Sequencing of the PPR virus caused outbreaks in Nubian ibex and mountain gazelles in Saudi Arabia from 2022-2024

preprint OA: closed
Full text JSON View at publisher
Full text 105,361 characters · extracted from preprint-html · click to expand
Sequencing of the PPR virus caused outbreaks in Nubian ibex and mountain gazelles in Saudi Arabia from 2022-2024 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Sequencing of the PPR virus caused outbreaks in Nubian ibex and mountain gazelles in Saudi Arabia from 2022-2024 Ali N. Alhafufi, Fanan Alaql, Hassan A. Albaqshi, Muhammed Abuhaimad, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6397316/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Morbillivirus caprinae , or PPRV, is the causative agent of devastating illnesses in wild and domestic ruminants worldwide namely Peste des petites ruminants (PPR). It causes mouth erosion, pneumonia, enteritis and fatality in acute cases. Saudi Arabian authorities focus on wildlife conservation considering the Kingdom's biodiversity as their natural heritage. Milestones have been achieved in this context, protecting scarce populations from ibex, gazelles, oryx and many other endangered species. PPR is endemic in Saudi Arabia causing repeated outbreaks in domestic and wild ungulates despite vaccination, threatening conservation. In this study, recurrent PPR outbreaks were detected in semi captive settings in Saudi Arabia between 2022 and 2024. Where 309 samples from different wild ruminants were sent to Weqaa central laboratory in Riyadh. The sequencing of the circulating virus in Nubian ibex and mountain gazelles was performed to investigate these outbreaks. The samples were initially screened by real time RT‒PCR then full N, P and partial F and H genes were sequenced in Nubian ibex and mountain gazelle (n = 2). Results PPRV was detected in 72% of the samples collected. Phylogenetic analysis revealed that the virus classified in lineage IV closer to a Turkish strain (MN657232). Compared with the used 75/1 vaccine, the field virus showed substitutions in 18 amino acids in the N protein, 9 critical amino acids in the H protein and 7 amino acids in the F protein. These numerous substitutions at critical points affect H and F 3D structures and linear epitopes, suggesting that the virus may have escaped lineage II 75/1 vaccination either partially or completely. Conclusion The transboundary nature of PPRV and the potential role of wildlife in the spread of the virus in Saudi Arabia need to be considered. To the best of our knowledge, this report is the first to characterize PPRV genetically in wild ruminants in Saudi Arabia that needs further investigations on the protective immune response elicited in wild ruminants and atypical hosts after conventional PPR vaccination. Prober investigation of the effectivity of vaccination programs in wild and atypical hosts of PPR can could significantly influence the success of global eradication initiatives. PPRV Morbilliviruses Morbillivirus caprinae Nucleocapsid gene Lineage IV Peste des petites ruminants Conservation Nubian ibex mountain gazelle Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Background PPR is a highly contagious viral disease affecting domestic and wild ruminants, causing substantial economic losses through its impact on the international trade of sheep and goats [ 1 ],[ 2 ]. The disease manifests as fever, mouth lesions, pneumonia, diarrhea, and inflammation of the respiratory and digestive tracts, leading to 90% morbidity and 100% mortality in acute cases [ 3 ]. PPR is classified as a transboundary and notifiable disease that continues to emerge or re-emerge in new territories worldwide [ 2 ]. Owing to the severe impact of PPR, the World Organization for Animal Health (WOAH) and the Food and Agriculture Organization (FAO) have designated PPR a high-priority disease for progressive control and eradication by 2030, inspired by the successful eradication of Rinderpest in 2011 [ 4 ]. PPR is caused by Morbillivirus caprinae , a member of the Paramyxoviridae family within the genus Morbillivirus . PPRV is pleomorphic or spherical, 400–500 nm in diameter, and possesses single-stranded RNA of negative polarity. This RNA encodes six structural proteins, namely, nucleocapsid (N), phosphoprotein (P), matrix (M), fusion (F), hemagglutinin (H), large protein or RNA-dependent RNA polymerase (L), along with two nonstructural proteins (C and V) [ 5 ]. Each of these proteins plays a significant role in the virus replication cycle [ 6 ]. The nucleocapsid protein (N) acts as an RNA scaffold that helps in viral RNA encapsidation, replication, and transcription [ 7 ]. It also inhibits the production of type II interferons [ 6 ]. This protein induces a strong immune response in affected animals. On the basis of partial N and F gene sequencing, PPRV can be classified into 4 lineages (I–IV) associated with different geographical regions [ 8 ], [ 9 ]. Lineages I and II are found mainly in Western Africa, lineage III has historically been dominant in the Middle East, while lineage IV is considered the most widespread lineage worldwide, circulating in Asia and being reported in recent isolates in the Middle East [ 10 ]. Despite their genetic differences, all four lineages are immunologically indistinguishable [ 8 ]. Mass vaccination against PPR is the chosen method for virus control. The administration of lineage II vaccine including Nigerian 75/1 strain elicited strong protective immune response that persist for many years [ 11 ]. The virus also encodes C and V nonstructural proteins that act as promoters in the processes of transcription and replication [ 12 ]. Both are encoded by the P gene via alternative reading frames. The ‘Soyuz1 motif’ 4 EQAYHVNKGLECIKSL 20 has been predicted to bind the nucleocapsid protein and prevent its self-assembly [ 13 ]. During the initial stages of PPRV replication, the virus recruits hemagglutinin (H) and fusion (F) proteins for binding and then enters the host cell cytoplasm through its receptors, namely, signaling lymphocyte activation molecule (SLAM) and Nectin-4, which enable entry via receptor-mediated endocytosis [ 12 ]. The ability to bind to both SLAM and nectin-4 receptors explains the lymphotropic and epitheliotropic nature of the virus. The F protein facilitates virus entry into the host cell cytoplasm. It has a membraned anchored subunit and another protruding one through cleavage of the F0 protein at the crucial cleavage site 104 RRTRR 108 , which is very important for virus virulence. It facilitates fusion between the host cell membrane and viral envelope with the help of a leucine zipper motif located at (aa 459–480) [ 10 ]. The viral H or HN protein is the most variable (sharing only 50% identity) and the most immunogenic protein. It is thought that it acts as a host cell tropism determinant in PPR [ 10 ], [ 8 ]. PPRV primarily infects goats and sheep, but over the last decades, the host range of PPRV has been continuously expanding to many other domestic and wild Artiodactyla species. Cattle, camels and several wild ruminants are occasionally infected occasionally [ 8 ]. PPR cases have been documented in many wild ruminants, including bharals, gazelles, ibexes, chowsingha ( Tetracerus quadricornis ), wild goats ( Capra aegagrus ), wild sheep ( Ovis orientalis, Pseudois nayaur ), and water deer ( Hydropotes inermis )[ 7 ]. Europe has been free from PPR for decades. However, in 2024, PPR eruptions were reported in Greece and Romania, which were previously officially free of the disease. This re-emergence poses a significant threat to sheep, goats, and certain wild ungulates [ 14 ]. Control measures have been implemented in both Greece and Romania, such as movement restrictions, zoning, and stamping out infected farms. Saudi Arabia first reported PPR three decades ago, and now, it is considered endemic and is located among divergent pools of different PPR lineages, although recent outbreaks have been attributed to lineage IV only [ 4 ], [ 15 ]. Pooled estimates based on published epidemiological studies reported a PPR prevalence of approximately 50% in sheep and goat populations in Saudi Arabia [ 2 ]. The Kingdom contributed to the global eradication program and reached stage 2. The PPR control plan in Saudi Arabia is a main focus and involves serological passive surveillance in domestic small ruminants and progressive vaccination via 75/1 locally produced live attenuated vaccines to achieve herd immunity. Animal immunity is tested under surveillance programs held annually [ 15 ]. In alignment with their 2030 vision, Saudi Arabia prioritized sustainability and conservation, where protecting endangered wild species was a focus through establishing captive breeding centers such as the King Khalid Wildlife Research Center in Riyadh and the Prince Saud Al-Faisal Wildlife Research Center near Taif [ 16 ]. Conservation efforts are threatened by recurrent outbreaks of the PPRV, especially in critically endangered populations such as Nubian ibex, mountain gazelles and Arabian oryx . To mention some of the reported cases, there has been serological evidence for the presence of the PPRV in Saudi Arabian wild deer and gazelle since the 1970s, although the PPRV was isolated for the first time in the Eastern part of Saudi Arabia in 1988.