dirofilaria immitis and its endosymbiont Wolbachia are the agents of the mosquito-borne heartworm disease (Bandi et al. 2001 ; Hise et al. 2004 ; Simón et al. 2007 ). They infect different groups of mammals, especially canids, causing lesions ranging from asymptomatic to severe cardiopulmonary clinical signs. In ecotone areas where urbanization encroaches natural settings, domestic dogs become the most affected species (Labarthe et al. 2014 ), although other species such as cats and humans may also be infected (McCall et al. 2008 ; Mendes-de-Almeida et al. 2021 ). The predilection site of adult worms are the pulmonary arteries and right ventricle of canids where they produce and release microfilariae into the bloodstream of the host (Kotani and Powers 1982 ). The larvae are picked up by the vector mosquitoes during their blood meal on the microfilaremic host. The larvae develop into infective stage (L3) in the vector (extrinsic cycle) and await in the head spaces for the next blood meal, when it leaves the mosquito and infects the host (McGreevy et al. 1974 ). The prevalence of heartworm infections is higher in tropical areas due to the heat favoring mosquito density and the extrinsic cycle (Slocombe JOD et al. 1989 ). In Brazil the most competent vector of the Americas, the exophilic salt marsh species Ochlerotatus taeniorhynchus enhances the transmission capacity by sharing territories with the sylvatic and hemisynanthropic vector Ochlerotatus scapularis , frequently reported at ecotones of natural lowland areas (Labarthe et al. 1998a , b ). Therefore, the Brazilian sea shore nearby natural areas provide conditions for transmission to occur. In those areas, when there are unprotected dogs mingled with infected microfilaremic, canids mosquitoes infection is favored and consequently, a focus may develop. The coastal areas of the state of Rio de Janeiro are recognized as presenting the highest number of heartworm infected dogs in Brazil (Labarthe et al. 2014 ). Even so, in the municipalities of Magé and Duque de Caxias there were no reports of the infection until 2017 (De Andrade Vieira et al. 2024 ). Not long afterwards, a survey conducted in Baixada Fluminense area tested dogs with access to veterinary care, detecting 13.2% seroprevalence (Guedes et al. 2024 ). Therefore, due to the rapid spread and apparent increase in canine heartworm infections in the area that gathers natural conserved areas, ecotones, low-income human population, coastal shore and tropical climate, a survey was conducted to evaluate the seroprevalence and risk factors of heartworm infection for the canine population without access to veterinary services. Materials and Methods Sample collection The included municipalities are mostly located on a lowlands area spreading from the Atlantic coast to highlands covered by Atlantic Forest. The land use includes rural areas and human low-income homes. There is intense touristic activity at the waterfalls of the natural areas. Dogs included in the survey should be aged over 12 months and have never received chemoprophylaxis. The owners formally consented with the inclusion of their dogs in the survey and provided information on the dog’s demographics, lifestyle, health status and clinical signs and blood samples were collected. Each sample was transferred into two EDTA containing tubes. One tube was stored at -20 ºC for molecular assay and the other reserved for parasitological tests. Parasitological tests were performed to detect microfilariae by modified Knott’s test (Newton and Wright 1956 ) and to detect D. immitis antigen using immunochromatographic assays no longer than five days later. Dogs were considered infected when they tested either antigens or microfilariae morphologically identified as D. immitis positive. When there were doubts on the microfilariae identification, the sample was further tested by molecular assay. Molecular analyses DNAg was extracted from whole blood sample using the QIAamp® DNA Blood Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer recommendations and stored at -20°C until the multiplex PCR. For filarioid detection the multiplex polymerase chain reactions (PCR) were performed using a general pair 12S rDNA gene 12SF (5’- GTTCCAGAATAATCGGCTA − 3’) and 12SR (5’- ATTGACGGATG(AG)TTTGTACC − 3’) for the detection of filarial nematodes, and the other primer pair of one oligonucleotide specific for D. immitis − 12SF2B (5’- TTTTTACTTTTTTGGTAATG − 3’) (Simsek and Ciftci 2016 ), according to previously established protocols. The preparation of the solutions and the conditions of the PCR runs were based upon previous studies (Casiraghi et al. 2004 , 2006 ; Gioia et al. 2010 ). D. immitis DNAg (adult worm) was used as a positive control and ultrapure water as a negative control. The amplified DNA fragments were subjected in a 2% agarose gel for electrophoresis, stained with ethidium bromide and visualized under ultraviolet light (Sambrook and Russell 2001 ). Sequences were read on an ABI 3730xl DNA Analyzer (Applied Biosystems). The sequences obtained (GenBank accession numbers PP949214- PP949216) were edited in the CHROMASPRO software, version 1.5 (Technelysium Pty Ltd, Tewantin, QLD, Australia) and identified by similarity assessment through comparative analysis with sequences deposited in GenBank using BLASTN ( https://blast.ncbi.nlm.nih.gov/Blast.cgi ). Statistical analyses The associations between each of the potential risk factors for D. immitis (Odds ratio analysis) were carried out separately using univariable binomial regression. The risk factors considered were coat, sex, age, breed, weight, travel and shipping. Factors with p 0.05 in the univariate analysis were considered for inclusion in a multivariate regression model, which was constructed by reverse elimination. The analyses were carried out in Statistical Package for the Social Sciences SPSS software (IBMR), version 29.0.1.0. Results A total of 260 blood samples were included. Of those, 37 (14.2%) were microfilaremic and 52 (20%) were antigenemic. A total of 17 (46%) microfilaremic samples presented microfilariae that could not be morphologically identified as D. immitis . All the 17 samples examined by PCR presented mono infection either by Acanthocheilonema reconditum or D. immitis. Out of those, two presented microfilariae of A. reconditum (2/17, 11,8%) and 15 (88,2%) of D. immitis , therefore 35 (13.5%) samples presented D. immitis microfilariae. Only 9 microfilaremic samples were antigen negative, therefore 23.5% (61/260) of the dogs were infected by D. immitis (Table 1 ). No sample presented microfilariae of Dirofilaria repens . Table 1 Antigen and microfilariae (mff) of Dirofilaria immitis detected in canine blood samples from Duque de Caxias and Magé, Rio de Janeiro metro area, Rio de Janeiro State, Brazil. Antigen test mff + (%) mff - (%) Antigen (+) 26 (74.3) 26 (11.6) Antigen (-) 9 (25.7) 199 (88.4) Total 35 225 mff +: microfilariae detected mff -: microfilariae no detected Of the animals examined, 84.2% (219/260) lived in the municipality of Duque de Caxias and 15.7% (41/260) in the municipality of Magé. In the municipality of Duque de Caxias 80.7% (42/52) of the dogs were infected with the filarioid. The frequency of dog’s positive for D. immitis was higher in males (55.7%; 29/52) than in females (44.2%; 23/52). Animals of undetermined breed were the most parasitized (20.5%). Most dogs were always kept at home, never traveling. Only 13 dogs travelled and travelling showed no influence on infection. No factor tested in the univariate analysis was significant for D. immitis p > 0.05 (Table 2 ). Table 2 Potential risk factors for canine heartworm infection in dogs living in Baixada Fluminense, Rio de Janeiro State, Brazil Risk factor N Dirofilaria immitis n (%) Odds ratio (95% CI) p value Total samples 260 52 (20) Breed No Yes 234 26 48 (20.5) 4 (15.4) 1.42 (0.46–4.31) 0.71 Sex Male Female 117 143 29 (24.8) 23 (16.1) 1.21 (0.87–1.71) 0.2966 Age ≤ 7 year > 7 year 163 92 26 (16.0) 24 (26.0) 0.54 (0.20–1.01) 0.07 Weight ≤ 10 kg > 10 Kg 87 152 12 (13.8) 33 (21.7) 0.41 (0.28–0.51) 0.68 Coat color Light Dark 44 208 11 (25.0) 39 (18.7) 1.44 (0.57–1.31) 0.46 Coat length Short Medium-long 111 156 41 (36.9) 34 (21.8) 1.25 (0.71–3.89) 0.71 Travel history Yes No 13 247 1 (7.7) 51 (20.6) 0.32 (0.04–2.52) 0.43 Discussion In Brazil, the Coastal regions of the south (Santa Catarina and Paraná), southeast (Rio de Janeiro and São Paulo) and northeast (Bahia and Pernambuco) are endemic for canine heartworm disease (Labarthe et al. 2014 ), but there is evidence of the disease in non-coastal regions with an eco-epidemiological scenario that favors infection with D. immitis in dogs (Santos et al. 2021 ; De Andrade Vieira et al. 2022 ; Sebolt et al. 2022 ). It is true that the epidemiological panorama has changed with the occurrence of frequent cases due to recent climate change and the expansion of the global economy in recent years (Meireles et al. 2014 ). The presence of microfilaremic dogs in the Baixada Fluminense region is a worrying factor within the One Health concept (Fontes-Sousa et al. 2019 ), as cases of human heartworm disease have already been reported in areas where there are infected dogs, whether rural or urban (Zumaquero et al. 2020 ; Mendoza-Roldan et al. 2021 ). The prevalence in five municipalities of the Baixada Fluminense region was previously reported to range from 2.85 to 3.4% (De Andrade Vieira et al. 2022 , 2024 ). In this study, despite the high prevalence observed (20%), there was no statistical significance between the variables analyzed. The last update study of canine heartworm disease in the Brazilian coastal region (Labarthe et al. 2014 ), showed that the high prevalence of canine heartworm disease may be associated with environmentally protected areas. Although none of the biometric and phenotypic patterns of dogs showed a significant association with antigen test positivity, some individual characteristics such as short, dark hair and weight