Phenotypic and Genotypic Resistances Associated with Pyrethroid and Organophosphate in Aedes aegypti (Diptera: Culicidae)

Phenotypic and Genotypic Resistances Associated with Pyrethroid and Organophosphate in Aedes aegypti (Diptera: Culicidae) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Phenotypic and Genotypic Resistances Associated with Pyrethroid and Organophosphate in Aedes aegypti (Diptera: Culicidae) Wan Fatma Zuharah, Fatin Nabila Abdullah, Asfa Nurizzah Zin Azman, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7486335/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 07 Feb, 2026 Read the published version in Parasites & Vectors → Version 1 posted 9 You are reading this latest preprint version Abstract Background For decades, reliance on insecticides for vector control has been a common approach in combating the yellow fever mosquito, Aedes aegypti (L.), and this approach has led to the development of insecticide resistance. This study investigates the phenotypic and genotypic resistance of Ae. aegypti to pyrethroid (permethrin and deltamethrin) and organophosphate (malathion and pirimiphos-methyl) across Malaysia, Thailand, Indonesia, and the USA. Methods Adult female Aedes aegypti were subjected to WHO-recommended insecticide bioassays to assess susceptibility to pyrethroids and organophosphates. Molecular analyses were performed to detect kdr mutations, while biochemical assays quantified metabolic enzyme activities. Results High resistance levels were observed in Malaysian and the US strains to both pyrethroids and organophosphates, with intermediate resistance in Thailand and susceptibility in Indonesia. Notably, new mutations T1520I and I1011M were detected in Ae. aegypti Malaysian populations, marking the first report of T1520I in the region. Additionally, V1016I was newly identified in Indonesian strains, highlighting emerging resistance trends. The coexistence of multiple kdr mutations (S989P, V1016G, F1534C, and T1520I) in Malaysian strains poses a significant challenge to vector control efforts. Interestingly, the Riverside strain from the USA exhibited up to a 10-fold increase in β-EST metabolic enzyme activity compared to the VCRU reference strain, indicating substantial metabolic resistance. In contrast, despite high phenotypic resistance, the Malaysian Hamna strain showed no significant increase in detoxifying enzymes, suggesting that kdr mutations alone may drive resistance in these populations. Furthermore, resistance in Thai strains was not associated with kdr mutations but rather with altered acetylcholinesterase and elevated GST activities, highlighting the diversity of resistance mechanisms. The study also identified multiple-loci mutations (triple and quadruple haplotypes) in Malaysian strains, suggesting an advanced stage of resistance evolution. Conclusions These findings highlight the importance of continuous surveillance and targeted vector control strategies in mitigating the spread of resistance. The detection of novel mutations and diverse resistance mechanisms emphasizes the adaptability of Ae. aegypti to insecticide pressure and the need for innovative approaches to maintain the efficacy of vector control measures. Aedes aegypti kdr mutation Mosquitoes Metabolic enzyme Resistance Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Background The yellow fever mosquito Aedes aegypti is a widely distributed species of significant public nuisance and vector for the viral pathogens of yellow fever, dengue, chikungunya, and Zika infections [ 1 ]. This species has shown dynamic invasive distribution patterns worldwide. Its distribution in Southeast Asia has been attributed to increased trade in the 19th century, with higher prevalence near coastal areas (Rao, 1967). While tropical and subtropical regions are remain favorable due to the climatically suitability, human influence and artificial environments also contribute to sustaining this species' range in temperate and subtropical regions [ 2 ]. In the United States of America (USA), Ae. aegypti was reported in 183 counties across 26 states from 1995 to 2016, with a persistent presence in 94 countries [ 3 ]. The genetic analysis revealed 20 distinct haplotypes across the Americas, Africa, and Asia, suggesting multiple introductions and complex phylogeographic structures [ 4 ]. Local shifts in distribution have been observed, such as in Southern Florida, possibly due to interspecific interactions with Ae. albopictus [ 5 ]. The resistance status of Ae. aegypti varies globally and is influenced by local insecticide application patterns as well as resistance mechanisms. Understanding the resistance is crucial for effective vector control operations [ 6 , 7 ]. The resistance status of Ae. aegypti necessitates resistance management tactics for effective vector control. The resistance occurs due to genetic mutations, metabolic changes, and behavioral adaptations that allow these mosquitoes to survive exposure to commonly used insecticides [ 8 ]. These adaptations complicate control efforts, highlighting the need for ongoing research and monitoring to direct public health interventions and to ensure the efficacy of vector control programs. Resistance mechanisms include target site mutations, increased detoxification enzyme activity, and behavioural changes, which can significantly impact the effectiveness of currently available insecticides [ 9 , 10 ]. Target site resistance can lead to reduced binding affinity to insecticides, and render them less effective [ 11 ]. Mutations in the para-sodium channel gene significantly contribute to target site resistance, particularly against pyrethroids [ 12 , 13 ]. These mutations are prevalent in Southeast Asian populations of Ae. aegypti , contributing to widespread resistance [ 14 , 15 ] to pyrethroids [ 16 ]. Resistance to multiple classes of insecticides, including organochlorines (OC), organophosphates (OP), pyrethroids (PY), and carbamates (C), is increasing, which is particularly noted in Thailand and Malaysia [ 17 ]. The S989P mutation is within domain II and is frequently observed in deltamethrin-resistant Ae. aegypti , constitutes another notable kdr mutation that functions synergistically with the V1016G mutation [ 18 ]. The further problem has coupled up both resistance mechanisms, including elevated oxidase enzyme activity and target-site mutations, such as V1023G and S996P in the voltage-gated sodium channel gene [ 19 ]. Recent studies in Malaysia have identified a novel knockdown resistance ( kdr ) mutation, A1007G, in the voltage-gated sodium channel (VGSC) of Ae. aegypti mosquitoes [ 20 , 21 ]. Additionally, three common kdr mutations (S989P, V1016G, and F1534C), was also detected in Ae. aegypti populations from multiple states, including Selangor, Penang, and Kelantan [ 20 , 21 ]. In Indonesia, however, insecticide resistance surveillance remains fragmented due to the lack of a nationwide monitoring system. Furthermore, the same kdr mutations of predominant V1016G, S989P, and F1534C as in Malaysia are associated with pyrethroid resistance [ 22 , 23 ], while mutations in the acetylcholinesterase (AChE) gene remain unreported [ 24 ]. The co-occurrence in Thailand Ae. aegypti mosquitoes with S989P are usually frequent, and the S989P + V1016G + F1534C (triple-mutant) heterozygous genotype confers high resistance, reducing the efficacy of pyrethroid thermal fogging under operational conditions. V1016G is common across Thai populations, significantly associated with deltamethrin resistance, and F1534 is associated with permethrin resistance [ 25 , 26 ]. Whereas, high frequencies of kdr mutations V1016I and F134C associated with pyrethroid was repeatedly documented in Florida, USA since 2018 [ 27 ] In various populations, increased activity of detoxifying enzymes such as esterases, mixed-function oxidases, and glutathione-S-transferases has been observed. Enhanced metabolism through detoxification enzymes is another significant resistance mechanism. This involves increased activity of enzymes that break down insecticides, reducing their effectiveness [ 14 , 17 ]. Metabolic resistance can involve enhanced expression of cytochrome P450 enzymes, which play a crucial role in breaking down toxic substances, further complicating the landscape of vector control [ 28 ]. This heightened enzyme activity is a key to metabolic resistance to insecticides like deltamethrin and malathion [ 29 ]. This amalgamation of mutations augments the insect's capacity and metabolic detoxification to endure exposure to PY and OP insecticides, thereby complicating control initiatives and necessitating additional investigation into alternative management frameworks. Ongoing monitoring of resistance patterns will be crucial to effectively adapting and refining these strategies. This study assessed the resistance profiles of Ae. aegypti mosquitoes obtained from several Southeast Asian countries (Malaysia, Indonesia, Thailand), which have been known as a hotspot for arboviral diseases and hyperendemic of dengue, and the United States of America (USA) for comparison. The occurrence of mutations within the voltage-gated sodium channel gene, alongside the influence of metabolic resistance on the Ae. aegypti populations’ response to PY and OP insecticides was elucidated. Methods Mosquitoes Field sampling of Ae. aegypti mosquitoes were conducted employing ovitraps, which utilized a black tin can (dimensions: height 10.4 cm, diameter 7.0 cm). A hardboard paddle (dimensions: 3 cm × 14.7 cm × 0.3 cm) was positioned vertically within each ovitrap, with the textured surface oriented upwards to promote oviposition. Dechlorinated tap water was introduced into each receptacle to a depth of 6.0 cm, utilizing 200 mL of dechlorinated tap water. The ovitraps were established at the sampling location for a minimum of five days to encourage oviposition by the adult female Ae. aegypti mosquitoes. Mosquito collection used in this study were meticulously selected from Malaysia, specifically at Flat Hamna (FH) (5.351133, 100.3016) and the Taman Bukit Jambul Apartment (TBJ) in Penang (5.336123, 100.287673), one site in Depok (DP), West Java Province, Indonesia (6.2338, 106.4921), and two sites situated in Songkhla (SK) (7.1222, 100.3548) and Surat Thani (ST), Thailand (9.128875, 99.325629). In addition, one strain from Riverside (RS), California (33.918933, -117.372186), was used as a reference strain for comparison (Fig. 1 ). The VCRU strain was used as the susceptible strain for the basis of comparison with other field strains. The collected larvae were transported back to the laboratory, where they were cultured in enamel trays filled with dechlorinated tap water. The culture conditions were regulated to maintain a temperature of (28 ± 2) ℃, relative humidity of 70–85%, and a light cycle of 12 hours of illumination followed by 12 hours of darkness. The larvae were nourished with a composite feed consisting of dog biscuit, beef liver, yeast, and milk powder, prepared in a weight ratio of 2:1:1:1 and administered as a fine powder at a dosage of 1 g per day. The larvae were permitted to progress to the adult stage, designated as the F 0 generation. In instances where the population of the F 0 generation is insufficient for conducting a bioassay evaluation, it shall be propagated to the F 1 and F 2 generations. Adult Mosquito Bioassays Adult bioassays were conducted using the standardized protocol established by the World Health Organization [ 30 ]. The study used non-blood-fed adult female mosquitoes of the field strain. All field strains of Ae. aegypti were tested with PY and OP insecticides in four replicates, each comprising 25 non-blood-fed female mosquitoes aged between 3 and 5 days. Adult mosquito bioassay functions as a direct response to insecticides. This susceptibility test on Ae. aegypti was done using the WHO-impregnated paper of discriminating doses for pyrethroid (0.4% permethrin and 0.03% deltamethrin) and organophosphate (60mg/m 2 pirimiphos-methyl and 5% malathion). Controls were conducted in duplicate