MAPK domain inhibition: Validation of the anti-angiogenic effects of curcumin from Curcuma longa in NDEA model of liver carcinoma in Wistar rats

MAPK domain inhibition: Validation of the anti-angiogenic effects of curcumin from Curcuma longa in NDEA model of liver carcinoma in Wistar rats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article MAPK domain inhibition: Validation of the anti-angiogenic effects of curcumin from Curcuma longa in NDEA model of liver carcinoma in Wistar rats Olayinka Fisayo Onifade, Oluseyi Adeboye Akinloye, Oluwatosin A. Dosumu, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2621916/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objectives This study employed MAPK domain inhibition as an anti-angiogenic scaffold and further validate the anti-angiogenic effects of the lead phytochemicals, curcumin from ethanolic extract of curcuma longa (EECL) in N-nitrosodiethylamine (NDEA) model of liver cancer in Wistar rats. Methods One hundred and twenty Wistar rats comprising of sixty male and female rats were randomly selected into twelve groups (n = 5): group A (100 mg/kg NDEA + 200 mg/kg EECL), group B (100 mg/kg NDEA + 400 mg/kg EECL), group C (100 mg/kg NDEA + 600 mg/kg EECL), group D (100 mg/kg NDEA + 200 mg/kg pure curcumin), group E (100 mg/kg NDEA + 100 mg/kg sylibon 140), group F (100 mg/kg NDEA), group G (200 mg/kg pure curcumin), group H (100 mg/kg DMSO), group I (200 mg/kg EECL), group J (400 mg/kg EECL), group K (600 mg/kg EECL), group L (control) at the end of 42 days of the experiment period. The lead phytochemicals, curcumin from EECL were isolated and subjected to Gas Chromatography-Mass Spectrometry for characterization. The anti-angiogenic potentials of the curcumin isolates were validated through molecular docking and the expression of antiangiogenic related mRNA. Results The binding of Co-crystallized, curcumin and cis-sesquisabinene hydrate, to the binding site led to the conformation with binding energies of -15.15 kcal/mol, -7.212 kcal/mol, and − 6.361 kcal/mol respectively. Treatment with 200 mg/kg and 400 mg/kg significantly (p < 0.05) downregulated the expression of MAPK and Vascular endothelial growth factor mRNAs in the hepatocyte tumour, while the Alpha Fero Protein and Interleukin-10 mRNA was significantly (p < 0.05) upregulated. Conclusion Ethanolic extract of Curcumin longa possessed anti-angiogenic and anti-proliferating prospective against MAPK domain inhibition. Biological sciences/Biochemistry Biological sciences/Cancer Biological sciences/Computational biology and bioinformatics Biological sciences/Molecular biology Health sciences/Biomarkers Ethanolic extract Curcuma longa (EECL) mitogen activated protein kinase (MAPK) Angiogenesis Gas Chromatography-Mass Spectrometry (GC-MS) N-nitrosodiethylamine (NDEA) Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Cancer is known to be heterogeneous which leads to many genetic changes within the cell[ 1 , 2 ]. liver cancer is more predominant in male as the fifth most diagnosed while seventh in female [ 3 ]. Hepatocellular carcinoma (HCC) ranks the sixth cancer in the world is a primary type of liver cancer [ 4 ]. HCC is the fourth type of cancer with high mortality rate. Factors that induce this condition ranges from hepatitis infection, alcoholic life style, smoking habit, unsafe sexual practices and consumption of contaminated foods [ 3 , 5 ]. The mitogen activated protein kinase (MAPK) cascade consist of serine/threonine kinases which convert extracellular molecules such as growth factors, hormones and tumor-promoting substances into intracellular signals for regulating cell proliferation, differentiation and survival [ 6 ]. The mitogen-activated protein kinase (MAPK) has four core protein kinases which are Ras, Raf, MEK and ERK that are initiated by ligand binding to receptor tryrosine kinase at the cell surface and in the nucleus they are involved in regulating gene expression [ 7 ]. MAPKs were implicated in diverse cellular processes such as cell survival, differentiation, adhesion, and proliferation [ 8 ]. A wide variety of foods and plants, including vegetables, flowers, fruits, cereals, spices, mushrooms, tea, algae, wild fruits, and medical plants, have been found to contain significant amounts of natural polyphenols from medicinal plants [ 9 ]. Polyphenols are known to show remarkable properties of promoting apoptosis and suppressing proliferation of cells via various pathways [ 10 , 11 ]. Curcuma longa commonly known as tumeric is a perennial herb, a rhizome containing volatile oil and curcumin being the active constituent [ 12 ]. In silico method of accessing drug targets that will bind small molecule libraries [ 13 ]. Computational methods for hit-to-lead optimization that can cover a large number of drug-like candidates from the pool of phytochemicals derived from plants while cutting costs and time [ 14 ]. Anti-angiogenic properties of ethanolic extract of Curcuma longa (CL) phytochemials were queried by affinity-based molecular docking and Prime MM-GBSA (Molecular Mechanics-Generalized Born Surface Area) to understand the binding affinity and atomistic interaction of CL compounds with MAPK for anti-angiogenesis. Curcuma longa phytochemical were isolated from the root of the plant, and their anti-angiogenic effects were validated in N-Nitrosodiethylamine (NDEA) model of liver carcinoma in male and female wistar rats. 2. Methods 2.1 Ethical Approval This study was approved based on the compliance with ethical standards and the relevant national and institutional guidelines on the care and use of laboratory by the Research Ethics Committee, with the approval number IRB/21/028 at the Nigerian Institute of Medical Research (NIMA) Yaba, Lagos State, Nigeria. 2.2 Sourcing and Authentication of Plant Material Curcuma longa rhizome was purchased from Ota market, Abeokuta, Ogun state, Nigeria. The root was authenticated with the authentication number FHA-3726 at the Department of Pure and Applied Botany, College of Biosciences, Federal University of Agriculture, Abeokuta, Ogun State, Nigeria. 2.3 Preparation of the Ethanolic Curcuma longa Extract Ethanolic extraction of Curcuma longa was carried out according to the method of [15]. Powdered Curcuma longa weighing 300 g was then macerated in 95% ethanol over 48 hours. The extract were filtered through number 1 Whatman filter paper. The Curcuma longa extract was concentrated using a rotary evaporator and afterwards stored at 4°C in a refrigerator until use. 2.4 Gas chromatography (GC)/mass spectrometry (MS) analysis The crude ethanolic extract of Curcuma longa was diluted with ethanol (1/100, v/v). filtered, too. A syringe was filled with the particle-free, diluted crude extract (1 L), before being injected into a GC-MS device with a 1:100 split ratio. The research wasperformed using an interfaced GC (Agilent 7890A, Agilent Technologies, USA)Agilent Technologies' mass selective detector (MSD, Agilent 7000) is outfitted with a capillary column of polar HP-5ms (30 m, 0.25 mm i.d., 0.25 m film thickness) Agilent (polysiloxane with a phenyl content of 5%). Operating the column at a linear speed helium serves as the carrier gas, moving at a velocity of 1 mL min-1 at 210 °C. Identification of chemical components was done via the mass spectral data and their fragmentation patterns [16]. 2.5 Protein retrieval and preparation The three-dimensional (3D) crystal structure of MAPK in complex with its inhibitor (PDB ID: 7AUV) was downloaded from the Protein Data Bank (http://www.rcsb.org/pdb). The co-crystallized inhibitor, ASTX029, is currently being evaluated in human phase I-II clinical trials in patients with advanced solid tumors [17]; this makes it a reference inhibitor for comparative study. The protein was viewed and prepared with the Protein Preparation Wizard [18] panel of the Schrödinger Maestro suite 11.5 [19]. In detail, the missing loops and the side chains were filled using Prime [20], bond orders were assigned, extrinsic hydrogen bond was added, the water and other molecules used for crystallization were removed, disulfide bonds were created, and the state was generated at pH 7.0±2.0 using Epik [21]. Thereafter, the protein was optimized using PROPKA P H 7.0 and subjected to retrained minimization with heavy atoms restrained and hydrogen unrestrained with OPLS3 force field [22]. 2.6 Ligand preparation The two-dimensional (2D) structures of the 40 phytochemicals reported from the ethanolic extract of CL L. rhizomes [23] and the FDA-approved ERK inhibitor (ulixertinib)[24] were downloaded in SDF format from the NCBI PubChem database (https://pubchem.ncbi.nlm.nih.gov). The structures were imported into Schrödinger Maestro 11.5 and prepared with the LigPrep interface of the software which effectively converts the 2D structures to 3D structures suitable for docking analysis [25]. ASTX029 was extracted from the protein and prepared accordingly to provide. All the compounds were desalted, tautomers were generated, specified chiralities were retained, OPLS3 force field [23] was used to generate low-energy states, and possible ionization states were generated at pH 7.0±2.0 using Epik [22]. 2.7 Molecular docking (rigid and induced fit approach) The Receptor Grid Generation panel of Schrödinger Maestro was used to define the binding pocket of the protein (ERK2) by specifying the size and position of the protein’s active site for ligand docking. The co-crystallized ligand was selected to guide the grid box mapping. The van der Waals (vdW) radius scaling factor of nonpolar receptor atoms and partial charge cut-off were set to 1.0 and 0.25, respectively. Thereafter, the molecular docking of the ligands was performed with the predefined ERK2 receptor grid using the Extra precision (XP) rigor of the Ligand Docking panel of the Schrödinger Maestro Glide tool [26]. The vdW radius scaling factor (0.80) and partial charge cutoff (0.15) were left at default. Furthermore, Induced Fit Docking [27] was performed for the top 3 hit compounds of CL resulting from the rigid docking and the reference ligands (ASTX029). The IFD panel of Schrödinger Maestro was used accordingly as previously described by [28]. Here, IFD allows the flexibility of both the ERK’s active site and the ligand for better ligand binding and protein-ligand interaction. 2.8 Molecular docking validation Using the generally recognized validation method, the Root Mean Square Deviation (RMSD) value of the native crystal structure pose and the docked pose of the co-crystalized ligand was calculated to validate the molecular docking protocol [29,30]. The previously extracted and prepared co-crystallized ligand was docked using the predefined ERK2 receptor grid in the Schrödinger Maestro workspace. The RMSD was calculated by superimposing the poses of the crystal structure ligand before and after docking. 2.9 PRIME MM-GBSA The free energy of binding (ΔGbind) of the protein-ligand complexes of the hit compounds and reference ligands were calculated for the complexes resulting from IFD. We used the Prime MM-GBSA [31] interface of Schrödinger Maestro 11.5 setting OPLS3 as the force field, VSGB as the solvation model, and minimize as the sampling methods. This ΔGbind was estimated using the following equation: ΔGbind = ΔEMM + ΔGsolv + ΔGSA Where, ΔEMM, ΔGsolv, and ΔGSA are the change in minimized energies, change in solvation energies, and change in surface area energies, respectively. The change (Δ) is calculated as the difference in the protein–inhibitor complex, uncomplexed protein, and the inhibitor energy [32,33]. 2.10 Pharmacokinetics The novel inhibitors from CL and the reference ligands were subjected to ADMET evaluation to understand their pharmacokinetics, drug-likeness, and toxicity properties. SwissADME[34] and PROTOX [35] were used combinatorially via the online tool provided on http://www.swissadme.ch/ and https://tox-new.charite.de/protox_II/, respectively. The chemical structure of each ligand was submitted to SwissADME and ProTox servers in their canonical simplified molecular-input line-entry system (SMILES) format obtained from the PubChem database. And the ADMET parameters were generated automatically. 2.11 Experimental animals All experiments were performed with male and female Wistar rats weighing between 80-100g, which were bought from a reputable farm at Abeokuta and kept in the animal house facility of the Department of Chemical and Food Science, Bells University of Technology,Ota. The animals were housed and allowed to acclimatize to the animal house condition of temperature 24-27°C and light-dark cycle (12:12 hour) for two week before commencement of the experiment. Rats were fed with standard pellet diets and water ad libitum . 2.12 Induction of liver damage N-nitrosodiethyiamine (NDEA) was administered to rats once in a week for a period of two weeks interperitoneally at the dosage of 100mg/ kg body weight to induce the pathology to the liver according to the modified method of [36]. 2.13 Experimental design After acclimatization the rats were randomly divided into twelve groups of five animals per group for both male and female rats separately. Group A, B, C, D, E, and F received 100 mg/kg body weight of N-nitrosodiethylamine and treated with 200 mg, 400 mg and 600mg of ethanolic extract of Curcuma longa for group A, B and C while group D were treated with 200 mg of pure curcumin and 100 mg of sylibon (standard drug ) in group E, animals in group F were not treated. Animals in G and H were administered 200 mg of pure curcumin only and 200 mg of DMSO respectively. Moreso, animals in group I, J and K received 200 mg, 400 mg and 600 mg of ethanolic extract of Curcuma longa accordingly while group L was not treated. The treatment lasted for 28 days. 2.14 Reverse Transcription–Polymerase Chain Reaction Total RNA was isolated from liver tissues followed by reverse transcription, and quantitative PCR were carried out [37].The tumors' RNAs were extracted using the TRIzol reagent. RNA-free DNase was used to dissolve the RNAs, and the RNeasy kit from Qiagen (Germany) was used to purify them. For the synthesis of cDNA, reverse transcriptase, random hexanucleotides, and 40 mg of total RNA were incubated at 37°C for 60 min. Utilizing the Snap gene software, the primers were created. Actin was used as the control gene. The thermocycler was used to amplify the mRNAs at 50 cycles for 2 h 20 min. The PCR products were run on 1.0% agarose gels. Ethidium bromide (EtBr) staining was used for visualization. The primers are as follows: TARGET GENES FORWARD 5′ -3′ REVERSE 5′ -3′ MAPK GACGACTTACCTAAGGAGAAGC CTGAGCCCTTGTCCTGACC VEGF AGAAAGCCCATGAAGTGGTGA TCATCGGGGTACTCCTGGAA IL-10 TTCCCTGGGAGAGAAGCTGA GACACCTTTGTCTTGGAGCTTA P53 TCGAGATGTTCCGAGAGCTG GTCTTCGGGTAGCTGGAGTG XIAP TGTTTTTCCTGATCGGGGCT CTTGTCCACCTTTTCGCGCC AFP AGTGGAGCGCATCCATTTCC CAACGACAATGGTAGCTACGTTAAA TNF ACTGAACTTCGGGGTGATCG GCTTGGTGGTTTGCTACGAC EGFR GCCACAGGTTCCGAGATGAA CCACGTAGTTTCTGGGGCAT HIF CCCAAAGACAATAGCTTTGCAGAAT TTGCTGCAGTAACGTTCCAATTCC ACTIN BETA CCACCAGTTCGCCATGGAT CCCACCATCACACCCTGG mRNAs expression of angiogenic related genes in the hepatocyte tumours of NDEA-model of hepatocullular carcinoma following treatment with ethanolic extract of curcuma longa lin and curcumin isolate. 2.15 Statistical analysis One-way analysis of variance (ANOVA) and Turkey’s multiple range tests in IBM-SPSS version 21.0 and GraphPad Prism version 7.0 were used. Data were denoted as the means ± standard error of the mean (SEM). Significance was set at p < 0.05. 3. RESULTS 3.1 Gas Chromatography analysis of the ethanolic extract of Curcuma longa The chromatogram of the Gas Chromatography analysis of the ethanolic extract of Curcuma longa Linn identified the major chemical constituents based on the peak retention time (Rt) and percentage area (Figure 1 and Table 1) a total of 40 compounds were identified. 3.2 Molecular interaction of ethanolic extract of Curcuma longa on MAPK Table 2-3 shows the scoring function used to predict the binding affinity and the free binding energy of the binding of ligands with MAPK and co-crystallized compound (-15.15 kcal/mol / -99.6 kcal/mol), curcumin (-7.21 kcal/mol / -72.93 kcal/mol), cis-Sesquisabinene hydrate (-6.36 kcal/mol / -27.63 kcal/mol), 12-Oxabicyclo (9.1.0) dodeca-3,7-diene (-5.944 kcal/mol / -27.71 kcal/mol), Curlone (-5.691 kcal/mol /-32.27 kcal/mol) and 2-Cyclohexen-1-ol (-5.505 kcal/mol / -2368 kcal/mol) as the top five hit compounds while 17 Octadecynoic Acid (-2.21 kcal/mol / -38.98 kcal/mol), 2,5-Octadiene (-1.89kcal/mol /-28.96 kcal/mol) and propane (-1.84 kcal/mol /-15.18 kcal/mol) had the least binding energy result. The molecular docking showed the interaction with various amino acids 2-Cyclohexen-1-ol express hydrogen bond interaction with amino acids with MET 108 and ASP 106 on the hydroxyl group of the MAPK protein (fig 2). Phytochemical 12-Oxabicyclo[9.1.0]dodeca-3,7-diene interacts with the carboxyl group of mapk with hydrogn bond using MET 108 (fig 3). cis-sesquisabinene hydrate express hydrogen bond using MET 108 on the hydroxyl group of the MAPK protein (fig 4) cocrystallized expresses interactions with amine group, benzene ring, hydroxy group, nitrile group and carboxyl group with the following amino acids ASP167,CYS 166,ARG 67, ASP 167 and MET 108 using hydrogen bond and TYP64 with pi-pi stacking (fig 5). Curcumin Curlone bond interaction with amino acids with MET 108 and ASP 106 on the hydroxyl group of the MAPK protein(fig 6). 