Molecular characterization of Klebsiella pneumoniae in clinical bovine mastitis in 14 provinces in China

Molecular characterization of Klebsiella pneumoniae in clinical bovine mastitis in 14 provinces in China | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular characterization of Klebsiella pneumoniae in clinical bovine mastitis in 14 provinces in China Maierhaba Wusiman, Jiakun Zuo, Yong Yu, Zhaoyang Lv, Mengdi Wang, and 12 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3027187/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Klebsiella pneumoniae ( K. pneumoniae ) is a major common environmental pathogen which causes bovine mastitis. To investigate the epidemic of K. pneumoniae of China, 131 K. pneumoniae strains were isolated from 495 clinical mastitis milk samples from 14 provinces in China. The isolation rate of K. pneumoniae was 26.5%, and K57 was the dominant serotype (45.0%, 59/131). Nineteen (14.5%) isolates were identified as hypervirulent K. pneumoniae (hvKP) and nine of them belonged to the K57 serotype. The mrkA , entB , wabG and fimH genes were prevalent virulence genes while rmpA , magA and ycf were not found in K. pneumoniae . Furthermore, K. pneumoniae had serious drug resistance and multiple beta-lactamase genes were detected, including blaTEM , blaSHV , blaNDM , blaCTX-M , blaDHA and blaKPC . Biofilm was an important factor in bacterial resistance and persistent infection, and 77.1% isolates could form biofilm. Although acylated homoserine lactone (AHL, a Gram-negative bacterial quorum sensing signal molecule) was not confirmed among the K. pneumoniae isolates, exogenous AHLs could reduce the biofilm formation ability of the K. pneumoniae strains. In conclusion, the high rate of isolation and serious antibiotic resistance of K. pneumonia were found in this study and indicated a potential threat to public health from the food chain. AHL bovine mastitis biofilm drug resistance Klebsiella pneumoniae virulence gene Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Bovine mastitis is mainly caused by bacterial pathogens, and a great deal of human and financial resources are expended to prevent and control bovine mastitis every year (Heikkila, Liski et al. 2018 ). Klebsiella pneumoniae ( K. pneumoniae ) is one of the most common causes of clinical bovine mastitis and induces severe clinical signs (Bengoechea and Sa Pessoa 2019 ). Klebsiella pneumoniae causes a major decrease in the milk production, however, there is only a few studies on K. pneumoniae isolates from bovine mastitis cases (Grohn et al., 2004, Masse et al., 2020). K. pneumoniae is a common opportunistic bacterial pathogen within the Enterobacteriaceae and is ubiquitously found on the surface of mucosae in animals or in the environment (such as water, soil, and vegetation). Generally, K. pneumoniae infects immunocompromised individuals, causing a range of diseases, including pneumonia, bacteremia, urinary tract infection, and liver abscesses (Russo, Olson et al. 2018 , Juan, Chuang et al. 2019 , Marr and Russo 2019 , Wang, Zhao et al. 2020 ). The pathogenic mechanism of K. pneumoniae is complicated. In the course of infection, K. pneumoniae invades and survives in the host by means of a variety of virulence factors, such as capsule polysaccharide (CPS), lipopolysaccharide (LPS), fimbriae, outer membrane protein and iron acquisition (Li, Zhao et al. 2014 ). The mechanism of some K. pneumoniae strains was well investigated in human infection because of their severe multidrug resistance and hypervirulence, however, little is known about how they infect the mammary gland of dairy cows (Cheng, Zhou et al. 2021 ). Klebsiella pneumoniae is one of the important drug-resistant bacteria that gaining attention in clinical. In past decades, control of bacterial diseases in animals have become difficult as a result of the abuse of antibiotic drugs and increasing resistance (Kurittu, Khakipoor et al. 2021 ). Clinical K. pneumoniae isolates usually show high resistance in many studies and it was listed as critical on the list of first priority pathogens for research and development of new antibiotics by WHO. Furthermore, Klebsiella species are a known reservoir for antibiotic resistance genes, which can spread to other Gram-negative bacteria (Wyres and Holt 2018 ). The antibiotic resistance mechanisms of K. pneumoniae are diverse, including mutation, drug-modifying enzymes with diverse activities, and modification of cell permeability. Besides varieties of drug resistance genes, biofilm is also associated with resistance. Biofilm comprises communities of microorganisms attached to the surface of biological tissues and abiotic materials; it is composed of bacteria, extracellular polysaccharides, protein, and DNA (Rabin, Zheng et al. 2015 ). The inherent antibiotic tolerance of sessile bacteria in biofilm often leads to failure of antimicrobial treatment. The bacteria cells in biofilm may become 10–1000 times more resistant to the effects of antimicrobial agents (Mah and O'Toole 2001 ). In addition, biofilm is associated with persistent infection of bacteria. Klebsiella pneumoniae with biofilm is protected from the host immune response in part by inhibiting the proximity of antibodies and antimicrobial peptides and reducing the effects of complement and phagocytosis (Fux, Costerton et al. 2005 ). Quorum sensing (QS) is a microbial cell-to-cell communication process, dynamically regulating a variety of bacterial physiological activities. Acyl-homoserine lactones (AHLs), important autoinducers in Gram-negative bacterial QS, play an important role in biofilm formation (O'Loughlin, Miller et al. 2013 , Rabin, Zheng et al. 2015 ). In K. pneumoniae , several lactones with differently sized chains have been detected, such as N-octanoylhomoserine lactone (C8-HSL), N-3-dodecanoyl-L-homoserine lactone (C12-HSL) (Yin, Purmal et al. 2012 )d hexanoyl-homoserine lactone (C6-AHL) (Ngeow, Cheng et al. 2013 ). However, there is little study of AHLs in mastitis associated K. pneumoniae . Recently the morbidity of mastitis caused by K. pneumoniae in China has tended to increase and poses a serious threat to the dairy industry and public health (Cheng, Zhou et al. 2021 ). However, compared with other bacterial mastitis pathogens, there have been few studies on K. pneumoniae as a causative agent of bovine mastitis. Therefore, 495 mastitis milk samples in this study were collected from large dairy farms in fourteen regions of China to investigate the characteristics of K. pneumoniae , and the influence of AHL molecules (C6-HSL and 3-oxo-C6-HSL) on the biofilm of K. pneumoniae . This study provided reference material for the prevention of bovine mastitis caused by K. pneumoniae . Materials and Methods Milk samples, strains and primers From March to August 2021, 495 milk samples were collected aseptically from dairy cows with clinical mastitis on large-scale dairy farms (herd size ≥ 500) in 14 provinces of China (Fig. 1 ). All the samples were also diagnosed by obvious clinical symptoms and California Mastitis Test. For mill collection, the udders of cows were cleaned with water and dried. Cotton balls with 75% ethanol were used to disinfect the surface of the udder. The first few streams of milk were discarded and the collected milk was kept in a sterile tube. Then the milk samples were immediately sent on ice packs to the lab within 48 h. The mastitis derived isolates are listed in Additional file 1. Klebsiella pneumoniae standard strain CMCC46117, stored by our laboratory, was used as the positive control in the PCR identification of K. pneumoniae . Chromobacterium violaceum CV026, stored by our laboratory, was used to determine the production of AHLs with acyl side chain length from C6 to C14 by K. pneumoniae isolates (Viswanath, Sekar et al. 2020 ). All PCR primers used in this study were synthesized by Sangon Biotech (China) and are listed in Table 1 . Table 1 Primers used in this study Class Primers Oligonucleotide sequence (5'→3') Description of amplificated gene Product size (bp) Specific identification khe-F ATGAAACGACCTGATTGCATTCGC Used for identifying K. pneumoniae 489 khe-R TTACTTTTTCCGCGGCTTACCGTC Resistance genes KPC-F GCCGTCTAGTTCTGCTGTCT Beta-lactamases that confer resistance to carbapenem 737 KPC-R CCAGACGACGGCATAGTCAT VIM-F TCGTCATGAAAGTGCGTGGA Metallo-beta-lactamase 200 VIM-R GGTGTTTGGTCGCATATCGC NDM-F CGAATGTCTGGCAGCACACT NDM family metallo-beta-lactamase 503 NDM-R ATCACCGAGATTGCCGAGC OXA-48-F GCTTGAAAGCCAGTCCCCTA Beta-lactamases that confer resistance to carbapenem 930 OXA-48-R TGATACAGGTGGCTGCGTAC SHV-F ATCTCCCTGTTAGCCACCCT Beta-lactamases that confer resistance to carbapenem 250 SHV-R GGATCTTTCGCTCCAGCTGT CTX-M-F a TGCGGAAAAGCACGTCAATG Beta-lactamases that confer resistance to cephalosporin 506 CTX-M-R a ATACATCGCGACGGCTTTCT TEM-F GCACGAGTGGGTTACATCGA TEM-type β-lactamase 727 TEM-R GTGAGGCACCTATCTCAGCG DHA-F TAGCCTGTGCAGCTTTGACT Beta-lactamases that confer resistance to cephamycins and oxyimino-cephalosporins 997 DHA-R CAGGATATTCCCGGGATGGC Capsule serotypes K1-F GGTGCTCTTTACATCATTGC Used for identifying K1 serotype 1283 K1-R GCAATGGCCATTTGCGTTAG K2-F GACCCGATATTCATACTTGACAGAG Used for identifying K2 serotype 641 K2-R CCTGAAGTAAAATCGTAAATAGATGGC K5-F TGGTAGTGATGCTCGCGA Used for identifying K5 serotype 280 K5-R CCTGAACCCACCCCAATC K20-F CGGTGCTACAGTGCATCATT Used for identifying K20 serotype 881 K20-R GTTATACGATGCTCAGTCGC K54-F CATTAGCTCAGTGGTTGGCT Used for identifying K54 serotype 1037 K54-R GCTTGACAAACACCATAGCAG K57-F CTCAGGGCTAGAAGTGTCAT Used for identifying K57 serotype 741 K57-R CACTAACCCAGAAAGTCGAG Virulence genes uge-F GCGCACACCTATTCTCACCT Required for capsular biosynthesis 219 uge-R GATCACATCCTGCACCCGAA wabG-F CTCTGGTGCGGCAGAAGTAC Required for biosynthesis of the core lipopolysaccharide 931 wabG-R TGGCCGTCGACGATAAACTC rmpA-F ACCCTTTACAGCCAAATTTTCTTGT Regulator of mucoid phenotype 468 rmpA-R CTGGGCTACCTCTGCTTCATAT magA-F TGATAAGTGGCGGAGATTCTGA Associated with mucoviscosity-associated protein 542 magA-R TGATAAGTGGCGGAGATTCTGA wcaG-F TGGTTGGGTCAGCAATCGT Associated with capsule biosynthesis 161 wcaG-R GCCAACTTTTGCAGCAGCTAAATAT ycf-F TGGTCACGGATTATGTAACGGT Associated with capsule 524 ycf-R ACGCTATGACAGAACCTGGT fimH-F GTCTACGTTAACCTGACCCCG Type 1 fimbriae adhesion 781 fimH-R ATTGATAGACAAAGGTGATGCCGAT mrkA-F CGGCGGCCAGGTTAATTTCT Associated with type 3 fimbriae 500 mrkA-R CGTAGCTGTTAACCACACCG entB-F CTGCGCTTTGAGGAAGAGGAG Associated with iron uptake 241 entB-R GCAAGTGGTGATAACGCTGATAC iucA-F GTAAACAGCGGCTTCAGCAC Associated with aerobactin 1230 iucA-R GCCAACTAAAACGTCAGCCC iroB-F ACAACAACGCGGGCATTTAC Associated with iron uptake 217 iroB-R TCCTGCATCTTTCGGCCAAT iroN-F GAATGAAACTACCGCCCCCA Associated with iron transport 1033 iroN-R TGTGGAGTGGAGGCGAGATA kfu-F GTGCTGGCCTACTATCCGTT Associated with iron uptake 520 kfu-R TATCGATACCGCCCAGCCAC alls-F CTTCAGCAGATAAATGACGGGGTAG Associated with allantoin metabolism 244 alls-R GTGGGTAAACCGCCATATTTTCC ecpD-F ACAGCGCATCGGTCATATCC Fimbrial adhesin 1319 ecpD-R CAACTTTTTCGTCACCCCCG a Meant that the PCR primers of blaCTX-M was designed referring to the nucleotide sequence of blaCTX-M-15 which accounted for the majority of blaCTX-M genes. Isolation and identification of K. pneumoniae The clinical mastitis derived milk samples were spread on MacConkey agar with sterile cotton swabs to isolate K. pneumoniae . After overnight culture at 37℃, for the plate that was noy considered contaminated (i.e., ≥ 3 phenotypically different types of colonies on the plate), pink, moist and swollen colonies were picked with sterile inoculating loops, added to nutrient broth (Hopebio, China) and incubated at 37℃ for 6–8 h. Bacterial genomic DNA was extracted from 1 mL enrichment culture using the boiling method (Holmes and Quigley 1981 ) and used as template for PCR identification of K. pneumoniae with primers khe -F/ khe -R (Table 1 ). Genomic DNA extraction of K. pneumoniae standard strain CMCC46117 prepared in the same way was used as the positive control. The PCR reaction conditions were as follows: 10 µL 2× Mix (TaKaRa, Japan), 1 µL F/R primers, 1 µL DNA template and 7 µL ddH 2 O; the annealing temperature was 58℃ for 45 s. The PCR products were identified by 1% agarose gel electrophoresis and sent to Sangon Biotech (China) for sequencing. Positive isolation of K. pneumoniae was verified by blasting the DNA sequence of the PCR product and showing identification with K. pneumoniae ≥ 98%. In addition, all the K. pneumoniae isolates. The positive samples were used to purify K. pneumoniae as described above and, after 2 to 3 generations of consecutive plate streaking, the positive strains from PCR of khe were preserved with 25% glycerol LB at -80℃. Meanwhile, we extracted the genomes of the K. pneumoniae isolates using a TIANamp Bacteria DNA kit (TianGen, China) and stored them at -20℃. Detection of capsular serotypes and string test of K. pneumoniae isolates The capsular serotypes of K. pneumoniae isolates were determined by PCR reaction as described in previous research (Yan, Zhou et al. 2016 ). To analyze the distribution of K1, K2, K5, K20, K54 and K57 capsule serotypes in clinical mastitis derived K. pneumoniae , genomic DNA of the abovementioned saved mastitis derived K. pneumoniae isolates were used as PCR templates and six pairs of capsular serotype primers (K1, K2, K5, K20, K54 and K57) (Table 1 ) were used for determination of the capsular serotypes of the isolates. The capsular polysaccharide is an important antigenic substance in hypervirulent K. pneumoniae , conferring the characteristic of high mucilage production. The string test was performed according to previous study with some modification to verify the phenotype of K. pneumoniae (Gao et al., 2019). Briefly, K. pneumoniae strains were incubated on blood agar, and after overnight culture at 37℃, the growing K. pneumoniae was slowly lifted upward from the colony using an inoculating loop. When the length of the mucoviscous string is > 5 cm, it is defined as a positive test and the isolate is regarded as hypervirulent K. pneumoniae (hvKP). If the string length is < 5 cm, the string test is negative and the isolate is classic K. pneumoniae (cKp). Detection of virulence genes of K. pneumoniae isolates Using the extracted genomic DNA as templates, primers (Table 1 ) of lipopolysaccharide associated genes ( uge , wabG ), capsular associated genes ( rmpA , magA , wcaG , ycf ), fimbriae associated genes ( fimH , mrkA ), siderophore associated genes ( entB , kfu , iroB , iroN , iucA ), allantoin associated genes ( alls ) and extracellular products associated genes ( ecpD ) were used for amplification to analyze the distribution of several common virulence genes in mastitis derived K. pneumoniae by the PCR method, as in previous studies (Alcantar-Curiel, Blackburn et al. 2013 , Candan and Aksoz 2015 , Vuotto, Longo et al. 2017 , Russo, Olson et al. 2018 , El-Domany, Awadalla et al. 2021 ). Antimicrobial susceptibility and antibiotic resistance gene testing Minimal inhibitory concentration (MIC) of ampicillin, amoxicillin/clavulanic acid, ceftazidime, sulfisoxazole, tetracycline, florfenicol, kanamycin and ciprofloxacin of 131 K. pneumoniae isolates were determined by broth microdilution method recommended by the Clinical and Laboratory Standardization Institute (CLSI) standard M07 (2020). E. coli ATCC 25922 was used as the quality control strain. The breakpoints of ampicillin, amoxicillin/clavulanic acid, ceftazidime, sulfisoxazole and kanamycin were referred to criteria published by the CLSI (2020). And the breakpoints of tetracycline, florfenicol and ciprofloxacin were referred to the ECOFFs (epidemiological cut-off values) of the European Committee on Antimicrobial Susceptibility Testing ( https://mic.eucast.org/search/ ). Based on resistance gene data from the Antibiotic Resistance Genes Database (ARDB), specific primers for eight β-lactam antibiotic resistance genes of K. pneumoniae were designed (Table 1 ), including carbapenemase-related genes ( blaKPC , blaVIM , blaOXA-48 , blaNDM ) and cephalosporin-related genes ( blaSHV , blaCTX-M-15 , blaTEM , blaDHA ). Using the extracted genomic DNA of K. pneumoniae as the template, the distribution of β-lactam antibiotic resistance genes in K. pneumoniae isolates was determined by PCR. The PCR reaction system and conditions were used as described above. Biofilm formation assay Bacterial biofilms were measured in 96-well polyvinyl chloride (PVC) microplates using the Crystal Violet method as described previously, with some modification (Wang, Zhao et al. 2020 ). Briefly, K. pneumoniae strains were cultured overnight at 37℃, diluted 1:100 in LB; 200 µL of bacterial culture were inoculated into 96-well PVC microplates and each strain was replicated in six wells. The bacteria were cultured at 37℃ for 24 h and the contents of the wells discarded. The wells were washed with PBS three times and dried at 60℃. Biofilm was stained by 0.1% Crystal Violet for 15 min at 37℃ and the excess Crystal Violet was washed off and the wells air-dried; 200 µL of 95% ethanol was added to the wells to dissolve the Crystal Violet and the absorbance at 595 nm (OD 595 ) was measured using a Synergy 2 microplate reader (BioTek, USA) to assess the biofilm formation ability of K. pneumoniae . Wells with sterile LB were used as blank controls. The ability of K. pneumoniae to form biofilm is reflected in the optical density of the sample (OD sample , OD s ). The critical OD (OD control , OD c ) was calculated from the arithmetic mean of the absorbance of six negative controls with addition of three times the standard deviation (SD). When OD s ≤ OD c , the bacteria did not form biofilm; when OD c < OD s ≤ 2OD c , the bacteria had weak ability to form biofilm; when 2OD c 4OD c , the bacterial ability to form biofilm was strong (Xu, Liang et al. 2016 ). Screening of AHL-producing K. pneumoniae by Chromobacterium violaceum CV026 biosensor The K. pneumoniae isolates were screened for the production of AHLs with N-acyl side chains from C4 to C8 by plate assay using the bioreporter strain Chromobacterium violaceum ( C. violaceum ) CV026 on LB agar, according to the reported mothed with some modification (Viswanath, Sekar et al. 2020 ). The C. violaceum CV026 was inoculated in LB broth at 28℃ to OD600 = 0.5 and 1 mL of CV026 culture to 100 mL molten semi-solid LB agar (45℃) and poured immediately into sterile dishes to make AHL report plates. The K. pneumoniae isolates were inoculated in 5 mL LB broth at 37℃ and cultured to logarithmic stage. Subsequently, 5 µL of each bacterial culture was dropped on to the