for each insecticide, employing silicone oil for PY control and olive oil for OP control. Twenty-five adult female Ae. aegypti mosquitoes were placed within the holding tubes and acclimatized for one hour. Following this acclimation interval, any damaged, injured, or dead mosquitoes were substituted with healthy individuals. Subsequently, the mosquitoes were transferred from the holding tube into a test tube that contained insecticide-impregnated paper. Data pertaining to knockdown effects were systematically recorded at five-minute intervals throughout one hour of exposure to the insecticides. At the end of the exposure period, the mosquitoes were promptly returned to the holding tubes, where they were provided with cotton wool moistened with a 10% sucrose solution as a nutritional source. The mortality rate was subsequently assessed 24 hours post-exposure. The test was run at a temperature of 28 ± 2°C, a relative humidity of 78 ± 10%, and a photoperiod of 12 hours of light followed by 12 hours of darkness. Statistical Test for Susceptibility of Aedes aegypti The percentage mortality observed after 24-hour exposure to insecticides in adult bioassay experiments was evaluated for susceptibility status utilizing the criteria established by the World Health Organization (WHO), wherein mosquitoes are classified as: (1) susceptible if the mortality percentage ranges from 98 to 100%, (2) incipiently resistant if mortality falls within the 90–97% range, and (3) resistant if mortality is less than 90% [ 30 ]. In instances where the mortality rate of the control mosquitoes exceeded 20%, the experimental data will be discarded. Conversely, when the control mortality rate was observed to be between 5% and 20%, the calculated percentage of mortality was adjusted utilizing Abbot’s formula [ 31 ]: $$\:=\frac{\text{%}\:\text{T}\text{r}\text{e}\text{a}\text{t}\text{e}\text{d}\:\text{m}\text{o}\text{r}\text{t}\text{a}\text{l}\text{i}\text{t}\text{y}-\:\text{%}\:\text{C}\text{o}\text{n}\text{t}\text{r}\text{o}\text{l}\:\text{m}\text{o}\text{r}\text{t}\text{a}\text{l}\text{i}\text{t}\text{y}\:}{100-\text{%}\:\text{C}\text{o}\text{n}\text{t}\text{r}\text{o}\text{l}\:\text{m}\text{o}\text{r}\text{t}\text{a}\text{l}\text{i}\text{t}\text{y}}\:x\:100%$$ In the present study, Abbot's correction concerning the control mortality was not applied due to the 0% mortality. The 24-hour mortality data were subjected to a one-way ANOVA analysis to determine the significant differences between localities for each insecticide. Data were tested for homogeneity and normality before the test. The transformation was done using a log transformation to fulfill the assumption of one-way ANOVA. IBM SPSS Statistics Version 28.0 of probit analysis was used for the statistical analysis to determine the knockdown times for 50% and 95% of the tested population (KdT 50 and KdT 95 ). We used Kaplan-Meier survival analysis with 95% confidence intervals (CIs) in SPSS Version 28.0 to examine the survival rate of Ae. aegypti in response to insecticides within 1 hour of exposure. The survival differences between the studied insecticides were then ascertained through pairwise comparisons using the log-rank test. Knockdown resistance mutations ( kdr ) of the voltage-gated sodium channel (VGSC) gene Ten specimens of alive Ae. aegypti mosquitoes' DNA that exhibited resistance after being tested with PY and OP insecticides was extracted using the DNeasy extraction Kit (Qiagen, Germany) following the manufacturer's protocol. The DNA concentration and purity were measured using a Nanodrop spectrophotometer at 260 nm. To ascertain kdr mutations, two segments of the coding region of the VGSC gene, encompassing exon 19 through exon 31 (including the 989, 1011, 1016, 1007, and 1534 coding positions), were amplified from DNA samples and subsequently subjected to direct sequencing. A polymerase chain reaction (PCR) mixture totaling 25 µl was formulated utilizing 7.5 µl of Platinum SuperFi II DNA Polymerase, 0.2 µl of the Forward primer, 0.2 µl of the Reverse primer, 5 µl of DNA template, and ultimately 2.1 µl of dH2O maintained on ice. To guarantee a homogeneous distribution of the PCR mixture, the formulation was centrifuged for 10 seconds using a mini centrifuge apparatus before PCR analysis. A comprehensive total of two sets of PCR mixtures were prepared for each DNA specimen for (1) domain II (which includes mutations at S989P, A1007G, I1011M/V, L1014F, V1016G/I, and T1520I), where the initial amplification of fragments was conducted utilizing primers AaSCF1 (AGACAATGTGGATCGCTTCC) and AaSCR4 (GGACGCAATCTGGCTTGTTA), whereas (2) for domain III, primers AaSCF7 (GAGAACTCGCCGATGAACTT) and AaSCR7 (GACGACGAAATCGAACAGGT) were employed in the polymerase chain reaction to identify the F1534C mutation [ 18 ]The parameters for the PCR were established at an initial denaturation temperature of 98°C for 30 seconds, followed by 30 cycles consisting of denaturation at 98°C for 15 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 1 minute. This ended in a final elongation phase at 72°C for 10 minutes and was subsequently maintained at 4°C ∞. The polymerase chain reaction (PCR) products were subjected to size-based separation on a 1.1% agarose gel. The gel-containing PCR products were stained with 1µl Biorad UView 6x loading dye and run at 140 V for 40 minutes in TAE buffer. The results were visualized under UV light. The PCR products were purified using ExoSAP at a 5:2 ratio and sent to Retrogen Inc., California, USA, for the sequencing service. The DNA sequencing process was completed with primers AaSCF3 (GTGGAACTTCACCGACTTCA) and AaSCR6 (CGACTTGATCCAGTTTGGAGA) for domain II, and AaSCR8 (TAGCTTTCAGCGGCTTCTTC) for domain III of Ae. aegypti [ 18 ]. Sequencing data obtained from Retrogen Sequencing Service were aligned using ClustalW, and protein sequences were translated using Mega v12. Quantification of Metabolic Detoxification Enzyme The experimental assays were performed on newly emerged F 0 generation female mosquitoes (within 24 hours) of the species Ae. aegypti collected from Asian countries and the USA, which were obtained through field collection methods described in the previous section. The quantification of metabolic enzymes was established using a standard protocol for assessing metabolic resistance described by Hemingway and Brogdon [ 32 ] and Valle et al. [ 33 ]. The chemicals used for the biochemical assays are: 1-naphthyl acetate (≥ 98%, Sigma Aldrich Corporation, St. Louis, MO, USA), 1-naphthol (≥ 99%, Spectrum Chemical Mfg. Corp., Gardena, CA, USA), 2-naphthol (≥ 99%, Spectrum Chemical Mfg. Corp., Gardena, CA, USA), 2-naphthyl acetate (≥ 98%, Sigma Aldrich Corporation, St. Louis, MO, USA), -nitrophenyl acetate (≥ 98%, Sigma Aldrich Corporation, St. Louis, MO, USA), p1-chloro-2,4-dinitrobenzene (CDNB) (99%, Acros Organics, Carlsbad, CA, USA), fast blue B salt (MP Biomedicals, LLC, Irvine CA, USA), and reduced glutathione (GSH) (99%, Chem-Impex International, Inc., Wood Dale, IL, USA). Homogenization of Aedes aegypti Forty individuals of adult Ae. aegypti on the first day of emergence without a bloodmeal from each locality were selected for biochemical assay. Each individual was homogenized using a pestle motor in 300µl of grade water and kept on ice to minimize proteolysis. For the reference strain of VCRU, five individuals were subjected to homogenization. Uncentrifuged aliquots of 25µl were used to quantify acetylcholinesterase (ACE) and 20µl for Mixed Function Oxidase (MFO). The remaining aliquots were centrifuged at 12000x g for 60 seconds. The supernatant was collected and used for esterases, Glutathione S-transferase, and total protein assays. Mixed function oxidase (MFO) assay on the cytochrome P450 The assay used to measure mixed–function oxidases measures an increase in haem content, which is consequently converted into cytochrome P450. The cytochrome P450 quantification process was based on the methodology described in WHO WHO [ 34 ]. To summarise, 20 µl of microfuge supernatant was mixed with 60 µl of 0.625M potassium phosphate buffer (pH 7.2) and 200 µl of tetramethyl benzidine (TMBZ) solution (0.012 g 3,3,5,5-tetramethylbenzidine + 6 ml methanol + 18 ml sodium acetate buffer 250 mM, pH 5.0). After adding 25 µl of 3% hydrogen peroxide, the mixture was left to sit at room temperature with light protection for 90 minutes. MFO activity values were computed using the standard absorbance curve at 650 nm based on known cytochrome C concentrations. Equivalent cytochrome P450/min/mg protein was used to measure enzymatic activity using an Epoch 2 Microplate Spectrophotometer (BioTek Instruments Inc., Winooski, VT, USA). Three positive controls were run using 20 µl of cytochrome C in place of mosquito homogenate, and three negative controls were performed using 20 µl of 0.625M potassium phosphate buffer (pH 7.2). Altered acetylcholinesterase (AChE) assay The activity of acetylcholinesterase was assessed either with or without the propoxur inhibitor present, labeled as AChE and AChI, using two separate 96-well plates. A total of 145 µl of Triton/Na phosphate (prepared with 5 ml of 100% Triton X-100 in 50 ml of 1M sodium phosphate buffer at pH 7.8 and 455 ml of distilled water) and 10 µl of DTNB/Na phosphate (prepared before used with 10mMDTNB in 100mM sodium phosphate buffer at pH 7.0) were added to 25 µl of mosquito homogenates prepared in duplicate. Each well in the AChE plates contained 10 mM acetylcholine iodide in grade water without propoxur. Propoxur (6 µl of 0.1M in acetone) was applied to the AChI plates in addition to 10 mM acetylcholine iodide in grade water. Both AChE and AChI plates were incubated for an hour at room temperature and were read at 405 nm using an Epoch 2 Microplate Spectrophotometer (BioTek Instruments Inc., Winooski, VT, USA). Three negative and three positive controls were provided by replacing the mosquito homogenate with 25 µl of sterile distilled water only. The findings were presented as a percentage of remaining activity in both the inhibited control and the inhibited fraction. Esterase (EST) assays First, 10 µl of the mosquito homogenates' supernatant was applied to each well in duplicate. Then, 200 µl of 30mM α-naphthyl acetate was added to one set of samples, while 200 µl of 30mM β-naphthyl acetate was added to the other set. The plate was incubated at room temperature for 15 minutes. After incubation, each well was filled with 50 µl of fast-blue stain, and the mixture was left to incubate for an additional five minutes. The reaction was read at 570 nm using an Epoch 2 Microplate Spectrophotometer (BioTek Instruments Inc., Winooski, VT, USA). Three positive controls were run at 10 µl of α-naphthol at 0.5 µg/mL, and three negative controls were run using 10 µl of sterile distilled water for the α-esterase assay. On the other hand, three negative controls were performed using 10 µl of sterile distilled water for the β-esterase test, and three positive controls were run using 10 µl of 0.5 µg/mL β-naphthol. EST activity against each substrate was calculated using standard absorbance curves corresponding to known α–naphthol or β–naphthol concentrations. Quantified enzymatic activities were expressed as nmol of either α-naphthol or β-naphthol/min/mg protein. Glutathione S-transferase (GST) assay Fifteen microlitres of mosquito homogenate were applied to each microtiter plate well in two test duplicates. 