over 10 kg had similar results to those reported before in Rio de Janeiro (Labarthe et al. 2014 ; Guedes et al. 2024 ). Older dogs (≤ 7 years) were more infected as also observed before (De Argôlo et al. 2018 ), suggesting that time favors the infection. Male dogs were the most infected in the area as already reported (De Andrade Vieira et al. 2024 ), although this is not the first report showing males as prone to the infection, it must be cautiously analyzed once spaying and neutering are uncommon in the area, leading to females being better cared for to avoid pregnancy. Since it has been shown that a prevalence of at least 20% is needed to allow odds ratio analysis in each area (Labarthe et al. 2014 ), it would be expected that the risk factors for D. immitis infection could be determined in the present study. Once it cannot be determined, the small sample size must be considered as a limiting factor. The fact that most of the animals have not travelled recently suggests that they were infected in their region of origin and that the cases can be considered autochthonous. The primary vectors of D. immitis in the state of Rio de Janeiro are crepuscular or nocturnal, sylvatic, hemisynantropic, and eclectic Ochlerotatus mosquitoes (Labarthe et al. 1998a , b ). The region, known for its ecological diversity, has favorable conditions for the maintenance and spread of the nematode, providing important insights into the endemicity of the disease in relation to the socio-environmental determinants of the area. Other filarioids, such as A. reconditum , have been frequently reported in dogs in some regions of Brazil (Ramos et al. 2016 ; De Argôlo et al. 2018 ), and although they are not pathogenic to these animals, their zoonotic potential should be considered. Recent studies have shown that Magé is the municipality with the highest prevalence of infection between 2017 and 2020, compared to the prevalence in Duque de Caxias in all those years (Vieira VMA 2019 ; De Andrade Vieira et al. 2022 , 2024 ). In relation to the socio-environmental conditions of these municipalities assessed during the active search, it was observed that the lack of environmental sanitation and improper management of solid waste, recent civil constructions, as well as the fact that houses are located near protected areas (or beach areas), provide favorable environments for the reproduction of culicidae vectors of D. immitis , associated with the transit of stray and resident animals between protected areas, are risk factors that outline the enzootic profile of heartworm disease, contributing to the establishment of the disease in the municipalities. Dogs are the most common and abundant carnivores in Brazil's Atlantic Forest regions and the presence of these animals in rural or peri-urban landscapes accompanying humans in work or leisure activities, for example, is a threat to wildlife in the transmission of pathogens causing a zoonotic spillover (Ellwanger and Chies 2021 ), in addition to competition and predation on native animals (Ribeiro et al. 2019 ). Therefore, integrated management actions for the maintenance and preservation of environmental conservation areas, in addition to dog population control, must be carried out to avoid the imbalance of biodiversity by bringing invasive vector species in the transmission of bioagents of importance to public health. There is no current survey in the region of possible vectors competent in the transmission of D. immitis , but studies already carried out in some municipalities of the Baixada Fluminense region have shown the presence of the species Ae. aegypti , Ae. albopictus , Ochlerotatus scapularis , Oc. taeniorhynchus involved in the transmission of arboviruses, i.e. the same species described as competent vectors for the transmission of stage 3 larvae of D. immitis (Labarthe et al. 1998a ; Bendas et al. 2017 ). In both suburban and urban areas, human activities are associated with a greater presence of disease-transmitting vectors, and changes in mosquito density can affect the prevalence of heartworm disease in dogs in certain regions (Spence Beaulieu et al. 2020 ). Therefore, an entomological survey of culicid vectors in protected areas is known to be necessary for taxonomic identification in conjunction with a molecular tool for the detection of D. immitis . Global warming and climate change significantly influence the epidemiology of these nematodes by accelerating their rate of development within vectors, thus facilitating their spread and extending their geographical distribution to regions previously considered to be free of the disease. Heartworm infection rate was high, higher than those reported before, despite the overall high availability of heartworm preventatives in Brazil. Since Heartworm is a zoonotic parasite transmitted by mosquitoes frequently found in the surveyed area, health personnel must be aware of the hazard this parasite imposes in the area. Conclusions The presence of microfilaremic dogs in Duque de Caxias and in Magé poses a greater hazard than in known endemic areas once the spillover to infect humans is possible in an area where the awareness is low among veterinarians and human health professionals. The factors evaluated in the canine population in this study, together with the socio-environmental determinants found in the localities, condition the maintenance of infection by D. immitis , increasing the possibility of the emergence of heartworm disease. Abbreviations The following abbreviations are used in this manuscript: mff Microfilariae EDTA Ethylenediamine tetraacetic acid ºC Degree Celsius DNAg Genomic DNA PCR Polymerase Chain Reaction Yr Year Kg Kilogram Declarations Competing interest The authors declare no competing interests Ethical standards The study was approved by the Animal Use Ethics Committee of the Oswaldo Cruz Institute/ Oswaldo Cruz Foundation (CEUA-IOC-L009/2020) and by the Oswaldo Cruz Institute/ Oswaldo Cruz Foundation Human Research Ethics Committee (CEP CAAE: 30759620.1.0000.5248). Funding This study was conducted with the support of (CAPES - funding code 001) and Plano de Objetivos e Metas (POM) of the Laboratório de Inovações em Terapias, Ensino e Bioprodutos – LITEB and Laboratório de Carrapatos e Outros Artrópodes Ápteros - Referência Nacional em Vetores das Riquetsioses (LAC), Instituto Oswaldo Cruz, Fiocruz. Author Contribution **Conceptualization:** Viviane Marques de Andrade Vieira, Antonio Henrique Almeida de Moraes Neto and Gilberto Salles Gazêta; **Writing-original draft preparation:** Viviane Marques de Andrade Vieira, **Writing – review and editing:** Antonio Henrique Almeida de Moraes Neto and Gilberto Salles Gazêta, **Formal analysis and investigation:** Viviane Marques de Andrade Vieira and Priscila Pinho da Silva; **Methodology:** Viviane Marques de Andrade Vieira, Priscila Pinho da Silva, Victor de Souza Leão, Ana Beatriz Paes Borsoi, Karla Bitencourth, Ingrid Benevides Machado, Mariana Guimarães Côrtes da Cruz. **Funding acquisition:** Antonio Henrique Almeida de Moraes Neto and Gilberto Salles Gazêta; **Supervision:** Antonio Henrique Almeida de Moraes Neto and Gilberto Salles Gazêta.All authors read and approved the final manuscript. Acknowledgement We would like to thank Dr. Norma Labarthe, Dr. Jonimar Paiva (in memoriam), and Dr. Bruno Alberigi for their valuable guidance and recommendations during the course of the project. Data Availability Data will be made available on request. References Bandi C, Trees AJ, Brattig NW (2001) Wolbachia in filarial nematodes: evolutionary aspects and implications for the pathogenesis and treatment of filarial diseases. Vet Parasitol 98:215–238. https://doi.org/10.1016/S0304-4017(01)00432-0 Bendas AJR, Mendes-de-Almeida F, Guerrero J, Labarthe N (2017) Atualização sobre a epidemiologia de Dirofilaria immitis na América do Sul e no México: revisão de literatura. Braz J Vet Res Anim Sci 54:319. https://doi.org/10.11606/issn.1678-4456.bjvras.2017.132572 Casiraghi M, Bain O, Guerrero R et al (2004) Mapping the presence of Wolbachia pipientis on the phylogeny of filarial nematodes: evidence for symbiont loss during evolution. Int J Parasitol 34:191–203. https://doi.org/10.1016/j.ijpara.2003.10.004 Casiraghi M, Bazzocchi C, Mortarino M et al (2006) A simple molecular method for discriminating common filarial nematodes of dogs (Canis familiaris). Vet Parasitol 141:368–372. https://doi.org/10.1016/j.vetpar.2006.06.006 De Andrade Vieira VM, Da Silva PP, Paulino ÉT et al (2024) Epidemiological analysis of Dirofilaria immitis (Spirurida: Onchocercidae) infecting pet dogs (Canis lupus familiaris, Linnaeus, 1758) in Baixada Fluminense, Rio de Janeiro. Front Vet Sci 11:1360593. https://doi.org/10.3389/fvets.2024.1360593 De Andrade Vieira VM, Martiniano NOM, Da Silva PP et al (2022) Molecular characterization of canine filarioids in a previously non-endemic area of Rio de Janeiro State, Brazil. Parasitol Res 121:925–932. https://doi.org/10.1007/s00436-022-07433-7 De Argôlo EGG, Reis T, Fontes DAT et al (2018) Canine filariasis in the Amazon: Species diversity and epidemiology of these emergent and neglected zoonoses. PLoS ONE 13:e0200419. https://doi.org/10.1371/journal.pone.0200419 Ellwanger JH, Chies JAB (2021) Zoonotic spillover: Understanding basic aspects for better prevention. Genet Mol Biol 44:e20200355. https://doi.org/10.1590/1678-4685-gmb-2020-0355 Fontes-Sousa AP, Silvestre-Ferreira AC, Carretón E et al (2019) Exposure of humans to the zoonotic nematode Dirofilaria immitis in Northern Portugal. Epidemiol Infect 147:e282. https://doi.org/10.1017/S0950268819001687 Gioia G, Lecová L, Genchi M et al (2010) Highly sensitive multiplex PCR for simultaneous detection and discrimination of Dirofilaria immitis and Dirofilaria repens in canine peripheral blood. Vet Parasitol 172:160–163. https://doi.org/10.1016/j.vetpar.2010.04.027 Guedes M, Gomes T, Alberigi B et al (2024) Evaluation of Seroprevalence and Risk Factors of Heartworm Infection for Dogs in Rio