12-Curlone interacts with the carboxyl group of MAPK with hydrogen bond using MET 108 (fig 7). Table 1: GC-MS of ethanolic extract of Curcuma longa Linn. S/N Retention time (min) Peak area (%) Peak Height (%) Name of the compound 1 8.433 2.27 0.95 1,4-Methano-1H-cyclopenta[d]pyridazine 2 8.709 0.24 0.12 2-Cyclohexen-1-ol 3 8.771 0.58 0.28 6-Isopropenyl-3-methoxymethoxy-3-methyl 4 10.092 0.07 0.05 Aromandendrene 5 10.274 0.15 0.20 Doconexent 6 10.391 0.06 0.07 Gamolenic Acid 7 10.525 0.83 0.92 Benzene 8 10.667 0.73 0.91 1,3-Cyclohexadiene 9 10.799 0.24 0.23 Cis-.alpha.-Bisabolene 10 10.929 1.09 1.36 Cyclohexene 11 11.000 0.08 0.08 1-Cyclohexene-1-methanol 12 11.128 0.32 0.28 12-Oxabicyclo[9.1.0]dodeca-3,7-diene 13 11.171 0.38 0.30 Cyclopentaneacetaldehyde 14 11.308 1.97 2.29 Propane 15 11.413 2.01 2.11 1-(2,3-Dihydroindol-1-yl)-4-phenyl-butan-1 16 11.489 2.04 2.11 Naphthalene 17 11.529 0.85 0.87 Alpha.-ylangene 18 11.578 1.29 1.05 Cis-Z-.alpha.-Bisabolene epoxide 19 11.703 0.67 0.66 6-(p-Tolyl)-2-methyl-2-heptenol 20 11.774 1.79 1.98 Curlone 21 11.817 2.82 2.26 Beta.-ylangene 22 11.998 24.27 18.36 Ar-tumerone 23 12.072 17.83 22.76 Tumerone 24 12.261 1.47 1.50 Cis-sesquisabinene hydrate 25 12.330 13.12 17.76 Curlone 26 12.661 2.27 1.51 2,5-Octadiene, 3,4,5,6-tetramethyl 27 12.770 1.88 2.06 Tumerone 28 12.826 3.36 4.37 Tumerone 29 12.885 3.73 4.87 3,7-Cyclodecadien-1-one 30 13.013 2.72 1.24 Prop-2-ynyl(E)-2-methylbut-2-enoate 31 13.184 4.07 3.30 Tumerone 32 13.299 0.86 0.64 Bicyclo[3.1.0]hexan-3-ol 33 13.749 0.76 0.56 6Z-2,5,5,10-Tetramethyl-undeca-2,6,9-trien 34 13.913 1.38 0.78 1,4-Methanoazulen-9-ol 35 14.379 1.02 0.49 2-Methyl-4-octenal 36 14.635 0.08 0.08 Cyclohexanol 37 15.149 0.13 0.18 Cyclopropaneoctanoic acid 38 15.201 0.12 0.12 Cyclopropanebutanoic acid 39 15.458 0.22 0.17 9,12-Octadecadienoic acid 40 15.500 0.23 0.18 17-Octadecynoic acid Table 2: Docking score and molecular mechanics with generalized born and surface area solvation (MMGBSA) S/N Compounds Docking Score MMGBSA dG Bind 1 Cocrystallized (standard) -15.15 -99.6 2 curcumin -7.212 -72.93 3 cis-sesquisabinene hydrate -6.361 -27.63 4 12-Oxabicyclo[9.1.0]dodeca-3,7-diene -5.944 -27.71 5 Curlone -5.691 -32.27 6 2-Cyclohexen-1-ol -5.505 -23.68 3.3 ADMET and the drug-likeness predictions. The pharmacokinetic profile of the test compounds is presented in Table 3 The result showed that all the compounds are highly absorbable by the human intestine. Among all the test compounds, only ASTX029 (co-ligand) is a substrate for the P-glycoprotein (P-gp). only cocrystallized and curcumin compounds that cannot permeate the blood-brain barrier (BBB) (Table 3).cocrystallized and curcumin compound were the inhibitor of both CYP2C9 and CYP3A4 the cytochrome p450 (CYP450) isoformsAlso, ASTX029 and Curcumin have the lowest skin permeation (Log k p) potential. (Table 3) Furthermore, the drug-likeness profile given in Table 3 showed that only ASTX029 violated Lipinski’s rule of 5 (RO5); (MW < 500, HBD < 5, HBA < 10, Logp ≤ 5). It also has the highest number of rotatable bonds (10). Generally, ASTX029 and Curcumin compounds have TPSA < 140Å 2 (Table 4) while cis-Sesquisabinene hydrate.2-Cyclohexen-1-ol and 12-Oxabicyclo[9.1.0]dodeca-3,7-dienehaving TPSA < 90Å 2 , and they are the only compounds that can permeate the blood-brain barrier (BBB) (Table 3). Finally, the Pro-Tox II toxicity prediction presented in Table 5 showed that all the parameters for each compound are reliably predicted with PA greater than 50%. Besides curcumin which is immunotoxic, all other compounds are not hepatotoxic, cytotoxic, immunotoxic, carcinogenic, or mutagenic. Most of the test compounds are non-toxic (based on Toxicity level). Table 3. Pharmacokinetic properties of the 4 hit compounds and reference ligands (ASTX029) as predicted by SwissADME . Compounds GI absorption BBB Permeant P-gp substrate CYP1A2 inhibitor CYP2C19 inhibitor CYP2C9 inhibitor ¶ CYP2D6 inhibitor ¶ CYP3A4 inhibitor Log k p (cm/s) Curlone High Yes no no yes yes no no -4.78 curcumin High no no no no yes no yes -6.28 cocrystalized High no yes no no yes yes yes -7.8 cis-sesquisabinene hydrate High Yes no no yes yes no no -4.76 12-Oxabicyclo[9.1.0]dodeca-3,7-diene High Yes no no no no no no -5.26 GI absorption- gastrointestinal absorption. BBB permeant- Blood-brain barrier permeant. P-gp substrate- P-Glycoprotein substrate. ¶ inhibition test for cytochrome p450 enzyme isoforms Table 4: The pedicted drug-likeness properties of the hit compounds and reference ligands (ASTX029) by SwissADMET. Compounds MW (g/mol) HBD HBA TPSA (Ų) Consensors logp Rotatable bond Lipinski violation ¶ Curlone 218.33 0 1 17.07 3.7 4 0 curcumin 368.38 2 6 93.06 3.03 8 0 cocrystalized 584.04 3 8 125.91 3.05 10 1 cis-sesquisabinene hydrate 222.37 1 1 20.23 3.81 4 0 12-Oxabicyclo[9.1.0]dodeca-3,7-diene 164.24 0 1 12.53 2.63 0 0 ¶ is the number of Lipinski rules violated. The rule states that druglike compounds should have Molecular weight (MW) <500, Hydrogen Bond Donor (HBD) < 5, Hydrogen Bond Acceptor (HBA) < 10, and Octanol/Water partition coefficient (logP) ≤ 5. TPSA - Topological polar surface area Table 5: Pro-Tox II toxicity prediction for the 3 Hit compounds and reference ligands (ASTX029 ) Compounds HT CG IT MG CT Toxicity class PA (%) LD50 (mg/kg) ASTX029 - - - - - 5 54.26 2500 Curcumin - - + - - 4 100 2000 cis-sesquisabinene hydrate - - - - - 5 70.97 3450 12-Oxabicyclo[9.1.0]dodeca-3,7-diene - - - - - 5 69.26 5000 Curlone - - - - - 5 69.26 4600 2-Cyclohexen-1-ol - - - - - 5 69.26 3000 + means active, - means inactive. HT - Hepatotoxicity, CG - Carcinogenicity, IT - Immunotoxicity, MG - Mutagenicity, CT- Cytogenicity, PA - Prediction Accuracy. Toxicity class ranges from value 1 to 6 with value 1 being toxic and 6 being non-toxic. 3.4 mRNAs expression of angiogenic related genes in the liver tumours of NDEA-model of hepatocellularcarcinoma following treatment with Curcuma longa isolates 3.4.1 Relative expression of MAPK mRNA MAPKs regulate important cellular processes such as proliferation, stress responses, apoptosis and immune defense [38,39]. MAPKs are ubiquitously expressed and evolutionarily conserved in eukaryotes [40,41]. In Fig. 8 A, the expression of Mapk mRNA was significant downregulation (p < 0.05) in group A, B, C, D, E, H, I, J, K and L when compared with negative control group F in male rats. Moreso, in the female rats (Fig. 8 B) there is a significant downregulation (p < 0.05) in the group A, B, C, D, E,G, H, I, J, K and l when compared with negative control group L. 3.4.2 Relative expression of VEGF mRNA The primary mediator of angiogenesis in cancer is VEGF, which is elevated by Hypoxia, growth factors, and oncogene expression. For angiogenesis to occur, Neoplastic growth and proliferation[42]. In Fig. 8 C, there was significant downregulation (p< 0.05) in group A,B,D,E,G,H,J,K and L as compared to the negative control group female (Fig. 8 D) in male rats. Also in female rats there was significant downregulation (p < 0.05) in group A, B, E, G, H, I,J, K and L as compared to group F in female rats. 3.4.3 Relative expression of EGFR mRNA EGFR is expressed in both cancerous and non-cancerous cells, but it is overexpressed in a variety of tumor types. The progression of the disease, a poor prognosis, and EGFR expression are all correlated. [43]. In Fig. 8 E, the expression of EGFR mRNA was significantly upregulated in group A, B, C, E,G and H when compared to the negative control group F in the male rats while A, C, D, E, G, H, I, J and K was significant downregulation (p < 0.05) in female rats as compared to the group F in Fig. 8 F. 3.4.4 Relative expression of HIF-1 mRNA HIF-1 plays key roles in the metabolism of energy, apoptosis, angiogenesis, and the regulation of homeostatic responses to hypoxia [44 ]. In Fig. 8 G, the expression of HIF-1 mRNA was significant downregulation (p < 0.05) in group A, B, C, D, E, G, H, I, J, K and L when compared to the negative control group F of both the male and female rats in Fig. 8 H. 3.4.5 Relative expression of AFP mRNA AFP is synthesized in early S1 phase of the cell cycle and is secreted prior to the M phase [45]. The production of AFP is initiated at the level of gene transcription and is proportional to the amount of available mRNA. In Fig. 8 I, the expression of AFP mRNA was significantly upregulated in group a,d,g,h and i when compared to the negative control group f in the male rats. Also group A,D,G,H and I was significantly upregulated as compared to group F in female rats in Fig. 8 J. 3.4.6 Relative expression of p53 mRNA p53 is a DNA binding protein which halts the cell cycle upon genomic stress [46] and essentially hinders proliferation of the cells with damaged DNA [47]. In Fig. 8 K, the expression of p53 mRNA there was significantly upregulated in group A, B, C, D, E, G, H, and J when compared to the negative control group f in the male rats, while there was significantly upregulation in A, C, D, G, I, J and K in the female rats in Fig. 8 L. 3.4.7 Relative expression of Xiap mRNA XIAP expression levels may directly determine the sensitivity of tumor cells to apoptosis [48,49]. As a general indicator of a poor prognosis for the disease, XIAP was discovered to be overexpressed in a number of cancer types and is frequently linked to chemoresistance and an increased risk of recurrence. [50,51]. In Fig. 8 M-8 N, the expression of Xiap mRNA was significant downregulation (p < 0.05) in group A, B, C, D, E, G, H, I, J, K and L when compared to the negative control group F of both the male and female rats. 3.4.8 Relative expression of iL-10 mRNA IL-10 family cytokines are upregulated in various human diseases and potentially contribute to the pathogenesis. Therefore, neutralizing antibodies blocking their biological functions may have potential therapeutic value [52,53]. In Fig. 8 O, the expression of iL-10 mRNA there was significantly upregulated (p < 0.05) in group A, B, C, E, G, H, I and J when compared with control group L of the male rats. Also, there was significant upregulation in group A, B, H, I, J, K and L when compared to the negative control group F in the female rats in Fig. 8 P. 4. Discussion 4.1 Phytochemicals from ethanolic extract of Curcuma longa The chromatogram of the Gas Chromatography analysis of the ethanolic extract of Curcuma longa Linn identified the major chemical constituents based on the peak retention time (Rt) and percentage area. A total of 40 compounds were identified. The presence of these numerous compounds are responsible for various pharmacological actions [54.55]. Several reports demonstrated that polyphenols including flavonoids have been shown to possess a significant antioxidant activity in various in vitro models. The in silico study on ethanolic extract of Curcuma longa phytochemical compounds against mapk has shown curcumin safe and active as the standard co-crystalized compound[56]. Curcumin interacted with the active site of MAPK through hydrogen bonds having the highest docking score among the phytrochemicals constituents [57, 58]. Additionally,All the compounds except ASTX029 can relatively have a steady concentration in the cell as they are non-substrate of the P-gp. P-gp is an efflux membrane ATP-binding-cassette (ABC) transporter that acts as a drug barrier by extruding drugs out of the cell [59]. The BBB permeation property predicts the ability of a compound to elicit an effect on the brain, [60], the ADMET and protoxll-predicted toxicity profile of curcumin inferred with the LD 50 prediction at 2000 mg/kg body weight as well as non-hepatotoxic, non-cytotoxic, non-mutagenic suggesting that it is good therapeutic properties with drug-likeness for oral drug development [61,62]. 5. Conclusion The tyrosine kinase inhibitors' conformation changed as a result of the binding of Curcuma longa isolates of curcumin, cis-sesquisabinene hydrate, 12-Oxabicyclo[9.1.0]dodeca-3,7-diene, curlone, and 2-Cyclohexen-1-ol to the binding site of mitogen activated protein kinase. In the NDEA model of liver cancer, Curcuma longa treatment showed anti-angiogenic and anti-proliferative potentials. Declarations Clarification This study is reported in accordance with ARRIVE guidelines. Source of funding This research did not receive any specific grant from funding agencies in the public, commercial or not for-profit sectors. Conflict of interest No conflict of interest to declare. Data availability All data generated or analyzed during this study are included in this published article [and its supplementary information files]. Ethical approval Ethical approval (reference number: IRB/21/028) was obtained at the Nigerian Institute of Medical Research (NIMA) Yaba, Lagos State, Nigeria. Author contribution All authors have read and approved the submission of this manuscript, OFO designed and organized the project, OAA, OAD and AAS monitored the progression and supervised the project.OSA was involved in the internal review of the manuscript. IOO and AAA were involved in some of the bench work. References Kagohara, L. T., Stein-O’Brien, G. L., Kelley, D., Flam, E., Wick, H. C., Danilova, L. V.. Epigenetic regulation of gene expression in cancer: techniques, resources and analysis. Brief. Funct. Genomics (2018),17, 49–63. doi: 10.1093/bfgp/elx018 PubMed Abstract | CrossRef Full Text | Google Scholar Kumar, R., Patiyal, S., Kumar, V., Nagpal, G., Raghava, G. P. S. (2019). In Silico Analysis of Gene Expression Change Associated with Copy Number of Enhancers in Pancreatic Adenocarcinoma. Int. J. Mol. Sci. 20, 3582. doi: 10.3390/ijms20143582CrossRef Full Text | Google Scholar Jemal, A, Bray, F, Ferlay, J. Global cancer statistics. CA Cancer J Clin 2011; 61(2): 69–90. Google Scholar | Medline | ISI Marra M, et al. (2011) Molecular targets and oxidative stress biomarkers in hepatocellular carcinoma: An overview. J Transl Med 9 :171. Ho, D. W.-H., Lo, R. C.-L., Chan, L.-K., Ng, I. O.-L. . Molecular Pathogenesis of Hepatocellular Carcinoma. Liver Cancer (2016), 5, 290–302. doi: 10.1159/000449340PubMed Abstract | CrossRef Full Text | Google Scholar Jiang, F., Chen, J., Ma, X., Huang, C., Zhu, S., Wang, F., Li, L., Luo, L., Ruan, H., and Huang, H. . Analysis of mutants from a genetic screening reveals the control of intestine and liver development by many common genes in zebrafish.Biochemical and Biophysical Research Communications. (2015) 460(3): 838-44 Knight H. and Irving E. A. Ras/Raf/MEK/ERK pathway activation in childhood acute lymphoblastic leukemia and its therapeutic targeting. (2014) Newcastle Cancer Centre at the Northern Institute for Cancer Research Wong C. H., and Cheng C. Y. , ( 2005).The blood-testis barrier: its biology, regulation, and physiological role in spermatogenesis. Curr. Top. Dev. Biol. 71: 263–296. Li, X.; Wang, T.; Zhou, B.; Gao, W.Y.; Cao, J.G.G.; Huangc, L.Q. . Chemical composition and antioxidant and anti-inflammatory potential of peels and flesh from different pear varieties (Pyrus spp.). Food Chem. (2014).152, 531–538. Zhang E.T, He Y., Grob P., Fong Y.W., Nogales E., and Tjian R. . Architecture of the human XPC DNA repair and stem cell coactivator complex. Proc Natl Acad Sci U S A (2015)112(48):14817-22 Ali A.A,. Aboshosha M.K. Kassem, Eman I. EL-Dabaawy and EL-Banna.A.N. Salinity Tolerance and Stevioside Improvement of In Vitro Selected Stevia (Stevia rebaudiana) Mutants.Int. J. Curr. Res. Biosci. Plant Biol. 2015, 2(4): 11-20 Kokate R. . A Systematic Overview of Cancer Immunotherapy: An Emerging Therapy. Pharm Pharmacol Int J 5(2):(2017) 00112. DOI: 10.15406/ppij.2017.05.00112 Yang Ou, Lu SS, Kong JY, Liang XQ, Luo ZJ, Jiang C,H. Computational drug discovery. Acta Pharmacologica Sinica 2012;33:1131–40 Enyedy I.J., Egan, W.J. Can we use docking and scoring for hit-to-lead optimization? J Comput. Aided Mol. Des. 22 (2008) 161–168. Kamsu Tchuente G, Fodouop Chegaing SP, Tagne RS, Kodjio N, Fakam Nguelebeck AL, Gatsing D (2019) Evaluation of the acute and sub-chronic toxicity of the ethanolic extract of Curcuma longa (Zingiberaceae) in Wistar albino rats. Mod Chem Appl 7:267. doi: 10.35248/2329-6798.19.7.267. Neha B, Tiwari KL, Jadhav SK. A review on nonconventional turmeric Curcuma caesia Roxb. Curr. Trend. Biotech. Pharm. 2014;8(1):91-101. Munck J. M. et al. , ‘ASTX029, a Novel Dual-mechanism ERK Inhibitor, Modulates Both the Phosphorylation and Catalytic Activity of ERK’, Mol Cancer Ther , vol. 20, no. 10, pp. 1757–1768, Oct. 2021, doi: 10.1158/1535-7163.MCT-20-0909. Madhavi Sastry G., Adzhigirey M., Day T. , Annabhimoju R., and Sherman W., ‘Protein and ligand preparation: parameters, protocols, and influence on virtual screening enrichments’, J Comput Aided Mol Des , vol. 27, no. 3, pp. 221–234, Mar. 2013, doi: 10.1007/s10822-013-9644-8 David T. I. et al. , ‘Molecular docking analysis of phyto-constituents from Cannabis sativa with pfDHFR’, Bioinformation , vol. 14, no. 9, pp. 574–579, 2018, doi: 10.6026/97320630014574. Jacobson M. P. et al. , ‘A hierarchical approach to all-atom protein loop prediction’, Proteins , vol. 55, no. 2, pp. 351–367, Mar. 2004, doi: 10.1002/prot.10613. Shelley J. C., Cholleti A., Frye L. L, Greenwood J. R. ,Timlin M. R., and . Uchimaya M, ‘Epik: a software program for pK a prediction and protonation state generation for drug-like molecules’, J Comput Aided Mol Des , vol. 21, no. 12, pp. 681–691, Dec. 2007, doi: 10.1007/s10822-007-9133-z. Harder E. et al. , ‘OPLS3: A Force Field Providing Broad Coverage of Drug-like Small Molecules and Proteins’, J. Chem. Theory Comput. , vol. 12, no. 1, pp. 281–296, Jan. 2016, doi: 10.1021/acs.jctc.5b00864. Abdel-Lateef E. et al. , ‘Bioactive chemical constituents of Curcuma longa L. rhizomes extract inhibit the growth of human hepatoma cell line (HepG2)’, Acta Pharm , vol. 66, no. 3, pp. 387–398, Sep. 2016, doi: 10.1515/acph-2016-0028Ref Khojasteh Poor F. et al. , ‘Mini review: The FDA-approved prescription drugs that target the MAPK signaling pathway in women with breast cancer’, BD , vol. 40, no. 2, pp. 51–62, Jun. 2021, doi: 10.3233/BD-201063. Schrödinger Release 2018-1, ‘LigPrep, Schrödinger, LLC, New York, NY, 2021.’ Friesner R. A. et al. , ‘Extra Precision Glide: Docking and Scoring Incorporating a Model of Hydrophobic Enclosure for Protein−Ligand Complexes’, J. Med. Chem. , vol. 49, no. 21, pp. 6177–6196, Oct. 2006, doi: 10.1021/jm051256o. Sherman W. , Beard H. S., and Farid R. , ‘Use of an Induced Fit Receptor Structure in Virtual Screening’, Chem Biol Drug Design , vol. 67, no. 1, pp. 83–84, Jan. 2006, doi: 10.1111/j.1747-0285.2005.00327.x. Kikiowo B. et al. , ‘Flavones scaffold of Chromolaena odorata as a potential xanthine oxidase inhibitor: Induced Fit Docking and ADME studies’, Bioimpacts , vol. 10, no. 4, pp. 227–234, Nov. 2019, doi: 10.34172/bi.2020.29. Kufareva I. and Abagyan R., ‘Methods of protein structure comparison’, Methods Mol Biol , vol. 857, pp. 231–257, 2012, doi: 10.1007/978-1-61779-588-6_10. Kikiowo B, Ogunleye J. A., Iwaloye O. , and T. T. Ijatuyi, ‘Therapeutic potential of Chromolaena odorata phyto-constituents against human pancreatic α-amylase’, Journal of Biomolecular Structure and Dynamics , vol. 40, no. 4, pp. 1801–1812, Mar. 2022, doi: 10.1080/07391102.2020.1833758 Hayes J. M.and Archontis G., MM-GB(PB)SA Calculations of Protein-Ligand Binding Free Energies . IntechOpen, 2012. doi: 10.5772/37107. Lyne P. D., Lamb M. L., and Saeh J. C., ‘Accurate prediction of the relative potencies of members of a series of kinase inhibitors using molecular docking and MM-GBSA scoring’, J Med Chem , vol. 49, no. 16, pp. 4805–4808, Aug. 2006, doi: 10.1021/jm060522a Kikiowo B. et al. , ‘Molecular Interaction and Inhibitory Activity of Dandelion’s Compounds on Nucleoprotein: A Therapeutic Intervention in Lassa Fever’, Biointerface Res Appl Chem , vol. 11, no. 5, pp. 12573–12583, Jan. 2021, doi: 10.33263/BRIAC115.1257312583. Daina A., Michielin O., and Zoete V. , ‘SwissADME: A free web tool to evaluate pharmacokinetics, drug-likeness and medicinal chemistry friendliness of small molecules’, Scientific Reports , vol. 7, p. 42717, Mar. 2017, doi: 10.1038/srep42717. Banerjee P., Eckert A. O., Schrey, A. K.and Preissner R., ‘ProTox-II: a webserver for the prediction of toxicity of chemicals’, Nucleic Acids Research , vol. 46, no. W1, pp. W257–W263, Jul. 2018, doi: 10.1093/nar/gky318 Devoshree MUKHERJEE, Riaz AHMAD.Dose-dependent effect of N'-Nitrosodiethylamine on hepatic architecture, RBC rheology and polypeptide repertoire in Wistar rats.Interdiscip Toxicol. 2015; Vol. 8(1): 1–7. W., Gan, J., Liu, W., and Green, R. (2005). Degradation of-Nitrosodimethylamine (NDMA) in Landscape Soils. Journal of Environmental Quality 34(1), 336–341. Omotuyi OI, Nash O, Enejoh OA, Oribamise EI, Adelakun NS: Chromolaena odorata flavonoids attenuate experimental nephropathy: Involvement of pro-inflammatory genes downregulation. Toxicol Rep (2020) 7(1421-1427 Liu, Y., Shepherd, E. G., and Nelin, L. D. MAPK phosphatases–regulating the immune response. Nat. Rev. Immunol. (2007).7, 202–212. doi: 10.1038/nri2035 Arthur, J. S. C., and Ley, S. C. Mitogen-activated protein kinases in innate immunity. Nat. Rev. Immunol. (2013). 13, 679–692. doi: 10.1038/nri3495 Kyriakis, J. M., and Avruch, J. . Mammalian MAPK signal transduction pathways activated by stress and inflammation: A 10-Year Update. Physiol. Rev. (2012) 92, 689–737. doi: 10.1152/physrev.00028.2011 Peti, W., and Page, R. . Molecular basis of MAP kinase regulation. Protein Sci. (2013) 22, 1698–1710. doi: 10.1002/pro.2374 Carmeliet P., VEGF as a key mediator of angiogenesis in cancer, Oncology 69 (3) (2005) 4–10 Baselga J., Why the epidermal growth factor receptor? The rationale for cancer therapy, Oncologist 7 (suppl 4) (2002) 2–8 Xie Y.B., Li J.P., Shen K., Meng F.,Wang L. , Han G.X., et al., Effect of HIF-1α on angiogenesis-related factors in K562 cells, Zhongguo Shi Yan Xue Ye Xue Za Zhi 27 (5) (2019) 1476–1481 Sell S, Skelly H, Leffert HL, Muller-Eberhard U, Kida S Relationship of the biosynthesis of alpha-fetoprotein, albumin,hemopexin, and haptoglobin to the growth state of fetal rat hepatocyte cultures. Ann N Y Acad Sci (1975)259: 45-58. Harris, S.L.; Levine, A.J. The p53 pathway: Positive and negative feedback loops. Oncogene 2005 , 24,2899–2908. [CrossRef] [PubMed] Powell, D.J.; Hrstka, R.; Candeias, M.; Bourougaa, K.; Vojtesek, B.; Fåhraeus, R. Stress-dependent changes inthe properties of p53 complexes by the alternative translation product p53/47. Cell Cycle 2008 , 7, 950–959. Eckelman BP, Salvesen GS, Scott FL. Human inhibitor of apoptosis proteins: why XIAP is the black sheep of the family EMBO Rep 2006 Oct;7(10):988-94 Yang WZ, Zhou H, Yan Y. XIAP underlies apoptosis resistance of renal cell carcinoma cells Mol Med Rep 2018Jan;17:125-130 Srinivasula SM, Ashwell JD. IAPs: what's in a name? Mol Cell 2008 Apr 25;30(2):123-35 doi: 10 Obexer P, Ausserlechner MJ. X-linked inhibitor of apoptosis protein - a critical death resistance regulator and therapeutic target for personalized cancer therapy Front Oncol 2014 Jul 28;4:197 Ouyang, W., Rutz, S., Crellin, N.K., Valdez, P.A., and Hymowitz, S.G. Regulation and functions of the IL-10 family of cytokines in inflammation and disease. Annu. Rev. Immunol. (2011).29, 71–109. Wang, X., Wong, K., Ouyang, W., and Rutz, S. . Targeting IL-10 Family Cytokines for the Treatment of Human Diseases. Cold Spring Harb. Perspect.Biol. (2017)11 Ali, A., Wang, Y.H. and Khan, I.A. Larvicidal and biting deterrent activity of essential oils of Curcuma longa , ar-turmerone, and curcuminoids against Aedes aegypti and Anopheles quadrimaculatus ( Culicidae : Diptera ). J. Med. Entomol ., (2015).52(5): 979-986. Abdel-Shafy S, Alanazi AD, Gabr HSM, Allam AM, Abou-Zeina HAA, Masoud RA, Soliman DE, Alshahrani MY Efficacy and safety of ethanolic Curcuma longa extract as a treatment for sand tampan ticks in a rabbit model.(2020) Veterinary World , 13(4): 812-820. Ya'u Ibrahim Z, Uzairu A, Shallangwa G, Abechi S. Molecular docking studies, drug-likeness and in-silico ADMET prediction of some novel β-Amino alcohol grafted 1,4,5-trisubstituted 1,2,3-triazoles derivatives as elevators of p53 protein levels. Scientific African, 2020; 10: e00570. Rattis BAC, Ramos SG, Celes MRN. Curcumin as a Potential Treatment for COVID-19. Front Pharmacol. 2021 May 7;12:675287. doi: 10.3389/fphar.2021.675287. PMID: 34025433; PMCID: PMC8138567 Oluwasayo Peter Abodunrin, Olayinka Fisayo Onifade and Abayomi Emmanuel Adegboyega (2022) ‘Therapeutic capability of five active compounds in typical African medicinal plants against main proteases of SARS-CoV-2 by computational approach”https://doi.org/10.1016/j.imu.2022.100964 Finch A. and Pillans P., ‘P-glycoprotein and its role in drug-drug interactions’, doi: 10.18773/austprescr.2014.050 Pardridge W. M, ‘Drug transport across the blood–brain barrier’, J Cereb Blood Flow Metab , vol. 32, no. 11, pp. 1959–1972, Nov. 2012, doi: 10.1038/jcbfm.2012.126. Oshevire DB., Mustapha A, Alozieuwa BU, Badeggi HH., Ismail A, Hassan ON, Ugwunnaji PI, Ibrahim J, Lawal B, Berinyu EB. In-silico investigation of curcumin drug-likeness, gene-targets and prognostic relevance of the targets in panels of human cancer cohorts. GSC Biological and Pharmaceutical Sciences, 2021; 14(01): 037–046. Oghenejobo M, Opajobi OA, Bethel OUS, et al. Antibacterial evaluation, phytochemical screening and ascorbic acid assay of turmeric (Curcuma longa).MOJ Bioequiv Availab 2017;4(2):232–9. https://doi.org/10.15406/mojbb.2017.04.00063 Additional Declarations No competing interests reported. Supplementary Files geneexpressionsupplementry1.pdf Geneexpressionsupplementary2.xlsx supplementary.csv Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2621916","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":192230790,"identity":"1cb77880-a092-4e7d-a096-f29758349bc5","order_by":0,"name":"Olayinka Fisayo Onifade","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABS0lEQVRIie2RQUvDMBTHMwrZJdhrigz9CBmFqijzqyQEtssYHgtCTRnUy2BXh36I3sSTLYHtsuFV2cCK4ElhXmRCD6ajMC114k0kv0MIj/fj/V8CgEbzFzEiAOgBqIhqD4DkKKss6/jTWQBSpTSVgsbqQlYKXquATMHtXMn5VjGhMUwS2qj1rZc4ocRjl1VUf3TTXY9ERjxFYNYQXxUrgC1CKbcH5x1OKJHsqovs+iTAmESQ7yPwxAsKue85mC0MFk7bDqYkYqGETcsXmYKcTQQkLwQjQ6Q66Qm7vhvvLLJgSmm9izRTzLc1imQhRo5aX42TxrAi4HIKzJRGQVG7NJUyss/GHa6CSVsp0vIDbA0ktPcuiKQlL2Yt6HGtfzqJ53PXq4U3sf8qUs/cGHUfbp9deVj2N+Vsy2VywMQPjSu28tZfTNFoNJr/yQdz8nL7GJBkPQAAAABJRU5ErkJggg==","orcid":"","institution":"Bells University of Technology","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Olayinka","middleName":"Fisayo","lastName":"Onifade","suffix":""},{"id":192230791,"identity":"65ca7b2c-44d4-4914-b358-6f8af7eb581d","order_by":1,"name":"Oluseyi Adeboye Akinloye","email":"","orcid":"","institution":"Federal University of Agriculture","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Oluseyi","middleName":"Adeboye","lastName":"Akinloye","suffix":""},{"id":192230792,"identity":"55c75458-a6e0-4861-b470-98d648cfc29d","order_by":2,"name":"Oluwatosin A. Dosumu","email":"","orcid":"","institution":"Federal University of Agriculture","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Oluwatosin","middleName":"A.","lastName":"Dosumu","suffix":""},{"id":192230793,"identity":"cc44dcc6-5558-47d3-890f-9e3b2030833c","order_by":3,"name":"Abdul Lateef","email":"","orcid":"","institution":"Federal University of Agriculture","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Abdul","middleName":"","lastName":"Lateef","suffix":""},{"id":192230794,"identity":"530501b8-7b78-4b2d-ad10-e2f9936fa6cf","order_by":4,"name":"Olufemi Samuel Amoo","email":"","orcid":"","institution":"Nigeria Institute of Medical Research","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Olufemi","middleName":"Samuel","lastName":"Amoo","suffix":""},{"id":192230795,"identity":"f1c68d1e-14df-41cf-8c54-5910b7cc1b1a","order_by":5,"name":"Idowu Olaposi Omotuyi","email":"","orcid":"","institution":"Adekunle Ajasin University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Idowu","middleName":"Olaposi","lastName":"Omotuyi","suffix":""},{"id":192230796,"identity":"d12d945a-d316-458d-a51d-36ab06d720ad","order_by":6,"name":"Adebowale Abiodun. Alade","email":"","orcid":"","institution":"Adekunle Ajasin University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Adebowale","middleName":"Abiodun.","lastName":"Alade","suffix":""}],"badges":[],"createdAt":"2023-02-23 18:59:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2621916/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2621916/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":35942406,"identity":"d7c0b0df-6834-4f54-bd59-2f765ffa50b0","added_by":"auto","created_at":"2023-04-18 14:34:10","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":40627,"visible":true,"origin":"","legend":"\u003cp\u003eGas chromatography–mass spectrometry chromatography of the ethanolic extract of \u003cem\u003eCurcuma longa\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-2621916/v1/88b30bfdfe2e5d2a8a6f4eb8.png"},{"id":35944726,"identity":"7c119bfa-1e84-43fc-964d-60743b61dee2","added_by":"auto","created_at":"2023-04-18 14:50:10","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":113492,"visible":true,"origin":"","legend":"\u003cp\u003e2D IFD 2-Cyclohexen-1-ol interactions with MAPK active site residues\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-2621916/v1/9b209a5623220b03de993e13.png"},{"id":35944000,"identity":"ff8bab01-e51f-4b6c-b25e-4928c580ceae","added_by":"auto","created_at":"2023-04-18 14:42:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":119922,"visible":true,"origin":"","legend":"\u003cp\u003e2D IFD 12-Oxabicyclo[9.1.0]dodeca-3,7-diene interactions with MAPK active site\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-2621916/v1/63b605e5ecdcbb45dc658d67.png"},{"id":35942410,"identity":"ee664baa-7b87-4a37-83bb-e3519d49cb65","added_by":"auto","created_at":"2023-04-18 14:34:10","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":157964,"visible":true,"origin":"","legend":"\u003cp\u003e2D IFD cis-sesquisabinene hydrate interactions with MAPK active site residues\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-2621916/v1/b577842dcec37adcee07e474.png"},{"id":35944003,"identity":"8cbc4886-de15-4948-9401-da5ac04b3517","added_by":"auto","created_at":"2023-04-18 14:42:10","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":179953,"visible":true,"origin":"","legend":"\u003cp\u003e2D IFD co-crystallized interactions with MAPK active site residues\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-2621916/v1/8f76228f85bf5f7e4c5201ac.png"},{"id":35942415,"identity":"df080309-f0bf-4f80-a6ba-3d0a2947d327","added_by":"auto","created_at":"2023-04-18 14:34:10","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":140768,"visible":true,"origin":"","legend":"\u003cp\u003e2D IFD curcumin interactions with MAPK active site residues\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-2621916/v1/77da158c3f7d617d4e0c034e.png"},{"id":35944933,"identity":"e3085798-8e12-4f21-8b44-32d8ea6f1c4c","added_by":"auto","created_at":"2023-04-18 14:58:10","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":162117,"visible":true,"origin":"","legend":"\u003cp\u003e2D IFD Curlone interactions with MAPK active site residues\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-2621916/v1/3d07c4c9b2fe3589cfac7cb6.png"},{"id":35944007,"identity":"bcbdd60a-db6f-475f-8e47-4715c0d0a7a4","added_by":"auto","created_at":"2023-04-18 14:42:10","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":2241862,"visible":true,"origin":"","legend":"\u003cp\u003eA: MAPK MALE Values are expressed mean ± SEM. Values with different letters are significantly different at p \u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003eB; MAPK female Values are expressed mean ± SEM. Values with different letters are significantly different at p \u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003eC: VEGF MALE. Values are expressed mean ± SEM. Values with different letters are significantly different at p \u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003eD: VEGF FEMALE. Values are expressed mean ± SEM. Values with different letters are significantly different at p \u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003eE : EGFR MALE. Values are expressed mean ± SEM. Values with different letters are significantly different at p \u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003eF: EGFR FEMALE. Values are expressed mean ± SEM. Values with different letters are significantly different at p \u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003eG: HIF MALE. Values are expressed mean ± SEM. Values with different letters are significantly different at p \u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003eH: HIF FEMALE.Values are expressed mean ± SEM. Values with different letters are significantly different at p \u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003eI: Alpha fero protein level in male rats.Values are expressed mean ± SEM. Values with different letters are significantly different at p \u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003eJ: AFP FEMALE. Values are expressed mean ± SEM. Values with different letters are significantly different at p \u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003eK: p53 MALE.Values are expressed mean ± SEM. Values with different letters are significantly different at p \u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003eL: p53 FEMALE. Values are expressed mean ± SEM. Values with different letters are significantly different at p \u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003eM: Xiap MALE. Values are expressed mean ± SEM. Values with different letters are significantly different at p \u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003eN: Xiap FEMALE. Values are expressed mean ± SEM. Values with different letters are significantly different at p \u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003eO: IL-10 MALE. Values are expressed mean ± SEM. Values with different letters are significantly different at p \u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003eP: IL-10 FEMALE. Values are expressed mean ± SEM. Values with different letters are significantly different at p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-2621916/v1/4da3f9bcf35e1192c8d1ffa6.png"},{"id":39158886,"identity":"b7cf14f0-3937-423e-b256-104eb5dfb8dc","added_by":"auto","created_at":"2023-06-27 10:45:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1508808,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2621916/v1/5a91be04-d68a-44cd-a82d-faf126828210.pdf"},{"id":35944932,"identity":"de18d8e2-136a-4f5c-8c0d-bc7deefffaeb","added_by":"auto","created_at":"2023-04-18 14:58:10","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":108291,"visible":true,"origin":"","legend":"","description":"","filename":"geneexpressionsupplementry1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2621916/v1/f06d3da19a6a8db26e9a38d2.pdf"},{"id":35945503,"identity":"63bcc50e-b8eb-40e9-bb65-70630bc0e1d0","added_by":"auto","created_at":"2023-04-18 15:06:10","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":71190,"visible":true,"origin":"","legend":"","description":"","filename":"Geneexpressionsupplementary2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-2621916/v1/4db8a3f30ece03a526d3164d.xlsx"},{"id":35944729,"identity":"4f0901dc-229c-4eae-addd-f4aa69bba559","added_by":"auto","created_at":"2023-04-18 14:50:10","extension":"csv","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":92697,"visible":true,"origin":"","legend":"","description":"","filename":"supplementary.csv","url":"https://assets-eu.researchsquare.com/files/rs-2621916/v1/5a94bfe3c13a9686bcf557a8.csv"}],"financialInterests":"No