195 µl of a working solution of 1-chloro-2,4-dinitrobenzene (CDNB) was used to measure glutathione S-transferase activity. This working solution, which was prepared by combining 0.0615 g of reduced glutathione (GSH) in 20 ml of 100 mM potassium phosphate buffer at pH 6.5 with 0.0042 g of 1-chloro-2,4-dinitrobenzene diluted in 1 ml of methanol, was administered to each duplicate of the mosquito homogenate. Three positive and negative controls were prepared using 15 µl of sterile distilled water. The absorbance was read at 340nm every minute for 20 minutes using an Epoch 2 Microplate Spectrophotometer (BioTek Instruments Inc., Winooski, VT, USA). The GST activity was calculated by converting the data with Beer’s Law ( A = εcl ) using a path length of 0.6 cm and an extinction coefficient of 4.29µM − 1 . Total protein assay All enzyme activity assays were normalized using protein concentration as a correction factor to take individual mosquito size variations into consideration. A commercial protein assay kit (Bio-Rad, USA) was used to produce the BSA standard curve, which was used to convert and calculate the protein concentration for each sample. After centrifugation, duplicates of 10 µl mosquito homogenates were plated in 96-well plates. Ten microlitres of mosquito homogenates and 300 microlitres of diluted Bio-Rad dye reagent were mixed to perform the protein test. After that, this combination was incubated for three to five minutes at room temperature. For the negative controls, 10 µl of distilled water was used in three wells, and for the positive controls, 10 µl of 1µg/mL BSA was used in three wells. The plate was then read at the optical density at 620 nm. Protein levels were calculated using a standard curve derived from the absorbance of bovine serum albumin. Biochemical data analysis The mean absorbance readings from replicate wells were converted into mean values, which were then divided by the corresponding protein values to determine each mosquito's enzyme activity. A one-way ANOVA was carried out to determine whether the Ae. aegypti strains' activities of acetylcholinesterase (AChE) after inhibition with propoxur, monooxygenases, esterases, and glutathione S-transferases (GSTs) differed significantly from one another (Welsch, Post hoc Test, P < 0.05). The data were log-transformed and subjected to a normality test before analysis in IBM SPSS Statistics version 28.0 to fulfill the assumptions of ANOVA. Results Susceptibility to Pyrethroids and Organophosphates Aedes aegypti Malaysia strain from both FH and TBJ showed significantly high phenotype resistance towards PY and OP insecticides (mortality between 9–22%; one-way ANOVA, p < 0.05) compared to other localities, except possible resistance for TBJ exposed to malathion (mortality 95%; Fig. 2 ). The Riverside strain from the USA also exhibited high phenotypic resistance to PY and was not significantly different from the Malaysian strain (mortality 22–33%; one-way ANOVA, p < 0.05), but remained susceptible to malathion. Aedes aegypti collected from ST, Thailand, showed phenotypic resistance to PY and OP (mortality 58–87%). However, the SK strain, also from Thailand, remained susceptible to PY (mortality rate 99%), but not to the OP group. However, no significant differences were found in the mortality of Ae. aegypti between SK and ST strains, Thailand (one-way ANOVA, p < 0.05). Mosquitoes from Indonesia were found to be less resistant to PY, which represents possible resistance and susceptible status to the OP group (Fig. 2 ). One-way ANOVA revealed significant differences between strains collected from Asian countries and the USA when exposed to insecticides (p < 0.01; Table 1 ). Table 1 The results of a one-way ANOVA represent the mean differences of 24 hours of Aedes aegypti mortality between each locality against pyrethroid and organophosphate insecticides. Class Insecticides MS df F Sign. Organophosphate 5% malathion Between group 674.667 6 28.184 < 0.001 Within group 25.333 21 Total 27 60mg/m 2 Between group 5052.267 6 21.416 < 0.001 pirimiphos-methyl Within group 280.00 21 Total 27 0.4% Between group 8666.267 6 92.909 < 0.001 Pyrethroid permethrin Within group 107.333 121 Total 27 0.03% Between group 5103.842 6 25.684 < 0.001 deltamethrin Within group 261.931 21 Total 27 Knockdown Time (KT) after Exposure to Pyrethroids and Organophosphates When comparing the impact of malathion on the knockdown time between strains, the Malaysia strain from FH showed the highest KT 50 at 69.88 minutes and KT 95 at 148.92 minutes (Table 2 ). The KT 95 levels of FH and TBJ in Malaysia showed no significant differences (p < 0.05). Knockdown of Ae. aegypti exposed to the OP group (malathion and pirimiphos-methyl) cannot be determined within one hour in most strains due to the delayed toxic effects of these compounds, which manifest after exposure, and mortality effects can be observed at 24 hours. The ST strains showed the highest KT 50 for permethrin, 876.61 minutes, indicating that a longer time was needed to cause knockdown (Table 2 ). Since no knockdown occurred after an hour of exposure, the KT 50 and KT 95 of permethrin for TBJ and FH from Malaysia, cannot be ascertained. The strong resistance status identified at 24-hour mortality in the previous section (Fig. 2 ) supports a high likelihood of rapid recovery, and the knockdown effect was temporary following exposure. The lowest KT 50 (15.30 minutes) and KT 95 (29.79 minutes) for deltamethrin were observed in the Depok strain from Indonesia, indicating that the fastest knockdown occurred upon exposure to deltamethrin (Table 2 ). In addition, the VCRU susceptible strains exhibited significantly faster knockdown, as indicated by both KT 50 and KT 95 , compared to other strains following exposure to PY insecticides. Meanwhile, the KT 50 and KT 95 of OP were unable to compute due to no knockdown within one hour of exposure, but 100% mortality was observed after 24 hours post-treatment. Survival after Exposure to Insecticides As shown in Fig. 2 , the survival analysis using the Kaplan-Meier method revealed a similar survival curve pattern for all strains and insecticides, except for the DP strain from Indonesia (pairwise, p < 0.01). Based on the log-rank test, the mean survival time varied less within 17.001–18.209 minutes with no significant differences between strains and insecticides (log-rank, p < 0.05; Table 3 ). The most susceptible strain towards OP with a low KT 50 value was determined in Fig. 3 and Table 2 , represented by DP, Indonesia. This strain also showed the highest survival mean in the survival analysis, ranging from 18.549 to 29.127 minutes (Table 3 ). Whereas the VCRU susceptible strain exhibited a similar survival pattern for OP with other strains, with no dead mosquitoes, indicating a delayed effect. However, 100% mortality, indicating susceptible status, was achieved after 24 hours post-treatment (Fig. 3 ). VCRU strains also showed significantly lower survival in the PY treatment compared to other strains (pairwise, p 0.01). Table 3 Mean survival time and log-rank test analysis for Aedes aegypti from different countries after insecticide exposure. Insecticide Country Locality Mean survival time Log-rank test Estimates Std. error Chi-square df Sign. 5% malathion Malaysia VCRU susceptible 17.268 0.372 Malaysia Hamna 17.268 0.372 111.326 6 < 0.001 Taman Bukit Jambul 18.203 0.405 Thailand Songkhla 17.993 0.391 Surat Thani 17.759 0.389 Indonesia Depok 22.177 0.513 United States of America Riverside 17.167 0.367 60mg/m 2 pirimiphos-methyl Malaysia VCRU susceptible 17.147 0.140 Malaysia Hamna 17.001 0.359 36.218 6 < 0.001 Taman Bukit Jambul 17.001 0.359 Thailand Songkhla 17.001 0.359 Surat Thani 17.043 0.361 Indonesia Depok 18.549 0.420 United States of America Riverside 16.993 0.359 0.4% permethrin Malaysia VCRU susceptible 54.539 0.391 Malaysia Hamna 17.023 0.360 1975.926 6 < 0.001 Taman Bukit Jambul 17.001 0.359 Thailand Songkhla 18.020 0.383 Surat Thani 18.020 0.383 Indonesia Depok 29.127 0.559 United States of America Riverside 17.942 0.360 0.03% deltamethrin Malaysia VCRU susceptible 53.138 0.176 Malaysia Hamna 17.434 0.375 1777.871 6 < 0.001 Taman Bukit Jambul 17.001 0.359 Thailand Songkhla 17.001 0.359 Surat Thani 18.105 0.384 Indonesia Depok 27.403 0.588 United States of America Riverside 18.209 0.399 Detection of Target Site kdr Mutation at Domain II and III of VGSC The VGSC resistance allele frequencies were detected in insecticide-resistant mosquitoes from DIIS6 regions (codons 989, 1007, 1011, 1016) and DIII6 for codons 1520 and 1534 among four countries (Fig. 4 ). Thailand-resistant mosquitoes showed a lower frequency of resistance alleles. Only 10% I1011M in SK-pirimiphos-methyl and 10% in ST-deltamethrin. The changes at codon position 1016 from Isoleucine (ATA) to Methionine (ATG) and codon position 1534 from phenylalanine (TTC) to cysteine (TGC) were discovered for pirimiphos-methyl-resistant, permethrin-resistant, and deltamethrin-resistant Ae. aegypti mosquitoes of the RS, USA strain. Surprisingly, the same mutation of V1016I was also detected in DP, Indonesia, for PY-possible-resistant individuals. A mixture of kdr mutation alleles was found in both Malaysian strains. TBJ exhibited four resistance codons with S989P and V1016G at domain II and T1520I and F1534C for domain III for pirimiphos-methyl-resistance and permethrin-resistant Ae. aegypti with different frequencies (Fig. 4 b, c, and d). Interestingly, this is the first time the detection of T1520I in Malaysia, which was reported in India earlier [ 35 ]. At codon position 1520, the wild-type amino acid Threonine (ACC) changes to Isoleucine (ATC) due to a C to T substitution. Our sequencing also detected I1011V at a 15% frequency in deltamethrin-resistant mosquitoes. Meanwhile, only three mutations were detected in malathion-resistance TBJ mosquitoes: S989P, V1016G, and F1534C. The same mutations were detected in the FH strain for pirimiphos-methyl-resistant and deltamethrin-resistant mosquitoes. In the malathion-resistant FH strain, changes at position 1011, from Isoleucine (ATA) to Methionine (ATG), were also detected. Distribution of kdr mutations and multiple loci of the genotypes We have identified eight combinations of substitutions, comprising six double-locus, one triple-locus, and one quadruple-locus, from four countries genotyped for DIIS6 and DIIIS6 out of 188 samples (Table 4 ). The locus genotype with a combination of two amino acid substitutions, DIIS6 and DIIIS6, type 5 (V1016I + F1534C), was found in pirimiphos-resistant, permethrin-resistant, and deltamethrin-resistant USA samples. We observed that the presence of these substitution patterns led to high resistance to both PY and OP insecticides. Biochemical Assays on Enzymatic Activities The mean enzymatic activities of each strain were reported in Table 5 , and the percentage frequency distribution of enzymes was tabulated in Figs. 5 – 9 for the remaining activity of acetylcholinesterase after inhibition with propoxur, MFO, α-EST, β-EST, and GST. The USA RS strain was found to have significantly higher elevated enzyme activities between 3–10 times than the VCRU susceptible strain (Table 5 ; one-way ANOVA, p < 0.05). This frequency distribution is well distributed and skewed to the right side, indicating resistance had occurred at the metabolic sites (Figs. 5 – 9 ), thus including a high frequency of kdr mutations (Fig. 4 and Table 4 ). SK strain has also shown a pattern of increasing all enzymes, but only the remaining acetylcholinesterase after inhibition with propoxur and GST showed significant figures (one-way ANOVA, p < 0.05; Table 5 ). Meanwhile, less frequency of kdr mutations was detected in the samples from SK (Table 4 ). The DP strain from Indonesia was found to be susceptible to OP and possibly resistant to PY (Fig. 1 ). These results were supported by the metabolic enzymes, where the upregulation of α-EST and GST was not significantly different from that of the VCRU reference strain (one-way ANOVA, p < 0.05). Malaysia strains from both TBJ and FH showed high resistance to insecticides (Fig. 2 ), with the presence of multiple kdr mutations (Table 4 ), indicating an upregulation of α-EST, β-EST, and GST enzymes as a mechanism of resistance for the FH strain. Still, it is not significantly different from the VCRU reference strain (one-way ANOVA, p > 0.05). Table 5 Mean enzyme activity of remaining activity of acetylcholinesterase (ACHE), mixed function oxidase (MFO), esterases, and glutathione S-transferase (GST) for Aedes aegypti mosquitoes from different countries (n = 40). Country Strain ACHE MFO α-EST Β-EST GST Mean ± SE Mean ± SE Mean ± SE Mean ± SE Mean ± SE Reference (Susceptible) VCRU 16.91 ± 1.24 a 10.44 ± 0.84 a 0.39 ± 0.02 a 0.56 ± 0.03 a 3.36x10 4 ± 0.00 a Malaysia Taman Bukit Jambul 5.46 ± 2.45 c 4.24 ± 1.34 b 0.99 ± 0.31 b 0.82 ± 0.36 a 3.74x10 3 ± 0.00 a,b Hamna 14.04 ± 1.88 a,b 24.85 ± 6.51 a 0.59 ± 0.14 a,b 0.88 ± 0.24 a 9.64x10 4 ± 0.00 a Thailand Surat Thani 2.69 ± 0.40 c 11.64 ± 0.65 a 0.69 ± 0.05 a,b 0.81 ± 0.07 a 1.37x10 3 ± 0.00 a,b Songkhla 16.92 ± 7.49 b 33.70 ± 12.51 a 1.06 ± 0.64 a,b 2.34 ± 1.15 a 3.49x10 3 ± 0.00 b Indonesia Depok 8.92 ± 2.14 b,c 3.10 ± 0.49 b 0.43 ± 0.04 a,b 0.44 ± 0.05 a 9.16x10 4 ± 0.00 a USA Riverside 126.21 ± 19.10 d 24.36 ± 5.36 a 1.45 ± 0.16 c 6.03 ± 0.70 b 3.61x10 3 ± 0.00 b Discussion Understanding the mechanisms underlying insecticide resistance in Aedes aegypti is essential for designing sustainable vector control strategies. Resistance arises through multiple pathways, including observable phenotypical resistance, enhanced metabolic detoxification, and target-site mutations in the mosquito nervous system. These mechanisms can act independently or synergistically, leading to varying levels of resistance across populations and geographic regions. Our study detected high phenotypic resistance of Ae. aegypti to pyrethroids (permethrin and deltamethrin) and organophosphates (malathion and pirimiphos-methyl) in strains from Penang, Malaysia, and Riverside, USA. In contrast, the Depok, Indonesia strain showed susceptibility to organophosphates and only incipient resistance to pyrethroids. Interestingly, Thai strains (Songkhla and Surat Thani) exhibited strong resistance to pyrethroids despite lacking detectable kdr mutations. This suggests that phenotypic resistance can occur independently of genetic markers, possibly driven by other physiological or environmental factors. Several elements, including insecticide resistance, environmental adaptations, and human activities, play critical roles in shaping this phenomenon [ 36 ]. The surge in cases highlights how critical it is to comprehend the dynamics influencing the Ae. aegypti 's resilience in both countries. The intensive use of insecticides for vector control has inadvertently exerted selective pressure on mosquito populations, favoring individuals with genetic mutations that confer resistance [ 21 ]. The escalating resistance to PY and OP insecticides presents a complex challenge rooted in distinct agricultural practices and environmental conditions. For example, the same insecticides used to control agricultural pests are employed in vector control programs for diseases like malaria and dengue [ 37 ]. Pests exposed to insecticides in one sector (e.g., agriculture) may develop resistance mechanisms that confer cross-resistance to insecticides used in the other sector (e.g., public health). Pests often develop resistance to multiple insecticide classes through various mechanisms, including target-site modifications, enzymatic detoxification, and reduced penetration or excretion of insecticides [ 38 ]. New mutation detections of T1520I, which has never been reported in Malaysia, as well as the presence of I1011M in domain SII6 were found in this study. The T1520I mutation in Ae. aegypti is part of a broader context of knockdown resistance ( kdr ) mutations that contribute to insecticide resistance, particularly against PY and DDT, and this T1520I novel gene was first reported in Delhi [ 35 , 39 ]. The presence of T1520I, although less prevalent than other mutations, plays a role in enhancing resistance when combined with F1534C, which enhances resistance to permethrin but does not affect sensitivity to deltamethrin [ 40 ]. Our results revealed a high frequency of dual-loci mutations of T1520I + F1534C from TBJ, Malaysia (Table 4 ). The distribution of these mutations varies across regions, with studies indicating a lack of recombination among haplogroups in Indian populations, suggesting stable resistance mechanisms [ 41 ]. The I1011M kdr mutation in Ae. aegypti is less prevalent in Asia and only detected at a low prevalence in malathion-resistant FH Malaysia strains. This mutation has been formally reported in Thailand, Vietnam, Brazil, French Guyana, and Martinique [ 42 , 43 ]. Regional variations were evident in V1016G and S989P mutations, which dominated Southeast Asian populations, whereas V1016I was prevalent in the Americas but has now emerged in Asian strains. In our study, homozygous V1016I was found in pirimiphos-resistant and deltamethrin-resistant RS USA strain. The V1016I mutation is not commonly found in Ae. aegypti in Asia; instead, the V1016G mutation is prevalent. Interestingly, V1016I was found in Depok, Indonesia, among the PY-possible resistant individuals. Such findings underscore the global dissemination and regional adaptation of resistance alleles. As supported by a review by Uemura et al. (2024) [ 44 ], V1016I resistance mutations have been found in Argentina, Brazil, Burkina Faso, Colombia, Ghana, Iran, the USA, and Venezuela (since 2023). The mutation occurred at DII6 for codons 1016, suggesting that the dissemination of resistance has transitioned from the Americas to Asia. This mutation, along with others in the voltage-gated sodium channel (VGSC) gene, has been linked to a substantial reduction in pyrethroid binding and efficacy of PY insecticides, which are commonly used for vector control. The V1016I mutation may not autonomously diminish PY sensitivity; however, it could engage in a synergistic interaction with other knockdown resistance mutations, such as F1534C or V410L, which can lead to resistance levels varying from 3.9- to 56-fold depending on the specific pyrethroid used [ 45 ]. PY-resistant Ae. aegypti populations, V1016I is often linked to another mutation, F1534C, which confers sodium channel resistance only to Type I pyrethroids, including permethrin, but not to Type II PY including deltamethrin [ 46 ]. Whereas, the mosquitoes carrying both V1016G and F1534C exhibited greater PY resistance than those carrying F1534C alone [ 40 ]. In which, Ae. aegypti mosquitoes with a high frequency of double homozygous resistant genotypes (II/CC), contributing to increased survivorship of mosquitoes at varying distances from insecticide application sites [ 47 ]. In our study, this interaction implies that V1016I or V1016G could be integral in augmenting mosquitoes' comprehensive resistance profile when conjoined with F1534C, resulting in resistance to permethrin and deltamethrin. Multiple knockdown resistance ( kdr ) mutations in the voltage-gated sodium channel (VGSC) gene were identified. The V1016G, S989P, and F1534C mutations are typically associated with the Indo-Pacific region [ 48 ]. The presence and frequency of these mutations across various populations can provide insights into the potential for resistance development similar to that found in this study in Malaysia and Indonesia. This mutation, when present with other kdr mutations, significantly enhances the survival of mosquitoes under insecticide exposure [ 49 , 50 ]. Specific haplotypes, particularly those containing multiple kdr mutations, are associated with higher resistance levels, emphasizing the need for targeted monitoring [ 51 ]. This mutation enhances resistance levels, impacting the effectiveness of insecticides and complicating vector control efforts against dengue and other viral transmissions [ 44 ]. For instance, the combination of V1016G and F1534C can confer up to a 1100-fold increase in resistance to PY [ 41 ]. Instead, the study highlights V1016G, S989P, and F1269C mutations associated with PY resistance in Southeast Asia, Asia particularly Singapore and Indonesia [ 52 ]. In Vietnam and Cambodia, high frequencies of V1016G, along with L982W and F1534C mutations, have been reported, which are associated with high levels of PY resistance, indicating a concerning trend of increasing resistance [ 53 ]. Beyond kdr mutations, other resistance mechanisms may also play a role, indicating that reliance solely on kdr mutation monitoring may not capture the complete picture of resistance dynamics [ 54 ]. Thus, solely relying on kdr mutations may not accurately predict the emergence of high resistance in mosquito populations. OP resistance is less frequently associated with genetic mutations, making it less likely to develop in insect populations [ 55 ]. The mode of action primarily involves the inhibition of acetylcholinesterase, leading to an accumulation of acetylcholine at nerve synapses [ 56 , 57 ]. In this study, metabolic detoxification, particularly through the overexpression of cytochrome P450 monooxygenases, esterases, and glutathione S-transferases, contributes significantly to insecticide resistance. In the Riverside, USA strain, resistance was associated with upregulated α-esterases, β-esterases, GSTs, and mixed-function oxidases, which were upregulated between 3 and 100 times compared to the VCRU reference strain. Resistance is most severe when metabolic and site mutation mechanisms co-occur. For example, the Riverside strain exhibited both high enzymatic activity and multiple kdr mutations, resulting in strong resistance to both pyrethroids and organophosphates. Similarly, dual-loci mutations such as T1520I + F1534C or V1016G + F1534C conferred markedly higher resistance levels than single mutations. This interplay highlights the complexity of resistance evolution and the challenge of relying on insecticides with a single mode of action [ 58 ]. By contrast, the FH Malaysia strain displayed high resistance without notable upregulation of detoxifying enzymes, suggesting the predominance of genetic rather than metabolic mechanisms. Whereas the TBJ, Malaysia strain showed increased MFO activity alone. According to Rubio-Palis et al. [ 59 ], elevated metabolic enzyme activity, such as mixed-function oxidases and GSTs, plays a significant role in resistance. In Ae. aegypti , while kdr mutations increased significantly after deltamethrin selection, only α-esterase activity remained elevated, indicating a complex relationship between mutations and enzyme upregulation [ 60 ]. While PY faces significant resistance challenges, the development of OP resistance remains limited. This suggests that the mechanisms and evolutionary pressures differ markedly between these two classes of insecticides. In addition, although the phenotypic resistance exhibited by the Thailand strains (Songkhla and Surat Thani) was high in PY exposure, they showed a limited frequency of kdr mutations. In Ae. aegypti from Côte d'Ivoire, phenotypic resistance was observed against several insecticides, with mortality rates varying significantly across different sites, yet no kdr mutations were detected [ 61 ]. Thus, the upregulation of the remaining acetylcholinesterase after inhibition with propoxur and GST mainly contributed to the resistance status of the Thai strains. The Indonesian strain from Depok showed a high susceptibility to OP and incipient resistance to PY, as indicated by their phenotypic resistance. Depok, Indonesia, is a suburban extension of Jakarta and a rapidly growing urban area that has yet to experience less insecticide pressure, allowing for a more susceptible mosquito population. However, the growing urban area may lead to more resistant individuals due to the selective pressures of insecticides [ 61 ] and habitat availability, which is increasingly at risk of vector-borne diseases that require management effort using insecticides such as Ae. aegypti expands its range [ 62 ]. The Depok, Indonesia, and Riverside, USA strains are still susceptible to malathion. Despite resistance mechanisms in some mosquito populations, malathion remains effective against many species due to specific genetic and enzymatic factors that limit the development of resistance. Overexpression of cytochrome P450 enzymes, which detoxify PY, may increase susceptibility to malathion. These enzymes can activate pro-insecticides, enhancing malathion's effectiveness [ 63 ]. Conversion through the metabolic enzymatic activation process of less toxic malathion to malathion-oxon, which is significantly more toxic due to its