Meta-analysis and experimental evidence reveal no impact of Nosema ceranae infection on honeybee carbohydrate consumption

Meta-analysis and experimental evidence reveal no impact of Nosema ceranae infection on honeybee carbohydrate consumption | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Meta-analysis and experimental evidence reveal no impact of Nosema ceranae infection on honeybee carbohydrate consumption View ORCID Profile Monika Ostap-Chec , View ORCID Profile Weronika Antoł , View ORCID Profile Daniel Bajorek , View ORCID Profile Ewelina Berbeć , View ORCID Profile Dawid Moroń , View ORCID Profile Marcin Rapacz , View ORCID Profile Krzysztof Miler doi: https://doi.org/10.1101/2025.02.11.637035 Monika Ostap-Chec 1 Institute of Systematics and Evolution of Animals of the Polish Academy of Sciences , Kraków, Poland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Monika Ostap-Chec For correspondence: ostap.chec{at}isez.pan.krakow.pl miler{at}isez.pan.krakow.pl Weronika Antoł 1 Institute of Systematics and Evolution of Animals of the Polish Academy of Sciences , Kraków, Poland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Weronika Antoł Daniel Bajorek 1 Institute of Systematics and Evolution of Animals of the Polish Academy of Sciences , Kraków, Poland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Daniel Bajorek Ewelina Berbeć 2 Department of Bees Breeding, Institute of Animal Husbandry and Breeding, Wroclaw University of Environmental and Life Sciences , Wrocław, Poland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Ewelina Berbeć Dawid Moroń 1 Institute of Systematics and Evolution of Animals of the Polish Academy of Sciences , Kraków, Poland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Dawid Moroń Marcin Rapacz 3 Department of Plant Breeding , Physiology, and Seed Science, University of Agriculture in Kraków , Poland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Marcin Rapacz Krzysztof Miler 1 Institute of Systematics and Evolution of Animals of the Polish Academy of Sciences , Kraków, Poland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Krzysztof Miler For correspondence: ostap.chec{at}isez.pan.krakow.pl miler{at}isez.pan.krakow.pl Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Honeybees ( Apis mellifera ) are indispensable pollinators, essential for ecosystem stability and agricultural productivity. However, they face numerous challenges, including pathogens that threaten their survival and ecosystem services. Among these pathogens, Nosema ceranae , a microsporidian parasite, causes significant damage to the intestinal tract and induces energetic imbalances in an organism, posing a major threat to both individual bees and entire colonies. In response to infections, bees often engage in behavioural defenses, such as selecting foods with higher antibiotic properties. We hypothesized that bees infected with N. ceranae might compensate behaviourally by increasing their carbohydrate consumption. To test this hypothesis, we conducted a meta-analysis of existing studies comparing sugar consumption in healthy and infected bees, complemented by an experimental study. In our experiment, we measured sugar intake and quantified trehalose levels in the hemolymph, a key indicator of energy reserves. Both the meta-analysis and experimental results consistently showed no significant differences in sugar consumption between healthy and infected bees. Similarly, trehalose levels in the hemolymph remained comparable between the two groups. Our findings suggest that the infection caused by N. ceranae does not elicit compensatory feeding behavior in honeybees. Moreover, the meta-analysis revealed significant gaps in current research, particularly a lack of studies focusing on forager bees, which face the highest energetic demands among colony members. Our findings call for future studies on the energetic effects of nosemosis and studies conducted under natural or semi-natural conditions. Introduction Parasites are among the most ubiquitous organisms on Earth, exerting both direct and indirect negative effects on their hosts [ 1 ]. Throughout coevolution, hosts have developed a range of strategies to defend themselves [ 2 ]. One of the first lines of defense against parasites lies in infection avoidance behavior. This defense is not always possible as, for example, intestinal parasites often enter the host accidentally, via ingestion of food or water. In response to parasitic infections, hosts may show changes in their appetite, dietary preferences, and foraging behavior [ 3 , 4 ]. These changes may stem from adaptive responses of the host, host manipulation by parasites, or even be a by-product of infection [ 5 ]. Self-medication and compensatory feeding are among the most prevalent adaptive behavioral responses of hosts to gut infections. Self-medication involves the active selection of substances with therapeutic properties to combat infection [ 6 , 7 ], while compensatory feeding focuses on replenishing resources lost due to infection or its treatment [ 8 , 9 ]. These strategies can be difficult to distinguish, but the key distinction lies in the fact that self-medication involves diets that are harmful to healthy individuals [e.g. 10, 11], whereas compensatory feeding does not incur harmful effects for uninfected individuals [e.g. 12]. Thus, dietary compensation in infected individuals often involves the intake of familiar foods in different proportions or increased quantities [ 13 , 14 ]. Honeybees ( Apis mellifera ) are critical pollinators that support both natural ecosystems and agricultural productivity [ 15 ]. However, these insects face numerous threats, among which parasitic infections stand out as a significant challenge to their health and survival [ 16 ]. Nosemosis, caused by Nosema ceranae and N. apis , is one of the most extensively studied gut infections in honeybees due to its severe impact on entire colony health. Given the critical role of honeybees in pollination, understanding and mitigating the effects of Nosema infection seems vital [ 17 – 19 ]. Transmission of Nosema spores is often accidental and difficult to avoid as it can occur via food exchange between individuals, collection of contaminated resources, or even sexually, between drones and queens [ 20 – 22 ]. Among the two agents responsible for nosemosis, N. ceranae has received greater attention due to its broader host range, year-round infection cycles with limited seasonal variation, and higher biotic potential across varying temperatures [ 23 , 24 ]. N. ceranae completes its life cycle within the epithelial cells of the honeybee midgut, a critical area for nutrient absorption [ 25 , 26 ]. Once spores reach the midgut, they multiply rapidly, exploiting host resources and triggering cell destruction, ultimately resulting in gut lesions, impaired absorption, and other effects (reviewed in [ 27 , 28 ]). Although infected bees may not show overt symptoms, they often suffer from digestive disorders, lethargy, and shortened lifespans [ 19 , 23 , 29 – 32 ]. The physiological damage and chronic energetic stress from N. ceranae infection contribute to immunosuppression in honeybees [ 33 – 37 ]. Transcriptomic analyses have shown the upregulation of energy metabolism genes in the midgut cells of infected bees [ 38 , 39 ], reflecting the parasite’s demand for host resources. Indeed, Nosema parasites, lacking mitochondria, rely on their hosts for essential energy sources, such as adenosine triphosphate (ATP), for their growth and reproduction [ 40 ]. The metabolic stress imposed by N. ceranae infection is further evidenced by decreased levels of hemolymph trehalose, a key sugar used for energy storage [ 41 – 43 ]. These energetic strains not only impair digestion but also affect thermoregulation and increase susceptibility to starvation [ 38 , 44 , 45 ]. Infected bees show prolonged foraging times and decreased flight frequency [ 46 – 49 ], likely due to the energetic burden of infection [ 43 – 45 , 50 ]. Given that carbohydrates are the primary fuel for honeybee flight [ 43 , 51 ], these effects can significantly reduce foraging success, as evidenced by reduced food stores in colonies heavily infected with N. ceranae [ 52 ]. Given the severe energetic