de Janeiro with Access to Veterinary Care. Acta Parasit. https://doi.org/10.1007/s11686-024-00859-2 Hise AG, Gillette-Ferguson I, Pearlman E (2004) The role of endosymbiotic Wolbachia bacteria in filarial disease. Cell Microbiol 6:97–104. https://doi.org/10.1046/j.1462-5822.2003.00350.x Kotani T, Powers KG (1982) Developmental stages of Dirofilaria immitis in the dog. Am J Vet Res 43:2199–2206 Labarthe N, Serrão ML, Fontenele Melo Y et al (1998a) Mosquito Frequency and Feeding Habits in an Enzootic Canine Dirofilariasis Area in Niterói, State of Rio de Janeiro, Brazil. Mem Inst Oswaldo Cruz 93:145–154. https://doi.org/10.1590/S0074-02761998000200002 Labarthe N, Serrão ML, Melo YF et al (1998b) Potential Vectors of Dirofilaria immitis (Leidy, 1856) in Itacoatiara, Oceanic Region of Niterói Municipality, State of Rio de Janeiro, Brazil. Mem Inst Oswaldo Cruz 93:425–432. https://doi.org/10.1590/S0074-02761998000400001 Labarthe NV, Pereira Paiva J, Reifur L et al (2014) Updated canine infection rates for Dirofilaria immitis in areas of Brazil previously identified as having a high incidence of heartworm-infected dogs. Parasites Vectors 7:493. https://doi.org/10.1186/s13071-014-0493-7 McCall JW, Genchi C, Kramer LH et al (2008) Chap. 4 Heartworm Disease in Animals and Humans. Advances in Parasitology. Elsevier, pp 193–285 McGreevy PB, Theis JH, Lavoipierre MMJ, Clark J (1974) Studies on filariasis. III. Dirofilaria immitis : emergence of infective larvae from the mouthparts of Aedes aegypti . J Helminthol 48:221–228. https://doi.org/10.1017/S0022149X00022896 Meireles J, Paulos F, Serrão I (2014) Dirofilariose em cães e gatos. 109:70–74 Mendes-de-Almeida F, Alves LC, Do Amaral Fernandes P et al (2021) Infection with Dirofilaria immitis and Other Infections in Cats and Dogs from Rio de Janeiro, Brazil: The Need for Prophylactic Enforcement. Acta Parasit 66:962–968. https://doi.org/10.1007/s11686-021-00345-z Mendoza-Roldan JA, Gabrielli S, Cascio A et al (2021) Zoonotic Dirofilaria immitis and Dirofilaria repens infection in humans and an integrative approach to the diagnosis. Acta Trop 223:106083. https://doi.org/10.1016/j.actatropica.2021.106083 Newton WL, Wright WH (1956) The occurrence of a dog filariid other than Dirofilaria immitis in the United States. J Parasitol 42:246–258 Ramos RAN, De Oliveira Do Rêgo AG, De Farias Firmino ED et al (2016) Filarioids infecting dogs in northeastern Brazil. Vet Parasitol 226:26–29. https://doi.org/10.1016/j.vetpar.2016.06.025 Ribeiro FS, Nichols E, Morato RG et al (2019) Disturbance or propagule pressure? Unravelling the drivers and mapping the intensity of invasion of free-ranging dogs across the Atlantic forest hotspot. Divers Distrib 25:191–204. https://doi.org/10.1111/ddi.12845 Sambrook J, Russell D (2001) Clonagem Molecular: Um Manual de Laboratório, 3rd edn. Nova York Santos MD, Alberigi B, Balius DMP et al (2021) Canine heartworm: natural infection along remote coastal area of Rio de Janeiro. Braz J Vet Med 43:e000220. https://doi.org/10.29374/2527-2179.bjvm000220 Sebolt APR, Snak A, De Lima FR et al (2022) Prevalence and risk factors for Dirofilaria immitis in dogs from Laguna, Santa Catarina, Brazil. Veterinary Parasitology: Reg Stud Rep 29:100697. https://doi.org/10.1016/j.vprsr.2022.100697 Simón F, Kramer LH, Román A et al (2007) Immunopathology of Dirofilaria immitis Infection. Vet Res Commun 31:161–171. https://doi.org/10.1007/s11259-006-3387-0 Simsek S, Ciftci AT (2016) Serological and Molecular Detection of Dirofilaria Species in Stray Dogs and Investigation of Wolbachia DNA by PCR in Turkey. J Arthropod Borne Dis 10:445–453 Slocombe JOD, Surgeoner GA, Srivastava B (1989) Determination of the heartworm transmission period and its used in diagnosis and control. Charleston, SC, pp 19–26 Spence Beaulieu MR, Federico JL, Reiskind MH (2020) Mosquito diversity and dog heartworm prevalence in suburban areas. Parasites Vectors 13:12. https://doi.org/10.1186/s13071-019-3874-0 Vieira VMA (2019) Potencial zoonótico por Dirofilaria immitis (leidy, 1856) Raillet & Henry, 1911 na Baixada Fluminense do Rio de Janeiro. Dissertação Zumaquero L, Simón F, Carretón E et al (2020) Prevalence of canine and human dirofilariosis in Puebla, Mexico. Vet Parasitol 282:109098. https://doi.org/10.1016/j.vetpar.2020.109098 Additional Declarations No competing interests reported. Supplementary Files PCR051022.tif PCR0108032023.tif PCRDIRO060623.tif DIRO180324.tif PCR0225052023.tif comtroles020424.tif PCRDIRO220124.jpg PCRDIRO220124GELP2.jpg PCRDIRO180423.tif PCRDIRO190623.tif PCRDIRO210324.tif PCRDIRO070623.tif PCRDIRO220124GELP1.jpg PCRDIRO070823.tif PCRDIRO070823B.tif PCRDIRO11032024.tif PCRDIRO14072023.2.tif PCRDIRO14072023.tif PCRDIRO230123.tif TesteDiro06072023.tif Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 24 Apr, 2026 Reviews received at journal 14 Apr, 2026 Reviewers agreed at journal 23 Mar, 2026 Reviewers agreed at journal 15 Mar, 2026 Reviewers invited by journal 13 Mar, 2026 Editor assigned by journal 10 Mar, 2026 Submission checks completed at journal 10 Mar, 2026 First submitted to journal 28 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8996842","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":606304607,"identity":"dfcdf9d3-9469-4ec6-a6fa-550f8c480f14","order_by":0,"name":"Viviane Marques Andrade Vieira","email":"","orcid":"","institution":"Oswaldo Cruz Institute, Oswaldo Cruz Foundation (LITEB/IOC/FIOCRUZ)","correspondingAuthor":false,"prefix":"","firstName":"Viviane","middleName":"Marques Andrade","lastName":"Vieira","suffix":""},{"id":606304608,"identity":"47d218e7-3574-4ba8-aed8-136095a6e1e7","order_by":1,"name":"Priscila Pinho Silva","email":"","orcid":"","institution":"Oswaldo Cruz Institute, Oswaldo Cruz Foundation (LITEB/IOC/FIOCRUZ)","correspondingAuthor":false,"prefix":"","firstName":"Priscila","middleName":"Pinho","lastName":"Silva","suffix":""},{"id":606304609,"identity":"539bea1d-ff46-4b90-a9f8-fbb6b09799d1","order_by":2,"name":"Victor Souza Leão","email":"","orcid":"","institution":"Oswaldo Cruz Institute, Oswaldo Cruz Foundation (LITEB/IOC/FIOCRUZ)","correspondingAuthor":false,"prefix":"","firstName":"Victor","middleName":"Souza","lastName":"Leão","suffix":""},{"id":606304610,"identity":"04cf125c-ce1c-4da9-9206-c87f657fced3","order_by":3,"name":"Ana Beatriz Pais Borsoi","email":"","orcid":"","institution":"Oswaldo Cruz Institute, Oswaldo Cruz Foundation (LAC/IOC/FIOCRUZ)","correspondingAuthor":false,"prefix":"","firstName":"Ana","middleName":"Beatriz Pais","lastName":"Borsoi","suffix":""},{"id":606304611,"identity":"276feb4a-0298-4084-a7da-88096307cb97","order_by":4,"name":"Karla Bitencourth","email":"","orcid":"","institution":"Oswaldo Cruz Institute, Oswaldo Cruz Foundation (LAC/IOC/FIOCRUZ)","correspondingAuthor":false,"prefix":"","firstName":"Karla","middleName":"","lastName":"Bitencourth","suffix":""},{"id":606304612,"identity":"f9169486-5ee7-489d-b418-bdf5b8864a48","order_by":5,"name":"Ingrid Benevides Machado","email":"","orcid":"","institution":"Oswaldo Cruz Institute, Oswaldo Cruz Foundation (LAC/IOC/FIOCRUZ)","correspondingAuthor":false,"prefix":"","firstName":"Ingrid","middleName":"Benevides","lastName":"Machado","suffix":""},{"id":606304613,"identity":"87ef3ea3-fd91-4583-9180-3bad48e8673d","order_by":6,"name":"Mariana Guimarães Côrtes Cruz","email":"","orcid":"","institution":"Oswaldo Cruz Institute, Oswaldo Cruz Foundation (LAC/IOC/FIOCRUZ)","correspondingAuthor":false,"prefix":"","firstName":"Mariana","middleName":"Guimarães Côrtes","lastName":"Cruz","suffix":""},{"id":606304614,"identity":"91968a85-80f4-410d-80c1-f36f1fdebcb5","order_by":7,"name":"Gilberto Salles Gazêta","email":"","orcid":"","institution":"Oswaldo Cruz Institute, Oswaldo Cruz Foundation (LAC/IOC/FIOCRUZ)","correspondingAuthor":false,"prefix":"","firstName":"Gilberto","middleName":"Salles","lastName":"Gazêta","suffix":""},{"id":606304615,"identity":"4d308f12-fa52-4ea0-9cd8-c423d39db35d","order_by":8,"name":"Antonio Henrique Almeida Moraes Neto","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABQklEQVRIiWNgGAWjYNACA2QO88EGMM0PIhIKsChnRtUiwcCWCNEiCaISDHBoQQJALQlQqw9gOABi++z+g48LCmyi+aUPP3z4c4dNHT8bc+ODn3sO2xufX5344YEBgzy/2AEUQ+8cZjaeYZCWO7MvzdiY90yahGQbY7Nhz7PDzGY33m6WADrMcObsBBRrbiSzSfMYHM7dcIbBTJqx7bCEwf3GNmmGA4fZzG6c3QDSkmBwG0WLPEIL+/efP9v+SxgcYwRr4TGecXbzDyxaDBBaeMwYeNsOwLVIGPD3bsNmi+GNZGNjHpBfeniKpXnbkiVngv1yIN1A4gbvNosEAwl0v8jdSHz4mOePTW4/D/vGjz/b7Pj52dgfPvhxwNqev//s5ps/Kmzk+aVRvY8HSIBVShCrHAT4D5CiehSMglEwCoYvAAB5sHd6m7xEHAAAAABJRU5ErkJggg==","orcid":"","institution":"Oswaldo Cruz Institute, Oswaldo Cruz Foundation (LITEB/IOC/FIOCRUZ)","correspondingAuthor":true,"prefix":"","firstName":"Antonio","middleName":"Henrique Almeida Moraes","lastName":"Neto","suffix":""}],"badges":[],"createdAt":"2026-02-28 16:26:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8996842/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8996842/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105903792,"identity":"6558e729-1d15-4c71-864c-87d0e1b6aa16","added_by":"auto","created_at":"2026-04-01 09:53:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":605601,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/a66409f5-0f3f-4ad4-8f15-f517684422ab.pdf"},{"id":104799230,"identity":"1c8b4994-b694-4b06-bb27-01c6a778bd76","added_by":"auto","created_at":"2026-03-17 10:13:22","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":2630006,"visible":true,"origin":"","legend":"","description":"","filename":"PCR051022.tif","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/5806dc01582eeb494f9e66e6.tif"},{"id":104799208,"identity":"6d9cfb36-40f6-4286-a2dc-13effd106fff","added_by":"auto","created_at":"2026-03-17 10:13:10","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2630006,"visible":true,"origin":"","legend":"","description":"","filename":"PCR0108032023.tif","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/e8f05ba9249ddf292cbe69c8.tif"},{"id":104799163,"identity":"640b3b9b-bd03-4237-8482-71274afeeff6","added_by":"auto","created_at":"2026-03-17 