[ 15 ] Camels and Arabian oryx in Saudi Arabia had evidence of seroprevalence without a history of vaccination, which proves exposure to the virus naturally [ 4 ]. Several recent eruptions of PPR were reported in this study in vaccinated and endangered wild ruminants. The aim of the present study was to describe the virus lineage types and their genetic characteristics, especially those of the viruses detected in Nubian ibex and mountain gazelles. A thorough comparison between the predicted epitopes present in the N, F and H proteins was made between vaccine and field viruses to draw preliminary conclusions about the main reason for the recurrent outbreaks and provide recommendations for future vaccination programs. Results Sample collection : The affected animals presented nasal discharge, erosion in the oral cavity, and diarrhea, with mortality in severe cases. The noticed PM lesions appeared as necrotic enteritis with zebra stripping as a characteristic lesion, severe pneumonia, and hemorrhages spanning most of the internal organs, as shown in figures (1–3). The samples collected, positive samples by real-time RT‒PCR and their host species are shown in Table (2). A total of 309 samples were collected, and 223 (72.1%) positive samples were detected via real-time RT‒PCR. All animals were vaccinated with 75/1 live attenuated freeze-dried commercial PPR vaccine produced nationally by the vaccine production unit of the Weqaa Center, Riyadh, Saudi Arabia. Table (1): Primers used for amplification of different targets of the PPR virus genome in this study. S Fragments Size oligo Sequence oligo Sequence Gene 1 1–3 2.20 kb 1F 5' CCAAACAAAGTTGGGTAAGGA 3' 4R 5' TYTGCTTGAACCACGAGAGA 3' N 2 5–7 2.12 kb 5F 5' CAACCAAYCATGCTCAYCAG 3' 8R 5' TTGCCCACGTGTACCATAAA 3' P/V/M 3 14–16 2.19 kb 14F 5' ATAAAGGCYCGRGTKACATA 3' 17R 5' AGGTCGAGTCTTRCATGCTT 3' F/H Table (2) Samples received and used for PPR virus diagnosis from 2022–2024 SN ID DATE SPP. Total No. No. (+ ve) 1 903 06/2022 Capra nubiana (Nubian Ibex) 65 62 2 1001 2022/07 Capra nubiana (Nubian Ibex) 75 42 3 1120 2022/08 Capra nubiana (Nubian Ibex) 25 21 4 1310 2022/09 Capra nubiana (Nubian Ibex) 28 20 5 1514 10/2022 Capra nubiana (Nubian Ibex) 14 4 6 1516 2022/11 Oryx leucoryx (Arabian oryx) 18 18 7 1681 2022/12 Gazella subgutturosa (Arabian Goitered Gazelle) 14 14 Total 239 181 SN ID DATE SPP. Total NO NO. (+ ve) 1 279 2023 Capra nubiana (Nubian Ibex) 7 0 2 279 2023 Gazella subgutturosa (Arabian Goitered Gazelle) 9 0 3 307 2023 Gazella subgutturosa (Arabian Goitered Gazelle) 6 2 4 1112 2023 Oryx leucoryx (Arabian oryx) 9 9 5 1227 2023 Gazella subgutturosa (Arabian Goitered Gazelle) 4 4 6 1258 2023 Gazella gazella 9 9 7 1406 2023 Gazella subgutturosa (Arabian Goitered Gazelle) 5 3 8 1414 2023 Gazella gazella 3 3 9 1473 2023 Capra nubiana (Nubian Ibex) 2 2 10 1563 2023 Oryx leucoryx (Arabian oryx) 3 3 Total 57 35 SN ID DATE SPP. Total NO NO. (+ ve) 1 30 2024 Gazelle spp 2 2 2 42 2024 Gazelle spp 4 2 3 155 2024 Gazella Gazella (mountain gazelle) 7 3 Total 13 7 309 223 (72%) Sequencing and sequence analysis: Sequences in study has obtained the following accession numbers (PV353910, PV353911, PV353912, PV358391, PV358392, PV395578) Phylogenetic analysis and nucleotide alignment revealed that the 2 samples clustered with lineage IV, as shown in Figures (6) and (4). Multiple sequence alignment is shown in Figure (4). The samples used in this study (903 and 155) are homologous to NM657232 (Turkish strain). The difference between the 155 PPR sample sequences and the 75/1 sequence was evident, as shown in Figures (4 and 5). Multiple N protein amino acid alignments revealed that many substitutions are evident compared with those in the PPR vaccine, which belongs to lineage II. Two epitopes in the N protein were predicted by [ 13 ], 1: from aa (1–35) and 2: (352–399). There was complete conservation in our sequences and the 75/1 vaccinal strain. However, region 401–482 was found to contain 18 substitutions between our samples and the vaccine strain, as shown in Figure (5). Multiple sequence alignment of the partial H protein The alignment in Figure (7) shows that the amplicon in our study spanned from aa (1-388) compared with the 609 full length H protein. According to the findings of [ 5 ], 9 critical amino acid substitutions were found between sample 155 and the 75/1 vaccine strains as follows: P170S, K176R, S179L, R240G, G264E, P267A, V269I, S302P, and M345T. P170S, K176R, S179L, and S302P had a proven effect on the H protein 3D structure. These mutations also exist in the older 2017 Capra Hircus Saudi strain_QGW08174.1, except for M345T. Similarly, [ 13 ] reported that several linear epitopes are predicted in the H protein of the PPR virus. Three substitutions were found in the first epitope: L16P, T20N, and T31V. The second mutation included 5 substitutions: G240R, K241G, S245D, P246L, and F251L. In the third one, D85N has only been substituted. Multiple sequence alignment of partial F protein Figure (8) shows the multiple alignment of PPR 155 with the Saudi 2017 strain and the 75/1 vaccine. The boxes in the figure indicate linear epitopes predicted in [ 13 ], where 7 substitutions are present; S489G, I492M, S503P, R518K, I522V, A524I, and S525P; and a leucine zipper motif, which is conserved among the vaccine and field strains and facilitates the fusion function of the F protein [ 10 ]. P(C/V) protein motif detection: The Soyuz1 motif was found to be conserved between 155 and 903. Discussion Saudi Arabia significantly contributes to the international trade of sheep and goats worldwide. The Kingdom was the world’s top importer in 2020, with 26.7% of global small ruminant imports with a value of 391 million USD [ 15 ]. PPR has been endemic in Saudi Arabia since 1990. The WOAH and FAO GEP initiatives seek to address the negative socioeconomic impacts of the disease on rural communities and mitigate its harmful effects on biodiversity in enzootic countries worldwide and eradication by 2030. The Kingdom considers achieving this goal on due date [ 15 ], Additionally, the program will help protect endangered wild ruminants, such as Arabian oryx, Nubian ibex, and mountain gazelles, which have recently been reintroduced into several wildlife reserves in Saudi Arabia [ 16 ]. Our findings indicate a significant prevalence of the disease among wild ruminants (72.1%). Despite ongoing vaccination campaigns, PPR continues to persist and erupt in many focal areas of the country. This persistence was attributed to factors such as open grazing practices, difficulty including many freerange and nomadic sheep and goat populations in vaccination campaigns and the ambiguous role of less susceptible species, including camels and unusual species such as biting midges [ 8 ], [ 17 ]. Considering these factors, achieving complete eradication of the virus via the PPR eradication program within the planned timeframe can be challenging. The presence of PPR in wild ungulates is evident and has been reported repeatedly [ 18 ]. The virus is classified into lineage types through partial or full N and/or F gene sequencing and further phylogenetic analysis. Additionally, the nucleocapsid (N) protein that directly binds to viral RNA plays a crucial role in gene transcription and contributes to virus replication. This study presents the complete sequencing of nucleocapsid protein-encoding genes from two RT‒PCR-positive samples [ 10 ]. Alignment of the current amino acid (aa) sequences with reference strains revealed changes in 18 positions from aa 400–480. Although this motif has not yet identified to contain linear epitopes, it still has considerable variation that can have some effect on infected animals. The other two domains in the N gene are identical to those in the vaccine strain as reported in [ 13 ], where all field samples were identical to those in the vaccine strain in terms of the full N gene. Consequently, phylogenetic analysis of DNA sequences classified our samples into lineage IV, aligning them with the Turkish lineage in the same clade. Our findings corroborate previous studies that confirmed the dominance of lineage IV in Asia, the Middle East, Africa, and other regions and in previous studies from Saudi Arabia [ 4 ], [ 15 ], [ 19 ]. The hemagglutinin protein helps the virus receptor-mediated endocytosis process and shares strong immunogenic epitopes [ 20 ], as the humoral immune response is elicited against the N, H and F proteins [ 5 , 10 , 21 ]. In our study, the H protein was partially sequenced. Substitutions in P170S, K176R, S179L and S302P were found in a predicted epitope and were predicted to change the 3D structure of the protein. These findings agree with those of [ 5 , 10 , 21 ], who studied the 3D structure of the H protein and predicted the most immunogenic motifs. This important finding led us to claim that the virus may escape the host immune response elicited by the N 75/1 vaccine, leading to drastic consequences. A supporting finding was found in the fusion protein partial sequence data obtained in this study. Although the sequence did not span the cleavage site, it spanned an important epitope where 7 substitutions are present: S489G, I492M, S503P, R518K, I522V, A524I, and S525P. The leucine zipper motif, which helps maintain F protein structure and function, is completely conserved in field and vaccine strains, as supported by [ 10 , 13 ] findings. Our study successfully achieved its intended objectives. All clinical cases were accurately diagnosed as PPR infection through real-time RT‒PCR. This study also provides important support on the sequence data published on PPR virus in Saudi Arabia, as it is the first sequence reported from wildlife in the Kingdom of Saudi Arabia and the first since 2017. All these efforts are needed in vaccine matching studies to implement correct vaccination programs. The sequence data revealed that the causative virus may escape vaccine induced immunity. Other factors can support or decrease such claims. This case requires further investigation where experimental vaccination and challenge should be performed with full genome sequencing of challenge viruses with further 3D modeling of H, N and F genes compared with the vaccine. Conclusion This study highlights PPR virus circulation in vaccinated wildlife flocks kept in reserves in Saudi Arabia. These animals are valuable and endangered. The key factor in this study is that the Saudi Arabian PPRV has not been well studied in the last 10 years, especially with respect to wildlife. The possibility of circulation of a variant virus that is not completely covered by vaccine induced immunity is present. The use of lineage IV vaccines or updated vaccine seed viruses may greatly limit the incursion of the PPR virus in wildlife. Materials and Methods Study design: This study is a retrospective observational investigation. A total of 309 samples were received as suspected to be infected with PPRV. From positive samples, two were partially sequenced and subjected to genetic analysis. Samples collection and preparation: The Virology Department of Weqaa Central Laboratory, Riyadh, Saudi Arabia, has received 309 samples from wild ruminants that were kept semi-captive in different wildlife breeding centers in Saudi Arabia from 2022–2024. The animals were either alive showing clinical symptoms, where lacrimal swabs and blood were collected, or morbid, where intestinal contents, liver, spleen, and lymph node tissues were collected. The main complaints were oral erosions, fever, coughing and diarrhea, while the PMs of the deceased animals presented pneumonia, zebra stripping of the large intestine and congestion in internal organs where PPR was