strain and digestive impairment caused by N. ceranae infections, one might expect honeybees to exhibit adaptive changes in their feeding behavior to compensate for energy deficits. While honeybees are known to adjust their diets in response to various stressors, such as selecting nectar with higher antibiotic properties [ 53 ] or gathering propolis to reduce parasite loads [ 54 ], the impact of N. ceranae on carbohydrate intake remains inconclusive. Considering the unresolved questions regarding the effects of N. ceranae on honeybee feeding behavior, this study aimed to systematically investigate whether infection prompts an increase in carbohydrate consumption as a compensatory response. We conducted a systematic review and meta-analysis of existing literature to assess food intake patterns in healthy versus infected bees. Additionally, we conducted a laboratory experiment to measure food intake and trehalose levels in both healthy and infected bees. We hypothesised that infection with N. ceranae depletes the energy reserves of honeybees, and in response, bees may compensate for this loss by increasing their carbohydrate intake. Methods 1. Consumption experiment 1.1. Experimental procedure We conducted the experiment using four unrelated, queenright honeybee colonies, each in good overall condition and previously treated with oxalic acid against Varroa destructor in early spring. The bees were also examined for Nosema infection (see below). We removed a single brood frame with capped cells, free of adult bees, from each colony and placed it in an incubator (KB53, Binder, Germany) set at 32°C overnight. The following day, newly emerged, one-day-old bees were collected and individually placed on Petri dishes. To increase feeding motivation, the bees were kept without food for approximately one hour. The bees were then divided into two treatment groups: infected and control. Bees in the infected group were individually fed a 10 µl drop of 1M sucrose solution containing 100,000 Nosema ceranae spores, while bees in the control group received a 10 µl drop of 1M sucrose solution without spores. The bees were monitored for up to three hours, and those that fully consumed their solution were promptly transferred to the appropriate wooden cage prepared in advance. Bees that did not consume their solution were excluded from the experiment. For each colony, we established 10 cages: five replicates containing infected bees and five containing control bees, with each cage housing 40 bees. This resulted in 200 bees per treatment group per colony, amounting to a total of 20 cages (1000 bees) per treatment group across all colonies. The cages were provided with ad libitum water and gravity feeders with 40% sucrose solution, then placed in an incubator (KB400, Binder, Germany) maintained at 32 °C. After an acclimation period of 24 hours, the initial number of living bees in each cage was recorded. Each morning, the water and food in each cage were renewed and weighed both before and after renewal to calculate daily food consumption over the preceding 24 hours. Mortality was monitored daily, with all dead individuals removed. The experiment continued for 14 days. On the final day, three bees from each cage were frozen for later analysis to confirm infection status (control vs. infected). Additionally, hemolymph was collected from five bees per cage using the antennae method [ 55 ]. Each hemolymph sample was collected into a 10 μl end-to-end microcapillary and frozen at –20 °C for later analysis of trehalose content. 1.2. Preparation of spores for infection and their genetic identification To confirm the identity of the N. ceranae spores, we used PCR following the protocol by Berbeć et al. [ 56 ]. In brief, 50 µl of the spore suspension was incubated in TNES buffer (100 mM Tris-HCl pH 8.0, 5 mM EDTA, 0.3 % SDS, 200 mM NaCl) with 8 µl of proteinase K (10 mg/ml) for 2 hours at 56°C with shaking. After incubation, the DNA was extracted by centrifugation, followed by precipitation with an equal volume of 100% isopropanol. The DNA pellet was then washed twice with 70% ethanol, dried, and resuspended in 50 µl of nuclease-free water. PCR amplification was conducted using species-specific primers targeting the rRNA genes of Nosema species, with a PCR Mix Plus kit containing PCR anti-inhibitors (A&A Biotechnology). The amplification conditions were as follows: an initial denaturation at 94°C for 3 minutes, followed by 35 cycles of 94°C for 30 seconds, 52°C for 30 seconds, and 72°C for 30 seconds. The following primer pairs were used: for N. ceranae : forward: 5’- CGGATAAAAGAGTCCGTTACC, reverse: 5’- TGAGCAGGGTTCTAGGGAT [ 57 ], and for N. apis : forward: 5’- CCATTGCCGGATAAGAGAGT, reverse: 5’- CCACCAAAAACTCCCAAGAG [ 58 ]. The PCR products were analyzed using gel electrophoresis to confirm the exclusive presence of N. ceranae . The spore suspension used for experimental inoculation was freshly prepared on the same day the bees were fed. We sourced the spores from our stock population of infected honeybees, which were maintained in controlled incubator conditions to sustain the infection for spore harvesting. To prepare the suspension, we homogenized the digestive tracts of several infected individuals using a micropestle in distilled water. The mixture was centrifuged (Frontier 5306, Ohaus, Switzerland) at 6,000 G for 5 minutes, repeating this process three times. After each centrifugation, the supernatant was replaced with fresh distilled water. The final supernatant was replaced with a 1M sucrose solution, and the concentration of spores was determined using a Bürker hemocytometer under a Leica DMLB light microscope equipped with phase contrast (PCM) and a digital camera. The final infection solution was adjusted to achieve a concentration of 100,000 spores per 10 µl by diluting with 1M sucrose solution. 1.3. Verification of Nosema infection status To confirm that bees exposed to N. ceranae spores were indeed infected and that bees in the control group remained uninfected, we assessed spore levels using qPCR quantification. We sampled three bees from each cage within both treatment groups across all colonies (as described above), resulting in a total of 15 infected and 15 control bees per colony (120 individuals overall). Additionally, to ensure that the colonies used for the experiment were initially free from N. ceranae infection, we tested their infection status. For this, we collected two bees from the same brood frames used to gather one-day-old bees, froze them, and subsequently analyzed their spore presence using qPCR to confirm they were free of Nosema spores. 1.4. DNA extraction and sample preparation for qPCR For DNA extraction, the abdomens of individual bees were cut using sterile instruments and placed into 2 ml cryovials, each containing 800 µl dH 2 O. The samples were homogenized using a Bead Ruptor ELITE homogenizer (Omni International) with a combination of “small” (0.5 mm) and “big” (2.8 mm) ceramid beads (Omni International). From each homogenate, a 200 µl aliquot was taken for DNA extraction following a solution-based protocol with Nuclei Lysis Solution and Protein Precipitation Solution (Promega). The resulting DNA pellets were resuspended in 100 µl of 1× TE buffer for further analysis. 