competing interests reported.","formattedTitle":"MAPK domain inhibition: Validation of the anti-angiogenic effects of curcumin from Curcuma longa in NDEA model of liver carcinoma in Wistar rats","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eCancer is known to be heterogeneous which leads to many genetic changes within the cell[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. liver cancer is more predominant in male as the fifth most diagnosed while seventh in female [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Hepatocellular carcinoma (HCC) ranks the sixth cancer in the world is a primary type of liver cancer [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. HCC is the fourth type of cancer with high mortality rate. Factors that induce this condition ranges from hepatitis infection, alcoholic life style, smoking habit, unsafe sexual practices and consumption of contaminated foods [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe mitogen activated protein kinase (MAPK) cascade consist of serine/threonine kinases which convert extracellular molecules such as growth factors, hormones and tumor-promoting substances into intracellular signals for regulating cell proliferation, differentiation and survival [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The mitogen-activated protein kinase (MAPK) has four core protein kinases which are Ras, Raf, MEK and ERK that are initiated by ligand binding to receptor tryrosine kinase at the cell surface and in the nucleus they are involved in regulating gene expression [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. MAPKs were implicated in diverse cellular processes such as cell survival, differentiation, adhesion, and proliferation [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eA wide variety of foods and plants, including vegetables, flowers, fruits, cereals, spices, mushrooms, tea, algae, wild fruits, and medical plants, have been found to contain significant amounts of natural polyphenols from medicinal plants [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Polyphenols are known to show remarkable properties of promoting apoptosis and suppressing proliferation of cells via various pathways [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. \u003cem\u003eCurcuma longa\u003c/em\u003e commonly known as tumeric is a perennial herb, a rhizome containing volatile oil and curcumin being the active constituent [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. \u003cem\u003eIn silico\u003c/em\u003e method of accessing drug targets that will bind small molecule libraries [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Computational methods for hit-to-lead optimization that can cover a large number of drug-like candidates from the pool of phytochemicals derived from plants while cutting costs and time [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Anti-angiogenic properties of ethanolic extract of \u003cem\u003eCurcuma longa (CL) phytochemials\u003c/em\u003e were queried by affinity-based molecular docking and Prime MM-GBSA (Molecular Mechanics-Generalized Born Surface Area) to understand the binding affinity and atomistic interaction of CL compounds with MAPK for anti-angiogenesis. \u003cem\u003eCurcuma longa\u003c/em\u003e phytochemical were isolated from the root of the plant, and their anti-angiogenic effects were validated in N-Nitrosodiethylamine (NDEA) model of liver carcinoma in male and female wistar rats.\u003c/p\u003e"},{"header":"2. Methods","content":"\u003cp\u003e\u003cstrong\u003e2.1 Ethical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved based on the compliance with ethical standards and the relevant national and institutional guidelines on the care and use of laboratory by the Research Ethics Committee, with the approval number IRB/21/028 at the Nigerian Institute of Medical Research (NIMA) Yaba, Lagos State, Nigeria.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 Sourcing and Authentication of Plant Material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCurcuma longa\u0026nbsp;\u003c/em\u003e rhizome was purchased from Ota market, Abeokuta, Ogun state, Nigeria. The root was authenticated with the authentication number FHA-3726 at the Department of Pure and Applied Botany, College of Biosciences, Federal University of Agriculture, Abeokuta, Ogun State, Nigeria.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 Preparation of the Ethanolic \u003cem\u003eCurcuma longa\u0026nbsp;\u003c/em\u003eExtract\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEthanolic extraction\u003cem\u003e\u0026nbsp;of Curcuma longa\u003c/em\u003e was carried out according to the method of\u003cem\u003e\u0026nbsp;\u003c/em\u003e[15]. Powdered \u003cem\u003eCurcuma longa\u0026nbsp;\u003c/em\u003eweighing 300 g was then macerated in 95% ethanol\u003cem\u003e\u0026nbsp;\u003c/em\u003e over 48 hours. The extract were filtered through number 1 Whatman filter paper. The \u003cem\u003eCurcuma longa\u003c/em\u003e extract was concentrated using a rotary evaporator and afterwards stored at 4\u0026deg;C in a refrigerator until use.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 Gas chromatography (GC)/mass spectrometry (MS) analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe crude ethanolic extract of Curcuma longa was diluted with ethanol (1/100, v/v). filtered, too. A syringe was filled with the particle-free, diluted crude extract (1 L), before being injected into a GC-MS device with a 1:100 split ratio. The research wasperformed using an interfaced GC (Agilent 7890A, Agilent Technologies, USA)Agilent Technologies\u0026apos; mass selective detector (MSD, Agilent 7000) is outfitted with a capillary column of polar HP-5ms (30 m, 0.25 mm i.d., 0.25 m film thickness) Agilent (polysiloxane with a phenyl content of 5%). Operating the column at a linear speed helium serves as the carrier gas, moving at a velocity of 1 mL min-1 at 210 \u0026deg;C.\u003c/p\u003e\n\u003cp\u003eIdentification of chemical components was done via the mass spectral data and their fragmentation patterns [16].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5 Protein retrieval and preparation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe three-dimensional (3D) crystal structure of MAPK in complex with its inhibitor (PDB ID: 7AUV) was downloaded from the Protein Data Bank (http://www.rcsb.org/pdb). The co-crystallized inhibitor, ASTX029, is currently being evaluated in human phase I-II clinical trials in patients with advanced solid tumors [17]; this makes it a reference inhibitor for comparative study. The protein was viewed and prepared with the Protein Preparation Wizard [18] panel of the Schr\u0026ouml;dinger Maestro suite 11.5 [19]. In detail, the missing loops and the side chains were filled using Prime [20], bond orders were assigned, extrinsic hydrogen bond was added, the water and other molecules used for crystallization were removed, disulfide bonds were created, and the state was generated at pH 7.0\u0026plusmn;2.0 using Epik [21]. Thereafter, the protein was optimized using PROPKA P\u003csup\u003eH\u003c/sup\u003e 7.0 and subjected to retrained minimization with heavy atoms restrained and hydrogen unrestrained with OPLS3 force field [22].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6 Ligand preparation\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe two-dimensional (2D) structures of the 40 phytochemicals reported from the ethanolic extract of CL L. rhizomes [23] and the FDA-approved ERK inhibitor (ulixertinib)[24] were downloaded in SDF format from the NCBI PubChem database (https://pubchem.ncbi.nlm.nih.gov). The structures were imported into Schr\u0026ouml;dinger Maestro 11.5 and prepared with the LigPrep interface of the software which effectively converts the 2D structures to 3D structures suitable for docking analysis [25]. ASTX029 was extracted from the protein and prepared accordingly to provide. All the compounds were desalted, tautomers were generated, specified chiralities were retained, OPLS3 force field [23] was used to generate low-energy states, and possible ionization states were generated at pH 7.0\u0026plusmn;2.0 using Epik [22].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;2.7 Molecular docking (rigid and induced fit approach)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Receptor Grid Generation panel of Schr\u0026ouml;dinger Maestro was used to define the binding pocket of the protein (ERK2) by specifying the size and position of the protein\u0026rsquo;s active site for ligand docking. The co-crystallized ligand was selected to guide the grid box mapping. The van der Waals (vdW) radius scaling factor of nonpolar receptor atoms and partial charge cut-off were set to 1.0 and 0.25, respectively. Thereafter, the molecular docking of the ligands was performed with the predefined ERK2 receptor grid using the Extra precision (XP) rigor of the Ligand Docking panel of the Schr\u0026ouml;dinger Maestro Glide tool [26]. The vdW radius scaling factor (0.80) and partial charge cutoff (0.15) were left at default. Furthermore, Induced Fit Docking [27] was performed for the top 3 hit compounds of CL resulting from the rigid docking and the reference ligands (ASTX029). The IFD panel of Schr\u0026ouml;dinger Maestro was used accordingly as previously described by [28]. Here, IFD allows the flexibility of both the ERK\u0026rsquo;s active site and the ligand for better ligand binding and protein-ligand interaction.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;2.8 Molecular docking validation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUsing the generally recognized validation method, the Root Mean Square Deviation (RMSD) value of the native crystal structure pose and the docked pose of the co-crystalized ligand was calculated to validate the molecular docking protocol [29,30]. The previously extracted and prepared co-crystallized ligand was docked using the predefined ERK2 receptor grid in the Schr\u0026ouml;dinger Maestro workspace. The RMSD was calculated by superimposing the poses of the crystal structure ligand before and after docking.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;2.9 PRIME MM-GBSA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe free energy of binding (\u0026Delta;Gbind) of the protein-ligand complexes of the hit compounds and reference ligands were calculated for the complexes resulting from IFD. We used the Prime MM-GBSA [31] interface of Schr\u0026ouml;dinger Maestro 11.5 setting OPLS3 as the force field, VSGB as the solvation model, and minimize as the sampling methods. This \u0026Delta;Gbind was estimated using the following equation:\u003c/p\u003e\n\u003cp\u003e\u0026Delta;Gbind = \u0026Delta;EMM + \u0026Delta;Gsolv + \u0026Delta;GSA\u003c/p\u003e\n\u003cp\u003eWhere, \u0026Delta;EMM, \u0026Delta;Gsolv, and \u0026Delta;GSA are the change in minimized energies, change in solvation energies, and change in surface area energies, respectively. The change (\u0026Delta;) is calculated as the difference in the protein\u0026ndash;inhibitor complex, uncomplexed protein, and the inhibitor energy [32,33].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;2.10 Pharmacokinetics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe novel inhibitors from CL and the reference ligands were subjected to ADMET evaluation to understand their pharmacokinetics, drug-likeness, and toxicity properties. SwissADME[34] and PROTOX [35] were used combinatorially via the online tool provided on http://www.swissadme.ch/ and https://tox-new.charite.de/protox_II/, respectively. The chemical structure of each ligand was submitted to SwissADME and ProTox servers in their canonical simplified molecular-input line-entry system (SMILES) format obtained from the PubChem database. And the ADMET parameters were generated automatically.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;2.11 Experimental animals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments were performed with male and female Wistar rats weighing between 80-100g, which were bought from a reputable farm at Abeokuta and kept in the animal house facility of the Department of Chemical and Food Science, Bells University of Technology,Ota. The animals were housed and allowed to acclimatize to the animal house condition of temperature 24-27\u0026deg;C and light-dark cycle (12:12 hour) for two week before commencement of the experiment. Rats were fed with standard pellet diets and water \u003cem\u003ead libitum\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;2.12 Induction of liver damage\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eN-nitrosodiethyiamine (NDEA) was administered to rats once in a week for a period of two weeks interperitoneally at the dosage of 100mg/ kg body weight to induce the pathology to the liver according to the modified method of [36].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.13 Experimental design\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter acclimatization the rats were randomly divided into twelve groups of five animals per group for both male and female rats separately. Group A, B, C, D, E, and F received 100 mg/kg body weight of N-nitrosodiethylamine and treated with 200 mg, 400 mg and 600mg of ethanolic extract of \u003cem\u003eCurcuma longa\u003c/em\u003e for group A, B and C while group D were treated with 200 mg of pure curcumin and 100 mg of sylibon (standard drug ) in group E, animals in group F were not treated. Animals in G and H were administered 200 mg of pure curcumin only and 200 mg of DMSO respectively. Moreso, animals in group I, J and K received 200 mg, 400 mg and 600 mg of ethanolic extract of \u003cem\u003eCurcuma longa\u003c/em\u003e accordingly while group L was not treated. The treatment lasted for 28 days.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.14 Reverse Transcription\u0026ndash;Polymerase Chain Reaction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was isolated from liver tissues followed by reverse transcription, and quantitative PCR were carried out [37].The tumors\u0026apos; RNAs were extracted using the TRIzol reagent. RNA-free DNase was used to dissolve the RNAs, and the RNeasy kit from Qiagen (Germany) was used to purify them. For the synthesis of cDNA, reverse transcriptase, random hexanucleotides, and 40 mg of total RNA were incubated at 37\u0026deg;C for 60 min. Utilizing the Snap gene software, the primers were created. Actin was used as the control gene. The thermocycler was used to amplify the mRNAs at 50 cycles for 2 h 20 min. The PCR products were run on 1.0% agarose gels. Ethidium bromide (EtBr) staining was used for visualization. The primers are as follows:\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"639\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.084507042253522%\"\u003e\n \u003cp\u003eTARGET\u003c/p\u003e\n \u003cp\u003eGENES\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.38341158059468%\"\u003e\n \u003cp\u003eFORWARD 5\u0026prime; -3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.5320813771518%\"\u003e\n \u003cp\u003eREVERSE 5\u0026prime; -3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.084507042253522%\"\u003e\n \u003cp\u003eMAPK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.38341158059468%\"\u003e\n \u003cp\u003eGACGACTTACCTAAGGAGAAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.5320813771518%\"\u003e\n \u003cp\u003eCTGAGCCCTTGTCCTGACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.084507042253522%\"\u003e\n \u003cp\u003eVEGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.38341158059468%\"\u003e\n \u003cp\u003eAGAAAGCCCATGAAGTGGTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.5320813771518%\"\u003e\n \u003cp\u003eTCATCGGGGTACTCCTGGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.084507042253522%\"\u003e\n \u003cp\u003eIL-10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.38341158059468%\"\u003e\n \u003cp\u003eTTCCCTGGGAGAGAAGCTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.5320813771518%\"\u003e\n \u003cp\u003eGACACCTTTGTCTTGGAGCTTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.084507042253522%\"\u003e\n \u003cp\u003eP53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.38341158059468%\"\u003e\n \u003cp\u003eTCGAGATGTTCCGAGAGCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.5320813771518%\"\u003e\n \u003cp\u003eGTCTTCGGGTAGCTGGAGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.084507042253522%\"\u003e\n \u003cp\u003eXIAP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.38341158059468%\"\u003e\n \u003cp\u003eTGTTTTTCCTGATCGGGGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.5320813771518%\"\u003e\n \u003cp\u003eCTTGTCCACCTTTTCGCGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.084507042253522%\"\u003e\n \u003cp\u003eAFP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.38341158059468%\"\u003e\n \u003cp\u003eAGTGGAGCGCATCCATTTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.5320813771518%\"\u003e\n \u003cp\u003eCAACGACAATGGTAGCTACGTTAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.084507042253522%\"\u003e\n \u003cp\u003eTNF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.38341158059468%\"\u003e\n \u003cp\u003eACTGAACTTCGGGGTGATCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.5320813771518%\"\u003e\n \u003cp\u003eGCTTGGTGGTTTGCTACGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.084507042253522%\"\u003e\n \u003cp\u003eEGFR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.38341158059468%\"\u003e\n \u003cp\u003eGCCACAGGTTCCGAGATGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.5320813771518%\"\u003e\n \u003cp\u003eCCACGTAGTTTCTGGGGCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.084507042253522%\"\u003e\n \u003cp\u003eHIF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.38341158059468%\"\u003e\n \u003cp\u003eCCCAAAGACAATAGCTTTGCAGAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.5320813771518%\"\u003e\n \u003cp\u003eTTGCTGCAGTAACGTTCCAATTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.084507042253522%\"\u003e\n \u003cp\u003eACTIN BETA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.38341158059468%\"\u003e\n \u003cp\u003eCCACCAGTTCGCCATGGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.5320813771518%\"\u003e\n \u003cp\u003eCCCACCATCACACCCTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003emRNAs expression of angiogenic related genes in the hepatocyte tumours of NDEA-model of hepatocullular carcinoma following treatment with ethanolic extract of curcuma longa lin and curcumin isolate.