10:12:52","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":2629970,"visible":true,"origin":"","legend":"","description":"","filename":"PCRDIRO060623.tif","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/62e16a78e033c3d1fd10cf25.tif"},{"id":104799183,"identity":"65c03efd-7edc-4a4d-a9c0-4b054e23c73f","added_by":"auto","created_at":"2026-03-17 10:13:04","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":2629998,"visible":true,"origin":"","legend":"","description":"","filename":"DIRO180324.tif","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/21531b6e8477bc213328f909.tif"},{"id":104799215,"identity":"ac80621c-ba2d-4c93-8f15-e91dc82b5324","added_by":"auto","created_at":"2026-03-17 10:13:11","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":2630014,"visible":true,"origin":"","legend":"","description":"","filename":"PCR0225052023.tif","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/49a19bdd33d5b0748cfe0021.tif"},{"id":104799157,"identity":"6bb80754-0046-44dd-a1fc-97720ad7b335","added_by":"auto","created_at":"2026-03-17 10:12:51","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":2630002,"visible":true,"origin":"","legend":"","description":"","filename":"comtroles020424.tif","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/e883507110a4951651df191a.tif"},{"id":104799222,"identity":"712951e5-26eb-47c7-b1d1-b1c91549c624","added_by":"auto","created_at":"2026-03-17 10:13:18","extension":"jpg","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":580056,"visible":true,"origin":"","legend":"","description":"","filename":"PCRDIRO220124.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/27ea3f46af9890ce8c8e0379.jpg"},{"id":104799276,"identity":"a2915d40-1da8-42a4-9ed5-5352a5dfb933","added_by":"auto","created_at":"2026-03-17 10:13:25","extension":"jpg","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":626676,"visible":true,"origin":"","legend":"","description":"","filename":"PCRDIRO220124GELP2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/3445c7a1c2aa7d162b8070d1.jpg"},{"id":104799165,"identity":"713b995c-d07e-4b08-b2ea-ea0be8fdc3f8","added_by":"auto","created_at":"2026-03-17 10:12:53","extension":"tif","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":2629970,"visible":true,"origin":"","legend":"","description":"","filename":"PCRDIRO180423.tif","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/208f1b6452c40ce917a1e2d6.tif"},{"id":104799161,"identity":"f4cd3550-ca9b-4e19-8b71-8cf31a043090","added_by":"auto","created_at":"2026-03-17 10:12:52","extension":"tif","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":2629998,"visible":true,"origin":"","legend":"","description":"","filename":"PCRDIRO190623.tif","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/f7d8de377ef46e53164e5f7e.tif"},{"id":104799123,"identity":"ba245cd3-e05a-49e2-9ca7-879f9aff14b2","added_by":"auto","created_at":"2026-03-17 10:12:45","extension":"tif","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":2629998,"visible":true,"origin":"","legend":"","description":"","filename":"PCRDIRO210324.tif","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/6e8bdabfc9b1b5f31bc18a0f.tif"},{"id":104799217,"identity":"dccc16b0-653d-4b78-969a-6da59c81fb79","added_by":"auto","created_at":"2026-03-17 10:13:12","extension":"tif","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":2629998,"visible":true,"origin":"","legend":"","description":"","filename":"PCRDIRO070623.tif","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/03a24565cba7bccbc8ea12aa.tif"},{"id":104799227,"identity":"b80c00a0-402e-49eb-9772-6f95efb1a20b","added_by":"auto","created_at":"2026-03-17 10:13:20","extension":"jpg","order_by":12,"title":"","display":"","copyAsset":false,"role":"supplement","size":596906,"visible":true,"origin":"","legend":"","description":"","filename":"PCRDIRO220124GELP1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/2fd8ad3cf628c384dbe70159.jpg"},{"id":104799218,"identity":"aef3e103-62fa-4ce3-8e8a-82002fb2afc1","added_by":"auto","created_at":"2026-03-17 10:13:13","extension":"tif","order_by":13,"title":"","display":"","copyAsset":false,"role":"supplement","size":2629970,"visible":true,"origin":"","legend":"","description":"","filename":"PCRDIRO070823.tif","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/305182798c4215d5b6c80cf0.tif"},{"id":104799156,"identity":"e24a73a2-835d-466e-9b95-7f036ce2a18b","added_by":"auto","created_at":"2026-03-17 10:12:51","extension":"tif","order_by":14,"title":"","display":"","copyAsset":false,"role":"supplement","size":2629970,"visible":true,"origin":"","legend":"","description":"","filename":"PCRDIRO070823B.tif","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/c3e737ea480e700efc34c534.tif"},{"id":104799219,"identity":"e48b4a90-d26a-43ad-8da4-f4df6e6bd1d9","added_by":"auto","created_at":"2026-03-17 10:13:14","extension":"tif","order_by":15,"title":"","display":"","copyAsset":false,"role":"supplement","size":2630010,"visible":true,"origin":"","legend":"","description":"","filename":"PCRDIRO11032024.tif","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/7eb1c7f2a1ef68add995c4e8.tif"},{"id":104799395,"identity":"055de649-3899-42c3-979c-f7bca18f83ff","added_by":"auto","created_at":"2026-03-17 10:13:43","extension":"tif","order_by":16,"title":"","display":"","copyAsset":false,"role":"supplement","size":2629970,"visible":true,"origin":"","legend":"","description":"","filename":"PCRDIRO14072023.2.tif","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/dc5e75eb1797c38ce70ba2ac.tif"},{"id":104799134,"identity":"64caa0c6-4928-407b-b2fe-5cf2d5a1d4c2","added_by":"auto","created_at":"2026-03-17 10:12:50","extension":"tif","order_by":17,"title":"","display":"","copyAsset":false,"role":"supplement","size":2629970,"visible":true,"origin":"","legend":"","description":"","filename":"PCRDIRO14072023.tif","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/d15a805db52491df32271052.tif"},{"id":104799281,"identity":"f101d995-6426-4f3d-9b54-30bc03bc91ee","added_by":"auto","created_at":"2026-03-17 10:13:27","extension":"tif","order_by":18,"title":"","display":"","copyAsset":false,"role":"supplement","size":2629970,"visible":true,"origin":"","legend":"","description":"","filename":"PCRDIRO230123.tif","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/7d9b8aeba439343bb9866dfd.tif"},{"id":104799246,"identity":"b2a17ed8-52e2-4e4a-b971-dd31d132db39","added_by":"auto","created_at":"2026-03-17 10:13:23","extension":"tif","order_by":19,"title":"","display":"","copyAsset":false,"role":"supplement","size":2629970,"visible":true,"origin":"","legend":"","description":"","filename":"TesteDiro06072023.tif","url":"https://assets-eu.researchsquare.com/files/rs-8996842/v1/9e64073f3fc16caac24c0b33.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"Canine Dirofilaria immitis Infection in a Tropical Area Recently Colonized by the parasite","fulltext":[{"header":"Introduction","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe nematode \u003cem\u003eDirofilaria immitis\u003c/em\u003e and its endosymbiont \u003cem\u003eWolbachia\u003c/em\u003e are the agents of the mosquito-borne heartworm disease (Bandi et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Hise et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Sim\u0026oacute;n et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). They infect different groups of mammals, especially canids, causing lesions ranging from asymptomatic to severe cardiopulmonary clinical signs. In ecotone areas where urbanization encroaches natural settings, domestic dogs become the most affected species (Labarthe et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), although other species such as cats and humans may also be infected (McCall et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Mendes-de-Almeida et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe predilection site of adult worms are the pulmonary arteries and right ventricle of canids where they produce and release microfilariae into the bloodstream of the host (Kotani and Powers \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e1982\u003c/span\u003e). The larvae are picked up by the vector mosquitoes during their blood meal on the microfilaremic host. The larvae develop into infective stage (L3) in the vector (extrinsic cycle) and await in the head spaces for the next blood meal, when it leaves the mosquito and infects the host (McGreevy et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e1974\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe prevalence of heartworm infections is higher in tropical areas due to the heat favoring mosquito density and the extrinsic cycle (Slocombe JOD et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e1989\u003c/span\u003e). In Brazil the most competent vector of the Americas, the exophilic salt marsh species \u003cem\u003eOchlerotatus taeniorhynchus\u003c/em\u003e enhances the transmission capacity by sharing territories with the sylvatic and hemisynanthropic vector \u003cem\u003eOchlerotatus scapularis\u003c/em\u003e, frequently reported at ecotones of natural lowland areas (Labarthe et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e1998a\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003eb\u003c/span\u003e). Therefore, the Brazilian sea shore nearby natural areas provide conditions for transmission to occur. In those areas, when there are unprotected dogs mingled with infected microfilaremic, canids mosquitoes infection is favored and consequently, a focus may develop.