1.5. Quantification of N. ceranae load by qPCR To quantify the parasite load, we amplified a 65 bp fragment of the N. ceranae Hsp70 gene using primers designed by Cilia et al. [ 59 ]. Since the Hsp70 gene exists as a single copy per spore, the measured copy number can be directly translated into the spore load per individual [ 59 , 60 ]. The original DNA extracts were diluted 10× for qPCR which was performed using a CFX96 Touch Real-Time PCR Detection System (Bio-Rad) in a 20 µl reaction mix containing: 5 µl of DNA template, 10 µl of SsoAdvanced TM Universal SYBR ® Green Supermix (Bio-Rad), target primers at a final concentration of 0.2 µM (see Table 1 for primer sequences), and ddH 2 O up to a total volume of 20 µl. The cycling conditions were as follows: an initial denaturation at 98 °C for 3 minutes, followed by 40 cycles of 98 °C for 15 seconds and 60 °C for 30 seconds. View this table: View inline View popup Download powerpoint Table 1. Primers used in qPCR for Hsp70 amplification and absolute quantification. For absolute quantification, a purified PCR product of a broader 824 bp Hsp70 fragment was used as a standard. The fragment was amplified using newly designed primers (see Table 1 ) in a 25 µl reaction mix containing: 2 µl of DNA extract from an infected bee, 12.5 µl of DreamTaq TM Hot Start PCR Master Mix, 0.4 µM of each primer, and ddH 2 O to a final volume of 25 µl. The cycling conditions were: initial denaturation at 95 °C for 3 minutes, followed by 40 cycles of 95 °C for 30 seconds, 58 °C for 30 seconds, and 72 °C for 60 seconds, with a final elongation at 72 °C for 5 minutes. To increase yield, products from multiple reactions were pooled and subjected to agarose gel electrophoresis. The target band was then excised and purified using the ZymoClean Gel Recovery Kit. The concentration of the purified product was measured using a Qubit Broad Range Assay. The copy number was calculated based on the concentration and fragment length according to Qiagen guidelines [ 61 ] for absolute quantification. A standard curve for each plate was prepared using the purified product, with a dilution series covering a dynamic range of 8 logs (from 10 −1 to 10 6 copies). Standards were run in triplicate and samples were in duplicate on each qPCR plate. The method demonstrated a sensitivity of 6.20 × 10 −1 copies/µl (equivalent to 2 480 copies/bee or 3.39 log copies/bee), which was the lowest concentration in the dilution series with high reproducibility and strong linearity (R 2 ≥ 0.996). PCR efficiencies for the standard curve between 90 and 110% were accepted. To confirm specificity, a melting curve analysis was performed at the end of each run, covering the temperature range of 65-95 °C in 0.5 °C increments, with a dwell time of 5 seconds per step. 1.6. Calculation of spore load To determine the spore load, the mean starting quantity of the template for each duplicate based on the standard curve was calculated. The results were expressed as the number of Hsp70 copies/µl, which corresponds to the number of spores (following Cilia et al. [ 59 ]). Given that: DNA extract was diluted 10× for the reaction, the total DNA extract volume was 100 µl, and that the DNA extraction was performed on 1/4 of the original homogenate volume, the initial spore count was multiplied by 4000. Finally, the values were log 10 -transformed to obtain the spore load as the log number of spores per bee. 1.7. Hemolymph trehalose analysis Trehalose levels were measured using a trehalose assay kit (K-TREH, Neogen, USA), following the manufacturer’s protocol. Each hemolymph sample (1 μl) was diluted 200-fold with distilled water. Samples with less than 1 µl were discarded, as volumes below this threshold were considered not precise enough for quantitative analysis. For the assay, 20 µl of each diluted sample was analyzed in duplicate. The analysis was performed in batches (consecutive plates). The increase in absorbance, resulting from enzymatic reaction products, was measured at 340 nm using the Multiskan FC microplate reader (Thermo Scientific, USA). Trehalose concentrations were calculated using a calibration curve ranging from 0.00625 to 0.4 g/l and adjusted by a factor of 200 to reflect the original concentration in the undiluted samples. Due to the detection limit of the assay kit (1 g/l after correcting for dilution), any values below this threshold were considered 0. In total, we analyzed 84 samples from the control group and 65 from the infected group. 1.8. Statistical analysis All statistical analyses were performed using R [ 62 ]. Daily sucrose solution consumption was calculated based on the differences in the feeder weight. The per capita consumption (mg/bee/day) was estimated by dividing the total consumption by the number of live bees on a given day, yielding the average amount of food consumed per individual per day. To analyze this consumption data, we employed a generalized additive model (GAM, [ 63 ] using the mgcv package [ 64 , 65 ]). The model, with a Gaussian distribution and an identity link function, was used to examine the relationship between sugar consumption and time (days) for both the control and infected groups. The colony and cage (replicate) nested within the colony were included as random effects. For mortality analysis, we used Cox mixed-effects regression with the survival and lme4 packages [ 65 , 66 ]. The model included group (control vs. infected) as a fixed effect, with colony and cage (replicate) nested within the colony as random effects. Trehalose levels were analyzed using a linear mixed-effect model fitted with the lmer function from the lme4 package [ 66 ]. The model included group (control vs. infected) as a fixed factor, while colony, cage (replicate), and plate (data analysis batch) were treated as random effects. Data were transformed by applying square root to achieve a normal distribution of residuals. The significance of the fixed effect was tested using the anova function (stats package) [ 62 ]. 2. Systematic review and meta-analysis We conducted a systematic review and meta-analysis following the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines [ 68 ]. The review protocol was not pre-registered. 2.1. Eligibility criteria We established the following eligibility criteria for studies to be included in the systematic review and meta-analysis: (i) studies using worker honeybees ( A. mellifera ), (ii) laboratory experiments comparing workers exposed to N. ceranae spores with workers not exposed to Nosema , and (iii) studies reporting food consumption measurements for both groups over time. 2.2. Data sources and search An electronic search was conducted on January 16, 2024, using the Web of Science and Scopus databases. The search phrase used was “nosema and apis” in the topic, along with a forward search (i.e. documents citing one or more works from the list) refined by the same phrase. References were de-duplicated using Mendeley and then Zotero. We filtered out articles with “review” or “meta-analysis” in the title and further searched for all studies containing “ceranae” in the title, abstract, or keywords. Titles and abstracts of these articles were reviewed for potential inclusion. Two independent investigators assessed the eligibility of the articles, with studies marked as potentially eligible by either investigator being included for full-text review. 2.3. Extraction of study details and study exclusion From the eligible studies, we extracted the following data: (i) mean and standard deviation (SD) of food consumption for both groups, (ii) number of replicates per group, (iii) duration of consumption measurement (days), (iv) concentration of sucrose solution used, (v) age of the inoculated workers, (vi) method of inoculation (individual or collective), and (vii) inoculation dose (spores per individual). Data extraction was performed by one investigator. In cases where data were reported in a different format, appropriate conversions were applied to standardize measurements (mg/bee/day). As such, in two cases, SD was calculated from the reported standard error (SE) using the formula SD = SE × √ sample size . In one case, SD was obtained from the range of values (range divided by 4). In five cases, the mean and SD were calculated based on the median, quartiles, and maximum/minimum values using the method by Wan et al. [ 69 ]. In seven cases, the data were reported as volume (μL), so we converted it to mass (mg) using the following formula: consumed mg = sucrose solution concentration used in the study × 1.39 g/ml × consumed volume reported × 1000 mg/g. If not available in the text, the data were extracted from figures using Web Plot Digitizer [ 70 ] for maximum accuracy. Studies were excluded if: (i) there was no comparison between infected and control groups (e.g. consumption measured only for the infected), (ii) food consumption was measured but not reported in a usable form (e.g. data not shown), (iii) complete data extraction was not possible due to missing information (e.g. unknown worker age, infection dose, mode of infection, sucrose solution concentration). In two studies where the number of replicates varied between groups and was not specified, we assumed the lowest reported replicate count for both groups. 