potent inhibition of acetylcholinesterase (AChE), and these detoxification enzymes are often upregulated in resistant populations. However, their role in malathion resistance is complex and not always sufficient to confer resistance, as seen in various studies where mosquitoes remained susceptible despite enzyme overexpression [ 64 , 65 ]. Conclusions In conclusion, this study demonstrated that resistance in Ae. aegypti is shaped by multiple, interacting mechanisms, including phenotypical traits, metabolic detoxification, and kdr mutations. High resistance to pyrethroids and organophosphates was observed across Malaysia, Indonesia, Thailand, and the USA, with novel detections of T1520I and I1011M in Malaysia and V1016I in Indonesia. These findings underscore the complexity of resistance evolution under selective pressure from insecticide use and environmental change. Thus, insecticides that are often applied at higher doses or with greater frequency than necessary exert strong selective pressure on pest populations. This practice accelerates the survival and reproduction of individuals with resistant traits, leading to the rapid evolution of resistant populations. The environmental degradation of insecticides can leave sub-lethal residues, further select resistant individuals [ 66 ], and allowing the expansion of resistant individuals. Without proper monitoring of pest populations and economic thresholds, insecticides are often applied prophylactically, further exacerbating resistance. Other than that, climate change is expected to exacerbate resistance by expanding the ranges of invasive pests and altering the effectiveness of insecticides [ 67 ]. As highlighted earlier, managing resistance requires continuous surveillance and the integration of adaptive vector control strategies to sustain the effectiveness of current insecticides. Declarations Acknowledgments We would like to express our sincere gratitude to Universiti Sains Malaysia, the University of California, Riverside, the National Research and Innovation Agency of the Republic of Indonesia (BRIN), and Prince of Songkhla University for their invaluable support throughout this research. The institution's resources and facilities greatly contributed to the successful completion of this work. We want to acknowledge the collaborative efforts of our colleagues, whose guidance and insights have significantly contributed to the development of this work. Funding We also extend our heartfelt appreciation to the Ministry of Higher Education Malaysia (FRGS/1/2023/STG03/USM/02/4) and the UC Riverside Urban Entomology Endowed Chair Research Fund. This funding was essential in facilitating the research and enabling the publication of this manuscript. Special thanks to the Malaysian American Commission on Educational Exchange (MACEE) and the Bureau of Educational and Cultural Affairs of the United States Department of State for the US-ASEAN Fulbright Fellowship to Wan Fatma Zuharah that enabled her to pursue research at UC Riverside. Availability of data and materials All data generated or analyzed during this study are included in this article and its supplementary materials. Authors’ Contribution The authors' contributions are as follows: WFZ: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Validation, Writing—original draft; CYL: Conceptualization, Methodology, Funding acquisition, Resources, Supervision, Validation, Writing—review & editing; FNA, ANZA, EB, TK, IG, TP, TSS- Methodology, Investigation; SHL: Data curation, Formal Analysis. Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare no competing interests. References Jeffrey RP, Andrea G-S, Panayiota K. Recent History of Aedes aegypti: Vector Genomics and Epidemiology Records. BioScience. 2018;68 11:854–60; doi: https://doi.org/10.1093/biosci/biy119 . Capinha C, Rocha J, Sousa CA. Macroclimate determines the global range limit of Aedes aegypti. EcoHealth. 2014;11:420–8. Hahn MB, Eisen RJ, Eisen L, Boegler KA, Moore CG, McAllister J, et al. Reported distribution of Aedes (stegomyia) aegypti and Aedes (stegomyia) albopictus in the United States, 1995–2016 (diptera: Culicidae). Journal of medical entomology. 2016;53 5:1169–75. Bracco JE, Capurro ML, Lourenço-de-Oliveira R, Sallum MAM. Genetic variability of Aedes aegypti in the Americas using a mitochondrial gene: evidence of multiple introductions. Memorias do Instituto Oswaldo Cruz. 2007;102:573–80. Hopperstad K, Reiskind M. Recent changes in the local distribution of Aedes aegypti (Diptera: Culicidae) in South Florida, USA. Journal of medical entomology. 2016;53 4:836–42. Selvaraj P, Wenger EA, Bridenbecker D, Windbichler N, Russell JR, Gerardin J, et al. Vector genetics, insecticide resistance and gene drives: An agent-based modeling approach to evaluate malaria transmission and elimination. PLoS computational biology. 2020;16 8:e1008121. Ahdika A, Lusiyana N. Investigation of Aedes aegypti's resistance toward insecticides exposure using Markov modeling. 2018. Karunamoorthi K, Sabesan S. Insecticide resistance in insect vectors of disease with special reference to mosquitoes: a potential threat to global public health. 2013. Oakeshott JG, Home I, Sutherland TD, Russell RJ. The genomics of insecticide resistance. Genome Biology. 2003;4 1:202. Sato Y, Jang S, Takeshita K, Itoh H, Koike H, Tago K, et al. Insecticide resistance by a host-symbiont reciprocal detoxification. Nature Communications. 2021;12 1:6432. Kasai S, Komagata O, Itokawa K, Shono T, Ng LC, Kobayashi M, et al. Mechanisms of pyrethroid resistance in the dengue mosquito vector, Aedes aegypti: target site insensitivity, penetration, and metabolism. PLoS neglected tropical diseases. 2014;8 6:e2948. Saavedra-Rodriguez K, Strode C, Flores Suarez A, Fernandez Salas I, Ranson H, Hemingway J, et al. Quantitative trait loci mapping of genome regions controlling permethrin resistance in the mosquito Aedes aegypti. Genetics. 2008;180 2:1137–52. Severson D, Anthony N, Andreev O, Ffrench-Constant R. Molecular mapping of insecticide resistance genes in the yellow fever mosquito (Aedes aegypti). Journal of Heredity. 1997;88 6:520–4. Saavedra-Rodriguez K, Campbell CL, Lozano S, Penilla-Navarro P, Lopez-Solis A, Solis-Santoyo F, et al. Permethrin resistance in Aedes aegypti: Genomic variants that confer knockdown resistance, recovery, and death. PLoS Genetics. 2021;17 6:e1009606. Saingamsook J, Yanola J, Lumjuan N, Walton C, Somboon P. Investigation of relative development and reproductivity fitness cost in three insecticide-resistant strains of Aedes aegypti from Thailand. Insects. 2019;10 9:265. Rosilawati R, HLa L, WAa N, AHa N, Aa R, Ma KA, et al. Pyrethroid Resistance Status of Aedes (Stegomyia) aegypti (Linneaus) from Dengue Endemic Areas in Peninsular Malaysia. development. 2017;16 2. Gan SJ, Leong YQ, bin Barhanuddin MFH, Wong ST, Wong SF, Mak JW, et al. Dengue fever and insecticide resistance in Aedes mosquitoes in Southeast Asia: a review. Parasites & vectors. 2021;14 1:315. Kawada H, Higa Y, Futami K, Muranami Y, Kawashima E, Osei JH, et al. Discovery of point mutations in the voltage-gated sodium channel from African Aedes aegypti populations: potential phylogenetic reasons for gene introgression. PLOS Neglected Tropical Diseases. 2016;10 6:e0004780. Rasli R, Lee HL, Wasi Ahmad N, Fikri SFF, Ali R, Muhamed KA, et al. Susceptibility status and resistance mechanisms in permethrin-selected, laboratory susceptible and field-collected Aedes aegypti from Malaysia. Insects. 2018;9 2:43. Zuharah WF, Sufian M. The discovery of a novel knockdown resistance (kdr) mutation A1007G in the Voltage-Gated Sodium Channel (vgsc) on Aedes aegypti (Diptera: Culicidae) from Malaysia. 2020. Akhir MAM, Wajidi MF, Lavoué S, Azzam G, Jaafar IS, Awang Besar NAU, et al. Knockdown resistance (kdr) gene of Aedes aegypti in Malaysia with the discovery of a novel regional specific point mutation A1007G. Parasites & Vectors. 2022;15 1:122. Hamid P, Prastowo J, Widyasari A. Knockdown resistance (kdr) of the voltage-gated sodium channel gene of Aedes aegypti population in Denpasar, Bali, Indonesia.. Parasites & Vectors 2017;10:283; doi: https://doi.org/10.1186/s13071-017-2215-4 . Wuliandari J, Hoffmann A, Tantowijoyo W. Frequency of kdr mutations in the voltage-sensitive sodium channel (VSSC) gene in Aedes aegypti from Yogyakarta and implications for Wolbachia-infected mosquito trials.. Parasites & Vectors. 2020;13:429; doi: https://doi.org/10.1186/s13071-020-04304-x . Ridha M, Yudhastuti R, Notobroto H, Hidajat M, Diyanah K, Jassey B, et al. A systematic review of insecticide resistance in Aedes aegypti (Diptera: Culicidae) and implications for dengue control in Indonesia. Veterinary World. 2025;18 3:658; doi: https://doi.org/10.14202/vetworld.2025.658-672 . Stenhouse SA, Plernsub S, Yanola J, Lumjuan N, Dantrakool A, Choochote W, et al. Detection of the V1016G mutation in the voltage-gated sodium channel gene of Aedes aegypti (Diptera: Culicidae) by allele-specific PCR assay, and its distribution and effect on deltamethrin resistance in Thailand. Parasites & Vectors. 2013;6 253. Yanola J, Somboon P, Walton C, Nachaiwieng W, Somwang P, Prapanthadara L-a. High-throughput assays for detection of the F1534C mutation in the voltage-gated sodium channel gene in permethrin-resistant Aedes aegypti and the distribution of this mutation throughout Thailand. Trop Med Int Health. 2011;16 4:501 – 19. Estep AS, Sanscrainte ND, Waits CM, Bernard SJ, Lylod AM, Lucas KJ, et al. Quantification of permethrin resistance and kdr alleles in Florida strains of Aedes aegypti (L.) and Aedes albopictus (Skuse). PLoS Negl Trop Dis. 2018;12 10:e0006544. Schluep SM, Buckner EA. Metabolic resistance in permethrin-resistant Florida Aedes aegypti (Diptera: Culicidae). Insects. 2021;12 10:866. Viana-Medeiros P, Bellinato D, Martins A, Valle D. Insecticide resistance, associated mechanisms and fitness aspects in two B razilian S tegomyia aegypti (= A edes aegypti) populations. Medical and Veterinary Entomology. 2017;31 4:340–50. WHO WHO. Standard operating procedure for testing insecticide susceptibility of adult mosquitoes in WHO tube tests. 2022. Abbott WS. A method of computing the effectiveness of an insecticide. J econ Entomol. 1925;18 2:265–7. Hemingway J, Brogdon W. Techniques to Detect Insecticide Resistance Mechanisms: Field and Laboratory Manual. World Health Organization; 1998. Valle D, Montella I, Ribeiro R, Viana-Medeiros P, Martins Jr A, Lima J. Quantification methodology for enzyme activity related to insecticide resistance in Aedes aegypti. Ministry of Health Brazil; 2006. WHO WHO: Techniques to detect insecticide resistance mechanisms (field and laboratory manual). World Health Organization; 1998. Kushwah RBS, Kaur T, Dykes CL, Ravi Kumar H, Kapoor N, Singh OP. A new knockdown resistance (kdr) mutation, F1534L, in the voltage-gated sodium channel of Aedes aegypti, co-occurring with F1534C, S989P and V1016G. Parasites & Vectors. 2020;13:1–12. Redo T, Triwani T, Anwar C, Salni S. Larvicidal activity of Ketapang leaf fraction (Terminalia catappa L) on Aedes aegypti instar III. Open Access Macedonian Journal of Medical Sciences. 2019;7 21:3526. Sternberg ED, Thomas MB. Insights from agriculture for the management of insecticide resistance in disease vectors. Evolutionary applications. 2018;11 4:404–14. Siddiqui SA, Fernando I, Nisa’ K, Shah MA, Rahayu T, Rasool A, et al. Effects of undesired substances and their bioaccumulation on the black soldier fly larvae, Hermetia illucens (Diptera: Stratiomyidae)–a literature review. Environmental Monitoring and Assessment. 2023;195 7:823. Kushwah RBS, Dykes CL, Kapoor N, Adak T, Singh OP. Pyrethroid-resistance and presence of two knockdown resistance (kdr) mutations, F1534C and a novel mutation T1520I, in Indian Aedes aegypti. PLoS Neglected Tropical Diseases. 2015;9 1:e3332. Chen M, Du Y, Wu S, Nomura Y, Zhu G, Zhorov BS, et al. Molecular evidence of sequential evolution of DDT-and pyrethroid-resistant sodium channel in Aedes aegypti. PLoS neglected tropical diseases. 