surface of AHL report plates to screen the AHL-producing K. pneumonia strains. Meanwhile, 5 µL C6-HSL (200 µM and 2 mM, Sigma-Aldrich, USA) dropped on the plates was used as a positive control. The plates were incubated at 28℃ overnight. Bacteria surrounded by purple pigmentation indicated that the strain could produce AHL which stimulated violacein synthesis by C. violaceum CV026. Influence of AHLs on biofilm formation by K. pneumoniae To study the influence of AHLs on biofilm formation by mastitis derived K. pneumoniae , non-biofilm-producers (Kp130, Kp41, Kp59), weak biofilm producers (Kp131, Kp87, Kp39), moderate biofilm producers (Kp120, Kp102, Kp21) and strong biofilm producers (Kp3, Kp15, Kp18) were selected as the subjects of a biofilm assay with/without AHLs. C6-HSL and 3-oxo-C6-HSL (Sigma-Aldrich, USA) were selected as two AHL study subjects. Briefly, bacteria were cultured to OD 600 = 0.5 in LB broth and then diluted with fresh LB medium with/without 1 µM of C6-HSL or 3-oxo-C6-HSL, respectively. The biofilm formed by each sample was determined as described above for the biofilm formation assay. Statistical analysis Statistical analyses in this study were conducted using SPSS V19.0 software. Student’s t -test was used to analyze the data and P values less than 0.05 were considered significant. Results Isolation and identification of K. Pneumoniae The K. pneumoniae grew moist and swollen pink colonies on MacConkey agar (Fig. 2 a) and a 489-bp PCR product was amplified from the positive K. pneumoniae strains with primers khe -F/ khe -F (Fig. 2 b); 131 K. pneumoniae strains, named Kp1–131, were listed in Supplementary table 1 , were isolated from 495 clinical mastitis milk samples and the total isolation rate was 26.5%. The isolation rates of K. pneumoniae in different provinces ranged from 0.0–70.6% (Fig. 2 c). Among them, the rate from Beijing was highest (70.6%), followed by Zhejiang (60.0%), Anhui province (59.1%) and Tianjin province (44.4%), respectively, which indicates a high prevalence of K. pneumoniae in these regions. Although nearly half of the isolations (49.6%) were from Hebei and Jiangsu provinces, the isolation rates were only close to the average level. The majority of isolation rates from different provinces were between 14.3% and 24.8%. No K. pneumoniae strain was isolated from Fujian and Henan provinces, but very few milk samples were collected from these provinces. Capsular serotypes of K. pneumoniae isolates The specific capsule serotypes of 131 K. pneumoniae strains are listed in Supplementary table 1 . There were 59 isolates (45.0%) belonging to the K57 serotype, 6 isolates (4.6%) belonging to the K20 serotype, and 2 (1.5%) isolates belonging to the K5 serotype. No isolates of K1, K2 and K54 serotype strains were found among 131 mastitis derived K. pneumoniae . In addition, the serotypes of 64 isolates (48.9%) were regarded as other serotypes because no PCR products of the above serotypes were detected (Fig. 3 a). There was also a regional difference in the distribution of the K57 serotype. Apart from several areas with a few isolates, including Fujian, Henan, Gansu and Yunnan provinces, the rate of isolation of K57 was greatest in Anhui (61.5%, 8/13), and lowest in Beijing (8.3%, 1/12) (Fig. 3 b). String test The mucinous phenotype detected by a string test was used to investigate the pathogenesis of K. pneumoniae . Among the 131 K. pneumoniae isolates, 19 stains from six provinces were identified as hypervirulent K. pneumoniae (hvKp) with a length of mucoviscous string > 5 cm, accounting for 14.5%. The other 112 strains were identified as classic K. pneumoniae (cKp), accounting for 85.5%. The distribution of hvKp in eight provinces is shown in Fig. 4 . Compared with other provinces, the isolation rate of hvKp from Guangdong province was highest (50.0%, 1/2), following by Ningxia province (44.4%, 4/9). Analysis of antimicrobial susceptibility profiles and antibiotic resistance genes The K. pneumoniae isolates exhibited serious drug resistance to seven classes of antibiotics and terrible multiple-drug resistance (MDR) (Tables 2 and 3 ). The isolates showed complete resistant to amoxicillin and erythromycin. The isolates also showed high resistance to sulfisoxazole (98.5%) and florfenicol (97.7%). The combination of amoxicillin and clavulanic acid significantly decreased the resistance rate of K. pneumoniae (52.7%). For cephalosporin antibiotics, 20.6% of K. pneumoniae isolates were resistant to ceftazidime. The isolates also showed varying degrees of resistance to the other common antibiotics used in livestock, including tetracycline (48.1%), kanamycin (25.2%) and cotrimoxazole (51.1%). Except amoxicillin and erythromycin, 76.4% (99/131) of the strains were resistant to two more kinds of antimicrobial agents (Table 3 ). Table 2 Antimicrobial susceptibility profiles of K. pneumoniae isolates Antibiotic class Drug Agents Breakpoints (S I R of CLSI or ECOFF, mg/liter) Percentage of Susceptible Strains (S, %) Percentage of Intermediate Strains (I, %) Percentage of Resistant Strains (R, %) β-Lactams Ampicillin a ≤ 8 16 ≥ 32 0 (0/131) 0.0 (0/131) 100.0 (131/131) Amoxicillin/clavulanic acid a ≤ 4 8 ≥ 16 6.9 (9/131) 40.4 (53/131) 52.7 (69/131) Ceftazidime a ≤ 4 8 ≥ 16 77.9 (102/131) 1.5 (2/131) 20.6 (27/131) Macrolides Erythromycin a ≤ 16 32 ≥ 64 0.0 (0/131) 0.0 (0/131) 100.0 (128/131) Sulfonamides Sulfisoxazole a ≤ 256 ≥ 512 1.5 (2/131) - 98.5 (129/131) Tetracyclines Tetracycline b 8 51.9 (68/131) - 48.1 (63/131) Phenicols Florfenicol b 8 2.3 (3/131) - 97.7 (128/131) Aminoglycosides Kanamycin a ≤ 16 32 ≥ 64 64.9 (85/131) 9.9 (13/131) 25.2 (33/131) Fluoroquinolones Ciprofloxacin b 0.125 48.9 (64/131) - 51.1 (67/131) a refer to the criteria published by the Clinical and Laboratory Standards Institute (CLSI, 2020). b refer to the ECOFFs (epidemiological cut-off values) of the European Committee on Antimicrobial Susceptibility Testing ( https://mic.eucast.org/search/ ). Table 3 The multiple-drug resistance (MDR) of 131 Kp isolates Strains Multiple of drug resistance Number of strains Percentage of total strains (%) Kp (55, 72, 83, 89, 91, 102, 112, 117, 120, 121) 9 10 7.6 Kp (11, 12, 14, 17, 33, 61, 74, 90, 92, 94, 99, 104, 107, 126, 110, 126) 8 16 12.2 Kp (1, 4, 5, 8, 9, 10, 49, 50, 53, 54, 56, 57, 69, 70, 79, 98, 103, 119, 129, 130) 7 20 15.3 Kp (2, 7, 15, 18, 19, 20, 25, 32, 34, 46, 47, 58, 65, 68, 71, 75, 77, 84, 88, 93, 100, 105, 106, 109, 111, 118, 124) 6 27 20.6 Kp (3, 6, 13, 16, 35, 36, 37, 38, 39, 40, 45, 51, 52, 62, 63, 67, 73, 76, 78, 80, 85, 96, 101, 108, 123, 131) 5 27 20.6 Kp (21, 22, 23, 24, 26, 27, 28, ,29, 30, 31, 41, 42, 43, 44, 48, 59, 60, 66, 81, 82, 86, 95, 97, 113, 114, 115, 116, 122, 127) 4 29 22.1 Kp (125, 128) 3 2 1.5 According to the PCR results for β-lactam antibiotic resistance genes, blaVIM and blaOXA-48 were not detected in the isolates. (Fig. 5 a). The detection rates of blaKPC , blaNDM , blaSHV , blaCTX-M , blaTEM , and blaDHA were 0.8% (1/131), 32.1% (42/131), 56.5% (74/131), 15.3% (20/131), 71.0% (93/131) and 4.6% (6/131), respectively (Fig. 5 b). Distribution of virulence genes Twelve virulence genes, mrkA , entB , wabG , fimH , ecpD , kfu , uge , iroN , wcaG , iucA , iroB , and alls , could be amplified from the mastitis derived K. pneumoniae isolates while rmpA , magA and ycf were not detected by the PCR method (Fig. 6 a). The K. pneumoniae isolates carried varying numbers of virulence genes, ranging from 1 − 8. Bacteria simultaneously carrying six virulence genes accounted for the highest proportion of K. pneumoniae isolates (26.7%, 35/131) (Fig. 6 b). Diverse rates of virulence genes were detected in this study. Among them, mrkA (93.1%, 122/131), entB (70.2%, 92/131), wabG (64.1%, 84/131), and fimH (61.1%, 80/131) were more prevalent in K. pneumoniae isolates, while iucA (9.9%, 13/131), iroB (8.4%, 11/131), and alls (2.3%, 3/131) were less commonly found in the isolates (Fig. 6 c). Biofilm formation The ODc calculated in this study was 0.38 and the biofilm formation abilities of the 131 K. pneumoniae isolates are shown in Fig. 7 . It was found that 77.10% of the K. pneumoniae isolates could form biofilm (ODs > 0.38) while 22.90% (30/131) did not form biofilm(ODs ≤ 0.38). Among the biofilm–forming strains, 46 isolates (35.1%) had weak ability to form biofilm (0.38 < ODs ≤ 0.76), 31 strains (23.7%) had moderate ability to form biofilm (0.76 1.52. Detection of AHLs of K. pneumoniae isolates CV026 is sensitive to the AHLs with N-acyl-side chains from C4 to C8 and the commercial C6-HSL induced the production of purple pigment by CV026 on the surface of AHL report plates (Fig. 8 ). However, based on the results from the 131 K. pneumoniae isolates on the surface of AHL report plates, no strain displayed purple pigmentation, which indicated that the cow mastitis derived K. pneumoniae did not produce AHLs with N-acyl-side chains from C4 to C8 (Fig. 8 a). Influence of AHLs on biofilm formation Biofilms of K. pneumoniae isolates with/without AHLs are shown in Fig. 8 and Table 4 . For the isolates (Kp130, Kp41, Kp59) that did not form biofilm, the AHLs did not influence the biofilm formation ability of K. pneumoniae (Fig. 8 b). For the isolates that had weak ability to form biofilm (Kp131, Kp87, Kp39), only 3-oxo-C6-HSL significantly decreased the biofilm formation of Kp131 ( P < 0.01) while C6-HSL did not. There was also no significant difference between the LB groups and the AHL-adding groups of the other two strains (Fig. 8 c). However, for the isolates with medium (Kp120, Kp102, Kp21, Fig. 8 d) and strong (Kp3, Kp15, Kp18, Fig. 8 e) biofilm-formation, the biofilm formation abilities of the isolates declined significantly after the addition of C6-HSL or 3-oxo-C6-HSL ( P < 0.05). Table 4 Influence of AHLs on biofilm formation of K. pneumoniae Strains Biofilm in LB (OD 595 ) Biofilm in LB with 1 µM C6-HSL (OD 595 ) Biofilm in LB with 1 µM 3-oxo-C6-HSL (OD 595 ) P value (LB with C6-HSL VS LB) P value (LB with 3-oxo-C6-HSL VS LB) No biofilm producer Kp130 0.294 ± 0.021 0.283 ± 0.035 0.268 ± 0.027 P > 0.05 P > 0.05 Kp41 0.277 ± 0.047 0.258 ± 0.047 0.247 ± 0.048 P > 0.05 P > 0.05 Kp59 0.296 ± 0.026 0.29 ± 0.019 0.28 ± 0.024 P > 0.05 P > 0.05 Weak biofilm producer Kp131 0.538 ± 0.06 0.454 ± 0.064 0.387 ± 0.059 P > 0.05 P 0.05 P > 0.05 Kp39 0.55 ± 0.114 0.502 ± 0.071 0.451 ± 0.042 P > 0.05 P > 0.05 Moderate biofilm producer Kp120, 1.276 ± 0.182 1.012 ± 0.176 1.067 ± 0.174 P < 0.01 P < 0.05 Kp102 1.273 ± 0.163 1.039 ± 0.175 1.026 ± 0.151 P < 0.05 P < 0.01 Kp21 1.367 ± 0.12 1.055 ± 0.144 1.084 ± 0.059 P < 0.01 P < 0.01 Strong biofilm producer Kp3 2.066 ± 0.197 1.753 ± 0.152 1.673 ± 0.195 P < 0.01 P < 0.01 Kp15 2.086 ± 0.174 1.682 ± 0.176 1.76 ± 0.272 P < 0.001 P < 0.05 Kp18 2.295 ± 0.274 1.963 ± 0.119 1.921 ± 0.254 P < 0.001 P < 0.01 Discussion As an opportunistic pathogenic bacterium, K. pneumoniae is ubiquitous in the environment of dairy farms and causes intramammary infection of dairy cows. In this study, the total isolation rate of K. pneumoniae from 14 provinces was about 26.6%. The present study showed that K. pneumoniae has become an important cause of dairy cattle mastitis in China. In order to accomplish infection in host animals or humans, K. pneumoniae must break through the physical and immune barriers via a series of virulence factors. Capsule polysaccharide (CPS) used to be recognized as the most important virulence factor in K. pneumoniae . This is because the presence of a thick capsule at the cell surface could prevent K. pneumoniae from opsonization and phagocytosis by leukomonocytes, which results in host immune deficiency (Li, Zhao et al. 2014 ). Although at least 78 capsule (K antigen) serotypes have been found in K. pneumoniae , it was not well studied in the past. Six capsule serotypes (K1, K2, K5, K54, K57 and K20) which are highly associated with pathogenicity in humans (Yan, Zhou et al. 2016 ) were selected to detect K. pneumoniae isolated in this study. Compared with the other K-types, K57 was obviously a major serotype of cow mastitis derived K. pneumoniae strains, as was identified in a previous study in China that showed a high detection rate in K. pneumoniae isolated from dairy cow mastitis (Cheng, Zhou et al. 2021 ). Considering that the K antigen is an important potential antigen for vaccines, the K57 capsule has the potential for inclusion in subunit vaccines for prevention of bovine mastitis caused by K. pneumoniae (Lin, Yang et al. 2022 ). In addition, it will need further study for capsule serotypes of K. pneumoniae isolates to better understand what the role of K. pneumoniae capsule plays in bovine mastitis. The degree of mucus production by K. pneumoniae strains is likely to correlate positively with invasion and infection (Lin, Lu et al. 2011 ). In K. pneumoniae of human origin, HMV strains were usually considered more virulent than non-HMV strains. However, in K. pneumoniae of bovine mastitis origin, it lacked of strong evidence for the association of HMV phenotype and severe mastitis (Gao et al., 2019). Although several capsule serotypes are usually reported to be associated with the pathogenicity of K. pneumoniae strains, some (10/19) of the K. pneumoniae were not classified to these capsule serotypes in this study. This may be because the hypermucoviscous (HMV) phenotype of K. pneumoniae is due to the hypersecretion of polysaccharides which are exopolysaccharides rather than capsule polysaccharides (Li, Zhao et al. 2014 ). Furthermore, the mucovisosity-associated gene A ( magA ) and regulator of mucoid phenotype ( rmpA ) have been associated with HMV colony phenotype. However, neither magA nor rmpA was found in this study, and this might be the reason that these two mucoid phenotype-associated genes are often present in the K. pneumoniae strains of K1 or K2 serotype from human patients (Chang, Bastian et al. 2013 ). The virulence of K. pneumoniae may be caused by other virulence factors, such as LPS, adhesion molecules, and iron-absorbing systems (Wang, Zhao et al. 2020 ). In this study, some high prevalence virulence genes were also identified in K. pneumoniae , such as fimH , mrkA , wabG and entB . The prevalence of fimH indicates that adherence of K. pneumoniae to bovine mammary epithelial cells might rely on type 1 fimbriae, which mediate bacterial adhesion to host cells (Stahlhut, Chattopadhyay et al. 2009 ). Another adhesion gene, mrkA , which is associated with type 3 fimbriae, could contribute to biofilm formation by K. pneumoniae , which makes it difficult to eliminate by bovine immune cells (Vuotto, Longo et al. 2017 ). WabG is involved in the biosynthesis of the core lipopolysaccharide whose mutation reduced K. pneumoniae pathogenicity and colonization ability in experimental urinary tract infections of rats (Izquierdo, Coderch et al. 2003 ). In addition, it seemed that wabG was more prevalent in the isolates of known capsule serotype (K5, K20, K57) than in the isolates of unknown serotype in Supplementary Fig. 1. The ability to obtain iron is critical for bacterial survival, and there are four siderophores (enterobactin, yersinabactin, salmochelin and aerobactin) in K. pneumoniae . In this study, the prevalence of entB (encoding enterobactin) was higher than that of the other iron absorbing genes in K. pneumoniae isolates from bovine mastitis. The results of this study are consistent with recent research in which entB was more prevalent in K. pneumoniae isolates from clinical mastitis than from subclinical mastitis (Cheng, Zhou et al. 2021 ). There is growing concern regarding antibiotic resistance in K. pneumoniae from bovine mastitis, which is leading to the emergence of more resistant bacteria. In this study, none of the isolates were susceptible to all selected antimicrobial agents, which might be caused by the overuse of antibiotics on some dairy farms. According to the antimicrobial result, the K. pneumoniae isolates showed high resistant to β-lactam antibiotics. Among the resistance mechanisms of β-lactam antibiotics, the expression of β-lactamase enzymes is one of the most studied and prevalent (Lima et al., 2020). By detecting eight common beta-lactam resistance genes, it was shown that the K. pneumoniae isolates carried multiple beta-lactam resistance genes, including blaTEM , blaSHV , blaCTX-M , blaDHA and blaNDM , which accounted for the high rate of resistance to beta-lactam antibiotics. The vim gene was not found in the K. pneumoniae isolates. This was because VIM-type carbapenemase mostly occurred in P. aeruginosa and P. putida but very rarely in Enterobacteriaceae . However, some resistance genotypes may not completely represent the phenotype; further studies are needed to establish the connections between them. Biofilm plays an important role in antibiotic resistance. There are multiple mechanisms of biofilm resistance, such as changing the penetrability of drug agents, slowing growth, and activating the general stress response (Mah and O'Toole 2001 ). The present results showed by crystal staining that most K. pneumoniae isolates could form biofilm in vitro . In a biofilm study of K. pneumoniae strains collected from human patients, wcaG was found to be associated with bacterial biofilm formation (Zheng, Lin et al. 2018 ). However, in this study, only 16.8% of the mastitis derived K. pneumoniae isolate s had wcaG , and the proportion of weak biofilm producers containing wcaG was higher than that of moderate or strong biofilm isolates (Supplementary Fig. 2). This might be explained by several possible factors. One potential explanation was that there was a difference between the K. pneumoniae isolates of human and cows. Another possibility was that the biofilm of K. pneumoniae was mediated by a variety of factors, such as type 3 pili, capsular polysaccharides (Clegg and Murphy 2016 ), outer membrane protein (Saurel, Iordanov et al. 2017 ) and c-di-GMP (Schumacher and Zeng 2016 ). In addition, quorum sensing plays an important role in mediating bacterial biofilm formation and resistance and provides a novel strategy for preventing infection with bacterial pathogens (Sikdar and Elias 2020 ). AHL is an important quorum sensing molecule in Gram-negative bacteria that participates in mediating multiple bacterial physiological activities, including biofilm, drug resistance, virulence factor production, etc. (Mukherjee and Bassler 2019 ). In Pseudomonas aeruginosa , a kind of QS inhibitor that interacts with LasR, RhlR, was shown to inhibit both the production of the virulence factor pyocyanin and biofilm formation (O'Loughlin, Miller et al. 2013 ). Although