\u003c/p\u003e \u003cp\u003eThe coastal areas of the state of Rio de Janeiro are recognized as presenting the highest number of heartworm infected dogs in Brazil (Labarthe et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Even so, in the municipalities of Mag\u0026eacute; and Duque de Caxias there were no reports of the infection until 2017 (De Andrade Vieira et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Not long afterwards, a survey conducted in Baixada Fluminense area tested dogs with access to veterinary care, detecting 13.2% seroprevalence (Guedes et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTherefore, due to the rapid spread and apparent increase in canine heartworm infections in the area that gathers natural conserved areas, ecotones, low-income human population, coastal shore and tropical climate, a survey was conducted to evaluate the seroprevalence and risk factors of heartworm infection for the canine population without access to veterinary services.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSample collection\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe included municipalities are mostly located on a lowlands area spreading from the Atlantic coast to highlands covered by Atlantic Forest. The land use includes rural areas and human low-income homes. There is intense touristic activity at the waterfalls of the natural areas.\u003c/p\u003e \u003cp\u003eDogs included in the survey should be aged over 12 months and have never received chemoprophylaxis. The owners formally consented with the inclusion of their dogs in the survey and provided information on the dog\u0026rsquo;s demographics, lifestyle, health status and clinical signs and blood samples were collected. Each sample was transferred into two EDTA containing tubes. One tube was stored at -20 \u0026ordm;C for molecular assay and the other reserved for parasitological tests. Parasitological tests were performed to detect microfilariae by modified Knott\u0026rsquo;s test (Newton and Wright \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e1956\u003c/span\u003e) and to detect \u003cem\u003eD. immitis\u003c/em\u003e antigen using immunochromatographic assays no longer than five days later.\u003c/p\u003e \u003cp\u003eDogs were considered infected when they tested either antigens or microfilariae morphologically identified as \u003cem\u003eD. immitis\u003c/em\u003e positive. When there were doubts on the microfilariae identification, the sample was further tested by molecular assay.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMolecular analyses\u003c/h3\u003e\n\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eDNAg was extracted from whole blood sample using the QIAamp\u0026reg; DNA Blood Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer recommendations and stored at -20\u0026deg;C until the multiplex PCR.\u003c/p\u003e \u003cp\u003eFor filarioid detection the multiplex polymerase chain reactions (PCR) were performed using a general pair 12S rDNA gene 12SF (5\u0026rsquo;- GTTCCAGAATAATCGGCTA\u0026thinsp;\u0026minus;\u0026thinsp;3\u0026rsquo;) and 12SR (5\u0026rsquo;- ATTGACGGATG(AG)TTTGTACC\u0026thinsp;\u0026minus;\u0026thinsp;3\u0026rsquo;) for the detection of filarial nematodes, and the other primer pair of one oligonucleotide specific for \u003cem\u003eD. immitis\u003c/em\u003e \u0026minus;\u0026thinsp;12SF2B (5\u0026rsquo;- TTTTTACTTTTTTGGTAATG\u0026thinsp;\u0026minus;\u0026thinsp;3\u0026rsquo;) (Simsek and Ciftci \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), according to previously established protocols. The preparation of the solutions and the conditions of the PCR runs were based upon previous studies (Casiraghi et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2004\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Gioia et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). \u003cem\u003eD. immitis\u003c/em\u003e DNAg (adult worm) was used as a positive control and ultrapure water as a negative control. The amplified DNA fragments were subjected in a 2% agarose gel for electrophoresis, stained with ethidium bromide and visualized under ultraviolet light (Sambrook and Russell \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2001\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSequences were read on an ABI 3730xl DNA Analyzer (Applied Biosystems). The sequences obtained (GenBank accession numbers PP949214- PP949216) were edited in the CHROMASPRO software, version 1.5 (Technelysium Pty Ltd, Tewantin, QLD, Australia) and identified by similarity assessment through comparative analysis with sequences deposited in GenBank using BLASTN (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://blast.ncbi.nlm.nih.gov/Blast.cgi\u003c/span\u003e\u003cspan address=\"https://blast.ncbi.nlm.nih.gov/Blast.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eStatistical analyses\u003c/h3\u003e\n\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe associations between each of the potential risk factors for \u003cem\u003eD. immitis\u003c/em\u003e (Odds ratio analysis) were carried out separately using univariable binomial regression. The risk factors considered were coat, sex, age, breed, weight, travel and shipping. Factors with p 0.05 in the univariate analysis were considered for inclusion in a multivariate regression model, which was constructed by reverse elimination. The analyses were carried out in Statistical Package for the Social Sciences SPSS software (IBMR), version 29.0.1.0.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eA total of 260 blood samples were included. Of those, 37 (14.2%) were microfilaremic and 52 (20%) were antigenemic. A total of 17 (46%) microfilaremic samples presented microfilariae that could not be morphologically identified as \u003cem\u003eD. immitis\u003c/em\u003e. All the 17 samples examined by PCR presented mono infection either by \u003cem\u003eAcanthocheilonema reconditum\u003c/em\u003e or \u003cem\u003eD. immitis.\u003c/em\u003e Out of those, two presented microfilariae of \u003cem\u003eA. reconditum\u003c/em\u003e (2/17, 11,8%) and 15 (88,2%) of \u003cem\u003eD. immitis\u003c/em\u003e, therefore 35 (13.5%) samples presented \u003cem\u003eD. immitis\u003c/em\u003e microfilariae. Only 9 microfilaremic samples were antigen negative, therefore 23.5% (61/260) of the dogs were infected by \u003cem\u003eD. immitis\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). No sample presented microfilariae of \u003cem\u003eDirofilaria repens\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAntigen and microfilariae (mff) of \u003cem\u003eDirofilaria immitis\u003c/em\u003e detected in canine blood samples from Duque de Caxias and Mag\u0026eacute;, Rio de Janeiro metro area, Rio de Janeiro State, Brazil.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntigen test\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003emff + (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003emff - (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntigen (+)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e26 (74.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e26 (11.6)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntigen (-)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9 (25.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e199 (88.4)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e225\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003emff +: microfilariae detected\u003c/p\u003e \u003cp\u003emff -: microfilariae no detected\u003c/p\u003e \u003cp\u003eOf the animals examined, 84.2% (219/260) lived in the municipality of Duque de Caxias and 15.7% (41/260) in the municipality of Mag\u0026eacute;. In the municipality of Duque de Caxias 80.7% (42/52) of the dogs were infected with the filarioid. The frequency of dog\u0026rsquo;s positive for \u003cem\u003eD. immitis\u003c/em\u003e was higher in males (55.7%; 29/52) than in females (44.2%; 23/52). Animals of undetermined breed were the most parasitized (20.5%). Most dogs were always kept at home, never traveling. Only 13 dogs travelled and travelling showed no influence on infection. No factor tested in the univariate analysis was significant for \u003cem\u003eD. immitis\u003c/em\u003e p\u0026thinsp;\u0026gt;\u0026thinsp;0.05 (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePotential risk factors for canine heartworm infection in dogs living in Baixada Fluminense, Rio de Janeiro State, Brazil\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eRisk factor\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eDirofilaria immitis\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003en (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOdds ratio (95% CI)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003ep\u003c/em\u003e value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal samples\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e260\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e52 (20)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eBreed\u003c/span\u003e\u003c/p\u003e \u003cp\u003eNo\u003c/p\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e234\u003c/p\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e48 (20.5)\u003c/p\u003e \u003cp\u003e4 (15.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.42 (0.46\u0026ndash;4.31)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.71\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eSex\u003c/span\u003e\u003c/p\u003e \u003cp\u003eMale\u003c/p\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e117\u003c/p\u003e \u003cp\u003e143\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e29 (24.8)\u003c/p\u003e \u003cp\u003e23 (16.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.21 (0.87\u0026ndash;1.71)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.2966\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eAge\u003c/span\u003e\u003c/p\u003e \u003cp\u003e\u0026le;\u0026thinsp;7\u0026nbsp;year\u003c/p\u003e \u003cp\u003e\u0026gt;\u0026thinsp;7\u0026nbsp;year\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e163\u003c/p\u003e \u003cp\u003e92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e26 (16.0)\u003c/p\u003e \u003cp\u003e24 (26.