2019;13 6:e0007432. Kaur T, Kushwah RS, Pradhan S, Das MK, Kona MP, Anushrita, et al. Knockdown-resistance (kdr) mutations in Indian Aedes aegypti populations: lack of recombination among haplotypes bearing V1016G, F1534C, and F1534L kdr alleles. bioRxiv. 2024:2024.12. 11.627862. Du Y, Nomura Y, Satar G, Hu Z, Nauen R, He SY, et al. Molecular evidence for dual pyrethroid-receptor sites on a mosquito sodium channel. Proceedings of the National Academy of Sciences. 2013;110 29:11785-90. Brengues C, Hawkes NJ, Chandre F, McCarroll L, Duchon S, Guillet P, et al. Pyrethroid and DDT cross-resistance in Aedes aegypti is correlated with novel mutations in the voltage‐gated sodium channel gene. Medical and veterinary entomology. 2003;17 1:87–94. Uemura N, Itokawa K, Komagata O, Kasai S. Recent advances in the study of knockdown resistance mutations in Aedes mosquitoes with a focus on several remarkable mutations. Current Opinion in Insect Science. 2024;63:101178. Silva JJ, Kouam CN, Scott JG. Levels of cross-resistance to pyrethroids conferred by the Vssc knockdown resistance allele 410L + 1016I + 1534C in Aedes aegypti. PLoS Neglected Tropical Diseases. 2021;15 7:e0009549. Chen T-Y, Smartt CT, Shin D. Combination of kdr mutation and detoxification gene expression associated with high tolerance for permethrin in a resistant Aedes aegypti population. bioRxiv. 2020:2020.06. 22.164483. Hernandez JR, Longnecker M, Fredregill CL, Debboun M, Pietrantonio PV. Kdr genotyping (V1016I, F1534C) of the Nav channel of Aedes aegypti (L.) mosquito populations in Harris County (Houston), Texas, USA, after Permanone 31–66 field tests and its influence on probability of survival. PLoS Neglected Tropical Diseases. 2021;15 11:e0009833. Endersby-Harshman NM, Schmidt TL, Chung J, van Rooyen A, Weeks AR, Hoffmann AA. Heterogeneous genetic invasions of three insecticide resistance mutations in Indo‐Pacific populations of Aedes aegypti (L.). Molecular Ecology. 2020;29 9:1628–41. Hernandez JR, Lee HJ, Vigilant ME, Crawford S, Pietrantonio PV. The V410L kdr allele in the VGSC confers higher levels of field resistance to permethrin in urban mosquito populations of Aedes aegypti (L.). Pest Management Science. 2025;81 2:923–36. Hernandez JR, Liu S, Fredregill CL, Pietrantonio PV. Impact of the V410L kdr mutation and co-occurring genotypes at kdr sites 1016 and 1534 in the VGSC on the probability of survival of the mosquito Aedes aegypti (L.) to Permanone in Harris County, TX, USA. PLoS neglected tropical diseases. 2023;17 1:e0011033. Atencia–Pineda MC, Diaz-Ortiz D, Pareja–Loaiza P, García–Leal J, Hoyos–López R, Calderón–Rangel A, et al. Assessing pyrethroid resistance in Aedes aegypti from Cordoba Colombia: Implications of kdr mutations. Plos one. 2024;19 8:e0309201. Hassan MR, Azit NA, Fadzil SM, Abd Ghani SR, Ahmad N, Nawi AM. Insecticide resistance of Dengue vectors in South East Asia: a systematic review. African Health Sciences. 2021;21 3:1124–40. Kasai S, Itokawa K, Uemura N, Takaoka A, Furutani S, Maekawa Y, et al. Emergence of hyper insecticide-resistant dengue vectors in Indochina Peninsula: threats of concomitant knockdown resistance mutations. bioRxiv. 2022:2022.03. 05.483084. Hawkins NJ, Bass C, Dixon A, Neve P. The evolutionary origins of pesticide resistance. Biological Reviews. 2019;94 1:135–55. Brito L, Barbieri F, Rocha R, Santos A, Silva R, Ribeiro E, et al. Pyrethroid and organophosphate pesticide resistance in field populations of horn fly in Brazil. Medical and veterinary entomology. 2019;33 1:121–30. Bucur B, Munteanu F-D, Marty J-L, Vasilescu A. Advances in enzyme-based biosensors for pesticide detection. Biosensors. 2018;8 2:27. Marrs TC. Organophosphate poisoning. Pharmacology & therapeutics. 1993;58 1:51–66. Schoville SD, Cohen ZP, Crossley MS. Population genomic insights into insecticide resistance in the Colorado potato beetle. Springer; 2021. Rubio-Palis Y, Dzuris N, Sandi C, Vizcaino-Cabarrus RL, Corredor-Medina C, González JA, et al. Insecticide resistance levels and associated mechanisms in three Aedes aegypti populations from Venezuela. Memórias do Instituto Oswaldo Cruz. 2023;118:e220210. Contreras-Perera Y, Ponce-Garcia G, Villanueva-Segura K, Lopez-Monroy B, Rodríguez-Sanchez IP, Lenhart A, et al. Impact of deltamethrin selection on kdr mutations and insecticide detoxifying enzymes in Aedes aegypti from Mexico. Parasites & Vectors. 2020;13:1–22. Kadjo YM-AE, Adja AM, Guindo-Coulibaly N, Zoh DD, Traoré DF, Assouho KF, et al. Insecticide Resistance and Metabolic Mechanisms in Aedes aegypti from Two Agrosystems (Vegetable and Cotton Crops) in Côte d'Ivoire. Vector-Borne and Zoonotic Diseases. 2023;23 9:475–85. Fikrig K, Noriega AO, Rodriguez RA, Bardales J, Rivas J, Reyna B, et al. Changing dynamics of Aedes aegypti invasion and vector-borne disease risk for rural communities in the Peruvian Amazon. bioRxiv. 2024:2024.09. 04.611168. Wipf NC, Duchemin W, Kouadio F-PA, Fodjo BK, Sadia CG, Mouhamadou CS, et al. Multi-insecticide resistant malaria vectors in the field remain susceptible to malathion, despite the presence of Ace1 point mutations. PLoS Genetics. 2022;18 2:e1009963. Huang X, Kaufman PE, Athrey GN, Fredregill C, Alvarez C, Shetty V, et al. Potential key genes involved in metabolic resistance to malathion in the southern house mosquito, Culex quinquefasciatus, and functional validation of CYP325BC1 and CYP9M12 as candidate genes using RNA interference. BMC genomics. 2023;24 1:160. Ngangue-Siewe IN, Ndjeunia-Mbiakop P, Kala-Chouakeu NA, Bamou R, Talipouo A, Djamouko-Djonkam L, et al. Bendiocarb and Malathion resistance in two major malaria vector populations in Cameroon is associated with high frequency of the G119S mutation (Ace-1) and overexpression of detoxification genes. Pathogens. 2022;11 8:824. Barathi S, Sabapathi N, Kandasamy S, Lee J. Present status of insecticide impacts and eco-friendly approaches for remediation-a review. Environmental Research. 2024;240:117432. Sharma S. Cultivating sustainable solutions: Integrated pest management (ipm) for safer and greener agronomy. Corporate Sustainable Management Journal. 2023;1 2:103–8. Tables Tables 2 and 4 are available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files Table2and4.docx Cite Share Download PDF Status: Published Journal Publication published 07 Feb, 2026 Read the published version in Parasites & Vectors → Version 1 posted Editorial decision: Revision requested 29 Sep, 2025 Reviews received at journal 29 Sep, 2025 Reviewers agreed at journal 28 Sep, 2025 Reviews received at journal 28 Sep, 2025 Reviewers agreed at journal 17 Sep, 2025 Reviewers invited by journal 17 Sep, 2025 Editor assigned by journal 10 Sep, 2025 Submission checks completed at journal 10 Sep, 2025 First submitted to journal 29 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7486335","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":517831162,"identity":"a702e3e5-4873-4d71-85dd-c0dbd8c55563","order_by":0,"name":"Wan Fatma Zuharah","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAoklEQVRIiWNgGAWjYDAC5gMg0oYULWwJjA0MDGmkazlMgg6DY8zPH92oOZ84f9oB1s08xGlhM2zOOXY7ccPtBLbbRGkxu98A1MIG1CJNtJZj7B+bc/6dS5w/m3gtPIbNuW0HEhuIdpj9MZ7C2bl9ycYbbie23ZxDjBbJNvYNn3O+2cnOn5187MYbYrQgAcYGJqIchqrpB8laRsEoGAWjYCQAAOu9OFTLhE1/AAAAAElFTkSuQmCC","orcid":"","institution":"Universiti Sains Malaysia","correspondingAuthor":true,"prefix":"","firstName":"Wan","middleName":"Fatma","lastName":"Zuharah","suffix":""},{"id":517831166,"identity":"eae28a46-7256-484e-a90e-999687838388","order_by":1,"name":"Fatin Nabila Abdullah","email":"","orcid":"","institution":"Universiti Sains Malaysia","correspondingAuthor":false,"prefix":"","firstName":"Fatin","middleName":"Nabila","lastName":"Abdullah","suffix":""},{"id":517831169,"identity":"b3dcef47-8807-41b9-a5bd-fedabf774d0e","order_by":2,"name":"Asfa Nurizzah Zin Azman","email":"","orcid":"","institution":"Universiti Sains Malaysia","correspondingAuthor":false,"prefix":"","firstName":"Asfa","middleName":"Nurizzah Zin","lastName":"Azman","suffix":""},{"id":517831170,"identity":"4484214d-9513-47e6-a8f7-ceb452a72bf9","order_by":3,"name":"Beni Ernawan","email":"","orcid":"","institution":"National Research and Innovation Agency of the Republic of Indonesia (BRIN)","correspondingAuthor":false,"prefix":"","firstName":"Beni","middleName":"","lastName":"Ernawan","suffix":""},{"id":517831174,"identity":"de047734-a7b6-4e10-af40-c540e10caaad","order_by":4,"name":"Titik Kartika","email":"","orcid":"","institution":"National Research and Innovation Agency of the Republic of Indonesia (BRIN)","correspondingAuthor":false,"prefix":"","firstName":"Titik","middleName":"","lastName":"Kartika","suffix":""},{"id":517831177,"identity":"988bf2e3-b8d5-4ce5-a0e0-89d018f48abe","order_by":5,"name":"Shao-Hung Dennis Lee","email":"","orcid":"","institution":"University of California","correspondingAuthor":false,"prefix":"","firstName":"Shao-Hung","middleName":"Dennis","lastName":"Lee","suffix":""},{"id":517831180,"identity":"0f232283-a31e-44da-9487-813e5a297bb6","order_by":6,"name":"Ikhsan Guswenrivo","email":"","orcid":"","institution":"National Research and Innovation Agency of the Republic of Indonesia (BRIN)","correspondingAuthor":false,"prefix":"","firstName":"Ikhsan","middleName":"","lastName":"Guswenrivo","suffix":""},{"id":517831183,"identity":"bff9f036-4ab2-4d26-86e7-6d9146af6eaf","order_by":7,"name":"Theerakamol Pengsakul","email":"","orcid":"","institution":"Prince of Songkhla University","correspondingAuthor":false,"prefix":"","firstName":"Theerakamol","middleName":"","lastName":"Pengsakul","suffix":""},{"id":517831185,"identity":"703a4aca-3de2-49ea-96fd-d437a096863c","order_by":8,"name":"Tianyun Su","email":"","orcid":"","institution":"EcoZone International LLC","correspondingAuthor":false,"prefix":"","firstName":"Tianyun","middleName":"","lastName":"Su","suffix":""},{"id":517831187,"identity":"70ac7951-4a3e-4bfe-9bd3-f70f58a8694d","order_by":9,"name":"Chow-Yang Lee","email":"","orcid":"","institution":"University of California","correspondingAuthor":false,"prefix":"","firstName":"Chow-Yang","middleName":"","lastName":"Lee","suffix":""}],"badges":[],"createdAt":"2025-08-29 08:08:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7486335/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7486335/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13071-026-07252-0","type":"published","date":"2026-02-07T15:59:56+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":92290467,"identity":"a9cf8ab5-746b-4037-aaf7-8e23a420df6a","added_by":"auto","created_at":"2025-09-26 20:45:31","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2097082,"visible":true,"origin":"","legend":"","description":"","filename":"Zuharahetal.AedesresistanceParasiteVectorsFinalwithoutEnd.docx","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/b765f996e3a9546f056657c2.docx"},{"id":92289624,"identity":"86ed2ac1-7836-42c1-9845-9ae3893dba80","added_by":"auto","created_at":"2025-09-26 20:37:17","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12094,"visible":true,"origin":"","legend":"","description":"","filename":"30b31c4c3aec4d268f9ec5a8cd55b0ac.json","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/756b49f23af50298d90e4903.json"},{"id":92290465,"identity":"086364e3-f607-4903-8f6c-e8af0c774af1","added_by":"auto","created_at":"2025-09-26 20:45:31","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":206840,"visible":true,"origin":"","legend":"","description":"","filename":"30b31c4c3aec4d268f9ec5a8cd55b0ac1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/d67d13102a6438df00858a18.xml"},{"id":92290468,"identity":"6f007e90-6eee-4d0b-8745-14e264543e2e","added_by":"auto","created_at":"2025-09-26 20:45:31","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":142347,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/d3488a4211f054bdc2d133f4.png"},{"id":92289632,"identity":"97dba061-38f8-46ff-835f-5603800816b2","added_by":"auto","created_at":"2025-09-26 20:37:17","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":309534,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage10.