suspected. The samples were shipped on a transport medium in a cold chain until they were prepared and tested according to [ 22 ]. Positive samples were recorded, and 2 of them (lab. Id. 903; 7 lacrimal swabs) collected on 16/6/2022 from Capra nubiana (Nubian ibex) and samples (Lab. Id. 155, 5 lacrimal swabs) collected on 1/2024 from mountain gazelles were used in conventional PCR for amplification of full N, P (C/V), partial H and F genes and further Illumina sequencing. PPR viral RNA extraction and real-time RT‒PCR amplification: Viral RNA was extracted from 200 µL samples via the automated Magna Pure Compact (Roche) RNA extraction platform, small volume according to the manufacturer’s recommendations. A negative or non-template control was included in each extraction plate. Detection of PPR viral RNA from the suspected cases was performed via ID Gene TM Peste Des Petites Ruminants Duplex TaqMan qRT‒PCR by adding 8 µL of ARM (amplification reaction mixture) to 5 µL of the sample or control RNA. Positive and negative controls were included in each reaction. The following amplification profile was used: Reverse transcription: 10 min at 45°C, polymerase amplification: 2 min at 95°C, followed by 40 cycles of DNA denaturation/elongation: 10 s at 95°C and then 30 s at 60°C. The detected fluorescence in the HEX/VIC channel was set for test validity, and the fluorescence in the FAM channel indicated positive samples and positive controls and detected the Cq values of the samples. Conventional RT‒PCR The following primer pairs were used (listed in Table 1) according to [ 23 ]. This protocol uses selected primers from [ 23 ] to achieve amplification of the full N, full P and partial F and H genes after many optimization trials. The amplification reaction was performed via a One-Step RT‒PCR High Fidelity Kit containing SuperScript™ III (Invitrogen). A total of 5.0 µL of the extracted RNA from each sample pool was used as the target of amplification, and 0.2 µM of each primer was used. The reverse transcription was conducted for 30 min at 50°C, followed by 2 min of predenaturation at 94°C. This step was followed by 34 cycles of denaturation at 94°C for 15 s (annealing at 57–60°C for 30 s) and extension at 68°C for 150 s. Finally, there was an additional single elongation cycle at 68°C for 5 min. PCR was first analyzed using 1% gel electrophoresis. The amplification process was considered successful and ready for sequencing when clear sharp bands appeared at the optimum base pair, as indicated in Table (1). Illumina sequencing The PCR products were first subjected to purification via cleanup (AMPure XP, Beckman Coulter, Inc., Kraemer Blvd. Brea, CA 92821 USA) to remove chemical residues, dimers and unused nucleotides. The products were quantified via a highly sensitive DNA kit (Qubit, USA). Tagmentation and indexing were then performed again by a bioanalyzer (highly sensitive DNA assay kit, USA) prior to loading into the MiSeq Reagent Kit v2 (2 × 250 bp) after denaturation and dilution per the manufacturer’s recommendations. Sequence analysis Nucleotide sequences generated as FastQ files were trimmed for low-quality bases that are less than Q30 by via trimmomatic, which also targeted the removal of the index sequences. The after-filtered data were generated and then used for assembly (mapped to a reference DNA or de novo assembly) via Bowtie and SAM tools to yield matched reads (BAM files), and a final consensus was obtained. This consensus sequence is then deposited into GenBank then analyzed through pairwise sequence alignment of either nucleotides or amino acids, multiple sequence alignment, and phylogenetic analysis. Phylogenetic tree: It was drawn via the maximum likelihood heuristic method and the Tamura‒Nei model with nearest-neighbor-interchange (NNI). Bootstrap values where 1000 replicates are shown next to the branches. The initial tree(s) for the heuristic search were obtained automatically by applying neighbor-joining and BioNJ algorithms to a matrix of pairwise distances estimated via the Tamura‒Nei model and then selecting the topology with the superior log likelihood value. The generated consensus sequence amino acids were aligned with the 75/1 vaccine strain via Clustal Omega in MEGA X software, and images were generated via BioEdit 7.7 software. Partial H protein aa sequence alignment: The generated consensus sequence (1-388 aa) was compared through multiple sequence alignment with the PPR (75/1) vaccine strain sequence, Saudi Arabian strain (2017_ QGW08174.1_Capra Hircus), United Arab Emirates (UXN86381.1Ammotragus_lervia|2021), AJT59441.1_PPR_1969-09-03, AXE28384.1|Israel|Capra_nubiana|lung_abdominal_cavity|2017-01). The analysis was performed via Clustal Omega in MEGA X software. Multiple sequence alignment of partial F protein In the current study, the region from amino acids 203–546 of the full-length (546 aa) F protein was sequenced. The aa sequence was aligned with the sequences of the QGW08173.1 Saudi/2017 strain and the Nigerian 75/1 vaccine strain. The analysis was performed via Clustal Omega in MEGA X software, and images were generated via BioEdit 7.7 software. P(C/V) protein motif detection: The sequence was scanned for the presence of the Soyuz1 motif 4EQAYHVNKGLECIKSL20 in the P protein. Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Availability of data and materials The sequence data present in the paper is available as GenBank accession numbers. Competing interests Not applicable. Funding Not applicable. Authors' contributions Conceptualization, RK, ANA,FA,HA and AA; methodology, FA, ANA, HA, AM,AA,EG, .; software, ANA, RK, HA, FA validation, MB,EG,AME and IA.; formal analysis, ANA investigation, RK, ANA, FA resources, RK.; data curation, ANA.; writing—original draft preparation, RK,EG.; writing—review and editing, RK,EG, MB.; All authors have read and agreed to the published version of the manuscript Acknowledgements The authors especially thank Dr.Fanan AlAql for her contribution in conventional PCR optimization trials and dedicated work throughout the project. References SowjanyaKumari S, Bhavya AP, Akshata N, Kumar KV, Bokade PP, Suresh KP, et al. Peste Des Petits Ruminants in Atypical Hosts and Wildlife: Systematic Review and Meta-Analysis of the Prevalence between 2001 and 2021. Arch Razi Inst. 2021;76(6):1589-606. Ahaduzzaman M. Peste des petits ruminants (PPR) in Africa and Asia: A systematic review and meta-analysis of the prevalence in sheep and goats between 1969 and 2018. Vet Med Sci. 2020;6(4):813-33. Alemu B, Gari G, Libeau G, Kwiatek O, Kidane M, Belayneh R, et al. Molecular detection and phylogenetic analysis of Peste des petits ruminants virus circulating in small ruminants in eastern Amhara region, Ethiopia. BMC Vet Res. 2019;15(1):84. Hemida MG, Alghadeer HM, Alhammadi M, Ali S. Prevalence and molecular characterization of some circulating strains of the peste-des-petits-ruminants virus in Saudi Arabia between 2014-2016. PeerJ. 2020;8:e9035. Gaur SK, Chaudhary Y, Jain J, Singh R, Kaul R. Structural and functional characterization of peste des petits ruminants virus coded hemagglutinin protein using various in-silico approaches. Front Microbiol. 2024;15:1427606. Zou H, Niu Z, Cheng P, Wu C, Li W, Luo G, et al. Structure, Attachment and Transmembrane Internalisation of Peste Des Petits Ruminants Virus. Vet Med Sci. 2025;11(1):e70182. Fayyad AF, Alzuheir IM. Peste des petits ruminants: past, present, and future scope. J Infect Dev Ctries. 2024;18(12):1837-45. Dou Y, Liang Z, Prajapati M, Zhang R, Li Y, Zhang Z. Expanding Diversity of Susceptible Hosts in Peste Des Petits Ruminants Virus Infection and Its Potential Mechanism Beyond. Front Vet Sci. 2020;7:66. Mdetele DP, Komba E, Seth MD, Misinzo G, Kock R, Jones BA. Review of Peste des Petits Ruminants Occurrence and Spread in Tanzania. Animals (Basel). 2021;11(6). Munir M. Peste des Petits Ruminants Virus. Pathobiology and Molecular Diagnosis. 2013. Mahapatra M, Selvaraj M, Parida S. Comparison of Immunogenicity and Protective Efficacy of PPR Live Attenuated Vaccines (Nigeria 75/1 and Sungri 96) Administered by Intranasal and Subcutaneous Routes. Vaccines (Basel). 2020;8(2). Prajapati M, Alfred N, Dou Y, Yin X, Prajapati R, Li Y, et al. Host Cellular Receptors for the Peste des Petits Ruminant Virus. Viruses. 2019;11(8). Nooruzzaman M, Akter MN, Begum JA, Begum S, Parvin R, Giasuddin M, et al. Molecular insights into peste des petits ruminants virus identified in Bangladesh between 2008 and 2020. Infect Genet Evol. 2021;96:105163. S.C. Bodjo NN, E. Couacy-Hymann , K. Tounkara & A. Diallo Rinderpest and peste des petits ruminants: a century of progress and the future. World organization of animal health. 2024;2025(4 February 2025). Benfield CTO, Legnardi M, Mayen F, Almajali A, Cinardi G, Wisser D, et al. Peste Des Petits Ruminants in the Middle East: Epidemiological Situation and Status of Control and Eradication Activities after the First Phase of the PPR Global Eradication Program (2017-2021). Animals (Basel). 2023;13(7). Barichievy C, Sheldon R, Wacher T, Llewellyn O, Al-Mutairy M, Alagaili A. Conservation in Saudi Arabia; moving from strategy to practice. Saudi J Biol Sci. 2018;25(2):290-2. Adedeji AJ, Milovanovic M, Dogonyaro BB, Adole JA, Samson M, Omoniwa DO, et al. Can pigs add another "P" to the PPR? Serological evidence of frequent Peste des petits ruminants infections in pigs in Nigeria. Vet Res. 2025;56(1):49. Fine AE, Pruvot M, Benfield CTO, Caron A, Cattoli G, Chardonnet P, et al. Eradication of Peste des Petits Ruminants Virus and the Wildlife-Livestock Interface. Front Vet Sci. 2020;7:50. Banyard AC, Parida S, Batten C, Oura C, Kwiatek O, Libeau G. Global distribution of peste des petits ruminants virus and prospects for improved diagnosis and control. J Gen Virol. 2010;91(Pt 12):2885-97. Abera* M. Review on Pest Des Petits Ruminants Virus and its Socioeconomic Impact in Small Ruminants. Journal of Biomedical Research & Environmental Sciences. 2023;4(10):1540-51. Gaafar BBM, Ali SA, Abd-Elrahman KA, Almofti YA. Immunoinformatics Approach for Multiepitope Vaccine Prediction from H, M, F, and N Proteins of Peste des Petits Ruminants Virus. J Immunol Res. 2019;2019:6124030. Parida S, Selvaraj M, Gubbins S, Pope R, Banyard A, Mahapatra M. Quantifying Levels of Peste Des Petits Ruminants (PPR) Virus in Excretions from Experimentally Infected Goats and Its Importance for Nascent PPR Eradication Programme. Viruses. 