2.4. Risk of bias The risk of bias was assessed by one investigator based on: (i) similarity of baseline characteristics between control and infected groups (low bias if similar, high bias if not, and unclear if differentiating factors were of unknown effect), and (ii) whether contamination was measured and reported (low bias if measured and reported, high bias if not, and unclear if not mentioned). 2.5. Meta-analysis The meta-analysis was conducted in R [ 62 ] using the metafor [ 71 ] and orchaRd packages [ 72 ]. We calculated standardized mean differences (SMDs) in consumption between infected and control groups for each study. A multivariate random-effects model was fitted using the rma.mv function, with random effects at the study level. Results were visualized using an orchard plot, and heterogeneity was assessed with Q and I 2 statistics. An influence analysis was conducted to identify outliers based on Cook’s distance, and the analysis was repeated with influential studies removed. A meta-regression was conducted to examine potential sources of heterogeneity, using the following moderators: age at inoculation, inoculation dose, duration of study, and mode of inoculation, as fixed effects. 2.6. Publication bias Publication bias was assessed visually using a funnel plot by examining the degree of effect asymmetry (plotting standard error against SMDs, see Supplementary Material 1) and statistically using Egger’s test. 2.7. Quality of evidence The strength of the evidence was evaluated by one investigator using the Grading of Recommendations Assessment, Development, and Evaluation (GRADE) guidelines [ 73 ]. The quality assessment considered study design, risk of bias, publication bias, inconsistencies, indirectness, imprecision, and the effect size in the included studies. Results 1. Consumption experiment The analysis revealed that infection with N. ceranae spores had no significant effect on sugar consumption in honeybees (estimate ± SE, control: 45.53 ± 1.54 mg/bee/day, infected: 44.68 ± 1.54 mg/bee/day; t = -0.953, p = 0.341). However, sugar consumption patterns over time displayed significant non-linearity in both groups (control: F = 31.84, p < 0.001, edf = 6.44; infected: F = 28.90, p 2) indicate strong non-linear trends ( Fig. 1 ) characterized by a steep increase in consumption during the initial days, followed by a more stable intake for the remaining time. The model accounted for 34% of the variance in sugar consumption. Download figure Open in new tab Fig. 1. Sucrose consumption (mg/bee) in control and infected bees over 14 days. There are no significant differences between groups. Lines represent generalized additive model predictions and shaded areas show 95% CI. Mortality rates differed significantly between the two groups. The hazard ratio, representing the risk of death, was 2.87 times higher (SE: 0.12) for infected bees compared to control individuals (z = 8.84, p < 0.001, Fig. 2 ). Download figure Open in new tab Fig. 2. Survival plot for control (healthy) and Nosema -infected bees over the 14 days. Each group consisted of 20 cages, with an initial number of individuals of 37-40 bees per cage. Lines represent Cox regression predictions and shaded areas show 95% CI. Spore loads differed significantly between the groups. In the infected group (N = 60), the mean log spore count per bee (± SD) was 6.58 ± 1.15, whereas the control group (N = 60) showed a much lower spore level of 2.59 ± 1.12, comparable to background spore counts in bees sampled directly from the frames before the experiment (N = 12, 2.05 ± 1.27). These background levels were consistent with previous studies [ 74 – 76 ]. To account for the possible cross-contamination with spores during DNA extraction, extraction blanks (N = 4) were analyzed, showing minimal spore levels (1.83 ± 1.27 log spores in the whole homogenate volume). At the end of the 14-day experiment, no significant differences were found in hemolymph trehalose levels between the Nosema -infected and control bees (F = 0.5568, p = 0.48, Fig. 3 ). The mean trehalose level in the control group was 27.86 ± 0.62 g/l (estimate ± SE, back-transformed from the square root) and in the infected group – 24.54 ± 0.63 g/l. Download figure Open in new tab Fig. 3. Trehalose levels in control and Nosema -infected groups of bees at the end of the 14-day experiment. Black squares indicate model estimates and whiskers show confidence intervals, both back-transformed from the square root. Individual datapoints are shown as dots. 2. Systematic review and meta-analysis 2.1. Study characteristics Our search yielded 8259 documents (2478 from Web of Science and 5781 from Scopus). After excluding two retracted articles and de-duplicating, 4481 documents remained. Filtering out reviews and meta-analyses removed an additional 114 articles and among those remaining, 819 documents contained “ceranae” in the title, abstract, or keywords. From these, we retrieved 207 potentially eligible articles for full-text review (listed in Supplementary Material 2), ultimately identifying 15 eligible studies from 14 documents. The current experiment was added as the 16th study ( Fig. 4 ). Download figure Open in new tab Fig. 4. PRISMA flow diagram of the study selection process. Among the included studies ( Table 2 ), only two used more than 10 replicates, with most relying on three to four replicates (56% of studies). The average duration of sucrose consumption measurement was two weeks, with 81% of studies using a 50% sucrose solution as food. Most studies inoculated one-day-old workers, while only two used bees of at least 10 days of age. Individual inoculation was more common (69% of studies), typically using a dose of 100,000 spores (56 % of studies). View this table: View inline View popup Download powerpoint Table 2. Overview of studies included in the systematic review and meta-analysis. 2.2. Risk of bias The overall risk of bias was low. Baseline characteristics of bees were similar between groups in most studies, and only two studies failed to report contamination appropriately. 2.3. Meta-analysis The random-effects meta-analysis showed that infection with N. ceranae had no significant effect on sucrose consumption (SMD = 0.0765 [95% CI: -0.3073, 0.4602], z = 0.3905, p = 0.6962) ( Fig. 5 ). There was high heterogeneity (Q = 332.40, df = 15, p < 0.0001, I 2 = 94.91%). Download figure Open in new tab Fig. 5. Orchard plot of standardized mean differences in sucrose consumption. Dots represent individual effect sizes, scaled by their precision, and numbers refer to the study number in the meta-analysis. The model estimate is shown as a dot outlined in black, with thin black lines indicating the 95% confidence intervals (CI) and thick black lines indicating the 95% prediction intervals (PI). The I² statistic estimates heterogeneity across studies. Influence analysis identified four outliers (studies number 1, 10, 13, and 14). Removing these outliers reduced heterogeneity but it remained substantial (Q = 19.25, df = 11, p = 0.0568; I 2 = 40.40%). After outlier removal, there was still no significant effect of infection on consumption rates (SMD = 0.031 [95% CI: -0.165, 0.104], z = 0.447, p = 0.655). 2.4. Exploration of data heterogeneity Subgroup meta-analysis comparing individual versus collective Nosema inoculation methods revealed no significant differences (Q = 0.16, df = 1, p = 0.692), with similar levels of heterogeneity (individual: 96.9%, collective: 79.4%). Among the moderators assessed (inoculation dose, age at inoculation, and duration of study), only inoculation age had a significant effect (estimate ± SE = 0.174 ± 0.077, p = 0.024). This suggests that studies using older bees reported higher effect sizes. In contrast, dose and duration had no significant impact (p > 0.05). 2.5. Publication bias Visual inspection of the funnel plot and Egger’s test indicated no publication bias (t = 0.845, p = 0.413). 