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.15 Statistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOne-way analysis of variance (ANOVA) and Turkey\u0026rsquo;s multiple range tests in IBM-SPSS version 21.0 and GraphPad Prism version 7.0 were used. Data were denoted as the means \u0026plusmn; standard error of the mean (SEM). Significance was set at p \u003cem\u003e\u0026lt;\u0026nbsp;\u003c/em\u003e0.05.\u003c/p\u003e"},{"header":"3. RESULTS","content":"\u003cp\u003e\u003cstrong\u003e3.1 Gas Chromatography analysis of the ethanolic extract of\u0026nbsp;\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCurcuma longa\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe chromatogram of the Gas Chromatography analysis of the ethanolic extract of \u003cem\u003eCurcuma longa Linn\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003eidentified the major chemical constituents based on the peak retention time (Rt) and percentage area (Figure 1 and Table 1) a total of 40 compounds were identified.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 \u0026nbsp;Molecular interaction of\u0026nbsp;ethanolic extract of \u003cem\u003eCurcuma longa\u0026nbsp;\u003c/em\u003eon MAPK\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTable 2-3 shows the scoring function used to predict the binding affinity and the free binding energy of the binding of ligands with MAPK and \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eco-crystallized\u0026nbsp;compound (-15.15\u0026nbsp;kcal/mol\u0026nbsp;/ -99.6\u0026nbsp;kcal/mol), curcumin (-7.21\u0026nbsp;kcal/mol\u0026nbsp;/ -72.93\u0026nbsp;kcal/mol), cis-Sesquisabinene hydrate (-6.36\u0026nbsp;kcal/mol\u0026nbsp;/ -27.63\u0026nbsp;kcal/mol), 12-Oxabicyclo (9.1.0) dodeca-3,7-diene (-5.944\u0026nbsp;kcal/mol\u0026nbsp;/ -27.71\u0026nbsp;kcal/mol), Curlone (-5.691\u0026nbsp;kcal/mol\u0026nbsp;/-32.27\u0026nbsp;kcal/mol) and 2-Cyclohexen-1-ol (-5.505\u0026nbsp;kcal/mol\u0026nbsp;/ -2368\u0026nbsp;kcal/mol) as the top \u0026nbsp;five hit compounds while \u0026nbsp;17 Octadecynoic Acid (-2.21\u0026nbsp;kcal/mol\u0026nbsp;/ -38.98\u0026nbsp;kcal/mol), 2,5-Octadiene (-1.89kcal/mol\u0026nbsp;/-28.96\u0026nbsp;kcal/mol) and propane (-1.84\u0026nbsp;kcal/mol\u0026nbsp;/-15.18\u0026nbsp;kcal/mol) had the least\u0026nbsp;binding energy\u0026nbsp;result.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The molecular docking showed the interaction with various amino acids 2-Cyclohexen-1-ol express hydrogen bond interaction with amino acids with \u0026nbsp;MET 108 and \u0026nbsp; ASP 106 on the hydroxyl group of the MAPK protein (fig 2). Phytochemical 12-Oxabicyclo[9.1.0]dodeca-3,7-diene interacts with the carboxyl group of mapk \u0026nbsp;with hydrogn bond using MET 108 (fig 3). cis-sesquisabinene hydrate express hydrogen bond using MET 108 on the hydroxyl group of the MAPK protein (fig 4) cocrystallized expresses interactions with amine group, benzene ring, hydroxy group, nitrile group and carboxyl group with the following amino acids ASP167,CYS 166,ARG 67, ASP 167 and MET 108 using hydrogen bond and TYP64 with pi-pi stacking (fig 5). Curcumin Curlone bond interaction with amino acids with \u0026nbsp;MET 108 and \u0026nbsp;ASP 106 on the hydroxyl group of the MAPK protein(fig 6). 12-Curlone interacts with the carboxyl group of MAPK with hydrogen bond using MET 108 (fig 7).\u003c/p\u003e\n\u003cp\u003eTable 1: GC-MS of ethanolic extract of \u003cem\u003eCurcuma \u0026nbsp; longa Linn.\u003c/em\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"605\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.884297520661157%\"\u003e\n \u003cp\u003e\u003cstrong\u003eS/N\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.983471074380166%\"\u003e\n \u003cp\u003eRetention time \u0026nbsp;(min)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.512396694214875%\"\u003e\n \u003cp\u003ePeak area (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.024793388429753%\"\u003e\n \u003cp\u003e\u0026nbsp;Peak\u0026nbsp;Height (%)\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.59504132231405%\"\u003e\n \u003cp\u003eName of the compound\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.884297520661157%\"\u003e\n \u003cp\u003e\u003cstrong\u003e1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.983471074380166%\"\u003e\n \u003cp\u003e8.433\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.512396694214875%\"\u003e\n \u003cp\u003e2.27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.024793388429753%\"\u003e\n \u003cp\u003e0.95\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.59504132231405%\"\u003e\n \u003cp\u003e1,4-Methano-1H-cyclopenta[d]pyridazine\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.884297520661157%\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.983471074380166%\"\u003e\n \u003cp\u003e8.709\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.512396694214875%\"\u003e\n \u003cp\u003e0.24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.024793388429753%\"\u003e\n \u003cp\u003e0.12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.59504132231405%\"\u003e\n \u003cp\u003e2-Cyclohexen-1-ol\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.884297520661157%\"\u003e\n \u003cp\u003e\u003cstrong\u003e3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.983471074380166%\"\u003e\n \u003cp\u003e8.771\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.512396694214875%\"\u003e\n \u003cp\u003e0.58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.024793388429753%\"\u003e\n \u003cp\u003e0.28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.59504132231405%\"\u003e\n \u003cp\u003e6-Isopropenyl-3-methoxymethoxy-3-methyl\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.884297520661157%\"\u003e\n \u003cp\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.983471074380166%\"\u003e\n \u003cp\u003e10.092\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.512396694214875%\"\u003e\n \u003cp\u003e0.07\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.024793388429753%\"\u003e\n \u003cp\u003e0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.59504132231405%\"\u003e\n \u003cp\u003eAromandendrene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.884297520661157%\"\u003e\n \u003cp\u003e\u003cstrong\u003e5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.983471074380166%\"\u003e\n \u003cp\u003e10.274\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.512396694214875%\"\u003e\n \u003cp\u003e0.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.024793388429753%\"\u003e\n \u003cp\u003e0.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.59504132231405%\"\u003e\n \u003cp\u003eDoconexent\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.884297520661157%\"\u003e\n \u003cp\u003e\u003cstrong\u003e6\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.983471074380166%\"\u003e\n \u003cp\u003e10.391\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.512396694214875%\"\u003e\n \u003cp\u003e0.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.024793388429753%\"\u003e\n \u003cp\u003e0.07\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.59504132231405%\"\u003e\n \u003cp\u003eGamolenic Acid\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.884297520661157%\"\u003e\n \u003cp\u003e\u003cstrong\u003e7\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.983471074380166%\"\u003e\n \u003cp\u003e10.525\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.512396694214875%\"\u003e\n \u003cp\u003e0.83\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.024793388429753%\"\u003e\n \u003cp\u003e0.92\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.59504132231405%\"\u003e\n \u003cp\u003eBenzene\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.884297520661157%\"\u003e\n \u003cp\u003e\u003cstrong\u003e8\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.983471074380166%\"\u003e\n \u003cp\u003e10.667\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.512396694214875%\"\u003e\n \u003cp\u003e0.73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.024793388429753%\"\u003e\n \u003cp\u003e0.91\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.59504132231405%\"\u003e\n \u003cp\u003e1,3-Cyclohexadiene\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.884297520661157%\"\u003e\n \u003cp\u003e\u003cstrong\u003e9\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.983471074380166%\"\u003e\n \u003cp\u003e10.799\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.512396694214875%\"\u003e\n \u003cp\u003e0.24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.024793388429753%\"\u003e\n \u003cp\u003e0.23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.59504132231405%\"\u003e\n \u003cp\u003eCis-.alpha.-Bisabolene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.884297520661157%\"\u003e\n \u003cp\u003e\u003cstrong\u003e10\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.983471074380166%\"\u003e\n \u003cp\u003e10.929\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.512396694214875%\"\u003e\n \u003cp\u003e1.09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.024793388429753%\"\u003e\n \u003cp\u003e1.36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.59504132231405%\"\u003e\n \u003cp\u003eCyclohexene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.884297520661157%\"\u003e\n \u003cp\u003e\u003cstrong\u003e11\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.983471074380166%\"\u003e\n \u003cp\u003e11.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.512396694214875%\"\u003e\n \u003cp\u003e0.08\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.024793388429753%\"\u003e\n \u003cp\u003e0.08\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.59504132231405%\"\u003e\n \u003cp\u003e1-Cyclohexene-1-methanol\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e12\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e11.128\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e12-Oxabicyclo[9.1.0]dodeca-3,7-diene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e13\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e11.171\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCyclopentaneacetaldehyde\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e14\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e11.308\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1.97\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2.29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePropane\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e15\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e11.413\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2.11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1-(2,3-Dihydroindol-1-yl)-4-phenyl-butan-1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e16\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e11.489\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2.04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2.11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNaphthalene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e17\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e11.529\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.85\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.87\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAlpha.-ylangene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e18\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e11.578\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1.29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCis-Z-.alpha.-Bisabolene epoxide\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e19\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e11.703\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.66\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e6-(p-Tolyl)-2-methyl-2-heptenol\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e20\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e11.774\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1.79\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1.98\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCurlone\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e21\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e11.817\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2.82\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2.26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eBeta.-ylangene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e22\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e11.998\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e24.27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e18.36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAr-tumerone\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e23\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e12.072\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e17.83\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e22.76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTumerone\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e24\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e12.261\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1.47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCis-sesquisabinene hydrate\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e25\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e12.330\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e13.12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e17.76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCurlone\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e26\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e12.661\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2.27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1.51\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2,5-Octadiene, 3,4,5,6-tetramethyl\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e27\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e12.770\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1.88\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTumerone\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e28\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e12.826\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e3.36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e4.37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTumerone\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e29\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e12.885\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e3.73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e4.87\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e3,7-Cyclodecadien-1-one\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e30\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e13.013\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2.72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1.24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eProp-2-ynyl(E)-2-methylbut-2-enoate\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e31\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e13.184\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e4.07\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e3.