2019;11(3). Dundon WG, Adombi C, Diallo A, Waqas A, Otsyina HR, Arthur CT, et al. Full genome sequence of a peste des petits ruminants virus (PPRV) from Ghana. Virus Genes 2014;49:497–501. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6397316","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":500232355,"identity":"5d6cf494-78b3-11f0-907b-06cc9d20a69f","order_by":0,"name":"Ali N. Alhafufi","email":"","orcid":"","institution":"Virology Department, Weqaa Center, Central Veterinary Laboratory","correspondingAuthor":false,"prefix":"","firstName":"Ali","middleName":"N.","lastName":"Alhafufi","suffix":""},{"id":500232396,"identity":"6827538a-78b3-11f0-907b-06cc9d20a69f","order_by":1,"name":"Fanan Alaql","email":"","orcid":"","institution":"Virology Department, Weqaa Center, Central Veterinary Laboratory","correspondingAuthor":false,"prefix":"","firstName":"Fanan","middleName":"","lastName":"Alaql","suffix":""},{"id":500232460,"identity":"73b3283b-78b3-11f0-907b-06cc9d20a69f","order_by":2,"name":"Hassan A. Albaqshi","email":"","orcid":"","institution":"Virology Department, Weqaa Center, Central Veterinary Laboratory","correspondingAuthor":false,"prefix":"","firstName":"Hassan","middleName":"A.","lastName":"Albaqshi","suffix":""},{"id":500232506,"identity":"7e20718a-78b3-11f0-907b-06cc9d20a69f","order_by":3,"name":"Muhammed Abuhaimad","email":"","orcid":"","institution":"Weqaa center, Central veterinary laboratory","correspondingAuthor":false,"prefix":"","firstName":"Muhammed","middleName":"","lastName":"Abuhaimad","suffix":""},{"id":500233644,"identity":"89dc0485-78b3-11f0-907b-06cc9d20a69f","order_by":4,"name":"Ameen Alyousaf","email":"","orcid":"","institution":"Virology Department, Weqaa Center, Central Veterinary Laboratory","correspondingAuthor":false,"prefix":"","firstName":"Ameen","middleName":"","lastName":"Alyousaf","suffix":""},{"id":500234951,"identity":"9c6f44a8-78b3-11f0-907b-06cc9d20a69f","order_by":5,"name":"El Gazali Gomaa","email":"","orcid":"","institution":"Virology Department, Weqaa Center, Central Veterinary Laboratory","correspondingAuthor":false,"prefix":"","firstName":"El","middleName":"Gazali","lastName":"Gomaa","suffix":""},{"id":500234952,"identity":"a7f288d9-78b3-11f0-907b-06cc9d20a69f","order_by":6,"name":"Mohammed Babiker MH","email":"","orcid":"","institution":"Animal Health Laboratory Administration, General Administration of Laboratory, Weqaa Center","correspondingAuthor":false,"prefix":"","firstName":"Mohammed","middleName":"Babiker","lastName":"MH","suffix":""},{"id":500234957,"identity":"b775e544-78b3-11f0-907b-06cc9d20a69f","order_by":7,"name":"Ibrehim Alshoumar","email":"","orcid":"","institution":"Animal Health Laboratory Administration, General Administration of Laboratory, Weqaa Center","correspondingAuthor":false,"prefix":"","firstName":"Ibrehim","middleName":"","lastName":"Alshoumar","suffix":""},{"id":500235198,"identity":"d57c3ea1-78b3-11f0-907b-06cc9d20a69f","order_by":8,"name":"Amira M. Elhassan","email":"","orcid":"","institution":"Virology Department, Weqaa Center, Central Veterinary Laboratory","correspondingAuthor":false,"prefix":"","firstName":"Amira","middleName":"M.","lastName":"Elhassan","suffix":""},{"id":500235307,"identity":"f4146531-78b3-11f0-907b-06cc9d20a69f","order_by":9,"name":"Naif Al Hanowsh","email":"","orcid":"","institution":"King Khalid Wildlife Research Centre (KKWRC)","correspondingAuthor":false,"prefix":"","firstName":"Naif","middleName":"Al","lastName":"Hanowsh","suffix":""},{"id":500235308,"identity":"fca08ff8-78b3-11f0-907b-06cc9d20a69f","order_by":10,"name":"Reham Karam","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABCUlEQVRIiWNgGAWjYFACHhAhByIYH0CFDIjRYgwimGFKidfCJkGUFvP23oOfbjAYyJu3H79WdaPmjj0De/M2CYaKWpxaZM6cS5bOYTAwnHMmp+x2zrFniQ08x8okGM4cx6lFQiLHAKjlD+MMhpy02zlshxMYJHLMJBjbjuHWIv/G+DfQFvsZ/G/SinP+HbZnkH8D1PIPjxYJHjOQwxJnSKQfY85tO8zYABSRYGyowa2FJ8fMGqgleYbEG2bp3L7DiW08acUWCccO4NbCfsb4NlCL7Qz+9Iefc74dtudnP7zxxoeaOpxawIDxH4jkgUQHG4hIYDiMXwsEsD9A5hGwZRSMglEwCkYSAAC+5E49ebfKXQAAAABJRU5ErkJggg==","orcid":"","institution":"Virology Department, Faculty of Veterinary Medicine, Mansoura University","correspondingAuthor":true,"prefix":"","firstName":"Reham","middleName":"","lastName":"Karam","suffix":""}],"badges":[],"createdAt":"2025-04-07 20:53:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6397316/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6397316/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":89232781,"identity":"48aee8fe-1de4-4bf4-b86a-05729bc41bf8","added_by":"auto","created_at":"2025-08-17 14:29:53","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":30301,"visible":true,"origin":"","legend":"\u003cp\u003eZebra stripping in the large intestine of mountain gazelle infected with PPR virus.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6397316/v1/edd216d4bfe36fc4176e56a1.png"},{"id":89230291,"identity":"b51a899c-4958-44d5-87b7-59f0b8e2a825","added_by":"auto","created_at":"2025-08-17 14:13:53","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":57288,"visible":true,"origin":"","legend":"\u003cp\u003eHemorrhagic enteritis in mountain gazelles infected with PPR virus.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6397316/v1/69faa0f11d00955b1e19e515.png"},{"id":89230296,"identity":"aa7dd509-82ea-410b-a73f-17b8e8a1edd2","added_by":"auto","created_at":"2025-08-17 14:13:53","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":240107,"visible":true,"origin":"","legend":"\u003cp\u003eSevere pneumonia in the lungs of the affected mountain gazelle\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6397316/v1/088d2133758ddd91bac80318.png"},{"id":89230301,"identity":"1beb2f6b-eb51-40c9-99d9-14967fc3637b","added_by":"auto","created_at":"2025-08-17 14:13:53","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":80272,"visible":true,"origin":"","legend":"\u003cp\u003eMultiple sequence alignment of recent Saudi Arabian PPR virus lineage IV.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6397316/v1/d33ccf38a911b33f42046840.png"},{"id":89230314,"identity":"d90629a0-8edf-4c2c-91d0-045d006aadb7","added_by":"auto","created_at":"2025-08-17 14:13:54","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":260207,"visible":true,"origin":"","legend":"\u003cp\u003eAmino acid alignment of N protein of sample 155 with UGL85089, and AUP34034 reference strains (Nigerian 75/1 vaccine strain).\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6397316/v1/5a7258e716dbcdf1fb27caa4.png"},{"id":89230299,"identity":"9eea7cbb-8a98-479f-a02b-6ec0f6ee9601","added_by":"auto","created_at":"2025-08-17 14:13:53","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":81892,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic analysis of the samples included in this study, with sequences representing all 4 lineages. Our samples clustered in lineage IV in the same clade as the MN657232 Turkish strain.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-6397316/v1/f3e67869db211a731201fa40.png"},{"id":89231711,"identity":"f1aaff8e-dafe-48cd-9042-691f239a8ba5","added_by":"auto","created_at":"2025-08-17 14:21:53","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":583901,"visible":true,"origin":"","legend":"\u003cp\u003eMultiple sequence alignment of the PPR H protein sequences. The clear boxes represent the amino acid substitutions that influence the 3D structure of the protein. Clustal Omega was used in MEGA X software.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-6397316/v1/b5ae982f7cfb07caa638fec5.png"},{"id":89232782,"identity":"913cf746-8a6d-4545-9083-e200239afbb0","added_by":"auto","created_at":"2025-08-17 14:29:53","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":488992,"visible":true,"origin":"","legend":"\u003cp\u003eMultiple sequence alignment of the PPR samples compared with the 75/1 vaccine strain.\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-6397316/v1/2dd582624012cb2b3987e7e7.png"},{"id":92085625,"identity":"7e806fbe-1ad5-4a79-b1a8-7c1d643742bf","added_by":"auto","created_at":"2025-09-24 12:53:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2485337,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6397316/v1/4066aa1d-d636-48d9-8026-d903f2b3e490.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Sequencing of the PPR virus caused outbreaks in Nubian ibex and mountain gazelles in Saudi Arabia from 2022-2024","fulltext":[{"header":"Background","content":"\u003cp\u003ePPR is a highly contagious viral disease affecting domestic and wild ruminants, causing substantial economic losses through its impact on the international trade of sheep and goats [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e],[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The disease manifests as fever, mouth lesions, pneumonia, diarrhea, and inflammation of the respiratory and digestive tracts, leading to 90% morbidity and 100% mortality in acute cases [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. PPR is classified as a transboundary and notifiable disease that continues to emerge or re-emerge in new territories worldwide [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eOwing to the severe impact of PPR, the World Organization for Animal Health (WOAH) and the Food and Agriculture Organization (FAO) have designated PPR a high-priority disease for progressive control and eradication by 2030, inspired by the successful eradication of Rinderpest in 2011 [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e\u003cp\u003ePPR is caused by \u003cem\u003eMorbillivirus caprinae\u003c/em\u003e, a member of the \u003cem\u003eParamyxoviridae\u003c/em\u003e family within the genus \u003cem\u003eMorbillivirus\u003c/em\u003e. PPRV is pleomorphic or spherical, 400\u0026ndash;500 nm in diameter, and possesses single-stranded RNA of negative polarity. This RNA encodes six structural proteins, namely, nucleocapsid (N), phosphoprotein (P), matrix (M), fusion (F), hemagglutinin (H), large protein or RNA-dependent RNA polymerase (L), along with two nonstructural proteins (C and V) [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Each of these proteins plays a significant role in the virus replication cycle [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe nucleocapsid protein (N) acts as an RNA scaffold that helps in viral RNA encapsidation, replication, and transcription [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. It also inhibits the production of type II interferons [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. This protein induces a strong immune response in