some AHL-producing K. pneumoniae strains have been found in humans, poultry and the environment (Yin, Purmal et al. 2012 , Hosny and Fadel 2021 ), no AHL molecules were found in K. pneumoniae in this study using the AHL biosensor reporter strain C. violaceum CV026. One possible reason may be that this method was limited because the CviR of CV026 only respond to the AHLs with acyl side chain length from C4 to C8 (McClean, Winson et al. 1997 ). Considering the potential of mixed infection of K. pneumoniae with other bacteria and the diversity of udder microbiota, the present study analyzed the effect of AHL on the biofilm formation abilities of mastitis derived K. pneumoniae strains. The results showed that AHLs could influence biofilm formation by some K. pneumoniae strains with strong and intermediate biofilm formation abilities. However, the action of AHLs was opposite to that of Pseudomonas aeruginosa (O'Loughlin, Miller et al. 2013 ), and the addition of exogenous C6-HSL or 3-oxo-C6-HSL decreased the ability of K. pneumoniae to form biofilm. As the regulatory mechanisms in bacteria, and especially those in the host, are complicated, the specific function of AHL for K. pneumoniae needs more investigation. Declarations Authors’ contributions XH, WC and JM participated in the design of the study. MW, ZL, MD and LN performed the experiments and analyzed the data. JZ and MW prepared the manuscript. YY and ZP contributed the mastitis materials. XZ, JW, HY, CH and WZ contributed reagents and analysis tools. XH, JW, ZC and WC revised the manuscript. All authors read and approved the final manuscript. Acknowledgements This work was supported by Key Project of Inter-Governmental International Scientific and Technological Innovation Cooperation (Grant No.2018YFE0102200), Shanghai Agriculture Applied Technology Development Program (Grant No. 2020-02-08-00-08-F01489), Priority Academic Program Development of Jiangsu Higher Education Institutions and Key Scientific and Technological Project of XPCC (Grant No. 2020AB025) and Research Foundation for Advanced Talents of Longyan University (Grant No. 2021ZN001). Data availability All data generated or analyzed during this study are included in this manuscript. Competing interests The authors declare that they have no competing interests. Ethical approval This study does not contain any experiments with human participants or animals. References Alcantar-Curiel MD, Blackburn D, Saldana Z, Gayosso-Vazquez C, Iovine NM, M. A. De la Cruz and J. A., Giron (2013) Multi-functional analysis of Klebsiella pneumoniae fimbrial types in adherence and biofilm formation. Virulence 4(2): 129 – 38.10.4161/viru.22974 Bengoechea JA, Sa Pessoa J (2019) Klebsiella pneumoniae infection biology: living to counteract host defences. FEMS Microbiol Rev 43(2): 123 – 44.10.1093/femsre/fuy043 Candan ED, Aksoz N (2015) Klebsiella pneumoniae : characteristics of carbapenem resistance and virulence factors. Acta Biochim Pol 62(4): 867 – 74.10.18388/abp.2015_1148 Chang L, Bastian I, Warner M (2013) Survey of Klebsiella pneumoniae bacteraemia in two South Australian hospitals and detection of hypermucoviscous phenotype and magA / rmpA genotypes in K. pneumoniae isolates. Infection 41(2): 559 – 63.10.1007/s15010-012-0374-y Cheng J, Zhou M, Nobrega DB, Cao Z, Yang J, Zhu C, Han B, Gao J (2021) Virulence profiles of Klebsiella pneumoniae isolated from 2 large dairy farms in China. J Dairy Sci 104(8): 9027 – 36.10.3168/jds.2020–20042 Clegg S, Murphy CN (2016) Epidemiology and Virulence of Klebsiella pneumoniae . Microbiol Spectr 4(1).10.1128/microbiolspec.UTI-0005-2012 El-Domany RA, Awadalla OA, Shabana SA, El-Dardir MA, Emara M (2021) Analysis of the correlation between antibiotic resistance patterns and virulence determinants in pathogenic Klebsiella pneumoniae isolates from Egypt. Microb Drug Resist 27(6): 727 – 39.10.1089/mdr.2020.0236 Fux CA, Costerton JW, Stewart PS, Stoodley P (2005) Survival strategies of infectious biofilms. Trends Microbiol 13(1): 34-40.10.1016/j.tim.2004.11.010 Heikkila AM, Liski E, Pyorala S, Taponen S (2018) Pathogen-specific production losses in bovine mastitis. J Dairy Sci 101(10): 9493 – 504.10.3168/jds.2018–14824 Holmes DS, Quigley M (1981) A rapid boiling method for the preparation of bacterial plasmids. Anal Biochem 114(1): 193 – 7.10.1016/0003-2697(81)90473-5 Hosny RA, Fadel MA (2021) Detection of quorum sensing N-acyl-homoserine lactone molecules produced by different resistant Klebsiella pneumoniae isolates recovered from poultry and different environmental niches. Appl Biochem Biotechnol 193(10): 3351 – 70.10.1007/s12010-021-03605-w Izquierdo L, Coderch N, Pique N, Bedini E, Corsaro MM, Merino S, Fresno S, Tomas JM, Regue M (2003) The Klebsiella pneumoniae wabG gene: role in biosynthesis of the core lipopolysaccharide and virulence. J Bacteriol 185(24): 7213 – 21.10.1128/JB.185.24.7213-7221.2003 Juan CH, Chuang C, Chen CH, Li L, Lin YT (2019) Clinical characteristics, antimicrobial resistance and capsular types of community-acquired, healthcare-associated, and nosocomial Klebsiella pneumoniae bacteremia. Antimicrob Resist Infect Control 8: 1.10.1186/s13756-018-0426-x Kurittu P, Khakipoor B, Aarnio M, Nykasenoja S, Brouwer M, Myllyniemi AL, Vatunen E, Heikinheimo A (2021) Plasmid-borne and chromosomal ESBL/AmpC genes in Escherichia coli and Klebsiella pneumoniae in global food products. Front Microbiol 12: 592291.10.3389/fmicb.2021.592291 Li B, Zhao Y, Liu C, Chen Z, Zhou D (2014) Molecular pathogenesis of Klebsiella pneumoniae . Future Microbiol 9(9): 1071 – 81.10.2217/fmb.14.48 Lin TL, Yang FL, Ren CT, Pan YJ, Liao KS, Tu IF, Chang YP, Cheng YY, Wu CY, Wu SH, Wang JT (2022) Development of Klebsiella pneumoniae capsule polysaccharide-conjugated vaccine candidates using phage depolymerases. Front Immunol 13: 843183.10.3389/fimmu.2022.843183 Lin YC, Lu MC, Tang HL, Liu HC, Chen CH, Liu KS, Lin C, Chiou CS, Chiang MK, Chen CM, Lai YC (2011) Assessment of hypermucoviscosity as a virulence factor for experimental Klebsiella pneumoniae infections: comparative virulence analysis with hypermucoviscosity-negative strain. BMC Microbiol 11: 50.10.1186/1471-2180-11-50 Mah TF, O'Toole GA (2001) Mechanisms of biofilm resistance to antimicrobial agents. Trends Microbiol 9(1): 34 – 9.10.1016/s0966-842x(00)01913-2 Marr CM, Russo TA (2019) Hypervirulent Klebsiella pneumoniae : a new public health threat. Expert Rev Anti Infect Ther 17(2): 71-73.10.1080/14787210.2019.1555470 McClean KH, Winson MK, Fish L, Taylor A, Chhabra SR, Camara M, Daykin M, Lamb JH, Swift S, Bycroft BW, Stewart G, Williams P (1997) Quorum sensing and chromobacterium violaceum: exploitation of violacein production and inhibition for the detection of N-acylhomoserine lactones. Microbiology (Reading) 143 (Pt 12): 3703 – 11.10.1099/00221287-143-12-3703 Mukherjee S, Bassler BL (2019) Bacterial quorum sensing in complex and dynamically changing environments. Nat Rev Microbiol 17(6): 371 – 82.10.1038/s41579-019-0186-5 Ngeow YF, Cheng HJ, Chen JW, Yin WF, Chan KG (2013) Short chain N-acylhomoserine lactone production by clinical multidrug resistant Klebsiella pneumoniae strain CSG20. Sensors (Basel) 13(11): 15242 – 51.10.3390/s131115242 O'Loughlin CT, Miller LC, Siryaporn A, Drescher K, Semmelhack MF, Bassler BL (2013) A quorum-sensing inhibitor blocks Pseudomonas aeruginosa virulence and biofilm formation. Proc Natl Acad Sci U S A 110(44): 17981-6.10.1073/pnas.1316981110 Rabin N, Zheng Y, Opoku-Temeng C, Du Y, Bonsu E, Sintim HO (2015) Biofilm formation mechanisms and targets for developing antibiofilm agents. Future Med Chem 7(4): 493-512.10.4155/fmc.15.6 Russo TA, Olson R, Fang CT, Stoesser N, Miller M, MacDonald U, Hutson A, Barker JH, La Hoz RM, Johnson JR (2018) Identification of biomarkers for differentiation of hypervirulent Klebsiella pneumoniae from Classical K. pneumoniae . J Clin Microbiol 56(9).10.1128/JCM.00776 – 18 Saurel O, Iordanov I, Nars G, Demange P, Le Marchand T, Andreas LB, Pintacuda G, Milon A (2017) Local and Global Dynamics in Klebsiella pneumoniae Outer Membrane Protein a in Lipid Bilayers Probed at Atomic Resolution. J Am Chem Soc 139(4): 1590 – 97.10.1021/jacs.6b11565 Schumacher MA, Zeng W (2016) Structures of the activator of K. pneumonia biofilm formation, MrkH, indicates PilZ domains involved in c-di-GMP and DNA binding. Proc Natl Acad Sci U S A 113(36): 10067 – 72.10.1073/pnas.1607503113 Sikdar R, Elias M (2020) Quorum quenching enzymes and their effects on virulence, biofilm, and microbiomes: a review of recent advances. Expert Rev Anti Infect Ther 18(12): 1221 – 33.10.1080/14787210.2020.1794815 Stahlhut SG, Chattopadhyay S, Struve C, Weissman SJ, Aprikian P, Libby SJ, Fang FC, K. A., Krogfelt, Sokurenko EV (2009) Population variability of the FimH type 1 fimbrial adhesin in Klebsiella pneumoniae . J Bacteriol 191(6): 1941 – 50.10.1128/JB.00601-08 Viswanath G, Sekar J, Ramalingam PV (2020) Detection of diverse n-acyl homoserine lactone signalling molecules among bacteria associated with rice rhizosphere. Curr Microbiol 77(11): 3480 – 91.10.1007/s00284-020-02183-0 Vuotto C, Longo F, Pascolini C, Donelli G, Balice MP, Libori MF, Tiracchia V, Salvia A, Varaldo PE (2017) Biofilm formation and antibiotic resistance in Klebsiella pneumoniae urinary strains. J Appl Microbiol 123(4): 1003 – 18.10.1111/jam.13533 Wang G, Zhao G, Chao X, Xie L, Wang H (2020) The characteristic of virulence, biofilm and antibiotic resistance of Klebsiella pneumoniae . Int J Environ Res Public Health 17(17).10.3390/ijerph17176278 Wayne P (2020) Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. 11th ed. CLSI standard M07, Clinical and Laboratory Standards Institute Wyres KL, Holt KE (2018) Klebsiella pneumoniae as a key trafficker of drug resistance genes from environmental to clinically important bacteria. Curr Opin Microbiol 45: 131 – 39.10.1016/j.mib.2018.04.004 Xu Z, Liang Y, Lin S, Chen D, Li B, Li L, Deng Y (2016) Crystal violet and XTT assays on Staphylococcus aureus biofilm quantification. Curr Microbiol 73(4): 474 – 82.10.1007/s00284-016-1081-1 Yan Q, Zhou M, Zou M, Liu WE (2016) Hypervirulent Klebsiella pneumoniae induced ventilator-associated pneumonia in mechanically ventilated patients in China. Eur J Clin Microbiol Infect Dis 35(3): 387 – 96.10.1007/s10096-015-2551-2 Yin WF, Purmal K, Chin S, Chan XY, Koh CL, Sam CK, Chan KG (2012) N-acyl homoserine lactone production by Klebsiella pneumoniae isolated from human tongue surface. Sensors (Basel) 12(3): 3472 – 83.10.3390/s120303472 Zheng JX, Lin ZW, Chen C, Chen Z, Lin FJ, Wu Y, Yang SY, Sun X, Yao WM, Li DY, Yu ZJ, Jin JL, Qu D, Deng QW (2018) Biofilm formation in Klebsiella pneumoniae bacteremia strains was found to be associated with CC23 and the presence of wcaG . Front Cell Infect Microbiol 8: 21.10.3389/fcimb.2018.00021 Additional Declarations No competing interests reported. Supplementary Files Supplementaryfigure1.docx Supplementary figure 1. Distribution of genes in K. pneumoniae isolates according to capsule serotypes a. Distribution of hvKP isolated and cKp (blue indicates hvKp and yellow indicated cKp). b: Distribution of β-lactamase genes and virulence genes in each K. pneumoniae isolate (white represented the absence of related genes and red indicated the presence of related genes). Supplementaryfigure2.docx Supplementary figure 2. Distribution of genes in K. pneumoniae isolates according to biofilm formation capacity a. Distribution of hvKP isolates and cKp (blue indicated hvKp and yellow indicated cKp). b: Distribution of β-lactamase genes and virulence genes in each K. pneumoniae isolate (white represented the absence of related genes and red indicated the presence of related genes; NBF, WBF, MBF and SBF represented no, weak, moderate and strong biofilm producers, respectively). Supplementarytable1.docx Supplementary table 1. Specific information of 131 isolates of K. pneumoniae Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3027187","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":207331947,"identity":"8e74ac81-6992-4dc3-b17b-47fc05ccadb4","order_by":0,"name":"Maierhaba Wusiman","email":"","orcid":"","institution":"Tarim University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Maierhaba","middleName":"","lastName":"Wusiman","suffix":""},{"id":207331948,"identity":"37c64246-805d-44c0-8265-02707dc6516a","order_by":1,"name":"Jiakun Zuo","email":"","orcid":"","institution":"Nanjing Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jiakun","middleName":"","lastName":"Zuo","suffix":""},{"id":207331949,"identity":"25ae14a1-e09c-4133-8164-ffe8af786c4b","order_by":2,"name":"Yong Yu","email":"","orcid":"","institution":"Nanjing Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Yu","suffix":""},{"id":207331950,"identity":"cda2b8f9-47c5-45d1-a5ce-05dd09f1fe36","order_by":3,"name":"Zhaoyang Lv","email":"","orcid":"","institution":"Tarim University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhaoyang","middleName":"","lastName":"Lv","suffix":""},{"id":207331951,"identity":"00c171ee-7fbb-4751-bd64-7e009f31bd40","order_by":4,"name":"Mengdi Wang","email":"","orcid":"","institution":"Shanghai Veterinary Research Institute, the Chinese Academy of Agricultural Sciences (CAAS)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mengdi","middleName":"","lastName":"Wang","suffix":""},{"id":207331952,"identity":"5ceb6df8-3133-49fd-9388-f1672f38e0f9","order_by":5,"name":"Lianhua Nie","email":"","orcid":"","institution":"Shanghai Veterinary Research Institute, the Chinese Academy of Agricultural Sciences (CAAS)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Lianhua","middleName":"","lastName":"Nie","suffix":""},{"id":207331953,"identity":"b62ab781-faf5-4a69-ac48-d8597394b5d5","order_by":6,"name":"Xiuping Zhang","email":"","orcid":"","institution":"Tarim University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiuping","middleName":"","lastName":"Zhang","suffix":""},{"id":207331954,"identity":"8a8c337f-946e-4c25-9a4b-062471e9539f","order_by":7,"name":"Jing Wu","email":"","orcid":"","institution":"Tarim University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Wu","suffix":""},{"id":207331955,"identity":"3cee5b48-ffb6-4b96-9afd-a88ff04cca1c","order_by":8,"name":"Wei Jiang","email":"","orcid":"","institution":"Shanghai Veterinary Research Institute, the Chinese Academy of Agricultural Sciences (CAAS)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Jiang","suffix":""},{"id":207331956,"identity":"0a9176e7-e0de-493b-9660-840901cace5c","order_by":9,"name":"Zihao Pan","email":"","orcid":"","institution":"Nanjing Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zihao","middleName":"","lastName":"Pan","suffix":""},{"id":207331957,"identity":"639d24ca-8be1-4062-a6b9-6ea3e00d0a2b","order_by":10,"name":"Wei Zhang","email":"","orcid":"","institution":"Nanjing Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Zhang","suffix":""},{"id":207331958,"identity":"4af0f6a2-c2c8-4584-b32d-ab2fa5d8b893","order_by":11,"name":"Huifang Yin","email":"","orcid":"","institution":"Longyan University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Huifang","middleName":"","lastName":"Yin","suffix":""},{"id":207331959,"identity":"4b1b08b3-4a68-4e62-a11f-f74408724ebe","order_by":12,"name":"Cuiqin Huang","email":"","orcid":"","institution":"Longyan University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Cuiqin","middleName":"","lastName":"Huang","suffix":""},{"id":207331960,"identity":"8d06e113-43bd-4eb7-820a-7c2b47f5e837","order_by":13,"name":"Zhaoguo Chen","email":"","orcid":"","institution":"Shanghai Veterinary Research Institute, the Chinese Academy of Agricultural Sciences (CAAS)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhaoguo","middleName":"","lastName":"Chen","suffix":""},{"id":207331961,"identity":"5db5cbe2-5843-4092-883a-6d4f92f92419","order_by":14,"name":"Jinfeng Miao","email":"","orcid":"","institution":"Nanjing Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jinfeng","middleName":"","lastName":"Miao","suffix":""},{"id":207331962,"identity":"f2748314-8184-4121-af9d-e57cea5977e6","order_by":15,"name":"Wei Chen","email":"","orcid":"","institution":"Tarim University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Chen","suffix":""},{"id":207331963,"identity":"af9cdfd4-560d-4cf2-bd9d-d6ab0e6c0979","order_by":16,"name":"Xiangan Han","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtklEQVRIiWNgGAWjYBACAygtx8befoA0LcZ8PGcSSNOSOE/CwQCvSjgwZz97TPJLzZ30NgmGBIYfFdsIa7HsyUs2ljn2LLdNuvEAY8+Z20Q47ECO4WMJtsO5bTIHEpgZ24jRcv6NwWGJf4fT2SQSDIjUciPH8OHHtsMJpGh5Y2zM2HfYsA0YyAeJ88v5HDPJH98Oy8u3tx988KOCCC0gwMwDZRwgTj0QMP4gWukoGAWjYBSMSAAAIeA+G4Uvs5wAAAAASUVORK5CYII=","orcid":"","institution":"Shanghai Veterinary Research Institute, the Chinese Academy of Agricultural Sciences (CAAS)","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Xiangan","middleName":"","lastName":"Han","suffix":""}],"badges":[],"createdAt":"2023-06-06 05:14:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3027187/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3027187/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":38229237,"identity":"0c5b20fd-db74-4973-85ca-da0a3e85eef8","added_by":"auto","created_at":"2023-06-08 13:51:49","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":362548,"visible":true,"origin":"","legend":"\u003cp\u003eClinical mastitis milk samples collected from 14 provinces or cities in China.\u003c/p\u003e\n\u003cp\u003eThe distribution of milk samples from dairy cows with clinical mastitis in different provinces or cities of China in 2021 is reflected through a bubble diagram. The milk sampling quantity from each location is displayed by the sizes of the red circles and marked in the yellow labels. Anhui: 22; Beijing: 17; Fujian: 3; Gansu: 9; Guangdong: 13; Hebei: 155; Henan: 3; Hubei: 10; Ningxia: 60; Shandong: 55; Jiangsu: 121; Tianjin: 9; Yunnan: 7; Zhejiang: 11.\u003c/p\u003e","description":"","filename":"Slide1.png","url":"https://assets-eu.researchsquare.com/files/rs-3027187/v1/d0f4157d4210e4f6527bda9b.png"},{"id":38229235,"identity":"056cf1e4-43c6-4528-a9a4-3453bc51784b","added_by":"auto","created_at":"2023-06-08 13:51:49","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":259160,"visible":true,"origin":"","legend":"\u003cp\u003eThe isolation of K. pneumoniae from different provinces or cities.