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.54 (0.20\u0026ndash;1.01)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.07\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eWeight\u003c/span\u003e\u003c/p\u003e \u003cp\u003e\u0026le;\u0026thinsp;10 kg\u003c/p\u003e \u003cp\u003e\u0026gt;\u0026thinsp;10 Kg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e87\u003c/p\u003e \u003cp\u003e152\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12 (13.8)\u003c/p\u003e \u003cp\u003e33 (21.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.41 (0.28\u0026ndash;0.51)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.68\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eCoat color\u003c/span\u003e\u003c/p\u003e \u003cp\u003eLight\u003c/p\u003e \u003cp\u003eDark\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e44\u003c/p\u003e \u003cp\u003e208\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11 (25.0)\u003c/p\u003e \u003cp\u003e39 (18.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.44 (0.57\u0026ndash;1.31)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.46\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eCoat length\u003c/span\u003e\u003c/p\u003e \u003cp\u003eShort\u003c/p\u003e \u003cp\u003eMedium-long\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e111\u003c/p\u003e \u003cp\u003e156\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e41 (36.9)\u003c/p\u003e \u003cp\u003e34 (21.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.25 (0.71\u0026ndash;3.89)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.71\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTravel history\u003c/span\u003e\u003c/p\u003e \u003cp\u003eYes\u003c/p\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e13\u003c/p\u003e \u003cp\u003e247\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 (7.7)\u003c/p\u003e \u003cp\u003e51 (20.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.32 (0.04\u0026ndash;2.52)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.43\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eIn Brazil, the Coastal regions of the south (Santa Catarina and Paran\u0026aacute;), southeast (Rio de Janeiro and S\u0026atilde;o Paulo) and northeast (Bahia and Pernambuco) are endemic for canine heartworm disease (Labarthe et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), but there is evidence of the disease in non-coastal regions with an eco-epidemiological scenario that favors infection with \u003cem\u003eD. immitis\u003c/em\u003e in dogs (Santos et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; De Andrade Vieira et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Sebolt et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). It is true that the epidemiological panorama has changed with the occurrence of frequent cases due to recent climate change and the expansion of the global economy in recent years (Meireles et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe presence of microfilaremic dogs in the Baixada Fluminense region is a worrying factor within the One Health concept (Fontes-Sousa et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), as cases of human heartworm disease have already been reported in areas where there are infected dogs, whether rural or urban (Zumaquero et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Mendoza-Roldan et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe prevalence in five municipalities of the Baixada Fluminense region was previously reported to range from 2.85 to 3.4% (De Andrade Vieira et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). In this study, despite the high prevalence observed (20%), there was no statistical significance between the variables analyzed. The last update study of canine heartworm disease in the Brazilian coastal region (Labarthe et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), showed that the high prevalence of canine heartworm disease may be associated with environmentally protected areas. Although none of the biometric and phenotypic patterns of dogs showed a significant association with antigen test positivity, some individual characteristics such as short, dark hair and weight over 10 kg had similar results to those reported before in Rio de Janeiro (Labarthe et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Guedes et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOlder dogs (\u0026le;\u0026thinsp;7 years) were more infected as also observed before (De Arg\u0026ocirc;lo et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), suggesting that time favors the infection. Male dogs were the most infected in the area as already reported (De Andrade Vieira et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), although this is not the first report showing males as prone to the infection, it must be cautiously analyzed once spaying and neutering are uncommon in the area, leading to females being better cared for to avoid pregnancy.\u003c/p\u003e \u003cp\u003eSince it has been shown that a prevalence of at least 20% is needed to allow odds ratio analysis in each area (Labarthe et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), it would be expected that the risk factors for \u003cem\u003eD. immitis\u003c/em\u003e infection could be determined in the present study. Once it cannot be determined, the small sample size must be considered as a limiting factor. The fact that most of the animals have not travelled recently suggests that they were infected in their region of origin and that the cases can be considered autochthonous.\u003c/p\u003e \u003cp\u003eThe primary vectors of \u003cem\u003eD. immitis\u003c/em\u003e in the state of Rio de Janeiro are crepuscular or nocturnal, sylvatic, hemisynantropic, and eclectic \u003cem\u003eOchlerotatus mosquitoes\u003c/em\u003e (Labarthe et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e1998a\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003eb\u003c/span\u003e). The region, known for its ecological diversity, has favorable conditions for the maintenance and spread of the nematode, providing important insights into the endemicity of the disease in relation to the socio-environmental determinants of the area. Other filarioids, such as \u003cem\u003eA. reconditum\u003c/em\u003e, have been frequently reported in dogs in some regions of Brazil (Ramos et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; De Arg\u0026ocirc;lo et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), and although they are not pathogenic to these animals, their zoonotic potential should be considered.\u003c/p\u003e \u003cp\u003eRecent studies have shown that Mag\u0026eacute; is the municipality with the highest prevalence of infection between 2017 and 2020, compared to the prevalence in Duque de Caxias in all those years (Vieira VMA \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; De Andrade Vieira et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). In relation to the socio-environmental conditions of these municipalities assessed during the active search, it was observed that the lack of environmental sanitation and improper management of solid waste, recent civil constructions, as well as the fact that houses are located near protected areas (or beach areas), provide favorable environments for the reproduction of culicidae vectors of \u003cem\u003eD. immitis\u003c/em\u003e, associated with the transit of stray and resident animals between protected areas, are risk factors that outline the enzootic profile of heartworm disease, contributing to the establishment of the disease in the municipalities.\u003c/p\u003e \u003cp\u003eDogs are the most common and abundant carnivores in Brazil's Atlantic Forest regions and the presence of these animals in rural or peri-urban landscapes accompanying humans in work or leisure activities, for example, is a threat to wildlife in the transmission of pathogens causing a zoonotic spillover (Ellwanger and Chies \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), in addition to competition and predation on native animals (Ribeiro et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Therefore, integrated management actions for the maintenance and preservation of environmental conservation areas, in addition to dog population control, must be carried out to avoid the imbalance of biodiversity by bringing invasive vector species in the transmission of bioagents of importance to public health.\u003c/p\u003e \u003cp\u003eThere is no current survey in the region of possible vectors competent in the transmission of \u003cem\u003eD. immitis\u003c/em\u003e, but studies already carried out in some municipalities of the Baixada Fluminense region have shown the presence of the species \u003cem\u003eAe. aegypti\u003c/em\u003e, \u003cem\u003eAe. albopictus\u003c/em\u003e, \u003cem\u003eOchlerotatus scapularis\u003c/em\u003e, \u003cem\u003eOc. taeniorhynchus\u003c/em\u003e involved in the transmission of arboviruses, i.e. the same species described as competent vectors for the transmission of stage 3 larvae of \u003cem\u003eD. immitis\u003c/em\u003e (Labarthe et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e1998a\u003c/span\u003e; Bendas et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In both suburban and urban areas, human activities are associated with a greater presence of disease-transmitting vectors, and changes in mosquito density can affect the prevalence of heartworm disease in dogs in certain regions (Spence Beaulieu et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Therefore, an entomological survey of culicid vectors in protected areas is known to be necessary for taxonomic identification in conjunction with a molecular tool for the detection of \u003cem\u003eD. immitis\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eGlobal warming and climate change significantly influence the epidemiology of these nematodes by accelerating their rate of development within vectors, thus facilitating their spread and extending their geographical distribution to regions previously considered to be free of the disease.