affected animals. On the basis of partial N and F gene sequencing, PPRV can be classified into 4 lineages (I\u0026ndash;IV) associated with different geographical regions [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Lineages I and II are found mainly in Western Africa, lineage III has historically been dominant in the Middle East, while lineage IV is considered the most widespread lineage worldwide, circulating in Asia and being reported in recent isolates in the Middle East [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Despite their genetic differences, all four lineages are immunologically indistinguishable [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eMass vaccination against PPR is the chosen method for virus control. The administration of lineage II vaccine including Nigerian 75/1 strain elicited strong protective immune response that persist for many years [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe virus also encodes C and V nonstructural proteins that act as promoters in the processes of transcription and replication [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Both are encoded by the P gene via alternative reading frames. The \u0026lsquo;Soyuz1 motif\u0026rsquo;\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e4\u003c/span\u003eEQAYHVNKGLECIKSL\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e20\u003c/span\u003e has been predicted to bind the nucleocapsid protein and prevent its self-assembly [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eDuring the initial stages of PPRV replication, the virus recruits hemagglutinin (H) and fusion (F) proteins for binding and then enters the host cell cytoplasm through its receptors, namely, signaling lymphocyte activation molecule (SLAM) and Nectin-4, which enable entry via receptor-mediated endocytosis [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The ability to bind to both SLAM and nectin-4 receptors explains the lymphotropic and epitheliotropic nature of the virus. The F protein facilitates virus entry into the host cell cytoplasm. It has a membraned anchored subunit and another protruding one through cleavage of the F0 protein at the crucial cleavage site \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e104\u003c/span\u003eRRTRR\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e108\u003c/span\u003e, which is very important for virus virulence. It facilitates fusion between the host cell membrane and viral envelope with the help of a leucine zipper motif located at (aa 459\u0026ndash;480) [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The viral H or HN protein is the most variable (sharing only 50% identity) and the most immunogenic protein. It is thought that it acts as a host cell tropism determinant in PPR [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\u003cp\u003ePPRV primarily infects goats and sheep, but over the last decades, the host range of PPRV has been continuously expanding to many other domestic and wild \u003cem\u003eArtiodactyla\u003c/em\u003e species. Cattle, camels and several wild ruminants are occasionally infected occasionally [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\u003cp\u003ePPR cases have been documented in many wild ruminants, including bharals, gazelles, ibexes, chowsingha (\u003cem\u003eTetracerus quadricornis\u003c/em\u003e), wild goats (\u003cem\u003eCapra aegagrus\u003c/em\u003e), wild sheep (\u003cem\u003eOvis orientalis, Pseudois nayaur\u003c/em\u003e), and water deer (\u003cem\u003eHydropotes inermis\u003c/em\u003e)[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eEurope has been free from PPR for decades. However, in 2024, PPR eruptions were reported in Greece and Romania, which were previously officially free of the disease. This re-emergence poses a significant threat to sheep, goats, and certain wild ungulates [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Control measures have been implemented in both Greece and Romania, such as movement restrictions, zoning, and stamping out infected farms.\u003c/p\u003e\u003cp\u003eSaudi Arabia first reported PPR three decades ago, and now, it is considered endemic and is located among divergent pools of different PPR lineages, although recent outbreaks have been attributed to lineage IV only [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Pooled estimates based on published epidemiological studies reported a PPR prevalence of approximately 50% in sheep and goat populations in Saudi Arabia [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The Kingdom contributed to the global eradication program and reached stage 2. The PPR control plan in Saudi Arabia is a main focus and involves serological passive surveillance in domestic small ruminants and progressive vaccination via 75/1 locally produced live attenuated vaccines to achieve herd immunity. Animal immunity is tested under surveillance programs held annually [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn alignment with their 2030 vision, Saudi Arabia prioritized sustainability and conservation, where protecting endangered wild species was a focus through establishing captive breeding centers such as the King Khalid Wildlife Research Center in Riyadh and the Prince Saud Al-Faisal Wildlife Research Center near Taif [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eConservation efforts are threatened by recurrent outbreaks of the PPRV, especially in critically endangered populations such as Nubian ibex, mountain gazelles and \u003cem\u003eArabian oryx\u003c/em\u003e. To mention some of the reported cases, there has been serological evidence for the presence of the PPRV in Saudi Arabian wild deer and gazelle since the 1970s, although the PPRV was isolated for the first time in the Eastern part of Saudi Arabia in 1988.[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] Camels and \u003cem\u003eArabian oryx\u003c/em\u003e in Saudi Arabia had evidence of seroprevalence without a history of vaccination, which proves exposure to the virus naturally [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Several recent eruptions of PPR were reported in this study in vaccinated and endangered wild ruminants. The aim of the present study was to describe the virus lineage types and their genetic characteristics, especially those of the viruses detected in Nubian ibex and mountain gazelles. A thorough comparison between the predicted epitopes present in the N, F and H proteins was made between vaccine and field viruses to draw preliminary conclusions about the main reason for the recurrent outbreaks and provide recommendations for future vaccination programs.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\"\u003e\n \u003ch2\u003e\u003cstrong\u003eSample collection\u003c/strong\u003e:\u003c/h2\u003e\n \u003cp\u003eThe affected animals presented nasal discharge, erosion in the oral cavity, and diarrhea, with mortality in severe cases. The noticed PM lesions appeared as necrotic enteritis with zebra stripping as a characteristic lesion, severe pneumonia, and hemorrhages spanning most of the internal organs, as shown in \u003cstrong\u003efigures (1–3).\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eThe samples collected, positive samples by real-time RT‒PCR and their host species are shown in Table\u0026nbsp;(2).\u003c/p\u003e\n \u003cp\u003eA total of 309 samples were collected, and 223 (72.1%) positive samples were detected via real-time RT‒PCR. All animals were vaccinated with 75/1 live attenuated freeze-dried commercial PPR vaccine produced nationally by the vaccine production unit of the Weqaa Center, Riyadh, Saudi Arabia.\u003c/p\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003cp\u003eTable (1): Primers used for amplification of different targets of the PPR virus genome in this study.\u003c/p\u003e\n \u003ctable id=\"Tabb\" border=\"1\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eS\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eFragments\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSize\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eoligo\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eoligo\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u0026ndash;3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.20 kb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026apos; CCAAACAAAGTTGGGTAAGGA 3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026apos; TYTGCTTGAACCACGAGAGA 3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026ndash;7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.12 kb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026apos; CAACCAAYCATGCTCAYCAG 3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026apos; TTGCCCACGTGTACCATAAA 3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eP/V/M\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14\u0026ndash;16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.19 kb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026apos; ATAAAGGCYCGRGTKACATA 3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e17R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026apos; AGGTCGAGTCTTRCATGCTT 3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF/H\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003c/div\u003e\n \u003cp\u003e\u003cstrong\u003eTable\u0026nbsp;(2)\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eSamples received and used for PPR virus diagnosis from 2022–2024\u003c/p\u003e\n \u003cdiv\u003e\n \u003ctable id=\"Taba\" border=\"1\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSN\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eID\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eDATE\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eSPP.\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTotal No.