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTumerone\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e32\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e13.299\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.64\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eBicyclo[3.1.0]hexan-3-ol\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e33\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e13.749\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.56\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e6Z-2,5,5,10-Tetramethyl-undeca-2,6,9-trien\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e34\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e13.913\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.78\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1,4-Methanoazulen-9-ol\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e35\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e14.379\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.49\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2-Methyl-4-octenal\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e36\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e14.635\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.08\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.08\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCyclohexanol\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e37\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15.149\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCyclopropaneoctanoic acid\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e38\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15.201\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCyclopropanebutanoic acid\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e39\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15.458\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e9,12-Octadecadienoic acid\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e40\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15.500\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e17-Octadecynoic acid\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2:\u0026nbsp;\u003c/strong\u003eDocking score and molecular mechanics with generalized born and surface area solvation (MMGBSA)\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"542\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"8.671586715867159%\"\u003e\n \u003cp\u003e\u003cstrong\u003eS/N\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"54.7970479704797%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCompounds\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.71217712177122%\"\u003e\n \u003cp\u003e\u003cstrong\u003eDocking Score\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.819188191881917%\"\u003e\n \u003cp\u003e\u003cstrong\u003eMMGBSA dG Bind\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"8.671586715867159%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"54.7970479704797%\"\u003e\n \u003cp\u003eCocrystallized (standard)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.71217712177122%\"\u003e\n \u003cp\u003e-15.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.819188191881917%\"\u003e\n \u003cp\u003e-99.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"8.671586715867159%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"54.7970479704797%\"\u003e\n \u003cp\u003ecurcumin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.71217712177122%\"\u003e\n \u003cp\u003e-7.212\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.819188191881917%\"\u003e\n \u003cp\u003e-72.93\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"8.671586715867159%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"54.7970479704797%\"\u003e\n \u003cp\u003ecis-sesquisabinene hydrate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.71217712177122%\"\u003e\n \u003cp\u003e-6.361\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.819188191881917%\"\u003e\n \u003cp\u003e-27.63\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"8.671586715867159%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"54.7970479704797%\"\u003e\n \u003cp\u003e12-Oxabicyclo[9.1.0]dodeca-3,7-diene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.71217712177122%\"\u003e\n \u003cp\u003e-5.944\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.819188191881917%\"\u003e\n \u003cp\u003e-27.71\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"8.671586715867159%\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"54.7970479704797%\"\u003e\n \u003cp\u003eCurlone\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.71217712177122%\"\u003e\n \u003cp\u003e-5.691\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.819188191881917%\"\u003e\n \u003cp\u003e-32.27\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"8.671586715867159%\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"54.7970479704797%\"\u003e\n \u003cp\u003e2-Cyclohexen-1-ol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.71217712177122%\"\u003e\n \u003cp\u003e-5.505\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.819188191881917%\"\u003e\n \u003cp\u003e-23.68\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e3.3 ADMET and the drug-likeness predictions.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe pharmacokinetic profile of the test compounds is presented in Table 3 The result showed that all the compounds are highly absorbable by the human intestine. Among all the test compounds, only ASTX029 (co-ligand) is a substrate for the P-glycoprotein (P-gp). only cocrystallized and curcumin compounds that cannot permeate the blood-brain barrier (BBB) (Table 3).cocrystallized and curcumin \u0026nbsp;compound were the \u0026nbsp;inhibitor of both CYP2C9 \u0026nbsp;and CYP3A4 \u0026nbsp; the cytochrome p450 (CYP450) isoformsAlso, ASTX029 and Curcumin have the lowest skin permeation (Log \u003cem\u003ek\u003c/em\u003ep) potential. (Table 3)\u003c/p\u003e\n\u003cp\u003eFurthermore, the drug-likeness profile given in Table 3 showed that only ASTX029 violated Lipinski\u0026rsquo;s rule of 5 (RO5); (MW \u0026lt; 500, HBD \u0026lt; 5, HBA \u0026lt; 10, Logp \u0026le; 5). It also has the highest number of rotatable bonds (10). Generally, ASTX029 and Curcumin compounds have TPSA \u0026lt; 140\u0026Aring;\u003csup\u003e2\u0026nbsp;\u003c/sup\u003e(Table 4) while\u0026nbsp;cis-Sesquisabinene hydrate.2-Cyclohexen-1-ol and 12-Oxabicyclo[9.1.0]dodeca-3,7-dienehaving TPSA \u0026lt; 90\u0026Aring;\u003csup\u003e2\u003c/sup\u003e, and they are the only compounds that can permeate the blood-brain barrier (BBB) (Table 3). Finally, the Pro-Tox II toxicity prediction presented in Table 5 showed that all the parameters for each compound are reliably predicted with PA greater than 50%. Besides curcumin which is immunotoxic, all other compounds are not hepatotoxic, cytotoxic, immunotoxic, carcinogenic, or mutagenic. Most of the test compounds are non-toxic (based on Toxicity level). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 3. Pharmacokinetic properties of the 4 hit compounds and reference ligands (ASTX029) as predicted by SwissADME\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"981\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.708886618998978%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCompounds\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.580183861082737%\"\u003e\n \u003cp\u003eGI absorption\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.19305413687436%\"\u003e\n \u003cp\u003eBBB Permeant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.6608784473953015%\"\u003e\n \u003cp\u003eP-gp substrate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.19305413687436%\"\u003e\n \u003cp\u003eCYP1A2 inhibitor\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.010214504596528%\"\u003e\n \u003cp\u003eCYP2C19 inhibitor\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.746680286006129%\"\u003e\n \u003cp\u003eCYP2C9 inhibitor\u003csup\u003e\u0026para;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.112359550561798%\"\u003e\n \u003cp\u003eCYP2D6 inhibitor\u003csup\u003e\u0026para;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.397344228804902%\"\u003e\n \u003cp\u003eCYP3A4 inhibitor\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.397344228804902%\"\u003e\n \u003cp\u003eLog \u003cem\u003ek\u003c/em\u003ep (cm/s)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.708886618998978%\"\u003e\n \u003cp\u003eCurlone\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.580183861082737%\"\u003e\n \u003cp\u003eHigh\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.19305413687436%\"\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.6608784473953015%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.19305413687436%\"\u003e\n \u003cp\u003e\u0026nbsp;no\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.010214504596528%\"\u003e\n \u003cp\u003eyes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.746680286006129%\"\u003e\n \u003cp\u003eyes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.112359550561798%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.397344228804902%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.397344228804902%\"\u003e\n \u003cp\u003e-4.78\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.708886618998978%\"\u003e\n \u003cp\u003ecurcumin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.580183861082737%\"\u003e\n \u003cp\u003eHigh\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.19305413687436%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.6608784473953015%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.19305413687436%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.010214504596528%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.746680286006129%\"\u003e\n \u003cp\u003eyes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.112359550561798%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.397344228804902%\"\u003e\n \u003cp\u003eyes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.397344228804902%\"\u003e\n \u003cp\u003e-6.28\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.708886618998978%\"\u003e\n \u003cp\u003ecocrystalized\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.580183861082737%\"\u003e\n \u003cp\u003eHigh\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.19305413687436%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.6608784473953015%\"\u003e\n \u003cp\u003eyes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.19305413687436%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.010214504596528%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.746680286006129%\"\u003e\n \u003cp\u003eyes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.112359550561798%\"\u003e\n \u003cp\u003eyes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.397344228804902%\"\u003e\n \u003cp\u003eyes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.397344228804902%\"\u003e\n \u003cp\u003e-7.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.708886618998978%\"\u003e\n \u003cp\u003ecis-sesquisabinene hydrate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.580183861082737%\"\u003e\n \u003cp\u003eHigh\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.19305413687436%\"\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.6608784473953015%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.19305413687436%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.010214504596528%\"\u003e\n \u003cp\u003eyes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.746680286006129%\"\u003e\n \u003cp\u003eyes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.112359550561798%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.397344228804902%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.397344228804902%\"\u003e\n \u003cp\u003e-4.76\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.708886618998978%\"\u003e\n \u003cp\u003e12-Oxabicyclo[9.1.0]dodeca-3,7-diene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.580183861082737%\"\u003e\n \u003cp\u003eHigh\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.19305413687436%\"\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.6608784473953015%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.19305413687436%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.010214504596528%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.746680286006129%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.112359550561798%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.397344228804902%\"\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.397344228804902%\"\u003e\n \u003cp\u003e-5.26\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eGI absorption- gastrointestinal absorption. BBB permeant- Blood-brain barrier permeant. P-gp substrate- P-Glycoprotein substrate. \u003csup\u003e\u0026para;\u003c/sup\u003einhibition test for cytochrome p450 enzyme isoforms\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 4:\u003cem\u003e\u0026nbsp;\u003c/em\u003eThe pedicted drug-likeness properties of the \u0026nbsp;hit compounds and reference ligands (ASTX029) by SwissADMET.\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"650\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.70552147239264%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCompounds\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.503067484662576%\"\u003e\n \u003cp\u003e\u003cstrong\u003eMW (g/mol)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.975460122699387%\"\u003e\n \u003cp\u003e\u003cstrong\u003eHBD\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.43558282208589%\"\u003e\n \u003cp\u003e\u003cstrong\u003eHBA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.50920245398773%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTPSA\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(\u0026Aring;\u0026sup2;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.877300613496933%\"\u003e\n \u003cp\u003e\u003cstrong\u003eConsensors logp\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.496932515337424%\"\u003e\n \u003cp\u003e\u003cstrong\u003eRotatable bond\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.496932515337424%\"\u003e\n \u003cp\u003e\u003cstrong\u003eLipinski violation\u003c/strong\u003e\u003csup\u003e\u0026para;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.70552147239264%\"\u003e\n \u003cp\u003eCurlone\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.503067484662576%\"\u003e\n \u003cp\u003e218.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.975460122699387%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.43558282208589%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.50920245398773%\"\u003e\n \u003cp\u003e17.07\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.877300613496933%\"\u003e\n \u003cp\u003e3.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.496932515337424%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.496932515337424%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.70552147239264%\"\u003e\n \u003cp\u003ecurcumin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.503067484662576%\"\u003e\n \u003cp\u003e368.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.975460122699387%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.43558282208589%\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.50920245398773%\"\u003e\n \u003cp\u003e93.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.877300613496933%\"\u003e\n \u003cp\u003e3.03\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.496932515337424%\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.496932515337424%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.70552147239264%\"\u003e\n \u003cp\u003ecocrystalized\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.503067484662576%\"\u003e\n \u003cp\u003e584.04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.975460122699387%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.43558282208589%\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.50920245398773%\"\u003e\n \u003cp\u003e125.91\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.877300613496933%\"\u003e\n \u003cp\u003e3.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.496932515337424%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.496932515337424%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.70552147239264%\"\u003e\n \u003cp\u003ecis-sesquisabinene hydrate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.503067484662576%\"\u003e\n \u003cp\u003e222.37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.975460122699387%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.43558282208589%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.50920245398773%\"\u003e\n \u003cp\u003e20.23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.877300613496933%\"\u003e\n \u003cp\u003e3.81\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.496932515337424%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.496932515337424%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.70552147239264%\"\u003e\n \u003cp\u003e12-Oxabicyclo[9.1.0]dodeca-3,7-diene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.503067484662576%\"\u003e\n \u003cp\u003e164.24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.975460122699387%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.43558282208589%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.50920245398773%\"\u003e\n \u003cp\u003e12.53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.877300613496933%\"\u003e\n \u003cp\u003e2.