2.6. Quality of evidence All included studies were randomized trials. Given the low risk of bias, absence of publication bias, and lack of inconsistencies or indirectness, the overall quality of evidence was rated as high. However, there was some concern regarding imprecision due to variability in consumption measures, which had to be standardized, potentially introducing errors. The summarized quality of evidence assessment is presented in Table 3 . View this table: View inline View popup Download powerpoint Table 3. Summarized quality of evidence assessment. Discussion Both our experimental findings and the meta-analysis suggest that infection with N. ceranae does not impact sugar consumption in honeybees. Among works marked as potentially eligible in our systematic review, several were excluded because no data was shown, even though they measured sucrose consumption. Notably, however, some of those studies reported no differences in consumption between the control and infected groups of workers [ 89 – 92 ]. Four other studies, two excluded for the usage of unspecified sucrose concentration [ 93 , 94 ], one for unspecified dose and mode of Nosema inoculation [ 95 ], and another for the usage of mixed Nosema species for inoculation [ 96 ] all demonstrated no effects of infection on consumption. Although formally excluded from our analysis, these studies strongly support the conclusion that nosemosis does not affect sucrose consumption. This result is somewhat surprising since the system of Nosema and honeybees seems a potential candidate for pronounced dietary compensation due to its strong relevance for the energy budget of the host [ 28 ]. A recent meta-analysis by Mrugała et al. [ 97 ] addresses the issue of how parasitic infections influence host feeding behavior. The analyses, carried out across all taxonomic groups, demonstrate that, on average, infected hosts consume about 25% less food compared to uninfected ones, with considerable variability across taxa. Notably, the study highlights that parasitic infections can increase the variability of host consumption rates by an average of 25%, suggesting that the effects are highly context-dependent and influenced by factors such as host type or age [ 97 ]. In more general terms, the impact of parasitism on feeding behavior may depend on the specific host-parasite relationship and ecological context. Our meta-analysis revealed high heterogeneity between studies (I² = 94.9%). Neither the dose of inoculation nor the number of assessment days significantly influenced effect sizes. Additionally, no differences were observed between the individual and collective inoculation methods. Among the included moderators, only the age at inoculation had a meaningful effect. Specifically, studies that utilized older bees showed that infected individuals reacted to nosemosis the strongest and by consuming more sugar [ 56 , 86 ]. This suggests that older bees may exhibit dietary compensation. Notably, none of the abovementioned studies that were formally excluded from the meta-analysis and demonstrated no differences between healthy and infected individuals utilized older bees. This indirectly supports the idea of a stronger effect of nosemosis in older individuals. However, more studies that contrast bees of different ages are needed. Interestingly, this issue seems to be confounded by the fact that it is not the age of bees per se that seems to be important, but the time of their inoculation. Specifically, in studies with relatively long duration of the analysis, in which the age of bees at the end of the experiment was high, but with inoculation at the very beginning of their life, infected bees did not consume more sugar than healthy ones [ 77 , 81 ]. In any case, there is a notable lack of research focusing on forager-age bees. It is well-documented that bees adjust their behavior to cope with illness by selecting food with specific benefits during infection, like nectar with higher antibiotic potential [ 53 ], gathering propolis to counter parasite levels [ 54 ], or choosing higher-quality pollen when infected with Nosema [ 81 ]. Our findings did not support the hypothesis that bees infected with N. ceranae exhibit increased sugar consumption. It might be that Nosema infection does not induce sufficient energetic stress to warrant an increase in sugar intake. This conclusion is supported by the lack of significant changes in trehalose levels observed in our study. This finding aligns with those of Li et al. [ 98 ], who reported that Nosema infection does not alter glycogen levels in bees, a primary glucose storage molecule. Kurze et al. [ 99 ] found that in Nosema -tolerant bees, the infection did not affect fructose, glucose, or trehalose levels, while in the sensitive strains, trehalose levels were altered (i.e. decreased). In contrast, studies by Mayack and Naug [ 43 ] and Aliferis et al. [ 50 ] reported significant changes in carbohydrate and amino acid levels, including reduced levels of fructose, L-proline, and cryoprotectants such as sorbitol and glycerol, suggesting higher energetic stress in Nosema -infected bees. However, these studies differ considerably from ours in key aspects. While our study, along with those by Li et al. [ 98 ] and Kurze et al. [ 99 ], was conducted in controlled laboratory conditions, Mayack et al. [ 43 ] and Aliferis et al. [ 50 ] investigated wild-caught foragers. The higher energy expenditure associated with flight and foraging activities in these bees likely introduces a different metabolic response compared to laboratory-reared bees. This further supports the idea of more pronounced energetic effects of Nosema infection in older or otherwise more sensitive bees. Importantly, the energetic stress in Nosema -infected honeybees may involve more than just changes in sugar metabolism. Studies have shown that as Nosema infection progresses, protein synthesis is reduced, indicating a disruption of protein metabolism [ 50 , 98 , 100 , 101 ]. Additionally, infected bees show increased respirometric activity and lipid loss, suggesting that lipids may be used to meet the heightened energy demands caused by the infection [ 98 ]. Notably, Gilbert et al. [ 102 ] report severe depletion of lipids in the honeybee fat body 14 days after N. ceranae infection. In summer bees, this depletion mirrors the lipid loss associated with aging. However, seasonal variations in lipid metabolism are significant: fall bees, with larger lipid reserves, experience a 50% reduction in their lipid stores when infected with N. ceranae . Furthermore, recent studies on microRNA (miRNA) expression and metabolomic analyses further highlight the extensive metabolic disruptions caused by N. ceranae infection [ 103 , 104 ]. These findings highlight that it is important to incorporate various measures of responses to infection, ideally accounting for various factors such as bee age, nutritional status, seasonal timing and environmental conditions. In conclusion, our experiment and meta-analysis provide consistent and reliable evidence that N. ceranae infection does not appear to significantly increase sugar consumption in honeybees. Moreover, the experiment revealed no significant difference in trehalose levels between infected and healthy bees, suggesting that their energetic status may be similar. However, it is important to note that both our study and the included meta-analysis have limited representation of older bees, particularly foragers. This highlights a significant gap in research. Furthermore, it is crucial to complement existing studies with field research conducted in natural or semi-natural conditions to gain a more comprehensive understanding of the metabolic responses to Nosema infection in honeybees. Funding This work was supported by the National Science Centre, Poland [grant number Preludium 2021/41/N/NZ8/02917]. Competing Interests The authors declare there are no conflicts of interest. Acknowledgments We thank Magdalena Migalska for her valuable advice during the development and optimization of the qPCR protocol. References 1. ↵ Dobson A , Lafferty KD , Kuris AM , et al. ( 2008 ) Homage to Linnaeus: How many parasites? How many hosts? Proc Natl Acad Sci 105 : 11482 – 11489 . doi: 10.1073/pnas.0803232105 OpenUrl Abstract / FREE Full Text 2. ↵ Schmid-Hempel P ( 2021 ) Evolutionary Parasitology: The Integrated Study of Infections, Immunology, Ecology, and Genetics . Oxford University Press 3. ↵ Naug D , Gibbs A ( 2009 ) Behavioral changes mediated by hunger in honeybees infected with Nosema ceranae . Apidologie 40 : 595 – 599 . doi: 