\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eNo. (+ ve)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e903\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e06/2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eCapra nubiana\u003c/em\u003e (Nubian Ibex)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e65\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e62\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e1001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2022/07\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eCapra nubiana\u003c/em\u003e (Nubian Ibex)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e75\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e42\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e1120\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2022/08\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eCapra nubiana\u003c/em\u003e (Nubian Ibex)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e1310\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2022/09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eCapra nubiana\u003c/em\u003e (Nubian Ibex)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e1514\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10/2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eCapra nubiana\u003c/em\u003e (Nubian Ibex)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e1516\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2022/11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eOryx leucoryx\u003c/em\u003e (Arabian oryx)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e1681\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2022/12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eGazella subgutturosa\u003c/em\u003e (Arabian Goitered Gazelle)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"6\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e239\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e181\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eSN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eID\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eDATE\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eSPP.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal NO\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eNO. (+ ve)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e279\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCapra nubiana (Nubian Ibex)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e279\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGazella subgutturosa (Arabian Goitered Gazelle)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e307\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eGazella subgutturosa\u003c/em\u003e (Arabian Goitered Gazelle)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1112\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eOryx leucoryx\u003c/em\u003e (Arabian oryx)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1227\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eGazella subgutturosa\u003c/em\u003e (Arabian Goitered Gazelle)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1258\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eGazella gazella\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1406\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eGazella subgutturosa\u003c/em\u003e (Arabian Goitered Gazelle)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1414\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eGazella gazella\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1473\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCapra nubiana\u003c/em\u003e (Nubian Ibex)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1563\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eOryx leucoryx\u003c/em\u003e (Arabian oryx)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"6\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e57\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e35\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eID\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eDATE\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eSPP.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal NO\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eNO. (+ ve)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2024\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eGazelle spp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2024\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eGazelle spp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e155\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2024\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eGazella Gazella\u003c/em\u003e (mountain gazelle)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"6\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e13\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e7\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"6\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e309\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e223 (72%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003ch3\u003eSequencing and sequence analysis:\u003c/h3\u003e\n\u003cp\u003eSequences in study has obtained the following accession numbers (PV353910, PV353911, PV353912, PV358391, PV358392, PV395578) Phylogenetic analysis and nucleotide alignment revealed that the 2 samples clustered with lineage IV, as shown in Figures (6) and (4).\u003c/p\u003e\n\u003cp\u003eMultiple sequence alignment is shown in Figure (4). The samples used in this study (903 and 155) are homologous to NM657232 (Turkish strain). The difference between the 155 PPR sample sequences and the 75/1 sequence was evident, as shown in Figures (4 and 5).\u003c/p\u003e\n\u003cp\u003eMultiple N protein amino acid alignments revealed that many substitutions are evident compared with those in the PPR vaccine, which belongs to lineage II. Two epitopes in the N protein were predicted by [\u003cspan class=\"CitationRef\"\u003e13\u003c/span\u003e], 1: from aa (1\u0026ndash;35) and 2: (352\u0026ndash;399). There was complete conservation in our sequences and the 75/1 vaccinal strain. However, region 401\u0026ndash;482 was found to contain 18 substitutions between our samples and the vaccine strain, as shown in Figure (5).\u003c/p\u003e\n\u003ch3\u003eMultiple sequence alignment of the partial H protein\u003c/h3\u003e\n\u003cp\u003eThe alignment in \u003cb\u003eFigure (7)\u003c/b\u003e shows that the amplicon in our study spanned from aa (1-388) compared with the 609 full length H protein.\u003c/p\u003e\u003cp\u003eAccording to the findings of [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], 9 critical amino acid substitutions were found between sample 155 and the 75/1 vaccine strains as follows: P170S, K176R, S179L, R240G, G264E, P267A, V269I, S302P, and M345T. P170S, K176R, S179L, and S302P had a proven effect on the H protein 3D structure.\u003c/p\u003e\u003cp\u003eThese mutations also exist in the older 2017 \u003cem\u003eCapra Hircus\u003c/em\u003e Saudi strain_QGW08174.1, except for M345T.\u003c/p\u003e\u003cp\u003eSimilarly, [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] reported that several linear epitopes are predicted in the H protein of the PPR virus. Three substitutions were found in the first epitope: L16P, T20N, and T31V. The second mutation included 5 substitutions: G240R, K241G, S245D, P246L, and F251L. In the third one, D85N has only been substituted.\u003c/p\u003e\n\u003ch3\u003eMultiple sequence alignment of partial F protein\u003c/h3\u003e\n\u003cp\u003eFigure (8) shows the multiple alignment of PPR 155 with the Saudi 2017 strain and the 75/1 vaccine. The boxes in the figure indicate linear epitopes predicted in [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], where 7 substitutions are present; S489G, I492M, S503P, R518K, I522V, A524I, and S525P; and a leucine zipper motif, which is conserved among the vaccine and field strains and facilitates the fusion function of the F protein [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eP(C/V) protein motif detection:\u003c/h3\u003e\n\u003cp\u003eThe Soyuz1 motif was found to be conserved between 155 and 903.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eSaudi Arabia significantly contributes to the international trade of sheep and goats worldwide. The Kingdom was the world\u0026rsquo;s top importer in 2020, with 26.7% of global small ruminant imports with a value of 391\u0026nbsp;million USD [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e\u003cp\u003ePPR has been endemic in Saudi Arabia since 1990. The WOAH and FAO GEP initiatives seek to address the negative socioeconomic impacts of the disease on rural communities and mitigate its harmful effects on biodiversity in enzootic countries worldwide and eradication by 2030. The Kingdom considers achieving this goal on due date [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e],\u003c/p\u003e\u003cp\u003eAdditionally, the program will help protect endangered wild ruminants, such as Arabian oryx, Nubian ibex, and mountain gazelles, which have recently been reintroduced into several wildlife reserves in Saudi Arabia [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Our findings indicate a significant prevalence of the disease among wild ruminants (72.1%). Despite ongoing vaccination campaigns, PPR continues to persist and erupt in many focal areas of the country. This persistence was attributed to factors such as open grazing practices, difficulty including many freerange and nomadic sheep and goat populations in vaccination campaigns and the ambiguous role of less susceptible species, including camels and unusual species such as biting midges [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Considering these factors, achieving complete eradication of the virus via the PPR eradication program within the planned timeframe can be challenging.\u003c/p\u003e\u003cp\u003eThe presence of PPR in wild ungulates is evident and has been reported repeatedly [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe virus is classified into lineage types through partial or full N and/or F gene sequencing and further phylogenetic analysis. Additionally, the nucleocapsid (N) protein that directly binds to viral RNA plays a crucial role in gene transcription and contributes to virus replication. This study presents the complete sequencing of nucleocapsid protein-encoding genes from two RT‒PCR-positive samples [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Alignment of the current amino acid (aa) sequences with reference strains revealed changes in 18 positions from aa 400\u0026ndash;480. Although this motif has not yet identified to contain linear epitopes, it still has considerable variation that can have some effect on infected animals. The other two domains in the N gene are identical to those in the vaccine strain as reported in [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], where all field samples were identical to those in the vaccine strain in terms of the full N gene.