\u003c/p\u003e\n\u003cp\u003ea. MacConkey agar was used to isolate and purify K. pneumoniae, which showed colonies that were pink, moist and swollen; b. PCR amplification of khe was used to for preliminary identification and purification of K. pneumoniae. Products of 489-bp in size were amplified from positive control K. pneumoniae CMCC46117 (Line 14) and suspected K. pneumoniae isolates (lines 1–13), while no product was amplified from a blank control (Line 15); c. 131 K. pneumoniae isolates were isolated from 12 regions and the number from each region is displayed in the black histogram. The isolation rate of each region is shown by the blue broken line.\u003c/p\u003e","description":"","filename":"Slide2.png","url":"https://assets-eu.researchsquare.com/files/rs-3027187/v1/3e435cb16535c6046cfd39d3.png"},{"id":38229810,"identity":"38e9a3ad-12cf-402d-b48b-cc5dee464305","added_by":"auto","created_at":"2023-06-08 13:59:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":118393,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution of K1, K2, K5, K20, K54 and K 57 capsule serotypes in K. pneumoniae isolates.\u003c/p\u003e\n\u003cp\u003ea. There were 59 isolates (45.0%) belonging to the K57 serotype, 6 isolates (4.6%) belonging to the K20 serotype, and 2 (1.5%) isolates belonging to the K5 serotype. No isolates of K1, K2 and K54 serotype strains were found; b. Distribution of capsule serotypes in K. pneumoniae isolates in twelve regions.\u003c/p\u003e","description":"","filename":"Slide3.png","url":"https://assets-eu.researchsquare.com/files/rs-3027187/v1/f136b32a66b3fee6a9c2fae7.png"},{"id":38230274,"identity":"1482f381-14e6-424b-b3f5-3ff81376c7a0","added_by":"auto","created_at":"2023-06-08 14:07:49","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":86763,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution of hypervirulent K. pneumoniae (hvKp) among K. pneumoniae isolates. The 19 hvKp isolates were isolated from eight regions and the number from each region is displayed in the black histogram. The isolation rate of each region is shown by the blue broken line.\u003c/p\u003e","description":"","filename":"Slide4.png","url":"https://assets-eu.researchsquare.com/files/rs-3027187/v1/883c069822057e8c53a884ee.png"},{"id":38229809,"identity":"32090684-a4ac-4fda-a54b-43c1ac2e8815","added_by":"auto","created_at":"2023-06-08 13:59:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":247384,"visible":true,"origin":"","legend":"\u003cp\u003eDetection of β-lactam antibiotic resistance genes in K. pneumoniae isolates by PCR. a. PCR amplification of eight common β-lactam antibiotic resistance genes of K. pneumoniae isolates. M: DNA Marker DL2000 (TAKARA, Japan); 1: blaVIM; 2: blaNDM; 3: blapOXA-48; 4: blaKPC; 5: blaDHA; 6: SHV; 7: blaCTX-M-15; 8: blaTEM; b. The rates of nine β-lactamase resistance genes in K. pneumoniae isolates.\u003c/p\u003e","description":"","filename":"Slide5.png","url":"https://assets-eu.researchsquare.com/files/rs-3027187/v1/b76f8c85b118f030973dc1a7.png"},{"id":38229812,"identity":"15a70134-8ddd-4a74-aa54-44d4b1b40cd7","added_by":"auto","created_at":"2023-06-08 13:59:49","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":255544,"visible":true,"origin":"","legend":"\u003cp\u003ePCR amplification of K. pneumoniae virulence genes.\u003c/p\u003e\n\u003cp\u003ea. PCR amplification of fifteen common virulence genes of K. pneumoniae isolates. M: DNA Marker DL2000 (TAKARA, Japan); 1: mrkA; 2: entB; 3: rmpA; 4: wabG; 5: ecpD; 6: magA; 7: kfu; 8: uge; 9: iroN; 10: wcaG; 11: iucA; 12: iroB; 13: alls; 14: ycf; 15: fimH; b. Multiple virulence genes carried by K. pneumoniae isolates.\u003c/p\u003e","description":"","filename":"Slide6.png","url":"https://assets-eu.researchsquare.com/files/rs-3027187/v1/60c64372799079eea1ceb957.png"},{"id":38229244,"identity":"d1258b35-bc5f-438b-b251-46bc582d5c81","added_by":"auto","created_at":"2023-06-08 13:51:49","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":221915,"visible":true,"origin":"","legend":"\u003cp\u003eBiofilm formation capacity of 131 K. pneumoniae isolates at 37°C for 24 h.\u003c/p\u003e\n\u003cp\u003eTo access the capacity for biofilm formation of K. pneumoniae isolates, bacteria were inoculated into 96-well PVC microplates and cultured at 37℃for 24 h. The bacterial biofilms were stained by crystal violet and the absorbance at 595 nm (OD595) was measured to assess the biofilm formation ability of K. pneumoniae. ODc = 0.38; ODs ≤ODc = no biofilm production; ODc \u0026lt; ODs ≤2ODc) = weak biofilm producer; 2ODc \u0026lt; ODs ≤4ODc = moderate biofilm producer; ODs \u0026gt; 4ODc = strong biofilm producer.\u003c/p\u003e","description":"","filename":"Slide7.png","url":"https://assets-eu.researchsquare.com/files/rs-3027187/v1/569d18dfa16c07448d9a4472.png"},{"id":38229242,"identity":"9158b0fc-daf0-47f0-9120-bb7f15bc63c6","added_by":"auto","created_at":"2023-06-08 13:51:49","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":239595,"visible":true,"origin":"","legend":"\u003cp\u003eScreening of AHL-producing K. pneumoniae and influence of AHLs on biofilm formation by K. pneumoniae.\u003c/p\u003e\n\u003cp\u003ea. Production of AHLs with N-acyl-side chains from C4 to C8 by K. pneumoniae was screened using bioreporter strain C. violaceum CV026; AHLs or AHL-producing strains would display purple pigmentation on the plates. ①: 2 mM C6-HSL; ②: 200 μM C6-HSL; ③–⑬: selection of K. pneumoniae isolates; b. AHLs did not influence the biofilm formation ability of no biofilm production strains (Kp130, Kp41, Kp59) (P \u0026gt; 0.05); c. For weak biofilm producer strains (Kp131, Kp87, Kp39), only 3-oxo-C6-HSL significantly decreased the biofilm formation of Kp131 (P \u0026lt; 0.01) while C6-HSL could not (P \u0026gt; 0.05). d. Both C6-HSL and 3-oxo-C6-HSL significantly decreased the biofilm formation abilities of moderate biofilm producers (Kp120, Kp102, Kp21); e. Both C6-HSL and 3-oxo-C6-HSL significantly decreased the biofilm formation abilities of strong biofilm producer strains (Kp3, Kp15, Kp18) (ns: P \u0026gt; 0.05; *: P \u0026lt; 0.05; **: 0.001 \u0026lt; P \u0026lt; 0.01; ***: P \u0026lt; 0.001; The final concentration of C6-HSL and 3-oxo-C6-HSL in AHL-adding groups used in the biofilm assay was 1 μM).\u003c/p\u003e","description":"","filename":"Slide8.png","url":"https://assets-eu.researchsquare.com/files/rs-3027187/v1/e77edb64d9148a96d03954d5.png"},{"id":38230275,"identity":"4e3c2b65-6584-489d-b4f6-33a1fda46c74","added_by":"auto","created_at":"2023-06-08 14:07:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2060740,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3027187/v1/a2d24c18-d2ac-461b-a2c1-50a098be85ab.pdf"},{"id":38229814,"identity":"af41a82e-5783-4964-89c2-a52780da4a34","added_by":"auto","created_at":"2023-06-08 13:59:49","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":203512,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary figure 1.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDistribution of genes in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eK. pneumoniae\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e isolates according to capsule serotypes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea.\u003c/strong\u003e Distribution of hvKP isolated and cKp (blue indicates hvKp and yellow indicated cKp). \u003cstrong\u003eb: \u003c/strong\u003eDistribution of β-lactamase genes and virulence genes in each \u003cem\u003eK. pneumoniae\u003c/em\u003e isolate (white represented the absence of related genes and red indicated the presence of related genes).\u003c/p\u003e","description":"","filename":"Supplementaryfigure1.docx","url":"https://assets-eu.researchsquare.com/files/rs-3027187/v1/701ab33b210f899409081b06.docx"},{"id":38229813,"identity":"ad3cc190-c0b5-4fd0-868f-ff9e5f4778ee","added_by":"auto","created_at":"2023-06-08 13:59:49","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":215257,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary figure 2.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDistribution of genes in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eK. pneumoniae\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e isolates according to biofilm formation capacity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea.\u003c/strong\u003e Distribution of hvKP isolates and cKp (blue indicated hvKp and yellow indicated cKp). \u003cstrong\u003eb: \u003c/strong\u003eDistribution of β-lactamase genes and virulence genes in each \u003cem\u003eK. pneumoniae\u003c/em\u003e isolate (white represented the absence of related genes and red indicated the presence of related genes; NBF, WBF, MBF and SBF represented no, weak, moderate and strong biofilm producers, respectively).\u003c/p\u003e","description":"","filename":"Supplementaryfigure2.docx","url":"https://assets-eu.researchsquare.com/files/rs-3027187/v1/7d886fa8fcce09da5ad57168.docx"},{"id":38229240,"identity":"0628925d-eb29-448f-afae-dd91a10dccf3","added_by":"auto","created_at":"2023-06-08 13:51:49","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":30605,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary table 1. Specific information of 131 isolates of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eK. pneumoniae\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Supplementarytable1.docx","url":"https://assets-eu.researchsquare.com/files/rs-3027187/v1/16f8d1353945359ff906d24c.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Molecular characterization of Klebsiella pneumoniae in clinical bovine mastitis in 14 provinces in China","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBovine mastitis is mainly caused by bacterial pathogens, and a great deal of human and financial resources are expended to prevent and control bovine mastitis every year (Heikkila, Liski et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e (\u003cem\u003eK. pneumoniae\u003c/em\u003e) is one of the most common causes of clinical bovine mastitis and induces severe clinical signs (Bengoechea and Sa Pessoa \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e causes a major decrease in the milk production, however, there is only a few studies on \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates from bovine mastitis cases (Grohn et al., 2004, Masse et al., 2020).\u003c/p\u003e \u003cp\u003e \u003cem\u003eK. pneumoniae\u003c/em\u003e is a common opportunistic bacterial pathogen within the \u003cem\u003eEnterobacteriaceae\u003c/em\u003e and is ubiquitously found on the surface of mucosae in animals or in the environment (such as water, soil, and vegetation). Generally, \u003cem\u003eK. pneumoniae\u003c/em\u003e infects immunocompromised individuals, causing a range of diseases, including pneumonia, bacteremia, urinary tract infection, and liver abscesses (Russo, Olson et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, Juan, Chuang et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Marr and Russo \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Wang, Zhao et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The pathogenic mechanism of \u003cem\u003eK. pneumoniae\u003c/em\u003e is complicated. In the course of infection, \u003cem\u003eK. pneumoniae\u003c/em\u003e invades and survives in the host by means of a variety of virulence factors, such as capsule polysaccharide (CPS), lipopolysaccharide (LPS), fimbriae, outer membrane protein and iron acquisition (Li, Zhao et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The mechanism of some \u003cem\u003eK. pneumoniae\u003c/em\u003e strains was well investigated in human infection because of their severe multidrug resistance and hypervirulence, however, little is known about how they infect the mammary gland of dairy cows (Cheng, Zhou et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e is one of the important drug-resistant bacteria that gaining attention in clinical. In past decades, control of bacterial diseases in animals have become difficult as a result of the abuse of antibiotic drugs and increasing resistance (Kurittu, Khakipoor et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Clinical \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates usually show high resistance in many studies and it was listed as critical on the list of first priority pathogens for research and development of new antibiotics by WHO. Furthermore, \u003cem\u003eKlebsiella\u003c/em\u003e species are a known reservoir for antibiotic resistance genes, which can spread to other Gram-negative bacteria (Wyres and Holt \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The antibiotic resistance mechanisms of \u003cem\u003eK. pneumoniae\u003c/em\u003e are diverse, including mutation, drug-modifying enzymes with diverse activities, and modification of cell permeability. Besides varieties of drug resistance genes, biofilm is also associated with resistance.\u003c/p\u003e \u003cp\u003eBiofilm comprises communities of microorganisms attached to the surface of biological tissues and abiotic materials; it is composed of bacteria, extracellular polysaccharides, protein, and DNA (Rabin, Zheng et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The inherent antibiotic tolerance of sessile bacteria in biofilm often leads to failure of antimicrobial treatment. The bacteria cells in biofilm may become 10\u0026ndash;1000 times more resistant to the effects of antimicrobial agents (Mah and O'Toole \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). In addition, biofilm is associated with persistent infection of bacteria. \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e with biofilm is protected from the host immune response in part by inhibiting the proximity of antibodies and antimicrobial peptides and reducing the effects of complement and phagocytosis (Fux, Costerton et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Quorum sensing (QS) is a microbial cell-to-cell communication process, dynamically regulating a variety of bacterial physiological activities. Acyl-homoserine lactones (AHLs), important autoinducers in Gram-negative bacterial QS, play an important role in biofilm formation (O'Loughlin, Miller et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e, Rabin, Zheng et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In \u003cem\u003eK. pneumoniae\u003c/em\u003e, several lactones with differently sized chains have been detected, such as N-octanoylhomoserine lactone (C8-HSL), N-3-dodecanoyl-L-homoserine lactone (C12-HSL) (Yin, Purmal et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2012\u003c/span\u003e)d hexanoyl-homoserine lactone (C6-AHL) (Ngeow, Cheng et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). However, there is little study of AHLs in mastitis associated \u003cem\u003eK. pneumoniae\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eRecently the morbidity of mastitis caused by \u003cem\u003eK. pneumoniae\u003c/em\u003e in China has tended to increase and poses a serious threat to the dairy industry and public health (Cheng, Zhou et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, compared with other bacterial mastitis pathogens, there have been few studies on \u003cem\u003eK. pneumoniae\u003c/em\u003e as a causative agent of bovine mastitis. Therefore, 495 mastitis milk samples in this study were collected from large dairy farms in fourteen regions of China to investigate the characteristics of \u003cem\u003eK. pneumoniae\u003c/em\u003e, and the influence of AHL molecules (C6-HSL and 3-oxo-C6-HSL) on the biofilm of \u003cem\u003eK. pneumoniae\u003c/em\u003e. This study provided reference material for the prevention of bovine mastitis caused by \u003cem\u003eK. pneumoniae\u003c/em\u003e.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMilk samples, strains and primers\u003c/h2\u003e \u003cp\u003eFrom March to August 2021, 495 milk samples were collected aseptically from dairy cows with clinical mastitis on large-scale dairy farms (herd size\u0026thinsp;\u0026ge;\u0026thinsp;500) in 14 provinces of China (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). All the samples were also diagnosed by obvious clinical symptoms and California Mastitis Test. For mill collection, the udders of cows were cleaned with water and dried. Cotton balls with 75% ethanol were used to disinfect the surface of the udder. The first few streams of milk were discarded and the collected milk was kept in a sterile tube. Then the milk samples were immediately sent on ice packs to the lab within 48 h. The mastitis derived isolates are listed in Additional file 1. \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e standard strain CMCC46117, stored by our laboratory, was used as the positive control in the PCR identification of \u003cem\u003eK. pneumoniae\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eChromobacterium violaceum\u003c/em\u003e CV026, stored by our laboratory, was used to determine the production of AHLs with acyl side chain length from C6 to C14 by \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates (Viswanath, Sekar et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAll PCR primers used in this study were synthesized by Sangon Biotech (China) and are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eClass\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimers\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOligonucleotide sequence (5'\u0026rarr;3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eDescription of amplificated gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eProduct size (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSpecific identification\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ekhe-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGAAACGACCTGATTGCATTCGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eUsed for identifying \u003cem\u003eK. pneumoniae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e489\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ekhe-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTACTTTTTCCGCGGCTTACCGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"15\" rowspan=\"16\"\u003e \u003cp\u003eResistance genes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKPC-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCGTCTAGTTCTGCTGTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBeta-lactamases that confer resistance to carbapenem\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e737\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKPC-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAGACGACGGCATAGTCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVIM-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGTCATGAAAGTGCGTGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMetallo-beta-lactamase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVIM-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTGTTTGGTCGCATATCGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNDM-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGAATGTCTGGCAGCACACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNDM family metallo-beta-lactamase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e503\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNDM-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCACCGAGATTGCCGAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOXA-48-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTTGAAAGCCAGTCCCCTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBeta-lactamases that confer resistance to carbapenem\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e930\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOXA-48-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGATACAGGTGGCTGCGTAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSHV-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCTCCCTGTTAGCCACCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBeta-lactamases that confer resistance to carbapenem\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e250\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSHV-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGATCTTTCGCTCCAGCTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTX-M-F \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCGGAAAAGCACGTCAATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBeta-lactamases that confer resistance to cephalosporin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e506\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTX-M-R \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATACATCGCGACGGCTTTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTEM-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCACGAGTGGGTTACATCGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTEM-type β-lactamase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e727\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTEM-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGAGGCACCTATCTCAGCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDHA-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAGCCTGTGCAGCTTTGACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBeta-lactamases that confer resistance to cephamycins and oxyimino-cephalosporins\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e997\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDHA-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGGATATTCCCGGGATGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"11\" rowspan=\"12\"\u003e \u003cp\u003eCapsule serotypes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eK1-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTGCTCTTTACATCATTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eUsed for identifying K1 serotype\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1283\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eK1-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAATGGCCATTTGCGTTAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eK2-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACCCGATATTCATACTTGACAGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eUsed for identifying K2 serotype\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e641\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eK2-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTGAAGTAAAATCGTAAATAGATGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eK5-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGTAGTGATGCTCGCGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eUsed for identifying K5 serotype\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e280\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eK5-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTGAACCCACCCCAATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eK20-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGGTGCTACAGTGCATCATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eUsed for identifying K20 serotype\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e881\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eK20-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTTATACGATGCTCAGTCGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eK54-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCATTAGCTCAGTGGTTGGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eUsed for identifying K54 serotype\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1037\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eK54-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTTGACAAACACCATAGCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eK57-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCAGGGCTAGAAGTGTCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eUsed for identifying K57 serotype\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e741\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eK57-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACTAACCCAGAAAGTCGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"29\" rowspan=\"30\"\u003e \u003cp\u003eVirulence genes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003euge-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCGCACACCTATTCTCACCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eRequired for capsular biosynthesis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e219\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003euge-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATCACATCCTGCACCCGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ewabG-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCTGGTGCGGCAGAAGTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eRequired for biosynthesis of the core lipopolysaccharide\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e931\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ewabG-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGCCGTCGACGATAAACTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ermpA-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCCTTTACAGCCAAATTTTCTTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eRegulator of mucoid phenotype\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e468\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ermpA-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGGGCTACCTCTGCTTCATAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emagA-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGATAAGTGGCGGAGATTCTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAssociated with mucoviscosity-associated protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e542\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emagA-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGATAAGTGGCGGAGATTCTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ewcaG-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGTTGGGTCAGCAATCGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAssociated with capsule biosynthesis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e161\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ewcaG-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCAACTTTTGCAGCAGCTAAATAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eycf-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGTCACGGATTATGTAACGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAssociated with capsule\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e524\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eycf-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACGCTATGACAGAACCTGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003efimH-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCTACGTTAACCTGACCCCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eType 1 fimbriae adhesion\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e781\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003efimH-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATTGATAGACAAAGGTGATGCCGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emrkA-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGGCGGCCAGGTTAATTTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAssociated with type 3 fimbriae\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emrkA-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGTAGCTGTTAACCACACCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eentB-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGCGCTTTGAGGAAGAGGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAssociated with iron uptake\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e241\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eentB-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAAGTGGTGATAACGCTGATAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eiucA-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTAAACAGCGGCTTCAGCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAssociated with aerobactin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1230\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eiucA-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCAACTAAAACGTCAGCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eiroB-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACAACAACGCGGGCATTTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAssociated with iron uptake\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e217\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eiroB-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCTGCATCTTTCGGCCAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eiroN-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAATGAAACTACCGCCCCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAssociated with iron transport\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1033\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eiroN-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTGGAGTGGAGGCGAGATA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ekfu-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGCTGGCCTACTATCCGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAssociated with iron uptake\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e520\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ekfu-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTATCGATACCGCCCAGCCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ealls-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTCAGCAGATAAATGACGGGGTAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAssociated with allantoin metabolism\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e244\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ealls-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGGGTAAACCGCCATATTTTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eecpD-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACAGCGCATCGGTCATATCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFimbrial adhesin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1319\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eecpD-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAACTTTTTCGTCACCCCCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003ea\u003c/sup\u003e Meant that the PCR primers of \u003cem\u003eblaCTX-M\u003c/em\u003e was designed referring to the nucleotide sequence of \u003cem\u003eblaCTX-M-15\u003c/em\u003e which accounted for the majority of \u003cem\u003eblaCTX-M\u003c/em\u003e genes.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIsolation and identification of\u003c/b\u003e \u003cb\u003eK. pneumoniae\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe clinical mastitis derived milk samples were spread on MacConkey agar with sterile cotton swabs to isolate \u003cem\u003eK. pneumoniae\u003c/em\u003e. After overnight culture at 37℃, for the plate that was noy considered contaminated (i.e., \u0026ge;\u0026thinsp;3 phenotypically different types of colonies on the plate), pink, moist and swollen colonies were picked with sterile inoculating loops, added to nutrient broth (Hopebio, China) and incubated at 37℃ for 6\u0026ndash;8 h. Bacterial genomic DNA was extracted from 1 mL enrichment culture using the boiling method (Holmes and Quigley \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e1981\u003c/span\u003e) and used as template for PCR identification of \u003cem\u003eK. pneumoniae\u003c/em\u003e with primers \u003cem\u003ekhe\u003c/em\u003e-F/\u003cem\u003ekhe\u003c/em\u003e-R (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Genomic DNA extraction of \u003cem\u003eK. pneumoniae\u003c/em\u003e standard strain CMCC46117 prepared in the same way was used as the positive control. The PCR reaction conditions were as follows: 10 \u0026micro;L 2\u0026times; Mix (TaKaRa, Japan), 1 \u0026micro;L F/R primers, 1 \u0026micro;L DNA template and 7 \u0026micro;L ddH\u003csub\u003e2\u003c/sub\u003eO; the annealing temperature was 58℃ for 45 s. The PCR products were identified by 1% agarose gel electrophoresis and sent to Sangon Biotech (China) for sequencing. Positive isolation of \u003cem\u003eK. pneumoniae\u003c/em\u003e was verified by blasting the DNA sequence of the PCR product and showing identification with \u003cem\u003eK. pneumoniae\u003c/em\u003e\u0026thinsp;\u0026ge;\u0026thinsp;98%. In addition, all the \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates.\u003c/p\u003e \u003cp\u003eThe positive samples were used to purify \u003cem\u003eK. pneumoniae\u003c/em\u003e as described above and, after 2 to 3 generations of consecutive plate streaking, the positive strains from PCR of \u003cem\u003ekhe\u003c/em\u003e were preserved with 25% glycerol LB at -80℃. Meanwhile, we extracted the genomes of the \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates using a TIANamp Bacteria DNA kit (TianGen, China) and stored them at -20℃.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDetection of capsular serotypes and string test of\u003c/b\u003e \u003cb\u003eK. pneumoniae\u003c/b\u003e \u003cb\u003eisolates\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe capsular serotypes of \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates were determined by PCR reaction as described in previous research (Yan, Zhou et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). To analyze the distribution of K1, K2, K5, K20, K54 and K57 capsule serotypes in clinical mastitis derived \u003cem\u003eK. pneumoniae\u003c/em\u003e, genomic DNA of the abovementioned saved mastitis derived \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates were used as PCR templates and six pairs of capsular serotype primers (K1, K2, K5, K20, K54 and K57) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) were used for determination of the capsular serotypes of the isolates.\u003c/p\u003e \u003cp\u003eThe capsular polysaccharide is an important antigenic substance in hypervirulent \u003cem\u003eK. pneumoniae\u003c/em\u003e, conferring the characteristic of high mucilage production. The string test was performed according to previous study with some modification to verify the phenotype of \u003cem\u003eK. pneumoniae\u003c/em\u003e (Gao et al., 2019). Briefly, \u003cem\u003eK. pneumoniae\u003c/em\u003e strains were incubated on blood agar, and after overnight culture at 37℃, the growing \u003cem\u003eK. pneumoniae\u003c/em\u003e was slowly lifted upward from the colony using an inoculating loop. When the length of the mucoviscous string is \u0026gt;\u0026thinsp;5 cm, it is defined as a positive test and the isolate is regarded as hypervirulent \u003cem\u003eK. pneumoniae\u003c/em\u003e (hvKP). If the string length is \u0026lt;\u0026thinsp;5 cm, the string test is negative and the isolate is classic \u003cem\u003eK. pneumoniae\u003c/em\u003e (cKp).\u003c/p\u003e \u003cp\u003e \u003cb\u003eDetection of virulence genes of\u003c/b\u003e \u003cb\u003eK. pneumoniae\u003c/b\u003e \u003cb\u003eisolates\u003c/b\u003e \u003c/p\u003e \u003cp\u003eUsing the extracted genomic DNA as templates, primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) of lipopolysaccharide associated genes (\u003cem\u003euge\u003c/em\u003e, \u003cem\u003ewabG\u003c/em\u003e), capsular associated genes (\u003cem\u003ermpA\u003c/em\u003e, \u003cem\u003emagA\u003c/em\u003e, \u003cem\u003ewcaG\u003c/em\u003e, \u003cem\u003eycf\u003c/em\u003e), fimbriae associated genes (\u003cem\u003efimH\u003c/em\u003e, \u003cem\u003emrkA\u003c/em\u003e), siderophore associated genes (\u003cem\u003eentB\u003c/em\u003e, \u003cem\u003ekfu\u003c/em\u003e, \u003cem\u003eiroB\u003c/em\u003e, \u003cem\u003eiroN\u003c/em\u003e, \u003cem\u003eiucA\u003c/em\u003e), allantoin associated genes (\u003cem\u003ealls\u003c/em\u003e) and extracellular products associated genes (\u003cem\u003eecpD\u003c/em\u003e) were used for amplification to analyze the distribution of several common virulence genes in mastitis derived \u003cem\u003eK. pneumoniae\u003c/em\u003e by the PCR method, as in previous studies (Alcantar-Curiel, Blackburn et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2013\u003c/span\u003e, Candan and Aksoz \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2015\u003c/span\u003e, Vuotto, Longo et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Russo, Olson et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, El-Domany, Awadalla et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eAntimicrobial susceptibility and antibiotic resistance gene testing\u003c/h2\u003e \u003cp\u003eMinimal inhibitory concentration (MIC) of ampicillin, amoxicillin/clavulanic acid, ceftazidime, sulfisoxazole, tetracycline, florfenicol, kanamycin and ciprofloxacin of 131 \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates were determined by broth microdilution method recommended by the Clinical and Laboratory Standardization Institute (CLSI) standard M07 (2020). \u003cem\u003eE. coli\u003c/em\u003e ATCC 25922 was used as the quality control strain. The breakpoints of ampicillin, amoxicillin/clavulanic acid, ceftazidime, sulfisoxazole and kanamycin were referred to criteria published by the CLSI (2020). And the breakpoints of tetracycline, florfenicol and ciprofloxacin were referred to the ECOFFs (epidemiological cut-off values) of the European Committee on Antimicrobial Susceptibility Testing (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://mic.eucast.org/search/\u003c/span\u003e\u003cspan address=\"https://mic.eucast.org/search/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eBased on resistance gene data from the Antibiotic Resistance Genes Database (ARDB), specific primers for eight β-lactam antibiotic resistance genes of \u003cem\u003eK. pneumoniae\u003c/em\u003e were designed (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), including carbapenemase-related genes (\u003cem\u003eblaKPC\u003c/em\u003e, \u003cem\u003eblaVIM\u003c/em\u003e, \u003cem\u003eblaOXA-48\u003c/em\u003e, \u003cem\u003eblaNDM\u003c/em\u003e) and cephalosporin-related genes (\u003cem\u003eblaSHV\u003c/em\u003e, \u003cem\u003eblaCTX-M-15\u003c/em\u003e, \u003cem\u003eblaTEM\u003c/em\u003e, \u003cem\u003eblaDHA\u003c/em\u003e). Using the extracted genomic DNA of \u003cem\u003eK. pneumoniae\u003c/em\u003e as the template, the distribution of β-lactam antibiotic resistance genes in \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates was determined by PCR. The PCR reaction system and conditions were used as described above.