10.1051/apido/2009039 OpenUrl CrossRef 4. ↵ Bernardo MA , Singer MS ( 2017 ) Parasite-altered feeding behavior in insects: integrating functional and mechanistic research frontiers . J Exp Biol 220 : 2848 – 2857 . doi: 10.1242/jeb.143800 OpenUrl Abstract / FREE Full Text 5. ↵ Vale P , Siva-Jothy J , Morrill A , Forbes MR ( 2018 ) The influence of parasites on insect behaviour. In: Insect Behavior: From Mechanisms to Ecological and Evolutionary Consequences . Oxford University Press 6. ↵ de Roode JC , Lefèvre T , Hunter MD ( 2013 ) Self-Medication in Animals . Science 340 : 150 – 151 . doi: 10.1126/science.1235824 OpenUrl Abstract / FREE Full Text 7. ↵ Abbott J ( 2014 ) Self-medication in insects: current evidence and future perspectives . Ecol Entomol 39 : 273 – 280 . doi: 10.1111/een.12110 OpenUrl CrossRef 8. ↵ Singer MS , Mason PA , Smilanich AM ( 2014 ) Ecological Immunology Mediated by Diet in Herbivorous Insects . Integr Comp Biol 54 : 913 – 921 . doi: 10.1093/icb/icu089 OpenUrl CrossRef PubMed 9. ↵ Shikano I , Cory JS ( 2016 ) Altered nutrient intake by baculovirus-challenged insects: Self-medication or compensatory feeding? J Invertebr Pathol 139 : 25 – 33 . doi: 10.1016/j.jip.2016.07.005 OpenUrl CrossRef PubMed 10. Singer MS , Mace KC , Bernays EA ( 2009 ) Self-Medication as Adaptive Plasticity: Increased Ingestion of Plant Toxins by Parasitized Caterpillars . PLoS ONE 4 : e4796 . doi: 10.1371/journal.pone.0004796 OpenUrl CrossRef PubMed 11. Freymann E , Carvalho S , Garbe LA , et al. ( 2024 ) Pharmacological and behavioral investigation of putative self-medicative plants in Budongo chimpanzee diets . PLOS ONE 19 : e0305219 . doi: 10.1371/journal.pone.0305219 OpenUrl CrossRef PubMed 12. Davis AK , Prouty C ( 2019 ) The sicker the better: nematode-infected passalus beetles provide enhanced ecosystem services . Biol Lett 15 : 20180842 . doi: 10.1098/rsbl.2018.0842 OpenUrl CrossRef PubMed 13. ↵ Lee K p , Cory J s , Wilson K , et al. ( 2005 ) Flexible diet choice offsets protein costs of pathogen resistance in a caterpillar . Proc R Soc B Biol Sci 273 : 823 – 829 . doi: 10.1098/rspb.2005.3385 OpenUrl CrossRef 14. ↵ Povey S , Cotter SC , Simpson SJ , et al. ( 2009 ) Can the protein costs of bacterial resistance be offset by altered feeding behaviour? J Anim Ecol 78 : 437 – 446 . doi: 10.1111/j.1365-2656.2008.01499.x OpenUrl CrossRef PubMed Web of Science 15. ↵ Papa G , Maier R , Durazzo A , et al. ( 2022 ) The Honey Bee Apis mellifera: An Insect at the Interface between Human and Ecosystem Health . Biology 11 : 233 . doi: 10.3390/biology11020233 OpenUrl CrossRef PubMed 16. ↵ Kurze C , Routtu J , Moritz RFA ( 2016 ) Parasite resistance and tolerance in honeybees at the individual and social level . Zoology 119 : 290 – 297 . doi: 10.1016/j.zool.2016.03.007 OpenUrl CrossRef PubMed 17. ↵ Moritz RFA , De Miranda J , Fries I , et al. ( 2010 ) Research strategies to improve honeybee health in Europe . Apidologie 41 : 227 – 242 . doi: 10.1051/apido/2010010 OpenUrl CrossRef 18. Hristov P , Shumkova R , Palova N , Neov B ( 2020 ) Factors Associated with Honey Bee Colony Losses: A Mini-Review . Vet Sci 7 : 166 . doi: 10.3390/vetsci7040166 OpenUrl CrossRef PubMed 19. ↵ Ostap-Chec M , Cait J , Scott RW , et al. ( 2024 ) Experimental evidence and meta-analysis indicate the negative effect of nosemosis on the survivorship of honeybees . 2024.02.27.581909 20. ↵ Fries I ( 2010 ) Nosema ceranae in European honey bees ( Apis mellifera ) . J Invertebr Pathol 103 : S73 – S79 . doi: 10.1016/j.jip.2009.06.017 OpenUrl CrossRef PubMed 21. Smith ML ( 2012 ) The Honey Bee Parasite Nosema ceranae: Transmissible via Food Exchange? PLOS ONE 7 : e43319 . doi: 10.1371/journal.pone.0043319 OpenUrl CrossRef PubMed 22. ↵ Roberts KE , Evison SEF , Baer B , Hughes WOH ( 2015 ) The cost of promiscuity: sexual transmission of Nosema microsporidian parasites in polyandrous honey bees . Sci Rep 5 : 10982 . doi: 10.1038/srep10982 OpenUrl CrossRef PubMed 23. ↵ Higes M , Martín-Hernández R , Martínez-Salvador A , et al. ( 2010 ) A preliminary study of the epidemiological factors related to honey bee colony loss in Spain . Environ Microbiol Rep 2 : 243 – 250 . doi: 10.1111/j.1758-2229.2009.00099.x OpenUrl CrossRef PubMed 24. ↵ Martín-Hernández R , Meana A , García-Palencia P , et al. ( 2009 ) Effect of Temperature on the Biotic Potential of Honeybee Microsporidia . Appl Environ Microbiol 75 : 2554 – 2557 . doi: 10.1128/AEM.02908-08 OpenUrl Abstract / FREE Full Text 25. ↵ García-Palencia P , Martín-Hernández R , González-Porto A-V , et al. ( 2010 ) Natural infection by Nosema ceranae causes similar lesions as in experimentally infected caged-worker honey bees (Apis mellifera) . J Apic Res 49 : 278 – 283 . doi: 10.3896/IBRA.1.49.3.08 OpenUrl CrossRef 26. ↵ Dussaubat C , Brunet J-L , Higes M , et al. ( 2012 ) Gut Pathology and Responses to the Microsporidium Nosema ceranae in the Honey Bee Apis mellifera . PLOS ONE 7 : e37017 . doi: 10.1371/journal.pone.0037017 OpenUrl CrossRef PubMed 27. ↵ Goblirsch M ( 2018 ) Nosema ceranae disease of the honey bee (Apis mellifera) . Apidologie 49 : 131 – 150 . doi: 10.1007/s13592-017-0535-1 OpenUrl CrossRef 28. ↵ Paris L , El Alaoui H , Delbac F , Diogon M ( 2018 ) Effects of the gut parasite Nosema ceranae on honey bee physiology and behavior . Curr Opin Insect Sci 26 : 149 – 154 . doi: 10.1016/j.cois.2018.02.017 OpenUrl CrossRef PubMed 29. ↵ Higes M , Martín-Hernández R , Botías C , et al. ( 2008 ) How natural infection by Nosema ceranae causes honeybee colony collapse . Environ Microbiol 10 : 2659 – 2669 . doi: 10.1111/j.1462-2920.2008.01687.x OpenUrl CrossRef PubMed Web of Science 30. Higes M , Martín-Hernández R , Garrido-Bailón E , et al. ( 2009 ) Honeybee colony collapse due to Nosema ceranae in professional apiaries . Environ Microbiol Rep 1 : 110 – 113 . doi: 10.1111/j.1758-2229.2009.00014.x OpenUrl CrossRef PubMed 31. Botías C , Martín-Hernández R , Barrios L , et al. ( 2013 ) Nosema spp. infection and its negative effects on honey bees (Apis mellifera iberiensis) at the colony level . Vet Res 44 : 25 . doi: 10.1186/1297-9716-44-25 OpenUrl CrossRef PubMed 32. ↵ Koch H , Brown MJ , Stevenson PC ( 2017 ) The role of disease in bee foraging ecology . Curr Opin Insect Sci 21 : 60 – 67 OpenUrl CrossRef PubMed 33. ↵ Antúnez K , Martín-Hernández R , Prieto L , et al. ( 2009 ) Immune suppression in the honey bee ( Apis mellifera ) following infection by Nosema ceranae ( Microsporidia ) . Environ Microbiol 11 : 2284 – 2290 . doi: 10.1111/j.1462-2920.2009.01953.x OpenUrl CrossRef PubMed Web of Science 34. Chaimanee V , Chantawannakul P , Chen Y , et al. ( 2012 ) Differential expression of immune genes of adult honey bee (Apis mellifera) after inoculated by Nosema ceranae . J Insect Physiol 58 : 1090 – 1095 OpenUrl CrossRef PubMed 35. Holt HL , Aronstein KA , Grozinger CM ( 2013 ) Chronic parasitization by Nosema microsporidia causes global expression changes in core nutritional, metabolic and behavioral pathways in honey bee workers (Apis mellifera) . BMC Genomics 14 : 799 . doi: 10.1186/1471-2164-14-799 OpenUrl CrossRef 36. Huang Q , Chen YP , Wang RW , et al. ( 2016 ) Host-Parasite Interactions and Purifying Selection in a Microsporidian Parasite of Honey Bees . PLOS ONE 11 : e0147549 . doi: 10.1371/journal.pone.0147549 OpenUrl CrossRef PubMed 37. ↵ Lourenço AP , Guidugli-Lazzarini KR , De Freitas NHA , et al. ( 2021 ) Immunity and physiological changes in adult honey bees (Apis mellifera) infected with Nosema ceranae: The natural colony environment . J Insect Physiol 131 : 104237 . doi: 10.1016/j.jinsphys.2021.104237 OpenUrl CrossRef PubMed 38. ↵ Vidau C , Panek J , Texier C , et al. ( 2014 ) Differential proteomic analysis of midguts from Nosema ceranae-infected honeybees reveals manipulation of key host functions . J Invertebr Pathol 121 : 89 – 96 . doi: 10.1016/j.jip.2014.07.002 OpenUrl CrossRef PubMed 39. ↵ Kurze C , Dosselli R , Grassl J , et al. ( 2016 ) Differential proteomics reveals novel insights into Nosema–honey bee interactions . Insect Biochem Mol Biol 79 : 42 – 49 OpenUrl CrossRef PubMed 40. ↵ Tsaousis AD , Kunji ERS , Goldberg AV , et al. ( 2008 ) A novel route for ATP acquisition by the remnant mitochondria of Encephalitozoon cuniculi . Nature 453 : 