\u003c/p\u003e\u003cp\u003eConsequently, phylogenetic analysis of DNA sequences classified our samples into lineage IV, aligning them with the Turkish lineage in the same clade. Our findings corroborate previous studies that confirmed the dominance of lineage IV in Asia, the Middle East, Africa, and other regions and in previous studies from Saudi Arabia [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe hemagglutinin protein helps the virus receptor-mediated endocytosis process and shares strong immunogenic epitopes [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], as the humoral immune response is elicited against the N, H and F proteins [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn our study, the H protein was partially sequenced. Substitutions in P170S, K176R, S179L and S302P were found in a predicted epitope and were predicted to change the 3D structure of the protein. These findings agree with those of [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], who studied the 3D structure of the H protein and predicted the most immunogenic motifs. This important finding led us to claim that the virus may escape the host immune response elicited by the N 75/1 vaccine, leading to drastic consequences.\u003c/p\u003e\u003cp\u003eA supporting finding was found in the fusion protein partial sequence data obtained in this study. Although the sequence did not span the cleavage site, it spanned an important epitope where 7 substitutions are present: S489G, I492M, S503P, R518K, I522V, A524I, and S525P. The leucine zipper motif, which helps maintain F protein structure and function, is completely conserved in field and vaccine strains, as supported by [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] findings.\u003c/p\u003e\u003cp\u003eOur study successfully achieved its intended objectives. All clinical cases were accurately diagnosed as PPR infection through real-time RT‒PCR. This study also provides important support on the sequence data published on PPR virus in Saudi Arabia, as it is the first sequence reported from wildlife in the Kingdom of Saudi Arabia and the first since 2017. All these efforts are needed in vaccine matching studies to implement correct vaccination programs.\u003c/p\u003e\u003cp\u003eThe sequence data revealed that the causative virus may escape vaccine induced immunity. Other factors can support or decrease such claims. This case requires further investigation where experimental vaccination and challenge should be performed with full genome sequencing of challenge viruses with further 3D modeling of H, N and F genes compared with the vaccine.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study highlights PPR virus circulation in vaccinated wildlife flocks kept in reserves in Saudi Arabia. These animals are valuable and endangered. The key factor in this study is that the Saudi Arabian PPRV has not been well studied in the last 10 years, especially with respect to wildlife. The possibility of circulation of a variant virus that is not completely covered by vaccine induced immunity is present. The use of lineage IV vaccines or updated vaccine seed viruses may greatly limit the incursion of the PPR virus in wildlife.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eStudy design:\u003c/h2\u003e\u003cp\u003eThis study is a retrospective observational investigation. A total of 309 samples were received as suspected to be infected with PPRV. From positive samples, two were partially sequenced and subjected to genetic analysis.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eSamples collection and preparation:\u003c/h2\u003e\u003cp\u003eThe Virology Department of Weqaa Central Laboratory, Riyadh, Saudi Arabia, has received 309 samples from wild ruminants that were kept semi-captive in different wildlife breeding centers in Saudi Arabia from 2022\u0026ndash;2024. The animals were either alive showing clinical symptoms, where lacrimal swabs and blood were collected, or morbid, where intestinal contents, liver, spleen, and lymph node tissues were collected.\u003c/p\u003e\u003cp\u003eThe main complaints were oral erosions, fever, coughing and diarrhea, while the PMs of the deceased animals presented pneumonia, zebra stripping of the large intestine and congestion in internal organs where PPR was suspected.\u003c/p\u003e\u003cp\u003eThe samples were shipped on a transport medium in a cold chain until they were prepared and tested according to [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e\u003cp\u003ePositive samples were recorded, and 2 of them (lab. Id. 903; 7 lacrimal swabs) collected on 16/6/2022 from \u003cem\u003eCapra nubiana\u003c/em\u003e (Nubian ibex) and samples (Lab. Id. 155, 5 lacrimal swabs) collected on 1/2024 from mountain gazelles were used in conventional PCR for amplification of full N, P (C/V), partial H and F genes and further Illumina sequencing.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003ePPR viral RNA extraction and real-time RT‒PCR amplification:\u003c/h2\u003e\u003cp\u003eViral RNA was extracted from 200 \u0026micro;L samples via the automated Magna Pure Compact (Roche) RNA extraction platform, small volume according to the manufacturer\u0026rsquo;s recommendations. A negative or non-template control was included in each extraction plate.\u003c/p\u003e\u003cp\u003eDetection of PPR viral RNA from the suspected cases was performed via ID Gene \u003csup\u003eTM\u003c/sup\u003e Peste Des Petites Ruminants Duplex TaqMan qRT‒PCR by adding 8 \u0026micro;L of ARM (amplification reaction mixture) to 5 \u0026micro;L of the sample or control RNA. Positive and negative controls were included in each reaction. The following amplification profile was used:\u003c/p\u003e\u003cp\u003eReverse transcription: 10 min at 45\u0026deg;C, polymerase amplification: 2 min at 95\u0026deg;C, followed by 40 cycles of DNA denaturation/elongation: 10 s at 95\u0026deg;C and then 30 s at 60\u0026deg;C. The detected fluorescence in the HEX/VIC channel was set for test validity, and the fluorescence in the FAM channel indicated positive samples and positive controls and detected the Cq values of the samples.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eConventional RT‒PCR\u003c/h2\u003e\u003cp\u003eThe following primer pairs were used (listed in Table\u0026nbsp;1) according to [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThis protocol uses selected primers from [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e] to achieve amplification of the full N, full P and partial F and H genes after many optimization trials.\u003c/p\u003e\u003cp\u003eThe amplification reaction was performed via a One-Step RT‒PCR High Fidelity Kit containing SuperScript\u0026trade; III (Invitrogen).\u003c/p\u003e\u003cp\u003eA total of 5.0 \u0026micro;L of the extracted RNA from each sample pool was used as the target of amplification, and 0.2 \u0026micro;M of each primer was used. The reverse transcription was conducted for 30 min at 50\u0026deg;C, followed by 2 min of predenaturation at 94\u0026deg;C. This step was followed by 34 cycles of denaturation at 94\u0026deg;C for 15 s (annealing at 57\u0026ndash;60\u0026deg;C for 30 s) and extension at 68\u0026deg;C for 150 s. Finally, there was an additional single elongation cycle at 68\u0026deg;C for 5 min. PCR was first analyzed using 1% gel electrophoresis. The amplification process was considered successful and ready for sequencing when clear sharp bands appeared at the optimum base pair, as indicated in \u003cb\u003eTable\u0026nbsp;(1).\u003c/b\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eIllumina sequencing\u003c/h2\u003e\u003cp\u003eThe PCR products were first subjected to purification via cleanup (AMPure XP, Beckman Coulter, Inc., Kraemer Blvd. Brea, CA 92821 USA) to remove chemical residues, dimers and unused nucleotides. The products were quantified via a highly sensitive DNA kit (Qubit, USA). Tagmentation and indexing were then performed again by a bioanalyzer (highly sensitive DNA assay kit, USA) prior to loading into the MiSeq Reagent Kit v2 (2 \u0026times; 250 bp) after denaturation and dilution per the manufacturer\u0026rsquo;s recommendations.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eSequence analysis\u003c/h2\u003e\u003cp\u003eNucleotide sequences generated as FastQ files were trimmed for low-quality bases that are less than Q30 by via trimmomatic, which also targeted the removal of the index sequences. The after-filtered data were generated and then used for assembly (mapped to a reference DNA or de novo assembly) via Bowtie and SAM tools to yield matched reads (BAM files), and a final consensus was obtained.\u003c/p\u003e\u003cp\u003eThis consensus sequence is then deposited into GenBank then analyzed through pairwise sequence alignment of either nucleotides or amino acids, multiple sequence alignment, and phylogenetic analysis.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003ePhylogenetic tree:\u003c/h2\u003e\u003cp\u003eIt was drawn via the maximum likelihood heuristic method and the Tamura‒Nei model with nearest-neighbor-interchange (NNI). Bootstrap values where 1000 replicates are shown next to the branches. The initial tree(s) for the heuristic search were obtained automatically by applying neighbor-joining and BioNJ algorithms to a matrix of pairwise distances estimated via the Tamura‒Nei model and then selecting the topology with the superior log likelihood value.\u003c/p\u003e\u003cp\u003eThe generated consensus sequence amino acids were aligned with the 75/1 vaccine strain via Clustal Omega in MEGA X software, and images were generated via BioEdit 7.7 software.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003ePartial H protein aa sequence alignment:\u003c/h2\u003e\u003cp\u003eThe generated consensus sequence (1-388 aa) was compared through multiple sequence alignment with the PPR (75/1) vaccine strain sequence, Saudi Arabian strain (2017_ QGW08174.1_Capra Hircus), United Arab Emirates (UXN86381.1Ammotragus_lervia|2021), AJT59441.1_PPR_1969-09-03, AXE28384.1|Israel|Capra_nubiana|lung_abdominal_cavity|2017-01). The analysis was performed via Clustal Omega in MEGA X software.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eMultiple sequence alignment of partial F protein\u003c/h2\u003e\u003cp\u003eIn the current study, the region from amino acids 203\u0026ndash;546 of the full-length (546 aa) F protein was sequenced. The aa sequence was aligned with the sequences of the QGW08173.1 Saudi/2017 strain and the Nigerian 75/1 vaccine strain. The analysis was performed via Clustal Omega in MEGA X software, and images were generated via BioEdit 7.7 software.