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eBiofilm formation assay\u003c/h2\u003e \u003cp\u003eBacterial biofilms were measured in 96-well polyvinyl chloride (PVC) microplates using the Crystal Violet method as described previously, with some modification (Wang, Zhao et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Briefly, \u003cem\u003eK. pneumoniae\u003c/em\u003e strains were cultured overnight at 37℃, diluted 1:100 in LB; 200 \u0026micro;L of bacterial culture were inoculated into 96-well PVC microplates and each strain was replicated in six wells. The bacteria were cultured at 37℃ for 24 h and the contents of the wells discarded. The wells were washed with PBS three times and dried at 60℃. Biofilm was stained by 0.1% Crystal Violet for 15 min at 37℃ and the excess Crystal Violet was washed off and the wells air-dried; 200 \u0026micro;L of 95% ethanol was added to the wells to dissolve the Crystal Violet and the absorbance at 595 nm (OD\u003csub\u003e595\u003c/sub\u003e) was measured using a Synergy 2 microplate reader (BioTek, USA) to assess the biofilm formation ability of \u003cem\u003eK. pneumoniae\u003c/em\u003e. Wells with sterile LB were used as blank controls.\u003c/p\u003e \u003cp\u003eThe ability of \u003cem\u003eK. pneumoniae\u003c/em\u003e to form biofilm is reflected in the optical density of the sample (OD\u003csub\u003esample\u003c/sub\u003e, OD\u003csub\u003es\u003c/sub\u003e). The critical OD (OD\u003csub\u003econtrol\u003c/sub\u003e, OD\u003csub\u003ec\u003c/sub\u003e) was calculated from the arithmetic mean of the absorbance of six negative controls with addition of three times the standard deviation (SD). When OD\u003csub\u003es\u003c/sub\u003e \u0026le; OD\u003csub\u003ec\u003c/sub\u003e, the bacteria did not form biofilm; when OD\u003csub\u003ec\u003c/sub\u003e \u0026lt; OD\u003csub\u003es\u003c/sub\u003e \u0026le; 2OD\u003csub\u003ec\u003c/sub\u003e, the bacteria had weak ability to form biofilm; when 2OD\u003csub\u003ec\u003c/sub\u003e\u0026thinsp;\u0026lt;\u0026thinsp;OD\u003csub\u003es\u003c/sub\u003e \u0026le; 4OD\u003csub\u003ec\u003c/sub\u003e, the bacteria had moderate ability to form biofilm; when OD\u003csub\u003es\u003c/sub\u003e \u0026gt; 4OD\u003csub\u003ec\u003c/sub\u003e, the bacterial ability to form biofilm was strong (Xu, Liang et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eScreening of AHL-producing\u003c/b\u003e \u003cb\u003eK. pneumoniae\u003c/b\u003e \u003cb\u003eby\u003c/b\u003e \u003cb\u003eChromobacterium violaceum\u003c/b\u003e \u003cb\u003eCV026 biosensor\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates were screened for the production of AHLs with N-acyl side chains from C4 to C8 by plate assay using the bioreporter strain \u003cem\u003eChromobacterium violaceum\u003c/em\u003e (\u003cem\u003eC. violaceum\u003c/em\u003e) CV026 on LB agar, according to the reported mothed with some modification (Viswanath, Sekar et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The \u003cem\u003eC. violaceum\u003c/em\u003e CV026 was inoculated in LB broth at 28℃ to OD600\u0026thinsp;=\u0026thinsp;0.5 and 1 mL of CV026 culture to 100 mL molten semi-solid LB agar (45℃) and poured immediately into sterile dishes to make AHL report plates. The \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates were inoculated in 5 mL LB broth at 37℃ and cultured to logarithmic stage. Subsequently, 5 \u0026micro;L of each bacterial culture was dropped on to the surface of AHL report plates to screen the AHL-producing \u003cem\u003eK. pneumonia\u003c/em\u003e strains. Meanwhile, 5 \u0026micro;L C6-HSL (200 \u0026micro;M and 2 mM, Sigma-Aldrich, USA) dropped on the plates was used as a positive control. The plates were incubated at 28℃ overnight. Bacteria surrounded by purple pigmentation indicated that the strain could produce AHL which stimulated violacein synthesis by \u003cem\u003eC. violaceum\u003c/em\u003e CV026.\u003c/p\u003e \u003cp\u003e \u003cb\u003eInfluence of AHLs on biofilm formation by\u003c/b\u003e \u003cb\u003eK. pneumoniae\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo study the influence of AHLs on biofilm formation by mastitis derived \u003cem\u003eK. pneumoniae\u003c/em\u003e, non-biofilm-producers (Kp130, Kp41, Kp59), weak biofilm producers (Kp131, Kp87, Kp39), moderate biofilm producers (Kp120, Kp102, Kp21) and strong biofilm producers (Kp3, Kp15, Kp18) were selected as the subjects of a biofilm assay with/without AHLs. C6-HSL and 3-oxo-C6-HSL (Sigma-Aldrich, USA) were selected as two AHL study subjects. Briefly, bacteria were cultured to OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.5 in LB broth and then diluted with fresh LB medium with/without 1 \u0026micro;M of C6-HSL or 3-oxo-C6-HSL, respectively. The biofilm formed by each sample was determined as described above for the biofilm formation assay.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analyses in this study were conducted using SPSS V19.0 software. Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test was used to analyze the data and \u003cem\u003eP\u003c/em\u003e values less than 0.05 were considered significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eIsolation and identification of K.\u003c/b\u003e \u003cb\u003ePneumoniae\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe \u003cem\u003eK. pneumoniae\u003c/em\u003e grew moist and swollen pink colonies on MacConkey agar (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea) and a 489-bp PCR product was amplified from the positive \u003cem\u003eK. pneumoniae\u003c/em\u003e strains with primers \u003cem\u003ekhe\u003c/em\u003e-F/\u003cem\u003ekhe\u003c/em\u003e-F (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb); 131 \u003cem\u003eK. pneumoniae\u003c/em\u003e strains, named Kp1\u0026ndash;131, were listed in Supplementary table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, were isolated from 495 clinical mastitis milk samples and the total isolation rate was 26.5%. The isolation rates of \u003cem\u003eK. pneumoniae\u003c/em\u003e in different provinces ranged from 0.0\u0026ndash;70.6% (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). Among them, the rate from Beijing was highest (70.6%), followed by Zhejiang (60.0%), Anhui province (59.1%) and Tianjin province (44.4%), respectively, which indicates a high prevalence of \u003cem\u003eK. pneumoniae\u003c/em\u003e in these regions.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAlthough nearly half of the isolations (49.6%) were from Hebei and Jiangsu provinces, the isolation rates were only close to the average level. The majority of isolation rates from different provinces were between 14.3% and 24.8%. No \u003cem\u003eK. pneumoniae\u003c/em\u003e strain was isolated from Fujian and Henan provinces, but very few milk samples were collected from these provinces.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCapsular serotypes of\u003c/b\u003e \u003cb\u003eK. pneumoniae\u003c/b\u003e \u003cb\u003eisolates\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe specific capsule serotypes of 131 \u003cem\u003eK. pneumoniae\u003c/em\u003e strains are listed in Supplementary table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. There were 59 isolates (45.0%) belonging to the K57 serotype, 6 isolates (4.6%) belonging to the K20 serotype, and 2 (1.5%) isolates belonging to the K5 serotype. No isolates of K1, K2 and K54 serotype strains were found among 131 mastitis derived \u003cem\u003eK. pneumoniae\u003c/em\u003e. In addition, the serotypes of 64 isolates (48.9%) were regarded as other serotypes because no PCR products of the above serotypes were detected (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThere was also a regional difference in the distribution of the K57 serotype. Apart from several areas with a few isolates, including Fujian, Henan, Gansu and Yunnan provinces, the rate of isolation of K57 was greatest in Anhui (61.5%, 8/13), and lowest in Beijing (8.3%, 1/12) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb).\u003c/p\u003e\n\u003ch3\u003eString test\u003c/h3\u003e\n\u003cp\u003eThe mucinous phenotype detected by a string test was used to investigate the pathogenesis of \u003cem\u003eK. pneumoniae\u003c/em\u003e. Among the 131 \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates, 19 stains from six provinces were identified as hypervirulent \u003cem\u003eK. pneumoniae\u003c/em\u003e (hvKp) with a length of mucoviscous string\u0026thinsp;\u0026gt;\u0026thinsp;5 cm, accounting for 14.5%. The other 112 strains were identified as classic \u003cem\u003eK. pneumoniae\u003c/em\u003e (cKp), accounting for 85.5%. The distribution of hvKp in eight provinces is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. Compared with other provinces, the isolation rate of hvKp from Guangdong province was highest (50.0%, 1/2), following by Ningxia province (44.4%, 4/9).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eAnalysis of antimicrobial susceptibility profiles and antibiotic resistance genes\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates exhibited serious drug resistance to seven classes of antibiotics and terrible multiple-drug resistance (MDR) (Tables\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and \u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The isolates showed complete resistant to amoxicillin and erythromycin. The isolates also showed high resistance to sulfisoxazole (98.5%) and florfenicol (97.7%). The combination of amoxicillin and clavulanic acid significantly decreased the resistance rate of \u003cem\u003eK. pneumoniae\u003c/em\u003e (52.7%). For cephalosporin antibiotics, 20.6% of \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates were resistant to ceftazidime. The isolates also showed varying degrees of resistance to the other common antibiotics used in livestock, including tetracycline (48.1%), kanamycin (25.2%) and cotrimoxazole (51.1%). Except amoxicillin and erythromycin, 76.4% (99/131) of the strains were resistant to two more kinds of antimicrobial agents (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAntimicrobial susceptibility profiles of \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntibiotic class\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDrug Agents\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBreakpoints\u003c/p\u003e \u003cp\u003e(S I R of CLSI or ECOFF, mg/liter)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePercentage of Susceptible Strains (S, %)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePercentage of Intermediate Strains (I, %)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePercentage of Resistant Strains (R, %)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eβ-Lactams\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAmpicillin \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;8 16\u0026thinsp;\u0026ge;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0 (0/131)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.0 (0/131)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e100.0 (131/131)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAmoxicillin/clavulanic acid \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;4 8\u0026thinsp;\u0026ge;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.9 (9/131)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e40.4 (53/131)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e52.7 (69/131)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCeftazidime \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;4 8\u0026thinsp;\u0026ge;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e77.9 (102/131)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.5 (2/131)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e20.6 (27/131)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMacrolides\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eErythromycin \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;16 32\u0026thinsp;\u0026ge;\u0026thinsp;64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.0 (0/131)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.0 (0/131)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e100.0 (128/131)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSulfonamides\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSulfisoxazole \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;256\u0026thinsp;\u0026ge;\u0026thinsp;512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.5 (2/131)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e98.5 (129/131)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTetracyclines\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTetracycline \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e51.9 (68/131)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e48.1 (63/131)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhenicols\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFlorfenicol \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.3 (3/131)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e97.7 (128/131)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAminoglycosides\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKanamycin \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;16 32\u0026thinsp;\u0026ge;\u0026thinsp;64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e64.9 (85/131)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9.9 (13/131)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e25.2 (33/131)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFluoroquinolones\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCiprofloxacin \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.125\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e48.9 (64/131)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e51.1 (67/131)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003e\u003csup\u003ea\u003c/sup\u003e refer to the criteria published by the Clinical and Laboratory Standards Institute (CLSI, 2020).\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003e\u003csup\u003eb\u003c/sup\u003e refer to the ECOFFs (epidemiological cut-off values) of the European Committee on Antimicrobial Susceptibility Testing (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://mic.eucast.org/search/\u003c/span\u003e\u003cspan address=\"https://mic.eucast.org/search/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe multiple-drug resistance (MDR) of 131 Kp isolates\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStrains\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMultiple of drug resistance\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNumber of strains\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePercentage of total strains (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKp (55, 72, 83, 89, 91, 102, 112, 117, 120, 121)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKp (11, 12, 14, 17, 33, 61, 74, 90, 92, 94, 99, 104, 107, 126, 110, 126)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e12.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKp (1, 4, 5, 8, 9, 10, 49, 50, 53, 54, 56, 57, 69, 70, 79, 98, 103, 119, 129, 130)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e15.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKp (2, 7, 15, 18, 19, 20, 25, 32, 34, 46, 47, 58, 65, 68, 71, 75, 77, 84, 88, 93, 100, 105, 106, 109, 111, 118, 124)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e20.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKp (3, 6, 13, 16, 35, 36, 37, 38, 39, 40, 45, 51, 52, 62, 63, 67, 73, 76, 78, 80, 85, 96, 101, 108, 123, 131)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e20.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKp (21, 22, 23, 24, 26, 27, 28, ,29, 30, 31, 41, 42, 43, 44, 48, 59, 60, 66, 81, 82, 86, 95, 97, 113, 114, 115, 116, 122, 127)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e22.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKp (125, 128)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eAccording to the PCR results for β-lactam antibiotic resistance genes, \u003cem\u003eblaVIM\u003c/em\u003e and \u003cem\u003eblaOXA-48\u003c/em\u003e were not detected in the isolates. (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). The detection rates of \u003cem\u003eblaKPC\u003c/em\u003e, \u003cem\u003eblaNDM\u003c/em\u003e, \u003cem\u003eblaSHV\u003c/em\u003e, \u003cem\u003eblaCTX-M\u003c/em\u003e, \u003cem\u003eblaTEM\u003c/em\u003e, and \u003cem\u003eblaDHA\u003c/em\u003e were 0.8% (1/131), 32.1% (42/131), 56.5% (74/131), 15.3% (20/131), 71.0% (93/131) and 4.6% (6/131), respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eDistribution of virulence genes\u003c/h2\u003e \u003cp\u003eTwelve virulence genes, \u003cem\u003emrkA\u003c/em\u003e, \u003cem\u003eentB\u003c/em\u003e, \u003cem\u003ewabG\u003c/em\u003e, \u003cem\u003efimH\u003c/em\u003e, \u003cem\u003eecpD\u003c/em\u003e, \u003cem\u003ekfu\u003c/em\u003e, \u003cem\u003euge\u003c/em\u003e, \u003cem\u003eiroN\u003c/em\u003e, \u003cem\u003ewcaG\u003c/em\u003e, \u003cem\u003eiucA\u003c/em\u003e, \u003cem\u003eiroB\u003c/em\u003e, and \u003cem\u003ealls\u003c/em\u003e, could be amplified from the mastitis derived \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates while \u003cem\u003ermpA\u003c/em\u003e, \u003cem\u003emagA\u003c/em\u003e and \u003cem\u003eycf\u003c/em\u003e were not detected by the PCR method (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). The \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates carried varying numbers of virulence genes, ranging from 1\u0026thinsp;\u0026minus;\u0026thinsp;8. Bacteria simultaneously carrying six virulence genes accounted for the highest proportion of \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates (26.7%, 35/131) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb). Diverse rates of virulence genes were detected in this study. Among them, \u003cem\u003emrkA\u003c/em\u003e (93.1%, 122/131), \u003cem\u003eentB\u003c/em\u003e (70.2%, 92/131), \u003cem\u003ewabG\u003c/em\u003e (64.1%, 84/131), and \u003cem\u003efimH\u003c/em\u003e (61.1%, 80/131) were more prevalent in \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates, while \u003cem\u003eiucA\u003c/em\u003e (9.9%, 13/131), \u003cem\u003eiroB\u003c/em\u003e (8.4%, 11/131), and \u003cem\u003ealls\u003c/em\u003e (2.3%, 3/131) were less commonly found in the isolates (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eBiofilm formation\u003c/h2\u003e \u003cp\u003eThe ODc calculated in this study was 0.38 and the biofilm formation abilities of the 131 \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e. It was found that 77.10% of the \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates could form biofilm (ODs\u0026thinsp;\u0026gt;\u0026thinsp;0.38) while 22.90% (30/131) did not form biofilm(ODs\u0026thinsp;\u0026le;\u0026thinsp;0.38). Among the biofilm\u0026ndash;forming strains, 46 isolates (35.1%) had weak ability to form biofilm (0.38\u0026thinsp;\u0026lt;\u0026thinsp;ODs\u0026thinsp;\u0026le;\u0026thinsp;0.76), 31 strains (23.7%) had moderate ability to form biofilm (0.76\u0026thinsp;\u0026lt;\u0026thinsp;ODs\u0026thinsp;\u0026le;\u0026thinsp;1.52), and 24 strains (18.3%) could form strong biofilm, with OD\u003csub\u003es\u003c/sub\u003e \u0026gt; 1.52.