553 – 556 . doi: 10.1038/nature06903 OpenUrl CrossRef PubMed Web of Science 41. ↵ Blatt J , Roces F ( 2001 ) Haemolymph sugar levels in foraging honeybees (Apis mellifera carnica): dependence on metabolic rate and in vivo measurement of maximal rates of trehalose synthesis . J Exp Biol 204 : 2709 – 2716 OpenUrl Abstract / FREE Full Text 42. Thompson SN ( 2003 ) Trehalose—the insect ‘blood’sugar . Adv Insect Physiol 31 : 205 – 285 OpenUrl CrossRef 43. ↵ Mayack C , Naug D ( 2010 ) Parasitic infection leads to decline in hemolymph sugar levels in honeybee foragers . J Insect Physiol 56 : 1572 – 1575 OpenUrl CrossRef PubMed Web of Science 44. ↵ Mayack C , Naug D ( 2009 ) Energetic stress in the honeybee Apis mellifera from Nosema ceranae infection . J Invertebr Pathol 100 : 185 – 188 . doi: 10.1016/j.jip.2008.12.001 OpenUrl CrossRef PubMed Web of Science 45. ↵ Martín-Hernández R , Botías C , Barrios L , et al. ( 2011 ) Comparison of the energetic stress associated with experimental Nosema ceranae and Nosema apis infection of honeybees (Apis mellifera) . Parasitol Res 109 : 605 – 612 . doi: 10.1007/s00436-011-2292-9 OpenUrl CrossRef PubMed 46. ↵ Dussaubat C , Sagastume S , Gómez-Moracho T , et al. ( 2013 ) Comparative study of Nosema ceranae (Microsporidia) isolates from two different geographic origins . Vet Microbiol 162 : 670 – 678 . doi: 10.1016/j.vetmic.2012.09.012 OpenUrl CrossRef PubMed 47. Alaux C , Crauser D , Pioz M , et al. ( 2014 ) Parasitic and immune modulation of flight activity in honey bees tracked with optical counters . J Exp Biol 217 : 3416 – 3424 . doi: 10.1242/jeb.105783 OpenUrl Abstract / FREE Full Text 48. Naug D ( 2014 ) Infected honeybee foragers incur a higher loss in efficiency than in the rate of energetic gain . Biol Lett 10 : 20140731 . doi: 10.1098/rsbl.2014.0731 OpenUrl CrossRef PubMed 49. ↵ Wolf S , McMahon DP , Lim KS , et al. ( 2014 ) So Near and Yet So Far: Harmonic Radar Reveals Reduced Homing Ability of Nosema Infected Honeybees . PLOS ONE 9 : e103989 . doi: 10.1371/journal.pone.0103989 OpenUrl CrossRef PubMed 50. ↵ Aliferis KA , Copley T , Jabaji S ( 2012 ) Gas chromatography–mass spectrometry metabolite profiling of worker honey bee ( Apis mellifera L.) hemolymph for the study of Nosema ceranae infection . J Insect Physiol 58 : 1349 – 1359 . doi: 10.1016/j.jinsphys.2012.07.010 OpenUrl CrossRef PubMed 51. ↵ Campbell J , Kessler B , Mayack C , Naug D ( 2010 ) Behavioural fever in infected honeybees: parasitic manipulation or coincidental benefit? Parasitology 137 : 1487 – 1491 . doi: 10.1017/S0031182010000235 OpenUrl CrossRef PubMed 52. ↵ Emsen B , De la Mora A , Lacey B , et al. ( 2020 ) Seasonality of Nosema ceranae Infections and Their Relationship with Honey Bee Populations , Food Stores, and Survivorship in a North American Region. Vet Sci 7 : 131 . doi: 10.3390/vetsci7030131 OpenUrl CrossRef 53. ↵ Gherman BI , Denner A , Bobiş O , et al. ( 2014 ) Pathogen-associated self-medication behavior in the honeybee Apis mellifera . Behav Ecol Sociobiol 68 : 1777 – 1784 . doi: 10.1007/s00265-014-1786-8 OpenUrl CrossRef 54. ↵ Pusceddu M , Piluzza G , Theodorou P , et al. ( 2019 ) Resin foraging dynamics in Varroa destructor-infested hives: a case of medication of kin? Insect Sci 26 : 297 – 310 . doi: 10.1111/1744-7917.12515 OpenUrl CrossRef PubMed 55. ↵ Borsuk G , Ptaszyńska AA , Olszewski K , et al. ( 2017 ) A New Method for Quick and Easy Hemolymph Collection from Apidae Adults . PLOS ONE 12 : e0170487 . doi: 10.1371/journal.pone.0170487 OpenUrl CrossRef PubMed 56. ↵ Berbeć E , Migdał P , Cebrat M , et al. ( 2022 ) Honeybee age and inoculum concentration as factors affecting the development of Nosema ceranae infection . Eur Zool J 89 : 1180 – 1190 . doi: 10.1080/24750263.2022.2121009 OpenUrl CrossRef 57. ↵ Chen Y , Evans JD , Smith IB , Pettis JS ( 2008 ) Nosema ceranae is a long-present and wide-spread microsporidian infection of the European honey bee (Apis mellifera) in the United States . J Invertebr Pathol 97 : 186 – 188 . doi: 10.1016/j.jip.2007.07.010 OpenUrl CrossRef PubMed 58. ↵ Chen Y , Evans JD , Zhou L , et al. ( 2009 ) Asymmetrical coexistence of Nosema ceranae and Nosema apis in honey bees . J Invertebr Pathol 101 : 204 – 209 . doi: 10.1016/j.jip.2009.05.012 OpenUrl CrossRef PubMed 59. ↵ Cilia G , Cabbri R , Maiorana G , et al. ( 2018 ) A novel TaqMan® assay for Nosema ceranae quantification in honey bee, based on the protein coding gene Hsp70 . Eur J Protistol 63 : 44 – 50 . doi: 10.1016/j.ejop.2018.01.007 OpenUrl CrossRef PubMed 60. ↵ Cilia G , Garrido C , Bonetto M , et al. ( 2020 ) Effect of api-bioxal® and apiherb® treatments against Nosema ceranae infection in Apis mellifera investigated by two qPCR methods . Vet Sci 7 :. doi: 10.3390/vetsci7030125 OpenUrl CrossRef 61. ↵ Absolute Quantification qPCR vs Relative Quantification qPCR. In: Qiagen PCR Quantif . http://www.qiagen.com/us/knowledge-and-support/knowledge-hub/bench-guide/pcr/pcr-quantification/pcr-quantification . Accessed 23 Dec 2024 62. ↵ R Core Team ( 2024 ) R: A Language and Environment for Statistical Computing . R for Statistical Computing 63. ↵ Heit DR , Ortiz-Calo W , Poisson MKP , et al. ( 2024 ) Generalized nonlinearity in animal ecology: Research, review, and recommendations . Ecol Evol 14 : e11387 . doi: 10.1002/ece3.11387 OpenUrl CrossRef PubMed 64. ↵ Wood SN ( 2017 ) Generalized Additive Models: An Introduction with R , Second Edition, 2nd ed. Chapman and Hall/CRC , New York 65. ↵ Wood S ( 2023 ) mgcv: Mixed GAM Computation Vehicle with Automatic Smoothness Estimation 66. ↵ Bates D , Mächler M , Bolker B , Walker S ( 2015 ) Fitting Linear Mixed-Effects Models Using lme4 . J Stat Softw 67 : 1 – 48 . doi: 10.18637/jss.v067.i01 OpenUrl CrossRef PubMed 67. Therneau TM , until 2009) TL (original S->R port and R maintainer, Elizabeth A, Cynthia C ( 2024 ) survival: Survival Analysis 68. ↵ Moher D , Shamseer L , Clarke M , et al. ( 2015 ) Preferred reporting items for systematic review and meta-analysis protocols (PRISMA-P) 2015 statement . Syst Rev 4 : 1 OpenUrl CrossRef PubMed 69. ↵ Wan X , Wang W , Liu J , Tong T ( 2014 ) Estimating the sample mean and standard deviation from the sample size, median, range and/or interquartile range . BMC Med Res Methodol 14 : 135 . doi: 10.1186/1471-2288-14-135 OpenUrl CrossRef PubMed 70. ↵ Rohatgi A ( 2022 ) WebPlotDigitizer (Version 4.6) [Computer software] . 71. ↵ Viechtbauer W ( 2010 ) Conducting meta-analyses in R with the metafor package . J Stat Softw 36 : 72. ↵ Nakagawa S , Lagisz M , O’Dea RE , et al. ( 2023 ) orchaRd 2.0: An R package for visualising meta-analyses with orchard plots . Methods Ecol Evol 14 : 2003 – 2010 . doi: 10.1111/2041-210X.14152 OpenUrl CrossRef 73. ↵ Guyatt G , Oxman AD , Akl EA , et al. ( 2011 ) GRADE guidelines: 1. Introduction— GRADE evidence profiles and summary of findings tables . J Clin Epidemiol 64 : 383 – 394 . doi: 10.1016/j.jclinepi.2010.04.026 OpenUrl CrossRef PubMed 74. ↵ Baffoni L , Gaggìa F , Alberoni D , et al. ( 2016 ) Effect of dietary supplementation of Bifidobacterium and Lactobacillus strains in Apis mellifera L. against Nosema ceranae . Benef Microbes 7 : 45 – 51 . doi: 10.3920/BM2015.0085 OpenUrl CrossRef 75. Braglia C , Alberoni D , Porrini MP , et al. ( 2021 ) Screening of Dietary Ingredients against the Honey Bee Parasite Nosema ceranae . Pathogens 10 : 1117 . doi: 10.3390/pathogens10091117 OpenUrl CrossRef PubMed 76. ↵ Garrido PM , Porrini MP , Alberoni D , et al. ( 2024 ) Beneficial Bacteria and Plant Extracts Promote Honey Bee Health and Reduce Nosema ceranae Infection . Probiotics Antimicrob Proteins 16 : 259 – 274 . doi: 10.1007/s12602-022-10025-7 OpenUrl CrossRef 77. ↵ Almasri H , Tavares DA , Diogon M , et al. ( 2021 ) Physiological effects of the interaction between Nosema ceranae and sequential and overlapping exposure to glyphosate and difenoconazole in the honey bee Apis mellifera . Ecotoxicol Environ Saf 217 : 112258 . doi: 10.1016/j.ecoenv.2021.112258 OpenUrl CrossRef PubMed 78. Al Naggar Y , Baer B ( 2019 ) Consequences of a short time exposure to a sublethal dose of Flupyradifurone (Sivanto) pesticide early in life on survival and immunity in the honeybee (Apis mellifera) . Sci Rep 9 : 19753 . doi: 10.1038/s41598-019-56224-1 OpenUrl