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/3200e302ae3345c5b5946288.jpeg"},{"id":92290432,"identity":"e84d58c1-e41c-43f9-98b6-9f063629370f","added_by":"auto","created_at":"2025-09-26 20:45:20","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":142757,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage11.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/cb4f2792b9c2e9caba67c2ee.jpeg"},{"id":92289630,"identity":"3af2f8e1-73d6-4044-b81f-5845b3668ca5","added_by":"auto","created_at":"2025-09-26 20:37:17","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":136937,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage12.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/97a70caa90951542c3d6e638.jpeg"},{"id":92289656,"identity":"3324857f-e32f-4d5c-9a75-d8f6e7b11073","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":138732,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage13.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/c2b937a33d8af3a9a8f62b33.jpeg"},{"id":92289653,"identity":"b570cba9-50ce-483b-8e52-e8412edf06fa","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":137661,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage14.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/4630a1498b85e3f1e691b6a8.jpeg"},{"id":92289647,"identity":"e7bacf78-a3b2-449a-97a8-2e20b1581d0f","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":151353,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage15.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/376a9c11ba0d9a6d86ae1ad0.jpeg"},{"id":92290435,"identity":"396e2ba4-d6ce-434b-852b-68f6fd3f897d","added_by":"auto","created_at":"2025-09-26 20:45:20","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":844669,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/f4f5e4882d5672792d66d2d1.jpeg"},{"id":92289631,"identity":"ce76de45-260f-4c6d-903d-599af5a6b8db","added_by":"auto","created_at":"2025-09-26 20:37:17","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":97493,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/2c0f453316c622297780ff73.png"},{"id":92289637,"identity":"8bdfecea-56ce-4067-a8f3-d104aa7a997e","added_by":"auto","created_at":"2025-09-26 20:37:17","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9571,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/c28fcdce86a1ac25c61b3233.jpeg"},{"id":92289645,"identity":"98f48e43-c5bc-4e6d-97fd-2835dc1891ed","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"jpeg","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9910,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/99c14fd92d806345050641c8.jpeg"},{"id":92289636,"identity":"647b82ea-918e-4cfc-b5cf-89ff85db873b","added_by":"auto","created_at":"2025-09-26 20:37:17","extension":"jpeg","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":330651,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/4ae6d3ddf7d87c12a67be40d.jpeg"},{"id":92289661,"identity":"c5479474-aca3-4bc4-a535-4d405e7d3c84","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"jpeg","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":342208,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/4ac2514d0e1ef06c3fd5921c.jpeg"},{"id":92289635,"identity":"9bb4c162-c775-44b8-b6fc-314b3706e280","added_by":"auto","created_at":"2025-09-26 20:37:17","extension":"jpeg","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1074,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/31e43cd77afa42913eef98dc.jpeg"},{"id":92289654,"identity":"16499114-8f63-4776-a3d3-30a489a49bbb","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"jpeg","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":299448,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/33a8934e304188d854c06fa5.jpeg"},{"id":92289640,"identity":"7f9eb49b-1aa3-43d6-9758-551d601dd3f1","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":38197,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/9ec28f1090bc687a5331900e.png"},{"id":92289638,"identity":"994bd1fc-4e0d-4a00-b358-da8f8d1b954f","added_by":"auto","created_at":"2025-09-26 20:37:17","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":39340,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/a6df693a0e867e476639754f.png"},{"id":92290469,"identity":"9802fd6f-99ee-4d28-80c6-09d1c627bcbf","added_by":"auto","created_at":"2025-09-26 20:45:31","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":104244,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage11.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/06757d15f4e7da43859fe5f4.png"},{"id":92289652,"identity":"052b6949-49da-415a-bc36-d613b6be0ea7","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":100132,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage12.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/f3ad74193fd3a30f51997688.png"},{"id":92289658,"identity":"41acfed9-1f87-4b02-9528-6c790537a48e","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":101809,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage13.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/fc95ed2c1c2ad767576198b7.png"},{"id":92289643,"identity":"6b29872f-1194-4c77-b3cf-32d14b2a6996","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":99682,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage14.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/654d0c2dd72ef1495b9d6282.png"},{"id":92289657,"identity":"28634401-2523-44c9-b1c7-09f616194066","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":114002,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage15.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/a104c94652dd6bd396ef1460.png"},{"id":92290470,"identity":"db149c0a-2f0d-483e-9c72-195dfbc597bc","added_by":"auto","created_at":"2025-09-26 20:45:32","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":229351,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/3cf0abdaadc7b1a856f007ba.png"},{"id":92289659,"identity":"27ec834c-064c-4ba6-8fd1-4058fc3afe0f","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"png","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":50159,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/54596f271c69ce16543667dc.png"},{"id":92289646,"identity":"2446d06d-7a2e-4e09-b928-04f90f17b5d1","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"png","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2846,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/e2e78fce55b901bfee821887.png"},{"id":92289644,"identity":"8230f80a-100b-4741-bc9c-709229e0fc20","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"png","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2904,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/78692d5fec46185974ec0a2b.png"},{"id":92290471,"identity":"dc6132cb-2c1f-4492-8637-225d77e9b081","added_by":"auto","created_at":"2025-09-26 20:45:32","extension":"png","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":60861,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/33ec5e3498a83b55f4da339e.png"},{"id":92290433,"identity":"e00cee6f-0d41-4e75-9eef-bccb98e62e41","added_by":"auto","created_at":"2025-09-26 20:45:20","extension":"png","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":61767,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/e92c27b40348be69a12c660a.png"},{"id":92289660,"identity":"ec3db6d3-4353-42cd-a599-70a1bd2bc044","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"png","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":935,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/ff9b8c4e739932793596667e.png"},{"id":92289662,"identity":"8dfa748e-5f11-4c7b-a50e-6bd0ec2b35ee","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"png","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":36922,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/ac49618190e9e5dc14e6b85a.png"},{"id":92289666,"identity":"ac9e8478-8e6f-4a3d-b408-8d86a8a6c561","added_by":"auto","created_at":"2025-09-26 20:37:19","extension":"xml","order_by":33,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":205310,"visible":true,"origin":"","legend":"","description":"","filename":"30b31c4c3aec4d268f9ec5a8cd55b0ac1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/7a10ae2491e6b83322e0b58c.xml"},{"id":92289664,"identity":"fdc9c8bf-3c21-495b-9ae7-c025bc2b1992","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"html","order_by":34,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":217847,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/5eeb230c8615680a0fe93c8c.html"},{"id":92289621,"identity":"c8a7a692-28ad-477d-a60a-463fabccf43c","added_by":"auto","created_at":"2025-09-26 20:37:17","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":370906,"visible":true,"origin":"","legend":"\u003cp\u003eLocation of the sampling sites for \u003cem\u003eAedes aegypti\u003c/em\u003e collection, which were located in Malaysia (Flat Hamna and Taman Bukit Jambul, Penang), Indonesia (Depok), Thailand (Songkhla and Surat Thani), and the United States of America (Riverside, California).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/7075e6e4276e58cc3c602ebb.png"},{"id":92289623,"identity":"68f0aa96-7f09-4d92-94ac-6da948581c6d","added_by":"auto","created_at":"2025-09-26 20:37:17","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":66797,"visible":true,"origin":"","legend":"\u003cp\u003eThe susceptibility status of \u003cem\u003eAedes aegypti\u003c/em\u003ein different localities to the pyrethroid and organophosphate insecticides. The letter represents the significant values at p\u0026lt;0.05 for each insecticide. R= Resistance, PR= Possible resistance, S= susceptible.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/9b93a52b16056ab626f1bc45.png"},{"id":92289626,"identity":"3fe2e2f9-6909-4959-82a6-b5f5770c104a","added_by":"auto","created_at":"2025-09-26 20:37:17","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":85393,"visible":true,"origin":"","legend":"\u003cp\u003eKaplan-Meier survival analysis graphs representing the survival of \u003cem\u003eAedes aegypti\u003c/em\u003e from different localities after exposure to insecticides; (A) 5% malathion, (B) 60mg/m2 pirimiphos-methyl, (C) 0.4% permethrin, and (D) 0.03% deltamethrin.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/05fe952da985a55215e80db3.png"},{"id":92290439,"identity":"2009f000-72df-4084-ad46-7710b994b353","added_by":"auto","created_at":"2025-09-26 20:45:26","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":56937,"visible":true,"origin":"","legend":"\u003cp\u003ePoint mutations of domain II and III in the voltage-gated sodium channel found in \u003cem\u003eAedes aegypti\u003c/em\u003e collected from Malaysia, Thailand, Indonesia, and the United States of America after exposure to (A) 5% malathion, (B) 60mg/m2 pirimiphos-methyl, (C) 0.4% permethrin, and (D) 0.03% deltamethrin. The VCRU susceptible strain (dead individual) was confirmed not to carry any known \u003cem\u003ekdr\u003c/em\u003e mutations. **No detection mutation has been done due to the susceptible mosquitoes.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/e4173a3d2aae40cb369a8a53.png"},{"id":92289628,"identity":"a8d7ea80-dcc5-4ebb-940b-c9c0b5a5b5cf","added_by":"auto","created_at":"2025-09-26 20:37:17","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":82138,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution of remaining acetylcholinesterase activity after inhibition with propoxur in \u003cem\u003eAedes aegypti\u003c/em\u003e samples from seven strains (n = 40).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/562400973a8c4754f28b5543.png"},{"id":92289629,"identity":"edfb17ca-db7e-48eb-b6da-9e233010bb6d","added_by":"auto","created_at":"2025-09-26 20:37:17","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":77001,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution of mixed function oxidase (MFO) from \u003cem\u003eAedes aegypti\u003c/em\u003e originating from seven localities (n=40).\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/11145f1d18dd86e25ecc3e6a.png"},{"id":92289649,"identity":"bc25b72c-0dfc-4227-8e14-7a9bc4fcac55","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":75900,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution of α-esterase in seven localities for \u003cem\u003eAedes aegypti\u003c/em\u003e mosquitoes (n = 40).