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eDetection of AHLs of\u003c/b\u003e \u003cb\u003eK. pneumoniae\u003c/b\u003e \u003cb\u003eisolates\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCV026 is sensitive to the AHLs with N-acyl-side chains from C4 to C8 and the commercial C6-HSL induced the production of purple pigment by CV026 on the surface of AHL report plates (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). However, based on the results from the 131 \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates on the surface of AHL report plates, no strain displayed purple pigmentation, which indicated that the cow mastitis derived \u003cem\u003eK. pneumoniae\u003c/em\u003e did not produce AHLs with N-acyl-side chains from C4 to C8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ea).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eInfluence of AHLs on biofilm formation\u003c/h2\u003e \u003cp\u003eBiofilms of \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates with/without AHLs are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e and Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. For the isolates (Kp130, Kp41, Kp59) that did not form biofilm, the AHLs did not influence the biofilm formation ability of \u003cem\u003eK. pneumoniae\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eb). For the isolates that had weak ability to form biofilm (Kp131, Kp87, Kp39), only 3-oxo-C6-HSL significantly decreased the biofilm formation of Kp131 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) while C6-HSL did not. There was also no significant difference between the LB groups and the AHL-adding groups of the other two strains (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ec). However, for the isolates with medium (Kp120, Kp102, Kp21, Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ed) and strong (Kp3, Kp15, Kp18, Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ee) biofilm-formation, the biofilm formation abilities of the isolates declined significantly after the addition of C6-HSL or 3-oxo-C6-HSL (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eInfluence of AHLs on biofilm formation of \u003cem\u003eK. pneumoniae\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eStrains\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBiofilm in LB (OD\u003csub\u003e595\u003c/sub\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBiofilm in LB with 1 \u0026micro;M C6-HSL (OD\u003csub\u003e595\u003c/sub\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBiofilm in LB with 1 \u0026micro;M 3-oxo-C6-HSL (OD\u003csub\u003e595\u003c/sub\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eP value (LB with C6-HSL VS LB)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eP value (LB with 3-oxo-C6-HSL VS LB)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eNo biofilm producer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKp130\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.294\u0026thinsp;\u0026plusmn;\u0026thinsp;0.021\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0.283\u0026thinsp;\u0026plusmn;\u0026thinsp;0.035\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.268\u0026thinsp;\u0026plusmn;\u0026thinsp;0.027\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKp41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.277\u0026thinsp;\u0026plusmn;\u0026thinsp;0.047\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0.258\u0026thinsp;\u0026plusmn;\u0026thinsp;0.047\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.247\u0026thinsp;\u0026plusmn;\u0026thinsp;0.048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKp59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.296\u0026thinsp;\u0026plusmn;\u0026thinsp;0.026\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.019\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eWeak biofilm producer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKp131\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.538\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0.454\u0026thinsp;\u0026plusmn;\u0026thinsp;0.064\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.387\u0026thinsp;\u0026plusmn;\u0026thinsp;0.059\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKp87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.645\u0026thinsp;\u0026plusmn;\u0026thinsp;0.101\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0.577\u0026thinsp;\u0026plusmn;\u0026thinsp;0.044\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.586\u0026thinsp;\u0026plusmn;\u0026thinsp;0.059\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKp39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.55\u0026thinsp;\u0026plusmn;\u0026thinsp;0.114\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0.502\u0026thinsp;\u0026plusmn;\u0026thinsp;0.071\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.451\u0026thinsp;\u0026plusmn;\u0026thinsp;0.042\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eModerate biofilm producer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKp120,\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e1.276\u0026thinsp;\u0026plusmn;\u0026thinsp;0.182\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e1.012\u0026thinsp;\u0026plusmn;\u0026thinsp;0.176\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1.067\u0026thinsp;\u0026plusmn;\u0026thinsp;0.174\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKp102\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e1.273\u0026thinsp;\u0026plusmn;\u0026thinsp;0.163\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e1.039\u0026thinsp;\u0026plusmn;\u0026thinsp;0.175\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1.026\u0026thinsp;\u0026plusmn;\u0026thinsp;0.151\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKp21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e1.367\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e1.055\u0026thinsp;\u0026plusmn;\u0026thinsp;0.144\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1.084\u0026thinsp;\u0026plusmn;\u0026thinsp;0.059\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eStrong biofilm producer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKp3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e2.066\u0026thinsp;\u0026plusmn;\u0026thinsp;0.197\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e1.753\u0026thinsp;\u0026plusmn;\u0026thinsp;0.152\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1.673\u0026thinsp;\u0026plusmn;\u0026thinsp;0.195\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKp15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e2.086\u0026thinsp;\u0026plusmn;\u0026thinsp;0.174\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e1.682\u0026thinsp;\u0026plusmn;\u0026thinsp;0.176\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1.76\u0026thinsp;\u0026plusmn;\u0026thinsp;0.272\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKp18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e2.295\u0026thinsp;\u0026plusmn;\u0026thinsp;0.274\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e1.963\u0026thinsp;\u0026plusmn;\u0026thinsp;0.119\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1.921\u0026thinsp;\u0026plusmn;\u0026thinsp;0.254\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eAs an opportunistic pathogenic bacterium, \u003cem\u003eK. pneumoniae\u003c/em\u003e is ubiquitous in the environment of dairy farms and causes intramammary infection of dairy cows. In this study, the total isolation rate of \u003cem\u003eK. pneumoniae\u003c/em\u003e from 14 provinces was about 26.6%. The present study showed that \u003cem\u003eK. pneumoniae\u003c/em\u003e has become an important cause of dairy cattle mastitis in China.\u003c/p\u003e \u003cp\u003eIn order to accomplish infection in host animals or humans, \u003cem\u003eK. pneumoniae\u003c/em\u003e must break through the physical and immune barriers via a series of virulence factors. Capsule polysaccharide (CPS) used to be recognized as the most important virulence factor in \u003cem\u003eK. pneumoniae\u003c/em\u003e. This is because the presence of a thick capsule at the cell surface could prevent \u003cem\u003eK. pneumoniae\u003c/em\u003e from opsonization and phagocytosis by leukomonocytes, which results in host immune deficiency (Li, Zhao et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Although at least 78 capsule (K antigen) serotypes have been found in \u003cem\u003eK. pneumoniae\u003c/em\u003e, it was not well studied in the past. Six capsule serotypes (K1, K2, K5, K54, K57 and K20) which are highly associated with pathogenicity in humans (Yan, Zhou et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) were selected to detect \u003cem\u003eK. pneumoniae\u003c/em\u003e isolated in this study. Compared with the other K-types, K57 was obviously a major serotype of cow mastitis derived \u003cem\u003eK. pneumoniae\u003c/em\u003e strains, as was identified in a previous study in China that showed a high detection rate in \u003cem\u003eK. pneumoniae\u003c/em\u003e isolated from dairy cow mastitis (Cheng, Zhou et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Considering that the K antigen is an important potential antigen for vaccines, the K57 capsule has the potential for inclusion in subunit vaccines for prevention of bovine mastitis caused by \u003cem\u003eK. pneumoniae\u003c/em\u003e (Lin, Yang et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In addition, it will need further study for capsule serotypes of \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates to better understand what the role of \u003cem\u003eK. pneumoniae\u003c/em\u003e capsule plays in bovine mastitis.\u003c/p\u003e \u003cp\u003eThe degree of mucus production by \u003cem\u003eK. pneumoniae\u003c/em\u003e strains is likely to correlate positively with invasion and infection (Lin, Lu et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). In \u003cem\u003eK. pneumoniae\u003c/em\u003e of human origin, HMV strains were usually considered more virulent than non-HMV strains. However, in \u003cem\u003eK. pneumoniae\u003c/em\u003e of bovine mastitis origin, it lacked of strong evidence for the association of HMV phenotype and severe mastitis (Gao et al., 2019). Although several capsule serotypes are usually reported to be associated with the pathogenicity of \u003cem\u003eK. pneumoniae\u003c/em\u003e strains, some (10/19) of the \u003cem\u003eK. pneumoniae\u003c/em\u003e were not classified to these capsule serotypes in this study. This may be because the hypermucoviscous (HMV) phenotype of \u003cem\u003eK. pneumoniae\u003c/em\u003e is due to the hypersecretion of polysaccharides which are exopolysaccharides rather than capsule polysaccharides (Li, Zhao et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Furthermore, the mucovisosity-associated gene A (\u003cem\u003emagA\u003c/em\u003e) and regulator of mucoid phenotype (\u003cem\u003ermpA\u003c/em\u003e) have been associated with HMV colony phenotype. However, neither \u003cem\u003emagA\u003c/em\u003e nor \u003cem\u003ermpA\u003c/em\u003e was found in this study, and this might be the reason that these two mucoid phenotype-associated genes are often present in the \u003cem\u003eK. pneumoniae\u003c/em\u003e strains of K1 or K2 serotype from human patients (Chang, Bastian et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe virulence of \u003cem\u003eK. pneumoniae\u003c/em\u003e may be caused by other virulence factors, such as LPS, adhesion molecules, and iron-absorbing systems (Wang, Zhao et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In this study, some high prevalence virulence genes were also identified in \u003cem\u003eK. pneumoniae\u003c/em\u003e, such as \u003cem\u003efimH\u003c/em\u003e, \u003cem\u003emrkA\u003c/em\u003e, \u003cem\u003ewabG\u003c/em\u003e and \u003cem\u003eentB\u003c/em\u003e. The prevalence of \u003cem\u003efimH\u003c/em\u003e indicates that adherence of \u003cem\u003eK. pneumoniae\u003c/em\u003e to bovine mammary epithelial cells might rely on type 1 fimbriae, which mediate bacterial adhesion to host cells (Stahlhut, Chattopadhyay et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Another adhesion gene, \u003cem\u003emrkA\u003c/em\u003e, which is associated with type 3 fimbriae, could contribute to biofilm formation by \u003cem\u003eK. pneumoniae\u003c/em\u003e, which makes it difficult to eliminate by bovine immune cells (Vuotto, Longo et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). \u003cem\u003eWabG\u003c/em\u003e is involved in the biosynthesis of the core lipopolysaccharide whose mutation reduced \u003cem\u003eK. pneumoniae\u003c/em\u003e pathogenicity and colonization ability in experimental urinary tract infections of rats (Izquierdo, Coderch et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). In addition, it seemed that \u003cem\u003ewabG\u003c/em\u003e was more prevalent in the isolates of known capsule serotype (K5, K20, K57) than in the isolates of unknown serotype in Supplementary Fig.\u0026nbsp;1. The ability to obtain iron is critical for bacterial survival, and there are four siderophores (enterobactin, yersinabactin, salmochelin and aerobactin) in \u003cem\u003eK. pneumoniae\u003c/em\u003e. In this study, the prevalence of \u003cem\u003eentB\u003c/em\u003e (encoding enterobactin) was higher than that of the other iron absorbing genes in \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates from bovine mastitis. The results of this study are consistent with recent research in which \u003cem\u003eentB\u003c/em\u003e was more prevalent in \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates from clinical mastitis than from subclinical mastitis (Cheng, Zhou et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThere is growing concern regarding antibiotic resistance in \u003cem\u003eK. pneumoniae\u003c/em\u003e from bovine mastitis, which is leading to the emergence of more resistant bacteria. In this study, none of the isolates were susceptible to all selected antimicrobial agents, which might be caused by the overuse of antibiotics on some dairy farms. According to the antimicrobial result, the \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates showed high resistant to β-lactam antibiotics. Among the resistance mechanisms of β-lactam antibiotics, the expression of β-lactamase enzymes is one of the most studied and prevalent (Lima et al., 2020). By detecting eight common beta-lactam resistance genes, it was shown that the \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates carried multiple beta-lactam resistance genes, including \u003cem\u003eblaTEM\u003c/em\u003e, \u003cem\u003eblaSHV\u003c/em\u003e, \u003cem\u003eblaCTX-M\u003c/em\u003e, \u003cem\u003eblaDHA\u003c/em\u003e and \u003cem\u003eblaNDM\u003c/em\u003e, which accounted for the high rate of resistance to beta-lactam antibiotics. The \u003cem\u003evim\u003c/em\u003e gene was not found in the \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates. This was because VIM-type carbapenemase mostly occurred in \u003cem\u003eP. aeruginosa\u003c/em\u003e and \u003cem\u003eP. putida\u003c/em\u003e but very rarely in \u003cem\u003eEnterobacteriaceae\u003c/em\u003e. However, some resistance genotypes may not completely represent the phenotype; further studies are needed to establish the connections between them.\u003c/p\u003e \u003cp\u003eBiofilm plays an important role in antibiotic resistance. There are multiple mechanisms of biofilm resistance, such as changing the penetrability of drug agents, slowing growth, and activating the general stress response (Mah and O'Toole \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). The present results showed by crystal staining that most \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates could form biofilm \u003cem\u003ein vitro\u003c/em\u003e. In a biofilm study of \u003cem\u003eK. pneumoniae\u003c/em\u003e strains collected from human patients, \u003cem\u003ewcaG\u003c/em\u003e was found to be associated with bacterial biofilm formation (Zheng, Lin et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). However, in this study, only 16.8% of the mastitis derived \u003cem\u003eK. pneumoniae\u003c/em\u003e isolate\u003cem\u003es\u003c/em\u003e had \u003cem\u003ewcaG\u003c/em\u003e, and the proportion of weak biofilm producers containing \u003cem\u003ewcaG\u003c/em\u003e was higher than that of moderate or strong biofilm isolates (Supplementary Fig.