CrossRef PubMed 79. Balbuena S , Castelli L , Zunino P , Antúnez K ( 2023 ) Effect of Chronic Exposure to Sublethal Doses of Imidacloprid and Nosema ceranae on Immunity, Gut Microbiota, and Survival of Africanized Honey Bees . Microb Ecol 85 : 1485 – 1497 . doi: 10.1007/s00248-022-02014-8 OpenUrl CrossRef PubMed 80. De la Mora A , Morfin N , Tapia-Rivera JC , et al. ( 2023 ) The Fungus Nosema ceranae and a Sublethal Dose of the Neonicotinoid Insecticide Thiamethoxam Differentially Affected the Health and Immunity of Africanized Honey Bees . Microorganisms 11 : 1258 . doi: 10.3390/microorganisms11051258 OpenUrl CrossRef PubMed 81. ↵ Ferguson JA , Northfield TD , Lach L ( 2018 ) Honey Bee (Apis mellifera) Pollen Foraging Reflects Benefits Dependent on Individual Infection Status . Microb Ecol 76 : 482 – 491 . doi: 10.1007/s00248-018-1147-7 OpenUrl CrossRef PubMed 82. Paris L , Roussel M , Pereira B , et al. ( 2017 ) Disruption of oxidative balance in the gut of the western honeybee Apis mellifera exposed to the intracellular parasite Nosema ceranae and to the insecticide fipronil . Microb Biotechnol 10 : 1702 – 1717 . doi: 10.1111/1751-7915.12772 OpenUrl CrossRef PubMed 83. Peghaire E , Moné A , Delbac F , et al. ( 2020 ) A Pediococcus strain to rescue honeybees by decreasing Nosema ceranae - and pesticide-induced adverse effects . Pestic Biochem Physiol 163 : 138 – 146 . doi: 10.1016/j.pestbp.2019.11.006 OpenUrl CrossRef PubMed 84. Straub L , Minnameyer A , Strobl V , et al. ( 2020 ) From antagonism to synergism: Extreme differences in stressor interactions in one species . Sci Rep 10 : 4667 . doi: 10.1038/s41598-020-61371-x OpenUrl CrossRef PubMed 85. Tritschler M , Vollmann JJ , Yañez O , et al. ( 2017 ) Protein nutrition governs within-host race of honey bee pathogens . Sci Rep 7 : 14988 . doi: 10.1038/s41598-017-15358-w OpenUrl CrossRef PubMed 86. ↵ Urueña Á , Blasco-Lavilla N , De la Rúa P ( 2023 ) Sulfoxaflor effects depend on the interaction with other pesticides and Nosema ceranae infection in the honey bee ( Apis mellifera ) . Ecotoxicol Environ Saf 264 : 115427 . doi: 10.1016/j.ecoenv.2023.115427 OpenUrl CrossRef PubMed 87. Vidau C , Diogon M , Aufauvre J , et al. ( 2011 ) Exposure to Sublethal Doses of Fipronil and Thiacloprid Highly Increases Mortality of Honeybees Previously Infected by Nosema ceranae . PLoS ONE 6 : e21550 . doi: 10.1371/journal.pone.0021550 OpenUrl CrossRef PubMed 88. Williams GR , Shutler D , Burgher-MacLellan KL , Rogers REL ( 2014 ) Infra-Population and -Community Dynamics of the Parasites Nosema apis and Nosema ceranae, and Consequences for Honey Bee (Apis mellifera) Hosts . PLoS ONE 9 : e99465 . doi: 10.1371/journal.pone.0099465 OpenUrl CrossRef PubMed 89. ↵ Aufauvre J , Misme-Aucouturier B , Viguès B , et al. ( 2014 ) Transcriptome Analyses of the Honeybee Response to Nosema ceranae and Insecticides . PLoS ONE 9 : e91686 . doi: 10.1371/journal.pone.0091686 OpenUrl CrossRef PubMed 90. Doublet V , Labarussias M , De Miranda JR , et al. ( 2015 ) Bees under stress: sublethal doses of a neonicotinoid pesticide and pathogens interact to elevate honey bee mortality across the life cycle . Environ Microbiol 17 : 969 – 983 . doi: 10.1111/1462-2920.12426 OpenUrl CrossRef PubMed 91. Paris L , Peghaire E , Moné A , et al. ( 2020 ) Honeybee gut microbiota dysbiosis in pesticide/parasite co-exposures is mainly induced by Nosema ceranae . J Invertebr Pathol 172 : 107348 . doi: 10.1016/j.jip.2020.107348 OpenUrl CrossRef 92. ↵ Porrini MP , Garrido PM , Umpiérrez ML , et al. ( 2020 ) Effects of Synthetic Acaricides and Nosema ceranae (Microsporidia: Nosematidae) on Molecules Associated with Chemical Communication and Recognition in Honey Bees . Vet Sci 7 : 199 . doi: 10.3390/vetsci7040199 OpenUrl CrossRef PubMed 93. ↵ Porrini MP , Garrido PM , Gende LB , et al. ( 2017 ) Oral administration of essential oils and main components: Study on honey bee survival and Nosema ceranae development . J Apic Res 56 : 616 – 624 . doi: 10.1080/00218839.2017.1348714 OpenUrl CrossRef 94. ↵ Duguet J , Zuñiga F , Martínez J ( 2022 ) Antifungal activity of “HO21-F”, a formulation based on Olea europaea plant extract, in honey bees infected with Nosema ceranae . J Invertebr Pathol 193 : 107801 . doi: 10.1016/j.jip.2022.107801 OpenUrl CrossRef PubMed 95. ↵ Glavinic U , Rajkovic M , Vunduk J , et al. ( 2021 ) Effects of Agaricus bisporus Mushroom Extract on Honey Bees Infected with Nosema ceranae . Insects 12 : 915 . doi: 10.3390/insects12100915 OpenUrl CrossRef PubMed 96. ↵ Pérez-Morfi A , Canto A , Feldman RE , et al. ( 2023 ) Effect of bee bread on Africanized honey bees infected with spores of Nosema spp . Entomol Exp Appl 171 : 374 – 385 . doi: 10.1111/eea.13286 OpenUrl CrossRef 97. ↵ Mrugała A , Wolinska J , Jeschke JM ( 2023 ) A meta-analysis of how parasites affect host consumption rates . Oikos 2023 : e09700 . doi: 10.1111/oik.09700 OpenUrl CrossRef 98. ↵ Li W , Chen Y , Cook SC ( 2018 ) Chronic Nosema ceranae infection inflicts comprehensive and persistent immunosuppression and accelerated lipid loss in host Apis mellifera honey bees . Int J Parasitol 48 : 433 – 444 . doi: 10.1016/j.ijpara.2017.11.004 OpenUrl CrossRef PubMed 99. ↵ Kurze C , Mayack C , Hirche F , et al. ( 2016 ) Nosema spp. infections cause no energetic stress in tolerant honeybees . Parasitol Res 115 : 2381 – 2388 . doi: 10.1007/s00436-016-4988-3 OpenUrl CrossRef PubMed 100. ↵ Badaoui B , Fougeroux A , Petit F , et al. ( 2017 ) RNA-sequence analysis of gene expression from honeybees (Apis mellifera) infected with Nosema ceranae . PLOS ONE 12 : e0173438 . doi: 10.1371/journal.pone.0173438 OpenUrl CrossRef PubMed 101. ↵ Li Z , He J , Yu T , et al. ( 2019 ) Transcriptional and physiological responses of hypopharyngeal glands in honeybees (Apis mellifera L.) infected by Nosema ceranae . Apidologie 50 : 51 – 62 . doi: 10.1007/s13592-018-0617-8 OpenUrl CrossRef 102. ↵ Gilbert J , Paris L , Dubuffet A , et al. ( 2024 ) Nosema ceranae infection reduces the fat body lipid reserves in the honeybee Apis mellifera . J Invertebr Pathol 207 : 108218 . doi: 10.1016/j.jip.2024.108218 OpenUrl CrossRef PubMed 103. ↵ Huang Q , Chen Y , Wang RW , et al. ( 2015 ) Honey bee microRNAs respond to infection by the microsporidian parasite Nosema ceranae . Sci Rep 5 : 17494 . doi: 10.1038/srep17494 OpenUrl CrossRef PubMed 104. ↵ Jousse C , Dalle C , Abila A , et al. ( 2020 ) A combined LC-MS and NMR approach to reveal metabolic changes in the hemolymph of honeybees infected by the gut parasite Nosema ceranae . J Invertebr Pathol 176 : 107478 . doi: 10.1016/j.jip.2020.107478 OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted February 15, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Meta-analysis and experimental evidence reveal no impact of Nosema ceranae infection on honeybee carbohydrate consumption Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Meta-analysis and experimental evidence reveal no impact of Nosema ceranae infection on honeybee carbohydrate consumption Monika Ostap-Chec , Weronika Antoł , Daniel Bajorek , Ewelina Berbeć , Dawid Moroń , Marcin Rapacz , Krzysztof Miler bioRxiv 2025.02.11.637035; doi: https://doi.org/10.1101/2025.02.11.637035 Share This Article: Copy Citation Tools Meta-analysis and experimental evidence reveal no impact of Nosema ceranae infection on honeybee carbohydrate consumption Monika Ostap-Chec , Weronika Antoł , Daniel Bajorek , Ewelina Berbeć , Dawid Moroń , Marcin Rapacz , Krzysztof Miler bioRxiv 2025.02.11.637035; doi: https://doi.org/10.1101/2025.02.11.637035 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Pathology Subject Areas All Articles Animal Behavior and Cognition (7622) Biochemistry (17648) Bioengineering (13870) Bioinformatics (41880) Biophysics (21423) Cancer Biology (18553) Cell Biology (25458) Clinical Trials (138) Developmental Biology (13364) Ecology (19866) Epidemiology (2067) Evolutionary Biology (24290) Genetics (15589) Genomics (22475) Immunology (17711) Microbiology (40326) Molecular Biology (17145) Neuroscience (88471) Paleontology (666) Pathology (2826) Pharmacology and Toxicology (4815) Physiology (7635) Plant Biology (15114) Scientific Communication and Education (2044) Synthetic Biology (4286) Systems Biology (9815) Zoology (2268)