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.496932515337424%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.496932515337424%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003csup\u003e\u0026para;\u003c/sup\u003e is the number of Lipinski rules violated. The rule states that druglike compounds should have Molecular weight (MW) \u0026lt;500, Hydrogen Bond Donor (HBD) \u0026lt; 5, Hydrogen Bond Acceptor (HBA) \u0026lt; 10, and Octanol/Water partition coefficient (logP) \u0026le; 5. TPSA - Topological polar surface area\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 5: Pro-Tox II toxicity prediction for the 3 Hit compounds and reference ligands (ASTX029 )\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"602\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.465890183028286%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCompounds\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.314475873544094%\"\u003e\n \u003cp\u003e\u003cstrong\u003eHT\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.317803660565724%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCG\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.316139767054908%\"\u003e\n \u003cp\u003e\u003cstrong\u003eIT\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.81863560732113%\"\u003e\n \u003cp\u003e\u003cstrong\u003eMG\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.321131447587354%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCT\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.647254575707155%\"\u003e\n \u003cp\u003e\u003cstrong\u003eToxicity class\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.317803660565724%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePA\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.480865224625624%\"\u003e\n \u003cp\u003e\u003cstrong\u003eLD50\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(mg/kg)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.465890183028286%\"\u003e\n \u003cp\u003eASTX029\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.314475873544094%\"\u003e\n \u003cp\u003e-\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.317803660565724%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.316139767054908%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.81863560732113%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.321131447587354%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.647254575707155%\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.317803660565724%\"\u003e\n \u003cp\u003e54.26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.480865224625624%\"\u003e\n \u003cp\u003e2500\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.465890183028286%\"\u003e\n \u003cp\u003eCurcumin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.314475873544094%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.317803660565724%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.316139767054908%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.81863560732113%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.321131447587354%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.647254575707155%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.317803660565724%\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.480865224625624%\"\u003e\n \u003cp\u003e2000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.465890183028286%\"\u003e\n \u003cp\u003ecis-sesquisabinene hydrate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.314475873544094%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.317803660565724%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.316139767054908%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.81863560732113%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.321131447587354%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.647254575707155%\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.317803660565724%\"\u003e\n \u003cp\u003e70.97\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.480865224625624%\"\u003e\n \u003cp\u003e3450\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.465890183028286%\"\u003e\n \u003cp\u003e12-Oxabicyclo[9.1.0]dodeca-3,7-diene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.314475873544094%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.317803660565724%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.316139767054908%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.81863560732113%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.321131447587354%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.647254575707155%\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.317803660565724%\"\u003e\n \u003cp\u003e69.26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.480865224625624%\"\u003e\n \u003cp\u003e5000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.465890183028286%\"\u003e\n \u003cp\u003eCurlone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.314475873544094%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.317803660565724%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.316139767054908%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.81863560732113%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.321131447587354%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.647254575707155%\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.317803660565724%\"\u003e\n \u003cp\u003e69.26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.480865224625624%\"\u003e\n \u003cp\u003e4600\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.465890183028286%\"\u003e\n \u003cp\u003e2-Cyclohexen-1-ol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.314475873544094%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.317803660565724%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.316139767054908%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.81863560732113%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.321131447587354%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.647254575707155%\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.317803660565724%\"\u003e\n \u003cp\u003e69.26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.480865224625624%\"\u003e\n \u003cp\u003e3000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e+ means active, - means inactive. HT - Hepatotoxicity, CG - Carcinogenicity, IT - Immunotoxicity, MG - Mutagenicity, CT- \u0026nbsp;Cytogenicity, PA - Prediction Accuracy. Toxicity class ranges \u0026nbsp; from value 1 to 6 with value 1 being toxic and 6 being non-toxic.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e3.4 \u0026nbsp;mRNAs expression of angiogenic related genes in the liver tumours of NDEA-model of hepatocellularcarcinoma following treatment with \u003cem\u003eCurcuma longa\u003c/em\u003e isolates\u003c/p\u003e\n\u003cp\u003e3.4.1 \u0026nbsp;Relative expression of MAPK mRNA\u003c/p\u003e\n\u003cp\u003eMAPKs regulate important cellular processes such as proliferation, stress responses, apoptosis and immune defense [38,39]. MAPKs are ubiquitously expressed and evolutionarily conserved in eukaryotes [40,41].\u003c/p\u003e\n\u003cp\u003eIn Fig. 8 A, the expression of\u0026nbsp;Mapk mRNA was significant downregulation \u0026nbsp;(p \u0026lt; 0.05) \u0026nbsp; in group A, B, C, D, E, H, I, J, K and L when compared with negative control group F in male rats. Moreso, in the female rats (Fig. 8 B) there is a significant downregulation (p \u0026lt; 0.05) in the group A, B, C, D, E,G, H, I, J, K and l when compared with negative control group L.\u003c/p\u003e\n\u003cp\u003e3.4.2 Relative expression of VEGF mRNA\u003c/p\u003e\n\u003cp\u003eThe primary mediator of angiogenesis in cancer is VEGF, which is elevated by Hypoxia, growth factors, and oncogene expression. For angiogenesis to occur, Neoplastic growth and proliferation[42].\u003c/p\u003e\n\u003cp\u003eIn Fig. 8 C, there was significant downregulation \u0026nbsp;(p\u0026lt; 0.05) in group A,B,D,E,G,H,J,K and L \u0026nbsp;as compared to the negative control group female (Fig. 8 D) in male rats. Also in female rats there was significant downregulation \u0026nbsp;(p \u0026lt; 0.05) in group A, B, E, G, H, I,J, K and L as compared to group F in female rats.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e3.4.3 Relative expression of EGFR mRNA\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eEGFR is expressed in both cancerous and non-cancerous cells, but it is overexpressed in a variety of tumor types. The progression of the disease, a poor prognosis, and EGFR expression are all correlated. [43].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn Fig. 8 E, the expression of EGFR mRNA was significantly upregulated in group A, B, C, E,G and H when compared to the negative control group F in the male rats while A, C, D, E, G, H, I, J and K was significant downregulation \u0026nbsp;(p \u0026lt; 0.05) in female rats as compared to the group F in \u0026nbsp;Fig. 8 F.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e3.4.4 Relative expression of HIF-1 mRNA\u003c/p\u003e\n\u003cp\u003eHIF-1 plays key roles in the metabolism of energy, apoptosis, angiogenesis, and the regulation of homeostatic responses to hypoxia\u0026nbsp;[44 ].\u003c/p\u003e\n\u003cp\u003eIn Fig. 8 G, the expression of HIF-1 mRNA was significant downregulation \u0026nbsp;(p \u0026lt; 0.05) in group A, B, C, D, E, G, H, I, J, K and L when compared to the negative control group F of both the male and female rats in Fig. 8 H.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e3.4.5 Relative expression of AFP mRNA\u003c/p\u003e\n\u003cp\u003eAFP is synthesized in early S1 phase of the cell cycle and is secreted prior to the M phase [45]. The production of AFP is initiated at the level of gene transcription and is proportional to the amount of available mRNA.\u003c/p\u003e\n\u003cp\u003eIn Fig. 8 I, the expression of AFP mRNA was significantly upregulated in group a,d,g,h and i when compared to the negative control group f in the male rats. Also group A,D,G,H and I \u0026nbsp;was significantly upregulated as compared to group F in female rats in Fig. 8 J.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e3.4.6 Relative expression of p53 mRNA\u003c/p\u003e\n\u003cp\u003ep53 is a DNA binding protein which halts the cell cycle upon genomic stress [46] and essentially hinders proliferation of the cells with damaged DNA [47].\u003c/p\u003e\n\u003cp\u003eIn Fig.\u0026nbsp;8\u0026nbsp;K, the expression of\u0026nbsp;p53 mRNA there was significantly upregulated in group A, B, C, D, E, G, H, and J \u0026nbsp;when compared to the \u0026nbsp;negative control group f in the male rats, while there was significantly upregulation \u0026nbsp;in A, C, D, G, I, J and K in the female rats in Fig.\u0026nbsp;8\u0026nbsp;L.\u003c/p\u003e\n\u003cp\u003e3.4.7 Relative expression of Xiap \u0026nbsp;mRNA\u003c/p\u003e\n\u003cp\u003eXIAP expression levels may directly determine the sensitivity of tumor cells to apoptosis [48,49]. As a general indicator of a poor prognosis for the disease, XIAP was discovered to be overexpressed in a number of cancer types and is frequently linked to chemoresistance and an increased risk of recurrence. [50,51].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn Fig. 8 M-8 N, the expression of \u0026nbsp;Xiap \u0026nbsp;mRNA \u0026nbsp;was significant downregulation \u0026nbsp;(p \u0026lt; 0.05) in group A, B, C, D, E, G, H, I, J, K and L when compared to the negative control group F of both the male and female rats.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e3.4.8 Relative expression of iL-10\u0026nbsp;mRNA\u003c/p\u003e\n\u003cp\u003eIL-10 family cytokines are upregulated in various human diseases and potentially contribute to the pathogenesis. Therefore, neutralizing antibodies blocking their biological functions may have potential therapeutic value [52,53].\u003c/p\u003e\n\u003cp\u003eIn Fig. 8 O, the expression of iL-10 mRNA there was significantly upregulated (p \u0026lt; 0.05) \u0026nbsp;in group A, B, C, E, G, H, I and J when compared with control group L of the male rats. Also, there was significant upregulation in group A, B, H, I, J, K and \u0026nbsp;L when compared to the negative control group F in the female rats in Fig. 8 P.\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003e\u003cstrong\u003e4.1 Phytochemicals from\u0026nbsp;ethanolic extract of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCurcuma longa\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe chromatogram of the Gas Chromatography analysis of the ethanolic extract of \u003cem\u003eCurcuma longa Linn\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003eidentified the major chemical constituents based on the peak retention time (Rt) and percentage area. A total of 40 compounds were identified.\u0026nbsp;The presence of these numerous compounds are responsible for various pharmacological actions [54.55].\u0026nbsp;Several reports demonstrated that polyphenols including flavonoids have been shown to possess a significant antioxidant activity in various \u003cem\u003ein vitro\u003c/em\u003e models.\u0026nbsp;The \u003cem\u003ein silico\u003c/em\u003e study on\u0026nbsp;ethanolic extract of\u0026nbsp;\u003cem\u003eCurcuma longa phytochemical compounds\u0026nbsp;\u003c/em\u003eagainst mapk has shown curcumin safe and active as the standard co-crystalized compound[56]. Curcumin interacted with \u0026nbsp;the active site of MAPK through hydrogen bonds having the highest docking score among the phytrochemicals constituents [57, 58]. \u0026nbsp; Additionally,All the compounds except ASTX029 can relatively have a steady concentration in the cell as they are non-substrate of the P-gp. P-gp is an efflux membrane ATP-binding-cassette (ABC) transporter that acts as a drug barrier by extruding drugs out of the cell [59]. The BBB permeation property predicts the ability of a compound to elicit an effect on the brain, [60], the ADMET and \u0026nbsp;protoxll-predicted toxicity profile of curcumin inferred \u0026nbsp;with the LD\u003csub\u003e50\u003c/sub\u003e prediction at 2000 mg/kg body weight \u0026nbsp;as well as \u0026nbsp; non-hepatotoxic, non-cytotoxic, non-mutagenic suggesting that it is good therapeutic properties with drug-likeness for oral drug development [61,62].\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThe tyrosine kinase inhibitors\u0026apos; conformation changed as a result of the binding of Curcuma longa isolates of curcumin, cis-sesquisabinene hydrate, 12-Oxabicyclo[9.1.0]dodeca-3,7-diene, curlone, and 2-Cyclohexen-1-ol to the binding site of mitogen activated protein kinase. In the NDEA model of liver cancer, Curcuma longa treatment showed anti-angiogenic and anti-proliferative potentials.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eClarification\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study is reported in accordance with ARRIVE guidelines.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSource of funding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research did not receive any specific grant from funding agencies in the public, commercial or not for-profit sectors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo conflict of interest to declare.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article [and its supplementary information files].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEthical approval (reference number: IRB/21/028) was obtained at the Nigerian Institute of Medical Research (NIMA) Yaba, Lagos State, Nigeria.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eAuthor contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors have read and approved the submission of this manuscript, OFO designed and organized the project, OAA, OAD and AAS monitored the progression and supervised the project.OSA was involved in the internal review of the manuscript. IOO and AAA were involved in some of the bench work.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKagohara, L. T., Stein-O\u0026rsquo;Brien, G. L., Kelley, D., Flam, E., Wick, H. C., Danilova, L. V.. Epigenetic regulation of gene expression in cancer: techniques, resources and analysis. \u003cem\u003eBrief. Funct. Genomics\u003c/em\u003e (2018),17, 49\u0026ndash;63. doi: 10.1093/bfgp/elx018 PubMed Abstract | CrossRef Full Text | Google Scholar\u003c/li\u003e\n\u003cli\u003eKumar, R., Patiyal, S., Kumar, V., Nagpal, G., Raghava, G. P. S. (2019). In Silico Analysis of Gene Expression Change Associated with Copy Number of Enhancers in Pancreatic Adenocarcinoma. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e 20, 3582. doi: 10.3390/ijms20143582CrossRef Full Text | Google Scholar\u003c/li\u003e\n\u003cli\u003eJemal, A, Bray, F, Ferlay, J. Global cancer statistics. CA Cancer J Clin 2011; 61(2): 69\u0026ndash;90. Google Scholar | Medline | ISI\u003c/li\u003e\n\u003cli\u003eMarra M, et al. (2011) Molecular targets and oxidative stress biomarkers in hepatocellular carcinoma: An overview. \u003cem\u003eJ Transl Med\u003c/em\u003e\u003cstrong\u003e9\u003c/strong\u003e:171.\u003c/li\u003e\n\u003cli\u003eHo, D. W.-H., Lo, R. C.-L., Chan, L.-K., Ng, I. O.-L. . Molecular Pathogenesis of Hepatocellular Carcinoma. \u003cem\u003eLiver Cancer\u003c/em\u003e (2016), 5, 290\u0026ndash;302. doi: 10.1159/000449340PubMed Abstract | CrossRef Full Text | Google Scholar\u003c/li\u003e\n\u003cli\u003eJiang, F., Chen, J., Ma, X., Huang, C., Zhu, S., Wang, F., Li, L., Luo, L., Ruan, H., and Huang, H. . Analysis of mutants from a genetic screening reveals the control of intestine and liver development by many common genes in zebrafish.Biochemical and Biophysical Research Communications. (2015) 460(3): 838-44\u003c/li\u003e\n\u003cli\u003eKnight H. and Irving E. A. Ras/Raf/MEK/ERK pathway activation in childhood acute lymphoblastic leukemia and its therapeutic targeting. (2014) Newcastle Cancer Centre at the Northern Institute for Cancer Research\u003c/li\u003e\n\u003cli\u003eWong C. H., and Cheng C. Y.\u003ccite\u003e, (\u003c/cite\u003e2005).The blood-testis barrier: its biology, regulation, and physiological role in spermatogenesis.\u003ccite\u003e \u003c/cite\u003e\u003cem\u003eCurr. Top. Dev. Biol. 71: 263\u0026ndash;296. \u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eLi, X.; Wang, T.; Zhou, B.; Gao, W.Y.; Cao, J.G.G.; Huangc, L.Q. . Chemical composition and antioxidant and anti-inflammatory potential of peels and flesh from different pear varieties (Pyrus spp.). Food Chem. (2014).152, 531\u0026ndash;538. \u003c/li\u003e\n\u003cli\u003eZhang E.T, He Y., Grob P., Fong Y.W., Nogales E., and Tjian R. . Architecture of the human XPC DNA repair and stem cell coactivator complex. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e (2015)112(48):14817-22\u003c/li\u003e\n\u003cli\u003eAli A.A,. Aboshosha M.K. Kassem, Eman I. EL-Dabaawy and EL-Banna.A.N. Salinity Tolerance and Stevioside Improvement of In Vitro Selected Stevia (Stevia rebaudiana) Mutants.Int. J. Curr. Res. Biosci. Plant Biol. 2015, 2(4): 11-20\u003c/li\u003e\n\u003cli\u003eKokate R. . A Systematic Overview of Cancer Immunotherapy: An Emerging Therapy. Pharm Pharmacol Int J 5(2):(2017) 00112. DOI: 10.15406/ppij.2017.05.00112\u003c/li\u003e\n\u003cli\u003eYang Ou, Lu SS, Kong JY, Liang XQ, Luo ZJ, Jiang C,H. Computational drug discovery. Acta Pharmacologica Sinica 2012;33:1131\u0026ndash;40\u003c/li\u003e\n\u003cli\u003eEnyedy I.J., Egan, W.J. Can we use docking and scoring for hit-to-lead optimization? J Comput. Aided Mol. Des. 22 (2008) 161\u0026ndash;168. \u003c/li\u003e\n\u003cli\u003eKamsu Tchuente G, Fodouop Chegaing SP, Tagne RS, Kodjio N, Fakam Nguelebeck AL, Gatsing D (2019) Evaluation of the acute and sub-chronic toxicity of the ethanolic extract of Curcuma longa (Zingiberaceae) in Wistar albino rats. Mod Chem Appl 7:267. doi: 10.35248/2329-6798.19.7.267.\u003c/li\u003e\n\u003cli\u003eNeha B, Tiwari KL, Jadhav SK. A review on nonconventional turmeric Curcuma caesia Roxb. Curr. Trend. Biotech. Pharm. 2014;8(1):91-101.\u003c/li\u003e\n\u003cli\u003eMunck J. M. \u003cem\u003eet al.\u003c/em\u003e, \u0026lsquo;ASTX029, a Novel Dual-mechanism ERK Inhibitor, Modulates Both the Phosphorylation and Catalytic Activity of ERK\u0026rsquo;, \u003cem\u003eMol Cancer Ther\u003c/em\u003e, vol. 20, no. 10, pp. 1757\u0026ndash;1768, Oct. 2021, doi: 10.1158/1535-7163.MCT-20-0909.\u003c/li\u003e\n\u003cli\u003eMadhavi Sastry G., Adzhigirey M., Day T. , Annabhimoju R., and Sherman W., \u0026lsquo;Protein and ligand preparation: parameters, protocols, and influence on virtual screening enrichments\u0026rsquo;, \u003cem\u003eJ Comput Aided Mol Des\u003c/em\u003e, vol. 27, no. 3, pp. 221\u0026ndash;234, Mar. 2013, doi: 10.1007/s10822-013-9644-8\u003c/li\u003e\n\u003cli\u003eDavid T. I. \u003cem\u003eet al.\u003c/em\u003e, \u0026lsquo;Molecular docking analysis of phyto-constituents from Cannabis sativa with pfDHFR\u0026rsquo;, \u003cem\u003eBioinformation\u003c/em\u003e, vol. 14, no. 9, pp. 574\u0026ndash;579, 2018, doi: 10.6026/97320630014574.\u003c/li\u003e\n\u003cli\u003eJacobson M. P. \u003cem\u003eet al.\u003c/em\u003e, \u0026lsquo;A hierarchical approach to all-atom protein loop prediction\u0026rsquo;, \u003cem\u003eProteins\u003c/em\u003e, vol. 55, no. 2, pp. 351\u0026ndash;367, Mar. 2004, doi: 10.1002/prot.10613.\u003c/li\u003e\n\u003cli\u003eShelley J. C., Cholleti A., Frye L. L, Greenwood J. R. ,Timlin M. R., and . Uchimaya M, \u0026lsquo;Epik: a software program for pK a prediction and protonation state generation for drug-like molecules\u0026rsquo;, \u003cem\u003eJ Comput Aided Mol Des\u003c/em\u003e, vol. 21, no. 12, pp. 681\u0026ndash;691, Dec. 2007, doi: 10.1007/s10822-007-9133-z.\u003c/li\u003e\n\u003cli\u003eHarder E. \u003cem\u003eet al.\u003c/em\u003e, \u0026lsquo;OPLS3: A Force Field Providing Broad Coverage of Drug-like Small Molecules and Proteins\u0026rsquo;, \u003cem\u003eJ. Chem. Theory Comput.\u003c/em\u003e, vol. 12, no. 1, pp. 281\u0026ndash;296, Jan. 2016, doi: 10.1021/acs.jctc.5b00864.\u003c/li\u003e\n\u003cli\u003eAbdel-Lateef E. \u003cem\u003eet al.\u003c/em\u003e, \u0026lsquo;Bioactive chemical constituents of Curcuma longa L. rhizomes extract inhibit the growth of human hepatoma cell line (HepG2)\u0026rsquo;, \u003cem\u003eActa Pharm\u003c/em\u003e, vol. 66, no. 3, pp. 387\u0026ndash;398, Sep. 2016, doi: 10.1515/acph-2016-0028Ref\u003c/li\u003e\n\u003cli\u003eKhojasteh Poor F. \u003cem\u003eet al.\u003c/em\u003e, \u0026lsquo;Mini review: The FDA-approved prescription drugs that target the MAPK signaling pathway in women with breast cancer\u0026rsquo;, \u003cem\u003eBD\u003c/em\u003e, vol. 40, no. 2, pp. 51\u0026ndash;62, Jun. 2021, doi: 10.3233/BD-201063.\u003c/li\u003e\n\u003cli\u003eSchr\u0026ouml;dinger Release 2018-1, \u0026lsquo;LigPrep, Schr\u0026ouml;dinger, LLC, New York, NY, 2021.\u0026rsquo;\u003c/li\u003e\n\u003cli\u003eFriesner R. A. \u003cem\u003eet al.\u003c/em\u003e, \u0026lsquo;Extra Precision Glide: Docking and Scoring Incorporating a Model of Hydrophobic Enclosure for Protein\u0026minus;Ligand Complexes\u0026rsquo;, \u003cem\u003eJ. Med. Chem.\u003c/em\u003e, vol. 49, no. 21, pp. 6177\u0026ndash;6196, Oct. 2006, doi: 10.1021/jm051256o.\u003c/li\u003e\n\u003cli\u003eSherman W. , Beard H. S., and Farid R. , \u0026lsquo;Use of an Induced Fit Receptor Structure in Virtual Screening\u0026rsquo;, \u003cem\u003eChem Biol Drug Design\u003c/em\u003e, vol. 67, no. 1, pp. 83\u0026ndash;84, Jan. 2006, doi: 10.1111/j.1747-0285.2005.00327.x.\u003c/li\u003e\n\u003cli\u003eKikiowo B. \u003cem\u003eet al.\u003c/em\u003e, \u0026lsquo;Flavones scaffold of \u003cem\u003eChromolaena odorata\u003c/em\u003e as a potential xanthine oxidase inhibitor: Induced Fit Docking and ADME studies\u0026rsquo;, \u003cem\u003eBioimpacts\u003c/em\u003e, vol. 10, no. 4, pp. 227\u0026ndash;234, Nov. 2019, doi: 10.34172/bi.2020.29.\u003c/li\u003e\n\u003cli\u003eKufareva I. and Abagyan R., \u0026lsquo;Methods of protein structure comparison\u0026rsquo;, \u003cem\u003eMethods Mol Biol\u003c/em\u003e, vol. 857, pp. 231\u0026ndash;257, 2012, doi: 10.1007/978-1-61779-588-6_10.\u003c/li\u003e\n\u003cli\u003eKikiowo B, Ogunleye J. A., Iwaloye O. , and T. T. Ijatuyi, \u0026lsquo;Therapeutic potential of \u003cem\u003eChromolaena odorata\u003c/em\u003e phyto-constituents against human pancreatic \u0026alpha;-amylase\u0026rsquo;, \u003cem\u003eJournal of Biomolecular Structure and Dynamics\u003c/em\u003e, vol. 40, no. 4, pp. 1801\u0026ndash;1812, Mar. 2022, doi: 10.1080/07391102.2020.1833758\u003c/li\u003e\n\u003cli\u003eHayes J. M.and Archontis G., \u003cem\u003eMM-GB(PB)SA Calculations of Protein-Ligand Binding Free Energies\u003c/em\u003e. IntechOpen, 2012. doi: 10.5772/37107.\u003c/li\u003e\n\u003cli\u003eLyne P. D., Lamb M. L., and Saeh J. C., \u0026lsquo;Accurate prediction of the relative potencies of members of a series of kinase inhibitors using molecular docking and MM-GBSA scoring\u0026rsquo;, \u003cem\u003eJ Med Chem\u003c/em\u003e, vol. 49, no. 16, pp. 4805\u0026ndash;4808, Aug. 2006, doi: 10.1021/jm060522a\u003c/li\u003e\n\u003cli\u003eKikiowo B. \u003cem\u003eet al.\u003c/em\u003e, \u0026lsquo;Molecular Interaction and Inhibitory Activity of Dandelion\u0026rsquo;s Compounds on Nucleoprotein: A Therapeutic Intervention in Lassa Fever\u0026rsquo;, \u003cem\u003eBiointerface Res Appl Chem\u003c/em\u003e, vol. 11, no. 5, pp. 12573\u0026ndash;12583, Jan. 2021, doi: 10.33263/BRIAC115.1257312583.\u003c/li\u003e\n\u003cli\u003eDaina A., Michielin O., and Zoete V. , \u0026lsquo;SwissADME: A free web tool to evaluate pharmacokinetics, drug-likeness and medicinal chemistry friendliness of small molecules\u0026rsquo;, \u003cem\u003eScientific Reports\u003c/em\u003e, vol. 7, p. 42717, Mar. 2017, doi: 10.1038/srep42717.\u003c/li\u003e\n\u003cli\u003eBanerjee P., Eckert A. O., Schrey, A. K.and Preissner R., \u0026lsquo;ProTox-II: a webserver for the prediction of toxicity of chemicals\u0026rsquo;, \u003cem\u003eNucleic Acids Research\u003c/em\u003e, vol. 46, no. W1, pp. W257\u0026ndash;W263, Jul. 2018, doi: 10.1093/nar/gky318\u003c/li\u003e\n\u003cli\u003eDevoshree MUKHERJEE, Riaz AHMAD.Dose-dependent effect of N\u0026apos;-Nitrosodiethylamine on hepatic architecture, RBC rheology and polypeptide repertoire in Wistar rats.Interdiscip Toxicol. 2015; Vol. 8(1): 1\u0026ndash;7. \u003c/li\u003e\n\u003cli\u003eW., Gan, J., Liu, W., and Green, R. (2005). Degradation of-Nitrosodimethylamine (NDMA) in Landscape Soils. Journal of Environmental Quality 34(1), 336\u0026ndash;341.\u003c/li\u003e\n\u003cli\u003eOmotuyi OI, Nash O, Enejoh OA, Oribamise EI, Adelakun NS: Chromolaena odorata flavonoids attenuate experimental nephropathy: Involvement of pro-inflammatory genes downregulation. \u003cem\u003eToxicol Rep \u003c/em\u003e(2020) 7(1421-1427\u003c/li\u003e\n\u003cli\u003eLiu, Y., Shepherd, E. G., and Nelin, L. D. MAPK phosphatases\u0026ndash;regulating the immune response. \u003cem\u003eNat. Rev. Immunol.\u003c/em\u003e (2007).7, 202\u0026ndash;212. doi: 10.1038/nri2035\u003c/li\u003e\n\u003cli\u003eArthur, J. S. C., and Ley, S. C. Mitogen-activated protein kinases in innate immunity. \u003cem\u003eNat. Rev. Immunol.\u003c/em\u003e (2013). 13, 679\u0026ndash;692. doi: 10.1038/nri3495\u003c/li\u003e\n\u003cli\u003eKyriakis, J. M., and Avruch, J. . Mammalian MAPK signal transduction pathways activated by stress and inflammation: A 10-Year Update. \u003cem\u003ePhysiol. Rev.\u003c/em\u003e (2012) 92, 689\u0026ndash;737. doi: 10.1152/physrev.00028.2011\u003c/li\u003e\n\u003cli\u003ePeti, W., and Page, R. . Molecular basis of MAP kinase regulation. \u003cem\u003eProtein Sci.\u003c/em\u003e (2013) 22, 1698\u0026ndash;1710. doi: 10.1002/pro.2374\u003c/li\u003e\n\u003cli\u003eCarmeliet P., VEGF as a key mediator of angiogenesis in cancer, Oncology 69 (3) (2005) 4\u0026ndash;10\u003c/li\u003e\n\u003cli\u003eBaselga J., Why the epidermal growth factor receptor? The rationale for cancer therapy, Oncologist 7 (suppl 4) (2002) 2\u0026ndash;8\u003c/li\u003e\n\u003cli\u003eXie Y.B., Li J.P., Shen K., Meng F.,Wang L. , Han G.X., et al., Effect of HIF-1\u0026alpha; on angiogenesis-related factors in K562 cells, Zhongguo Shi Yan Xue Ye Xue Za Zhi 27 (5) (2019) 1476\u0026ndash;1481\u003c/li\u003e\n\u003cli\u003eSell S, Skelly H, Leffert HL, Muller-Eberhard U, Kida S Relationship of the biosynthesis of alpha-fetoprotein, albumin,hemopexin, and haptoglobin to the growth state of fetal rat hepatocyte cultures. Ann N Y Acad Sci (1975)259: 45-58.\u003c/li\u003e\n\u003cli\u003eHarris, S.L.; Levine, A.J. The p53 pathway: Positive and negative feedback loops. Oncogene \u003cstrong\u003e2005\u003c/strong\u003e, 24,2899\u0026ndash;2908. [CrossRef] [PubMed]\u003c/li\u003e\n\u003cli\u003ePowell, D.J.; Hrstka, R.; Candeias, M.; Bourougaa, K.; Vojtesek, B.; F\u0026aring;hraeus, R. Stress-dependent changes inthe properties of p53 complexes by the alternative translation product p53/47. Cell Cycle \u003cstrong\u003e2008\u003c/strong\u003e, 7, 950\u0026ndash;959.\u003c/li\u003e\n\u003cli\u003eEckelman BP, Salvesen GS, Scott FL. Human inhibitor of apoptosis proteins: why XIAP is the black sheep of the family EMBO Rep 2006 Oct;7(10):988-94 \u003c/li\u003e\n\u003cli\u003eYang WZ, Zhou H, Yan Y. XIAP underlies apoptosis resistance of renal cell carcinoma cells Mol Med Rep 2018Jan;17:125-130\u003c/li\u003e\n\u003cli\u003eSrinivasula SM, Ashwell JD. IAPs: what\u0026apos;s in a name? Mol Cell 2008 Apr 25;30(2):123-35 doi: 10 \u003c/li\u003e\n\u003cli\u003eObexer P, Ausserlechner MJ. X-linked inhibitor of apoptosis protein - a critical death resistance regulator and therapeutic target for personalized cancer therapy Front Oncol 2014 Jul 28;4:197 \u003c/li\u003e\n\u003cli\u003eOuyang, W., Rutz, S., Crellin, N.K., Valdez, P.A., and Hymowitz, S.G. Regulation and functions of the IL-10 family of cytokines in inflammation and disease. Annu. Rev. Immunol. (2011).29, 71\u0026ndash;109.\u003c/li\u003e\n\u003cli\u003eWang, X., Wong, K., Ouyang, W., and Rutz, S. . Targeting IL-10 Family Cytokines for the Treatment of Human Diseases. Cold Spring Harb. Perspect.Biol. (2017)11\u003c/li\u003e\n\u003cli\u003eAli, A., Wang, Y.H. and Khan, I.A. Larvicidal and biting deterrent activity of essential oils of \u003cem\u003eCurcuma longa\u003c/em\u003e, ar-turmerone, and curcuminoids against \u003cem\u003eAedes aegypti \u003c/em\u003eand \u003cem\u003eAnopheles quadrimaculatus \u003c/em\u003e(\u003cem\u003eCulicidae\u003c/em\u003e: \u003cem\u003eDiptera\u003c/em\u003e). \u003cem\u003eJ. Med. Entomol\u003c/em\u003e., (2015).52(5): 979-986.\u003c/li\u003e\n\u003cli\u003eAbdel-Shafy S, Alanazi AD, Gabr HSM, Allam AM, Abou-Zeina HAA, Masoud RA, Soliman DE, Alshahrani MY Efficacy and safety of ethanolic \u003cem\u003eCurcuma longa \u003c/em\u003eextract as a treatment for sand tampan ticks in a rabbit model.(2020) \u003cem\u003eVeterinary World\u003c/em\u003e, 13(4): 812-820. \u003c/li\u003e\n\u003cli\u003eYa\u0026apos;u Ibrahim Z, Uzairu A, Shallangwa G, Abechi S. Molecular docking studies, drug-likeness and in-silico ADMET prediction of some novel \u0026beta;-Amino alcohol grafted 1,4,5-trisubstituted 1,2,3-triazoles derivatives as elevators of p53 protein levels. Scientific African, 2020; 10: e00570.\u003c/li\u003e\n\u003cli\u003eRattis BAC, Ramos SG, Celes MRN. Curcumin as a Potential Treatment for COVID-19. Front Pharmacol. 2021 May 7;12:675287. doi: 10.3389/fphar.2021.675287. PMID: 34025433; PMCID: PMC8138567\u003c/li\u003e\n\u003cli\u003eOluwasayo Peter Abodunrin, Olayinka Fisayo Onifade and Abayomi Emmanuel Adegboyega (2022) \u0026lsquo;Therapeutic capability of five active compounds in typical African medicinal plants against main proteases of SARS-CoV-2 by computational approach\u0026rdquo;https://doi.org/10.1016/j.imu.2022.100964\u003c/li\u003e\n\u003cli\u003eFinch A. and Pillans P., \u0026lsquo;P-glycoprotein and its role in drug-drug interactions\u0026rsquo;, doi: 10.18773/austprescr.2014.050\u003c/li\u003e\n\u003cli\u003ePardridge W. M, \u0026lsquo;Drug transport across the blood\u0026ndash;brain barrier\u0026rsquo;, \u003cem\u003eJ Cereb Blood Flow Metab\u003c/em\u003e, vol. 32, no. 11, pp. 1959\u0026ndash;1972, Nov. 2012, doi: 10.1038/jcbfm.2012.126.\u003c/li\u003e\n\u003cli\u003eOshevire DB., Mustapha A, Alozieuwa BU, Badeggi HH., Ismail A, Hassan ON, Ugwunnaji PI, Ibrahim J, Lawal B, Berinyu EB. In-silico investigation of curcumin drug-likeness, gene-targets and prognostic relevance of the targets in panels of human cancer cohorts. GSC Biological and Pharmaceutical Sciences, 2021; 14(01): 037\u0026ndash;046.\u003c/li\u003e\n\u003cli\u003eOghenejobo M, Opajobi OA, Bethel OUS, et al. Antibacterial evaluation, phytochemical screening and ascorbic acid assay of turmeric (Curcuma longa).MOJ Bioequiv Availab 2017;4(2):232\u0026ndash;9. https://doi.org/10.15406/mojbb.2017.04.00063\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Ethanolic extract Curcuma longa (EECL), mitogen activated protein kinase (MAPK), Angiogenesis, Gas Chromatography-Mass Spectrometry (GC-MS), N-nitrosodiethylamine (NDEA) ","lastPublishedDoi":"10.21203/rs.3.rs-2621916/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2621916/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cb\u003eObjectives\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThis study employed MAPK domain inhibition as an anti-angiogenic scaffold and further validate the anti-angiogenic effects of the lead phytochemicals, curcumin from ethanolic extract of \u003cem\u003ecurcuma longa\u003c/em\u003e (EECL) in N-nitrosodiethylamine (NDEA) model of liver cancer in Wistar rats.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMethods\u003c/b\u003e\u003c/p\u003e \u003cp\u003eOne hundred and twenty Wistar rats comprising of sixty male and female rats were randomly selected into twelve groups (n\u0026thinsp;=\u0026thinsp;5): group A (100 mg/kg NDEA\u0026thinsp;+\u0026thinsp;200 mg/kg EECL), group B (100 mg/kg NDEA\u0026thinsp;+\u0026thinsp;400 mg/kg EECL), group C (100 mg/kg NDEA\u0026thinsp;+\u0026thinsp;600 mg/kg EECL), group D (100 mg/kg NDEA\u0026thinsp;+\u0026thinsp;200 mg/kg pure curcumin), group E (100 mg/kg NDEA\u0026thinsp;+\u0026thinsp;100 mg/kg sylibon 140), group F (100 mg/kg NDEA), group G (200 mg/kg pure curcumin), group H (100 mg/kg DMSO), group I (200 mg/kg EECL), group J (400 mg/kg EECL), group K (600 mg/kg EECL), group L (control) at the end of 42 days of the experiment period. The lead phytochemicals, curcumin from EECL were isolated and subjected to Gas Chromatography-Mass Spectrometry for characterization. The anti-angiogenic potentials of the curcumin isolates were validated through molecular docking and the expression of antiangiogenic related mRNA.\u003c/p\u003e\u003cp\u003e\u003cb\u003eResults\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe binding of Co-crystallized, curcumin and cis-sesquisabinene hydrate, to the binding site led to the conformation with binding energies of -15.15 kcal/mol, -7.212 kcal/mol, and \u0026minus;\u0026thinsp;6.361 kcal/mol respectively. Treatment with 200 mg/kg and 400 mg/kg significantly (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) downregulated the expression of MAPK and Vascular endothelial growth factor mRNAs in the hepatocyte tumour, while the Alpha Fero Protein and Interleukin-10 mRNA was significantly (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) upregulated.\u003c/p\u003e\u003cp\u003e\u003cb\u003eConclusion\u003c/b\u003e\u003c/p\u003e \u003cp\u003eEthanolic extract of \u003cem\u003eCurcumin longa\u003c/em\u003e possessed anti-angiogenic and anti-proliferating prospective against MAPK domain inhibition.\u003c/p\u003e","manuscriptTitle":"MAPK domain inhibition: Validation of the anti-angiogenic effects of curcumin from Curcuma longa in NDEA model of liver carcinoma in Wistar rats","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-04-18 14:34:03","doi":"10.21203/rs.3.rs-2621916/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"964959ce-faa0-4981-b8d6-31443354d416","owner":[],"postedDate":"April 18th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":20742315,"name":"Biological sciences/Biochemistry"},{"id":20742316,"name":"Biological sciences/Cancer"},{"id":20742317,"name":"Biological sciences/Computational biology and bioinformatics"},{"id":20742318,"name":"Biological sciences/Molecular biology"},{"id":20742319,"name":"Health sciences/Biomarkers"}],"tags":[],"updatedAt":"2023-06-27T10:45:16+00:00","versionOfRecord":[],"versionCreatedAt":"2023-04-18 14:34:03","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2621916","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2621916","identity":"rs-2621916","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}