\u0026nbsp;2). This might be explained by several possible factors. One potential explanation was that there was a difference between the \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates of human and cows. Another possibility was that the biofilm of \u003cem\u003eK. pneumoniae\u003c/em\u003e was mediated by a variety of factors, such as type 3 pili, capsular polysaccharides (Clegg and Murphy \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), outer membrane protein (Saurel, Iordanov et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) and c-di-GMP (Schumacher and Zeng \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In addition, quorum sensing plays an important role in mediating bacterial biofilm formation and resistance and provides a novel strategy for preventing infection with bacterial pathogens (Sikdar and Elias \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAHL is an important quorum sensing molecule in Gram-negative bacteria that participates in mediating multiple bacterial physiological activities, including biofilm, drug resistance, virulence factor production, etc. (Mukherjee and Bassler \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e, a kind of QS inhibitor that interacts with LasR, RhlR, was shown to inhibit both the production of the virulence factor pyocyanin and biofilm formation (O'Loughlin, Miller et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Although some AHL-producing \u003cem\u003eK. pneumoniae\u003c/em\u003e strains have been found in humans, poultry and the environment (Yin, Purmal et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2012\u003c/span\u003e, Hosny and Fadel \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), no AHL molecules were found in \u003cem\u003eK. pneumoniae\u003c/em\u003e in this study using the AHL biosensor reporter strain \u003cem\u003eC. violaceum\u003c/em\u003e CV026. One possible reason may be that this method was limited because the CviR of CV026 only respond to the AHLs with acyl side chain length from C4 to C8 (McClean, Winson et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e1997\u003c/span\u003e). Considering the potential of mixed infection of \u003cem\u003eK. pneumoniae\u003c/em\u003e with other bacteria and the diversity of udder microbiota, the present study analyzed the effect of AHL on the biofilm formation abilities of mastitis derived \u003cem\u003eK. pneumoniae\u003c/em\u003e strains. The results showed that AHLs could influence biofilm formation by some \u003cem\u003eK. pneumoniae\u003c/em\u003e strains with strong and intermediate biofilm formation abilities. However, the action of AHLs was opposite to that of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e (O'Loughlin, Miller et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), and the addition of exogenous C6-HSL or 3-oxo-C6-HSL decreased the ability of \u003cem\u003eK. pneumoniae\u003c/em\u003e to form biofilm. As the regulatory mechanisms in bacteria, and especially those in the host, are complicated, the specific function of AHL for \u003cem\u003eK. pneumoniae\u003c/em\u003e needs more investigation.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eAuthors\u0026rsquo; contributions\u003c/h2\u003e \u003cp\u003eXH, WC and JM participated in the design of the study. MW, ZL, MD and LN performed the experiments and analyzed the data. JZ and MW prepared the manuscript. YY and ZP contributed the mastitis materials. XZ, JW, HY, CH and WZ contributed reagents and analysis tools. XH, JW, ZC and WC revised the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e \u003c/div\u003e\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Key Project of Inter-Governmental International Scientific and Technological Innovation Cooperation (Grant No.2018YFE0102200), Shanghai Agriculture Applied Technology Development Program (Grant No. 2020-02-08-00-08-F01489), Priority Academic Program Development of Jiangsu Higher Education Institutions and Key Scientific and Technological Project of XPCC (Grant No. 2020AB025) and Research Foundation for Advanced Talents of Longyan University (Grant No. 2021ZN001).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e All data generated or analyzed during this study are included in this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study does not contain any experiments with human participants or animals.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAlcantar-Curiel MD, Blackburn D, Saldana Z, Gayosso-Vazquez C, Iovine NM, M. A. De la Cruz and J. A., Giron (2013) Multi-functional analysis of \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e fimbrial types in adherence and biofilm formation. Virulence 4(2): 129 \u0026ndash; 38.10.4161/viru.22974\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBengoechea JA, Sa Pessoa J (2019) \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e infection biology: living to counteract host defences. FEMS Microbiol Rev 43(2): 123 \u0026ndash; 44.10.1093/femsre/fuy043\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCandan ED, Aksoz N (2015) \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e: characteristics of carbapenem resistance and virulence factors. Acta Biochim Pol 62(4): 867 \u0026ndash; 74.10.18388/abp.2015_1148\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang L, Bastian I, Warner M (2013) Survey of \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e bacteraemia in two South Australian hospitals and detection of hypermucoviscous phenotype and \u003cem\u003emagA\u003c/em\u003e/\u003cem\u003ermpA\u003c/em\u003e genotypes in \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates. Infection 41(2): 559 \u0026ndash; 63.10.1007/s15010-012-0374-y\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng J, Zhou M, Nobrega DB, Cao Z, Yang J, Zhu C, Han B, Gao J (2021) Virulence profiles of \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e isolated from 2 large dairy farms in China. J Dairy Sci 104(8): 9027 \u0026ndash; 36.10.3168/jds.2020\u0026ndash;20042\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClegg S, Murphy CN (2016) Epidemiology and Virulence of \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e. Microbiol Spectr 4(1).10.1128/microbiolspec.UTI-0005-2012\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl-Domany RA, Awadalla OA, Shabana SA, El-Dardir MA, Emara M (2021) Analysis of the correlation between antibiotic resistance patterns and virulence determinants in pathogenic \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e isolates from Egypt. Microb Drug Resist 27(6): 727 \u0026ndash; 39.10.1089/mdr.2020.0236\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFux CA, Costerton JW, Stewart PS, Stoodley P (2005) Survival strategies of infectious biofilms. Trends Microbiol 13(1): 34-40.10.1016/j.tim.2004.11.010\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeikkila AM, Liski E, Pyorala S, Taponen S (2018) Pathogen-specific production losses in bovine mastitis. J Dairy Sci 101(10): 9493 \u0026ndash; 504.10.3168/jds.2018\u0026ndash;14824\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHolmes DS, Quigley M (1981) A rapid boiling method for the preparation of bacterial plasmids. Anal Biochem 114(1): 193 \u0026ndash; 7.10.1016/0003-2697(81)90473-5\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHosny RA, Fadel MA (2021) Detection of quorum sensing N-acyl-homoserine lactone molecules produced by different resistant \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e isolates recovered from poultry and different environmental niches. Appl Biochem Biotechnol 193(10): 3351 \u0026ndash; 70.10.1007/s12010-021-03605-w\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIzquierdo L, Coderch N, Pique N, Bedini E, Corsaro MM, Merino S, Fresno S, Tomas JM, Regue M (2003) The \u003cem\u003eKlebsiella pneumoniae wabG\u003c/em\u003e gene: role in biosynthesis of the core lipopolysaccharide and virulence. J Bacteriol 185(24): 7213 \u0026ndash; 21.10.1128/JB.185.24.7213-7221.2003\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJuan CH, Chuang C, Chen CH, Li L, Lin YT (2019) Clinical characteristics, antimicrobial resistance and capsular types of community-acquired, healthcare-associated, and nosocomial \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e bacteremia. Antimicrob Resist Infect Control 8: 1.10.1186/s13756-018-0426-x\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKurittu P, Khakipoor B, Aarnio M, Nykasenoja S, Brouwer M, Myllyniemi AL, Vatunen E, Heikinheimo A (2021) Plasmid-borne and chromosomal ESBL/AmpC genes in \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e in global food products. Front Microbiol 12: 592291.10.3389/fmicb.2021.592291\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi B, Zhao Y, Liu C, Chen Z, Zhou D (2014) Molecular pathogenesis of \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e. Future Microbiol 9(9): 1071 \u0026ndash; 81.10.2217/fmb.14.48\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin TL, Yang FL, Ren CT, Pan YJ, Liao KS, Tu IF, Chang YP, Cheng YY, Wu CY, Wu SH, Wang JT (2022) Development of \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e capsule polysaccharide-conjugated vaccine candidates using phage depolymerases. Front Immunol 13: 843183.10.3389/fimmu.2022.843183\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin YC, Lu MC, Tang HL, Liu HC, Chen CH, Liu KS, Lin C, Chiou CS, Chiang MK, Chen CM, Lai YC (2011) Assessment of hypermucoviscosity as a virulence factor for experimental \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e infections: comparative virulence analysis with hypermucoviscosity-negative strain. BMC Microbiol 11: 50.10.1186/1471-2180-11-50\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMah TF, O'Toole GA (2001) Mechanisms of biofilm resistance to antimicrobial agents. Trends Microbiol 9(1): 34 \u0026ndash; 9.10.1016/s0966-842x(00)01913-2\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarr CM, Russo TA (2019) Hypervirulent \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e: a new public health threat. Expert Rev Anti Infect Ther 17(2): 71-73.10.1080/14787210.2019.1555470\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcClean KH, Winson MK, Fish L, Taylor A, Chhabra SR, Camara M, Daykin M, Lamb JH, Swift S, Bycroft BW, Stewart G, Williams P (1997) Quorum sensing and chromobacterium violaceum: exploitation of violacein production and inhibition for the detection of N-acylhomoserine lactones. Microbiology (Reading) 143 (Pt 12): 3703 \u0026ndash; 11.10.1099/00221287-143-12-3703\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMukherjee S, Bassler BL (2019) Bacterial quorum sensing in complex and dynamically changing environments. Nat Rev Microbiol 17(6): 371 \u0026ndash; 82.10.1038/s41579-019-0186-5\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNgeow YF, Cheng HJ, Chen JW, Yin WF, Chan KG (2013) Short chain N-acylhomoserine lactone production by clinical multidrug resistant \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e strain CSG20. Sensors (Basel) 13(11): 15242 \u0026ndash; 51.10.3390/s131115242\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eO'Loughlin CT, Miller LC, Siryaporn A, Drescher K, Semmelhack MF, Bassler BL (2013) A quorum-sensing inhibitor blocks \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e virulence and biofilm formation. Proc Natl Acad Sci U S A 110(44): 17981-6.10.1073/pnas.1316981110\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRabin N, Zheng Y, Opoku-Temeng C, Du Y, Bonsu E, Sintim HO (2015) Biofilm formation mechanisms and targets for developing antibiofilm agents. Future Med Chem 7(4): 493-512.10.4155/fmc.15.6\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRusso TA, Olson R, Fang CT, Stoesser N, Miller M, MacDonald U, Hutson A, Barker JH, La Hoz RM, Johnson JR (2018) Identification of biomarkers for differentiation of hypervirulent \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e from Classical \u003cem\u003eK. pneumoniae\u003c/em\u003e. J Clin Microbiol 56(9).10.1128/JCM.00776 \u0026ndash; 18\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaurel O, Iordanov I, Nars G, Demange P, Le Marchand T, Andreas LB, Pintacuda G, Milon A (2017) Local and Global Dynamics in \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e Outer Membrane Protein a in Lipid Bilayers Probed at Atomic Resolution. J Am Chem Soc 139(4): 1590 \u0026ndash; 97.10.1021/jacs.6b11565\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchumacher MA, Zeng W (2016) Structures of the activator of \u003cem\u003eK. pneumonia\u003c/em\u003e biofilm formation, MrkH, indicates PilZ domains involved in c-di-GMP and DNA binding. Proc Natl Acad Sci U S A 113(36): 10067 \u0026ndash; 72.10.1073/pnas.1607503113\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSikdar R, Elias M (2020) Quorum quenching enzymes and their effects on virulence, biofilm, and microbiomes: a review of recent advances. Expert Rev Anti Infect Ther 18(12): 1221 \u0026ndash; 33.10.1080/14787210.2020.1794815\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStahlhut SG, Chattopadhyay S, Struve C, Weissman SJ, Aprikian P, Libby SJ, Fang FC, K. A., Krogfelt, Sokurenko EV (2009) Population variability of the FimH type 1 fimbrial adhesin in \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e. J Bacteriol 191(6): 1941 \u0026ndash; 50.10.1128/JB.00601-08\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eViswanath G, Sekar J, Ramalingam PV (2020) Detection of diverse n-acyl homoserine lactone signalling molecules among bacteria associated with rice rhizosphere. Curr Microbiol 77(11): 3480 \u0026ndash; 91.10.1007/s00284-020-02183-0\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVuotto C, Longo F, Pascolini C, Donelli G, Balice MP, Libori MF, Tiracchia V, Salvia A, Varaldo PE (2017) Biofilm formation and antibiotic resistance in \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e urinary strains. J Appl Microbiol 123(4): 1003 \u0026ndash; 18.10.1111/jam.13533\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang G, Zhao G, Chao X, Xie L, Wang H (2020) The characteristic of virulence, biofilm and antibiotic resistance of \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e. Int J Environ Res Public Health 17(17).10.3390/ijerph17176278\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWayne P (2020) Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. 11th ed. CLSI standard M07, Clinical and Laboratory Standards Institute\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWyres KL, Holt KE (2018) \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e as a key trafficker of drug resistance genes from environmental to clinically important bacteria. Curr Opin Microbiol 45: 131 \u0026ndash; 39.10.1016/j.mib.2018.04.004\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu Z, Liang Y, Lin S, Chen D, Li B, Li L, Deng Y (2016) Crystal violet and XTT assays on \u003cem\u003eStaphylococcus aureus\u003c/em\u003e biofilm quantification. Curr Microbiol 73(4): 474 \u0026ndash; 82.10.1007/s00284-016-1081-1\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan Q, Zhou M, Zou M, Liu WE (2016) Hypervirulent \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e induced ventilator-associated pneumonia in mechanically ventilated patients in China. Eur J Clin Microbiol Infect Dis 35(3): 387 \u0026ndash; 96.10.1007/s10096-015-2551-2\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin WF, Purmal K, Chin S, Chan XY, Koh CL, Sam CK, Chan KG (2012) N-acyl homoserine lactone production by \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e isolated from human tongue surface. Sensors (Basel) 12(3): 3472 \u0026ndash; 83.10.3390/s120303472\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng JX, Lin ZW, Chen C, Chen Z, Lin FJ, Wu Y, Yang SY, Sun X, Yao WM, Li DY, Yu ZJ, Jin JL, Qu D, Deng QW (2018) Biofilm formation in \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e bacteremia strains was found to be associated with CC23 and the presence of \u003cem\u003ewcaG\u003c/em\u003e. Front Cell Infect Microbiol 8: 21.10.3389/fcimb.2018.00021\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"AHL, bovine mastitis, biofilm, drug resistance, Klebsiella pneumoniae, virulence gene","lastPublishedDoi":"10.21203/rs.3.rs-3027187/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3027187/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e (\u003cem\u003eK. pneumoniae\u003c/em\u003e) is a major common environmental pathogen which causes bovine mastitis. To investigate the epidemic of \u003cem\u003eK. pneumoniae\u003c/em\u003e of China, 131 \u003cem\u003eK. pneumoniae\u003c/em\u003e strains were isolated from 495 clinical mastitis milk samples from 14 provinces in China. The isolation rate of \u003cem\u003eK. pneumoniae\u003c/em\u003e was 26.5%, and K57 was the dominant serotype (45.0%, 59/131). Nineteen (14.5%) isolates were identified as hypervirulent \u003cem\u003eK. pneumoniae\u003c/em\u003e (hvKP) and nine of them belonged to the K57 serotype. The \u003cem\u003emrkA\u003c/em\u003e, \u003cem\u003eentB\u003c/em\u003e, \u003cem\u003ewabG\u003c/em\u003e and \u003cem\u003efimH\u003c/em\u003e genes were prevalent virulence genes while \u003cem\u003ermpA\u003c/em\u003e, \u003cem\u003emagA\u003c/em\u003e and \u003cem\u003eycf\u003c/em\u003e were not found in \u003cem\u003eK. pneumoniae\u003c/em\u003e. Furthermore, \u003cem\u003eK. pneumoniae\u003c/em\u003e had serious drug resistance and multiple beta-lactamase genes were detected, including \u003cem\u003eblaTEM\u003c/em\u003e, \u003cem\u003eblaSHV\u003c/em\u003e, \u003cem\u003eblaNDM\u003c/em\u003e, \u003cem\u003eblaCTX-M\u003c/em\u003e, \u003cem\u003eblaDHA\u003c/em\u003e and \u003cem\u003eblaKPC\u003c/em\u003e. Biofilm was an important factor in bacterial resistance and persistent infection, and 77.1% isolates could form biofilm. Although acylated homoserine lactone (AHL, a Gram-negative bacterial quorum sensing signal molecule) was not confirmed among the \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates, exogenous AHLs could reduce the biofilm formation ability of the \u003cem\u003eK. pneumoniae\u003c/em\u003e strains. In conclusion, the high rate of isolation and serious antibiotic resistance of \u003cem\u003eK. pneumonia\u003c/em\u003e were found in this study and indicated a potential threat to public health from the food chain.\u003c/p\u003e","manuscriptTitle":"Molecular characterization of Klebsiella pneumoniae in clinical bovine mastitis in 14 provinces in China","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-06-08 13:51:44","doi":"10.21203/rs.3.rs-3027187/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b528372b-c453-4f5f-b712-d402d8c8ab24","owner":[],"postedDate":"June 8th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-06-08T13:51:46+00:00","versionOfRecord":[],"versionCreatedAt":"2023-06-08 13:51:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3027187","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3027187","identity":"rs-3027187","version":["v1"]},"buildId":"iFTdqyg4nuje_uAy1AHro","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}