\u003c/p\u003e \u003cp\u003eHeartworm infection rate was high, higher than those reported before, despite the overall high availability of heartworm preventatives in Brazil. Since Heartworm is a zoonotic parasite transmitted by mosquitoes frequently found in the surveyed area, health personnel must be aware of the hazard this parasite imposes in the area.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe presence of microfilaremic dogs in Duque de Caxias and in Mag\u0026eacute; poses a greater hazard than in known endemic areas once the spillover to infect humans is possible in an area where the awareness is low among veterinarians and human health professionals. The factors evaluated in the canine population in this study, together with the socio-environmental determinants found in the localities, condition the maintenance of infection by \u003cem\u003eD. immitis\u003c/em\u003e, increasing the possibility of the emergence of heartworm disease.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eThe following abbreviations are used in this manuscript:\u003c/p\u003e\u003cp\u003e \u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\"\u003e\u003c/div\u003e\u003ctable id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"2\"\u003e \u003c/colgroup\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\"\u003e \u003cp\u003emff\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eMicrofilariae\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003e \u003cb\u003eEDTA\u003c/b\u003e \u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eEthylenediamine tetraacetic acid\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003e \u003cb\u003eºC\u003c/b\u003e \u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eDegree Celsius\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003e \u003cb\u003eDNAg\u003c/b\u003e \u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eGenomic DNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003e \u003cb\u003ePCR\u003c/b\u003e \u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003ePolymerase Chain Reaction\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003e \u003cb\u003eYr\u003c/b\u003e \u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eYear\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003e \u003cb\u003eKg\u003c/b\u003e \u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eKilogram\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/table\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003c/p\u003e\u003ch2\u003eCompeting interest\u003c/h2\u003e \u003cp\u003eThe authors declare no competing interests\u003c/p\u003e \u003cp\u003e\u003c/p\u003e\u003cp\u003e \u003c/p\u003e\u003ch2\u003eEthical standards\u003c/h2\u003e \u003cp\u003e The study was approved by the Animal Use Ethics Committee of the Oswaldo Cruz Institute/ Oswaldo Cruz Foundation (CEUA-IOC-L009/2020) and by the Oswaldo Cruz Institute/ Oswaldo Cruz Foundation Human Research Ethics Committee (CEP CAAE: 30759620.1.0000.5248).\u003c/p\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis study was conducted with the support of (CAPES - funding code 001) and Plano de Objetivos e Metas (POM) of the Laboratório de Inovações em Terapias, Ensino e Bioprodutos – LITEB and Laboratório de Carrapatos e Outros Artrópodes Ápteros - Referência Nacional em Vetores das Riquetsioses (LAC), Instituto Oswaldo Cruz, Fiocruz.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003e**Conceptualization:** Viviane Marques de Andrade Vieira, Antonio Henrique Almeida de Moraes Neto and Gilberto Salles Gazêta; **Writing-original draft preparation:** Viviane Marques de Andrade Vieira, **Writing – review and editing:** Antonio Henrique Almeida de Moraes Neto and Gilberto Salles Gazêta, **Formal analysis and investigation:** Viviane Marques de Andrade Vieira and Priscila Pinho da Silva; **Methodology:** Viviane Marques de Andrade Vieira, Priscila Pinho da Silva, Victor de Souza Leão, Ana Beatriz Paes Borsoi, Karla Bitencourth, Ingrid Benevides Machado, Mariana Guimarães Côrtes da Cruz. **Funding acquisition:** Antonio Henrique Almeida de Moraes Neto and Gilberto Salles Gazêta; **Supervision:** Antonio Henrique Almeida de Moraes Neto and Gilberto Salles Gazêta.All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eWe would like to thank Dr. Norma Labarthe, Dr. Jonimar Paiva (in memoriam), and Dr. Bruno Alberigi for their valuable guidance and recommendations during the course of the project.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eData will be made available on request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBandi C, Trees AJ, Brattig NW (2001) Wolbachia in filarial nematodes: evolutionary aspects and implications for the pathogenesis and treatment of filarial diseases. Vet Parasitol 98:215\u0026ndash;238. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0304-4017(01)00432-0\u003c/span\u003e\u003cspan address=\"10.1016/S0304-4017(01)00432-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBendas AJR, Mendes-de-Almeida F, Guerrero J, Labarthe N (2017) Atualiza\u0026ccedil;\u0026atilde;o sobre a epidemiologia de \u003cem\u003eDirofilaria immitis\u003c/em\u003e na Am\u0026eacute;rica do Sul e no M\u0026eacute;xico: revis\u0026atilde;o de literatura. Braz J Vet Res Anim Sci 54:319. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.11606/issn.1678-4456.bjvras.2017.132572\u003c/span\u003e\u003cspan address=\"10.11606/issn.1678-4456.bjvras.2017.132572\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCasiraghi M, Bain O, Guerrero R et al (2004) Mapping the presence of Wolbachia pipientis on the phylogeny of filarial nematodes: evidence for symbiont loss during evolution. Int J Parasitol 34:191\u0026ndash;203. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ijpara.2003.10.004\u003c/span\u003e\u003cspan address=\"10.1016/j.ijpara.2003.10.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCasiraghi M, Bazzocchi C, Mortarino M et al (2006) A simple molecular method for discriminating common filarial nematodes of dogs (Canis familiaris). Vet Parasitol 141:368\u0026ndash;372. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.vetpar.2006.06.006\u003c/span\u003e\u003cspan address=\"10.1016/j.vetpar.2006.06.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Andrade Vieira VM, Da Silva PP, Paulino \u0026Eacute;T et al (2024) Epidemiological analysis of Dirofilaria immitis (Spirurida: Onchocercidae) infecting pet dogs (Canis lupus familiaris, Linnaeus, 1758) in Baixada Fluminense, Rio de Janeiro. Front Vet Sci 11:1360593. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fvets.2024.1360593\u003c/span\u003e\u003cspan address=\"10.3389/fvets.2024.1360593\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Andrade Vieira VM, Martiniano NOM, Da Silva PP et al (2022) Molecular characterization of canine filarioids in a previously non-endemic area of Rio de Janeiro State, Brazil. Parasitol Res 121:925\u0026ndash;932. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00436-022-07433-7\u003c/span\u003e\u003cspan address=\"10.1007/s00436-022-07433-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Arg\u0026ocirc;lo EGG, Reis T, Fontes DAT et al (2018) Canine filariasis in the Amazon: Species diversity and epidemiology of these emergent and neglected zoonoses. PLoS ONE 13:e0200419. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0200419\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0200419\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEllwanger JH, Chies JAB (2021) Zoonotic spillover: Understanding basic aspects for better prevention. Genet Mol Biol 44:e20200355. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1590/1678-4685-gmb-2020-0355\u003c/span\u003e\u003cspan address=\"10.1590/1678-4685-gmb-2020-0355\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFontes-Sousa AP, Silvestre-Ferreira AC, Carret\u0026oacute;n E et al (2019) Exposure of humans to the zoonotic nematode \u003cem\u003eDirofilaria immitis\u003c/em\u003e in Northern Portugal. Epidemiol Infect 147:e282. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/S0950268819001687\u003c/span\u003e\u003cspan address=\"10.1017/S0950268819001687\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGioia G, Lecov\u0026aacute; L, Genchi M et al (2010) Highly sensitive multiplex PCR for simultaneous detection and discrimination of Dirofilaria immitis and Dirofilaria repens in canine peripheral blood. Vet Parasitol 172:160\u0026ndash;163. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.vetpar.2010.04.027\u003c/span\u003e\u003cspan address=\"10.1016/j.vetpar.2010.04.027\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuedes M, Gomes T, Alberigi B et al (2024) Evaluation of Seroprevalence and Risk Factors of Heartworm Infection for Dogs in Rio de Janeiro with Access to Veterinary Care. Acta Parasit. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11686-024-00859-2\u003c/span\u003e\u003cspan address=\"10.1007/s11686-024-00859-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHise AG, Gillette-Ferguson I, Pearlman E (2004) The role of endosymbiotic \u003cem\u003eWolbachia\u003c/em\u003e bacteria in filarial disease. Cell Microbiol 6:97\u0026ndash;104. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1046/j.1462-5822.2003.00350.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1462-5822.2003.00350.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKotani T, Powers KG (1982) Developmental stages of Dirofilaria immitis in the dog. Am J Vet Res 43:2199\u0026ndash;2206\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLabarthe N, Serr\u0026atilde;o ML, Fontenele Melo Y et al (1998a) Mosquito Frequency and Feeding Habits in an Enzootic Canine Dirofilariasis Area in Niter\u0026oacute;i, State of Rio de Janeiro, Brazil. Mem Inst Oswaldo Cruz 93:145\u0026ndash;154. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1590/S0074-02761998000200002\u003c/span\u003e\u003cspan address=\"10.1590/S0074-02761998000200002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLabarthe N, Serr\u0026atilde;o ML, Melo YF et al (1998b) Potential Vectors of Dirofilaria immitis (Leidy, 1856) in Itacoatiara, Oceanic Region of Niter\u0026oacute;i Municipality, State of Rio de Janeiro, Brazil. Mem Inst Oswaldo Cruz 93:425\u0026ndash;432. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1590/S0074-02761998000400001\u003c/span\u003e\u003cspan address=\"10.1590/S0074-02761998000400001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLabarthe NV, Pereira Paiva J, Reifur L et al (2014) Updated canine infection rates for Dirofilaria immitis in areas of Brazil previously identified as having a high incidence of heartworm-infected dogs. Parasites Vectors 7:493. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13071-014-0493-7\u003c/span\u003e\u003cspan address=\"10.1186/s13071-014-0493-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcCall JW, Genchi C, Kramer LH et al (2008) Chap. 4 Heartworm Disease in Animals and Humans. Advances in Parasitology. Elsevier, pp 193\u0026ndash;285\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcGreevy PB, Theis JH, Lavoipierre MMJ, Clark J (1974) Studies on filariasis. III. \u003cem\u003eDirofilaria immitis\u003c/em\u003e: emergence of infective larvae from the mouthparts of \u003cem\u003eAedes aegypti\u003c/em\u003e. J Helminthol 48:221\u0026ndash;228. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/S0022149X00022896\u003c/span\u003e\u003cspan address=\"10.1017/S0022149X00022896\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeireles J, Paulos F, Serr\u0026atilde;o I (2014) Dirofilariose em c\u0026atilde;es e gatos. 109:70\u0026ndash;74\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMendes-de-Almeida F, Alves LC, Do Amaral Fernandes P et al (2021) Infection with Dirofilaria immitis and Other Infections in Cats and Dogs from Rio de Janeiro, Brazil: The Need for Prophylactic Enforcement. Acta Parasit 66:962\u0026ndash;968. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11686-021-00345-z\u003c/span\u003e\u003cspan address=\"10.1007/s11686-021-00345-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMendoza-Roldan JA, Gabrielli S, Cascio A et al (2021) Zoonotic Dirofilaria immitis and Dirofilaria repens infection in humans and an integrative approach to the diagnosis. Acta Trop 223:106083. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.actatropica.2021.106083\u003c/span\u003e\u003cspan address=\"10.1016/j.actatropica.2021.106083\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNewton WL, Wright WH (1956) The occurrence of a dog filariid other than Dirofilaria immitis in the United States. J Parasitol 42:246\u0026ndash;258\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamos RAN, De Oliveira Do R\u0026ecirc;go AG, De Farias Firmino ED et al (2016) Filarioids infecting dogs in northeastern Brazil. Vet Parasitol 226:26\u0026ndash;29. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.vetpar.2016.06.025\u003c/span\u003e\u003cspan address=\"10.1016/j.vetpar.2016.06.025\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRibeiro FS, Nichols E, Morato RG et al (2019) Disturbance or propagule pressure? Unravelling the drivers and mapping the intensity of invasion of free-ranging dogs across the Atlantic forest hotspot. Divers Distrib 25:191\u0026ndash;204. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/ddi.12845\u003c/span\u003e\u003cspan address=\"10.1111/ddi.12845\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSambrook J, Russell D (2001) Clonagem Molecular: Um Manual de Laborat\u0026oacute;rio, 3rd edn. Nova York\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantos MD, Alberigi B, Balius DMP et al (2021) Canine heartworm: natural infection along remote coastal area of Rio de Janeiro. Braz J Vet Med 43:e000220. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.29374/2527-2179.bjvm000220\u003c/span\u003e\u003cspan address=\"10.29374/2527-2179.bjvm000220\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSebolt APR, Snak A, De Lima FR et al (2022) Prevalence and risk factors for Dirofilaria immitis in dogs from Laguna, Santa Catarina, Brazil. Veterinary Parasitology: Reg Stud Rep 29:100697. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.vprsr.2022.100697\u003c/span\u003e\u003cspan address=\"10.1016/j.vprsr.2022.100697\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSim\u0026oacute;n F, Kramer LH, Rom\u0026aacute;n A et al (2007) Immunopathology of Dirofilaria immitis Infection. Vet Res Commun 31:161\u0026ndash;171. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11259-006-3387-0\u003c/span\u003e\u003cspan address=\"10.1007/s11259-006-3387-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSimsek S, Ciftci AT (2016) Serological and Molecular Detection of Dirofilaria Species in Stray Dogs and Investigation of Wolbachia DNA by PCR in Turkey. J Arthropod Borne Dis 10:445\u0026ndash;453\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSlocombe JOD, Surgeoner GA, Srivastava B (1989) Determination of the heartworm transmission period and its used in diagnosis and control. Charleston, SC, pp 19\u0026ndash;26\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpence Beaulieu MR, Federico JL, Reiskind MH (2020) Mosquito diversity and dog heartworm prevalence in suburban areas. Parasites Vectors 13:12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13071-019-3874-0\u003c/span\u003e\u003cspan address=\"10.1186/s13071-019-3874-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVieira VMA (2019) Potencial zoon\u0026oacute;tico por Dirofilaria immitis (leidy, 1856) Raillet \u0026amp; Henry, 1911 na Baixada Fluminense do Rio de Janeiro. Disserta\u0026ccedil;\u0026atilde;o\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZumaquero L, Sim\u0026oacute;n F, Carret\u0026oacute;n E et al (2020) Prevalence of canine and human dirofilariosis in Puebla, Mexico. Vet Parasitol 282:109098. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.vetpar.2020.109098\u003c/span\u003e\u003cspan address=\"10.1016/j.vetpar.2020.109098\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"parasitology-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pare","sideBox":"Learn more about [Parasitology Research](http://link.springer.com/journal/436)","snPcode":"436","submissionUrl":"https://submission.nature.com/new-submission/436/3","title":"Parasitology Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Dirofilaria immitis, risk-factors, seroprevalence, Enzootic cycle, Modified Knott, Immunochromatography, Baixada Fluminense","lastPublishedDoi":"10.21203/rs.3.rs-8996842/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8996842/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIn Brazil, the nematode \u003cem\u003eDirofilaria immitis\u003c/em\u003e is endemic throughout the coastal region, but the distribution pattern has changed in recent years in places previously without occurrence or with low prevalence. The Baixada Fluminense in the state of Rio de Janeiro, Brazil, once considered a region free of canine heartworm disease, has raised growing concerns about the etiological profile of \u003cem\u003eD. immitis\u003c/em\u003e. The region, known for its ecological diversity, has favorable conditions for the maintenance and spread of the nematode, providing important insights into the endemicity of the disease in relation to the socio-environmental determinants of the area. The aim was to evaluate the risk factors related to the circulation of dogs susceptible to \u003cem\u003eDirofilaria immitis\u003c/em\u003e infection that influence prevalence in the municipalities of Duque de Caxias and Mag\u0026eacute;, Baixada Fluminense, RJ. Between 2022 and 2024, active search was carried out on dogs living near environmental conservation areas. A total of 260 blood samples were collected and sent for serological, parasitological and molecular analysis. The seroprevalence of filarioids in dogs was 20% (52/260), confirming the species \u003cem\u003eD. immitis\u003c/em\u003e and \u003cem\u003eAcanthocheilonema reconditum\u003c/em\u003e by molecular analysis (42.3%; 22/52). Only 9 microfilaremic samples were antigen negative, therefore 23.5% (61/260) of the dogs were infected by \u003cem\u003eD. immitis\u003c/em\u003e. Health education ef-forts should be undertaken to increase awareness of canine heartworm disease among professionals and pet owners.\u003c/p\u003e","manuscriptTitle":"Canine Dirofilaria immitis Infection in a Tropical Area Recently Colonized by the parasite","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-17 10:10:31","doi":"10.21203/rs.3.rs-8996842/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-04-24T14:06:08+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-15T02:54:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"257874819572046883471770142617648290851","date":"2026-03-24T00:49:32+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"210662577769937879357787044343884718980","date":"2026-03-15T09:16:13+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-13T07:13:56+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-10T06:30:38+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-10T05:43:55+00:00","index":"","fulltext":""},{"type":"submitted","content":"Parasitology Research","date":"2026-02-28T16:07:38+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"parasitology-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pare","sideBox":"Learn more about [Parasitology Research](http://link.springer.com/journal/436)","snPcode":"436","submissionUrl":"https://submission.nature.com/new-submission/436/3","title":"Parasitology Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"531fad63-44d8-45b6-baa5-83ca891c1b48","owner":[],"postedDate":"March 17th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[],"tags":[],"updatedAt":"2026-04-24T14:10:44+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-17 10:10:31","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8996842","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8996842","identity":"rs-8996842","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00