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eP(C/V) protein motif detection:\u003c/h2\u003e\u003cp\u003eThe sequence was scanned for the presence of the Soyuz1 motif 4EQAYHVNKGLECIKSL20 in the P protein.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cul type=\"disc\"\u003e\n \u003cli\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cul type=\"disc\"\u003e\n \u003cli\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cul type=\"disc\"\u003e\n \u003cli\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003eThe sequence data present in the paper is available as GenBank accession numbers.\u003c/p\u003e\n\u003cul type=\"disc\"\u003e\n \u003cli\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cul type=\"disc\"\u003e\n \u003cli\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization, RK, ANA,FA,HA and AA; methodology, FA, ANA, HA, AM,AA,EG, .; software, ANA, RK, HA, FA validation, MB,EG,AME and IA.; formal analysis, ANA investigation, RK, ANA, FA resources, RK.; data curation, ANA.; writing\u0026mdash;original draft preparation, RK,EG.; writing\u0026mdash;review and editing, RK,EG, MB.; All authors have read and agreed to the published version of the manuscript\u003c/p\u003e\n\u003cul type=\"disc\"\u003e\n \u003cli\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003eThe authors especially thank Dr.Fanan AlAql for her contribution in conventional PCR optimization trials and dedicated work throughout the project.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSowjanyaKumari S, Bhavya AP, Akshata N, Kumar KV, Bokade PP, Suresh KP, et al. Peste Des Petits Ruminants in Atypical Hosts and Wildlife: Systematic Review and Meta-Analysis of the Prevalence between 2001 and 2021. Arch Razi Inst. 2021;76(6):1589-606.\u003c/li\u003e\n\u003cli\u003eAhaduzzaman M. Peste des petits ruminants (PPR) in Africa and Asia: A systematic review and meta-analysis of the prevalence in sheep and goats between 1969 and 2018. Vet Med Sci. 2020;6(4):813-33.\u003c/li\u003e\n\u003cli\u003eAlemu B, Gari G, Libeau G, Kwiatek O, Kidane M, Belayneh R, et al. Molecular detection and phylogenetic analysis of Peste des petits ruminants virus circulating in small ruminants in eastern Amhara region, Ethiopia. BMC Vet Res. 2019;15(1):84.\u003c/li\u003e\n\u003cli\u003eHemida MG, Alghadeer HM, Alhammadi M, Ali S. Prevalence and molecular characterization of some circulating strains of the peste-des-petits-ruminants virus in Saudi Arabia between 2014-2016. PeerJ. 2020;8:e9035.\u003c/li\u003e\n\u003cli\u003eGaur SK, Chaudhary Y, Jain J, Singh R, Kaul R. Structural and functional characterization of peste des petits ruminants virus coded hemagglutinin protein using various in-silico approaches. Front Microbiol. 2024;15:1427606.\u003c/li\u003e\n\u003cli\u003eZou H, Niu Z, Cheng P, Wu C, Li W, Luo G, et al. Structure, Attachment and Transmembrane Internalisation of Peste Des Petits Ruminants Virus. Vet Med Sci. 2025;11(1):e70182.\u003c/li\u003e\n\u003cli\u003eFayyad AF, Alzuheir IM. Peste des petits ruminants: past, present, and future scope. J Infect Dev Ctries. 2024;18(12):1837-45.\u003c/li\u003e\n\u003cli\u003eDou Y, Liang Z, Prajapati M, Zhang R, Li Y, Zhang Z. Expanding Diversity of Susceptible Hosts in Peste Des Petits Ruminants Virus Infection and Its Potential Mechanism Beyond. Front Vet Sci. 2020;7:66.\u003c/li\u003e\n\u003cli\u003eMdetele DP, Komba E, Seth MD, Misinzo G, Kock R, Jones BA. Review of Peste des Petits Ruminants Occurrence and Spread in Tanzania. Animals (Basel). 2021;11(6).\u003c/li\u003e\n\u003cli\u003eMunir M. Peste des Petits Ruminants Virus. Pathobiology and Molecular Diagnosis. 2013.\u003c/li\u003e\n\u003cli\u003eMahapatra M, Selvaraj M, Parida S. Comparison of Immunogenicity and Protective Efficacy of PPR Live Attenuated Vaccines (Nigeria 75/1 and Sungri 96) Administered by Intranasal and Subcutaneous Routes. Vaccines (Basel). 2020;8(2).\u003c/li\u003e\n\u003cli\u003ePrajapati M, Alfred N, Dou Y, Yin X, Prajapati R, Li Y, et al. Host Cellular Receptors for the Peste des Petits Ruminant Virus. Viruses. 2019;11(8).\u003c/li\u003e\n\u003cli\u003eNooruzzaman M, Akter MN, Begum JA, Begum S, Parvin R, Giasuddin M, et al. Molecular insights into peste des petits ruminants virus identified in Bangladesh between 2008 and 2020. Infect Genet Evol. 2021;96:105163.\u003c/li\u003e\n\u003cli\u003eS.C. Bodjo NN, E. Couacy-Hymann , K. Tounkara \u0026amp; A. Diallo Rinderpest and peste des petits ruminants: a century of progress and the future. World organization of animal health. 2024;2025(4 February 2025).\u003c/li\u003e\n\u003cli\u003eBenfield CTO, Legnardi M, Mayen F, Almajali A, Cinardi G, Wisser D, et al. Peste Des Petits Ruminants in the Middle East: Epidemiological Situation and Status of Control and Eradication Activities after the First Phase of the PPR Global Eradication Program (2017-2021). Animals (Basel). 2023;13(7).\u003c/li\u003e\n\u003cli\u003eBarichievy C, Sheldon R, Wacher T, Llewellyn O, Al-Mutairy M, Alagaili A. Conservation in Saudi Arabia; moving from strategy to practice. Saudi J Biol Sci. 2018;25(2):290-2.\u003c/li\u003e\n\u003cli\u003eAdedeji AJ, Milovanovic M, Dogonyaro BB, Adole JA, Samson M, Omoniwa DO, et al. Can pigs add another \u0026quot;P\u0026quot; to the PPR? Serological evidence of frequent Peste des petits ruminants infections in pigs in Nigeria. Vet Res. 2025;56(1):49.\u003c/li\u003e\n\u003cli\u003eFine AE, Pruvot M, Benfield CTO, Caron A, Cattoli G, Chardonnet P, et al. Eradication of Peste des Petits Ruminants Virus and the Wildlife-Livestock Interface. Front Vet Sci. 2020;7:50.\u003c/li\u003e\n\u003cli\u003eBanyard AC, Parida S, Batten C, Oura C, Kwiatek O, Libeau G. Global distribution of peste des petits ruminants virus and prospects for improved diagnosis and control. J Gen Virol. 2010;91(Pt 12):2885-97.\u003c/li\u003e\n\u003cli\u003eAbera* M. Review on Pest Des Petits Ruminants Virus and its Socioeconomic Impact in Small Ruminants. Journal of Biomedical Research \u0026amp; Environmental Sciences. 2023;4(10):1540-51.\u003c/li\u003e\n\u003cli\u003eGaafar BBM, Ali SA, Abd-Elrahman KA, Almofti YA. Immunoinformatics Approach for Multiepitope Vaccine Prediction from H, M, F, and N Proteins of Peste des Petits Ruminants Virus. J Immunol Res. 2019;2019:6124030.\u003c/li\u003e\n\u003cli\u003eParida S, Selvaraj M, Gubbins S, Pope R, Banyard A, Mahapatra M. Quantifying Levels of Peste Des Petits Ruminants (PPR) Virus in Excretions from Experimentally Infected Goats and Its Importance for Nascent PPR Eradication Programme. Viruses. 2019;11(3).\u003c/li\u003e\n\u003cli\u003eDundon WG, Adombi C, Diallo A, Waqas A, Otsyina HR, Arthur CT, et al. Full genome sequence of a peste des petits ruminants virus (PPRV) from Ghana. Virus Genes 2014;49:497\u0026ndash;501.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"PPRV, Morbilliviruses, Morbillivirus caprinae, Nucleocapsid gene, Lineage IV, Peste des petites ruminants, Conservation, Nubian ibex, mountain gazelle","lastPublishedDoi":"10.21203/rs.3.rs-6397316/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6397316/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cb\u003eBackground\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eMorbillivirus caprinae\u003c/em\u003e, or PPRV, is the causative agent of devastating illnesses in wild and domestic ruminants worldwide namely \u003cem\u003ePeste des petites ruminants\u003c/em\u003e (PPR). It causes mouth erosion, pneumonia, enteritis and fatality in acute cases. Saudi Arabian authorities focus on wildlife conservation considering the Kingdom's biodiversity as their natural heritage. Milestones have been achieved in this context, protecting scarce populations from ibex, gazelles, oryx and many other endangered species. PPR is endemic in Saudi Arabia causing repeated outbreaks in domestic and wild ungulates despite vaccination, threatening conservation. In this study, recurrent PPR outbreaks were detected in semi captive settings in Saudi Arabia between 2022 and 2024. Where 309 samples from different wild ruminants were sent to Weqaa central laboratory in Riyadh. The sequencing of the circulating virus in Nubian ibex and mountain gazelles was performed to investigate these outbreaks. The samples were initially screened by real time RT‒PCR then full N, P and partial F and H genes were sequenced in Nubian ibex and mountain gazelle (n\u0026thinsp;=\u0026thinsp;2).\u003c/p\u003e\u003cp\u003e\u003cb\u003eResults\u003c/b\u003e\u003c/p\u003e\u003cp\u003ePPRV was detected in 72% of the samples collected. Phylogenetic analysis revealed that the virus classified in lineage IV closer to a Turkish strain (MN657232). Compared with the used 75/1 vaccine, the field virus showed substitutions in 18 amino acids in the N protein, 9 critical amino acids in the H protein and 7 amino acids in the F protein. These numerous substitutions at critical points affect H and F 3D structures and linear epitopes, suggesting that the virus may have escaped lineage II 75/1 vaccination either partially or completely.\u003c/p\u003e\u003cp\u003e\u003cb\u003eConclusion\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe transboundary nature of PPRV and the potential role of wildlife in the spread of the virus in Saudi Arabia need to be considered. To the best of our knowledge, this report is the first to characterize PPRV genetically in wild ruminants in Saudi Arabia that needs further investigations on the protective immune response elicited in wild ruminants and atypical hosts after conventional PPR vaccination. Prober investigation of the effectivity of vaccination programs in wild and atypical hosts of PPR can could significantly influence the success of global eradication initiatives.\u003c/p\u003e","manuscriptTitle":"Sequencing of the PPR virus caused outbreaks in Nubian ibex and mountain gazelles in Saudi Arabia from 2022-2024","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-17 14:13:48","doi":"10.21203/rs.3.rs-6397316/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7ef51a99-950d-4433-90c7-87dee48863dd","owner":[],"postedDate":"August 17th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-09-24T12:53:37+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-17 14:13:48","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6397316","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6397316","identity":"rs-6397316","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00