\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/f1ef2ef6bf5c009ecdeaef13.png"},{"id":92289639,"identity":"0c4fd850-ddb3-46b7-b29b-2b83c88760e0","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":75194,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution of β-esterase from \u003cem\u003eAedes aegypti\u003c/em\u003e mosquitoes collected from different countries (n=40).\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/b4a1cf769aad343a58777d9a.png"},{"id":92289641,"identity":"47edb0a0-c294-4810-9c09-d21aea52e495","added_by":"auto","created_at":"2025-09-26 20:37:18","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":87086,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution of glutathione S-transferase (GST) in \u003cem\u003eAedes aegypti\u003c/em\u003e originated from different countries in Asia and the USA (n=40).\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/6530ac998a91de52608b8bbe.png"},{"id":102234679,"identity":"a6436ab7-c3bf-4af5-9738-808f5f8e1c32","added_by":"auto","created_at":"2026-02-09 16:12:51","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2269321,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/bf80d5d9-f065-4108-812b-572cf13fb984.pdf"},{"id":92289622,"identity":"34b33138-7b3c-4eec-bb28-4332747be4a1","added_by":"auto","created_at":"2025-09-26 20:37:17","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":160645,"visible":true,"origin":"","legend":"","description":"","filename":"Table2and4.docx","url":"https://assets-eu.researchsquare.com/files/rs-7486335/v1/b53e6faf563035f19da847c0.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Phenotypic and Genotypic Resistances Associated with Pyrethroid and Organophosphate in Aedes aegypti (Diptera: Culicidae)","fulltext":[{"header":"Background","content":"\u003cp\u003eThe yellow fever mosquito \u003cem\u003eAedes aegypti\u003c/em\u003e is a widely distributed species of significant public nuisance and vector for the viral pathogens of yellow fever, dengue, chikungunya, and Zika infections [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. This species has shown dynamic invasive distribution patterns worldwide. Its distribution in Southeast Asia has been attributed to increased trade in the 19th century, with higher prevalence near coastal areas (Rao, 1967). While tropical and subtropical regions are remain favorable due to the climatically suitability, human influence and artificial environments also contribute to sustaining this species' range in temperate and subtropical regions [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. In the United States of America (USA), \u003cem\u003eAe. aegypti\u003c/em\u003e was reported in 183 counties across 26 states from 1995 to 2016, with a persistent presence in 94 countries [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The genetic analysis revealed 20 distinct haplotypes across the Americas, Africa, and Asia, suggesting multiple introductions and complex phylogeographic structures [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Local shifts in distribution have been observed, such as in Southern Florida, possibly due to interspecific interactions with \u003cem\u003eAe. albopictus\u003c/em\u003e [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe resistance status of \u003cem\u003eAe. aegypti\u003c/em\u003e varies globally and is influenced by local insecticide application patterns as well as resistance mechanisms. Understanding the resistance is crucial for effective vector control operations [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The resistance status of \u003cem\u003eAe. aegypti\u003c/em\u003e necessitates resistance management tactics for effective vector control. The resistance occurs due to genetic mutations, metabolic changes, and behavioral adaptations that allow these mosquitoes to survive exposure to commonly used insecticides [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. These adaptations complicate control efforts, highlighting the need for ongoing research and monitoring to direct public health interventions and to ensure the efficacy of vector control programs.\u003c/p\u003e\u003cp\u003eResistance mechanisms include target site mutations, increased detoxification enzyme activity, and behavioural changes, which can significantly impact the effectiveness of currently available insecticides [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Target site resistance can lead to reduced binding affinity to insecticides, and render them less effective [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Mutations in the para-sodium channel gene significantly contribute to target site resistance, particularly against pyrethroids [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. These mutations are prevalent in Southeast Asian populations of \u003cem\u003eAe. aegypti\u003c/em\u003e, contributing to widespread resistance [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] to pyrethroids [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Resistance to multiple classes of insecticides, including organochlorines (OC), organophosphates (OP), pyrethroids (PY), and carbamates (C), is increasing, which is particularly noted in Thailand and Malaysia [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe S989P mutation is within domain II and is frequently observed in deltamethrin-resistant \u003cem\u003eAe. aegypti\u003c/em\u003e, constitutes another notable \u003cem\u003ekdr\u003c/em\u003e mutation that functions synergistically with the V1016G mutation [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The further problem has coupled up both resistance mechanisms, including elevated oxidase enzyme activity and target-site mutations, such as V1023G and S996P in the voltage-gated sodium channel gene [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Recent studies in Malaysia have identified a novel knockdown resistance (\u003cem\u003ekdr\u003c/em\u003e) mutation, A1007G, in the voltage-gated sodium channel (VGSC) of \u003cem\u003eAe. aegypti\u003c/em\u003e mosquitoes [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Additionally, three common \u003cem\u003ekdr\u003c/em\u003e mutations (S989P, V1016G, and F1534C), was also detected in \u003cem\u003eAe. aegypti\u003c/em\u003e populations from multiple states, including Selangor, Penang, and Kelantan [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In Indonesia, however, insecticide resistance surveillance remains fragmented due to the lack of a nationwide monitoring system. Furthermore, the same \u003cem\u003ekdr\u003c/em\u003e mutations of predominant V1016G, S989P, and F1534C as in Malaysia are associated with pyrethroid resistance [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], while mutations in the acetylcholinesterase (AChE) gene remain unreported [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The co-occurrence in Thailand \u003cem\u003eAe. aegypti\u003c/em\u003e mosquitoes with S989P are usually frequent, and the S989P\u0026thinsp;+\u0026thinsp;V1016G\u0026thinsp;+\u0026thinsp;F1534C (triple-mutant) heterozygous genotype confers high resistance, reducing the efficacy of pyrethroid thermal fogging under operational conditions. V1016G is common across Thai populations, significantly associated with deltamethrin resistance, and F1534 is associated with permethrin resistance [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Whereas, high frequencies of \u003cem\u003ekdr\u003c/em\u003e mutations V1016I and F134C associated with pyrethroid was repeatedly documented in Florida, USA since 2018 [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/p\u003e\u003cp\u003eIn various populations, increased activity of detoxifying enzymes such as esterases, mixed-function oxidases, and glutathione-S-transferases has been observed. Enhanced metabolism through detoxification enzymes is another significant resistance mechanism. This involves increased activity of enzymes that break down insecticides, reducing their effectiveness [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Metabolic resistance can involve enhanced expression of cytochrome P450 enzymes, which play a crucial role in breaking down toxic substances, further complicating the landscape of vector control [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. This heightened enzyme activity is a key to metabolic resistance to insecticides like deltamethrin and malathion [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. This amalgamation of mutations augments the insect's capacity and metabolic detoxification to endure exposure to PY and OP insecticides, thereby complicating control initiatives and necessitating additional investigation into alternative management frameworks. Ongoing monitoring of resistance patterns will be crucial to effectively adapting and refining these strategies.\u003c/p\u003e\u003cp\u003eThis study assessed the resistance profiles of \u003cem\u003eAe. aegypti\u003c/em\u003e mosquitoes obtained from several Southeast Asian countries (Malaysia, Indonesia, Thailand), which have been known as a hotspot for arboviral diseases and hyperendemic of dengue, and the United States of America (USA) for comparison. The occurrence of mutations within the voltage-gated sodium channel gene, alongside the influence of metabolic resistance on the \u003cem\u003eAe. aegypti\u003c/em\u003e populations\u0026rsquo; response to PY and OP insecticides was elucidated.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eMosquitoes\u003c/h2\u003e\u003cp\u003eField sampling of \u003cem\u003eAe. aegypti\u003c/em\u003e mosquitoes were conducted employing ovitraps, which utilized a black tin can (dimensions: height 10.4 cm, diameter 7.0 cm). A hardboard paddle (dimensions: 3 cm \u0026times; 14.7 cm \u0026times; 0.3 cm) was positioned vertically within each ovitrap, with the textured surface oriented upwards to promote oviposition. Dechlorinated tap water was introduced into each receptacle to a depth of 6.0 cm, utilizing 200 mL of dechlorinated tap water. The ovitraps were established at the sampling location for a minimum of five days to encourage oviposition by the adult female \u003cem\u003eAe. aegypti\u003c/em\u003e mosquitoes.\u003c/p\u003e\u003cp\u003eMosquito collection used in this study were meticulously selected from Malaysia, specifically at Flat Hamna (FH) (5.351133, 100.3016) and the Taman Bukit Jambul Apartment (TBJ) in Penang (5.336123, 100.287673), one site in Depok (DP), West Java Province, Indonesia (6.2338, 106.4921), and two sites situated in Songkhla (SK) (7.1222, 100.3548) and Surat Thani (ST), Thailand (9.128875, 99.325629). In addition, one strain from Riverside (RS), California (33.918933, -117.372186), was used as a reference strain for comparison (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The VCRU strain was used as the susceptible strain for the basis of comparison with other field strains.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe collected larvae were transported back to the laboratory, where they were cultured in enamel trays filled with dechlorinated tap water. The culture conditions were regulated to maintain a temperature of (28\u0026thinsp;\u0026plusmn;\u0026thinsp;2) ℃, relative humidity of 70\u0026ndash;85%, and a light cycle of 12 hours of illumination followed by 12 hours of darkness. The larvae were nourished with a composite feed consisting of dog biscuit, beef liver, yeast, and milk powder, prepared in a weight ratio of 2:1:1:1 and administered as a fine powder at a dosage of 1 g per day. The larvae were permitted to progress to the adult stage, designated as the F\u003csub\u003e0\u003c/sub\u003e generation. In instances where the population of the F\u003csub\u003e0\u003c/sub\u003e generation is insufficient for conducting a bioassay evaluation, it shall be propagated to the F\u003csub\u003e1\u003c/sub\u003e and F\u003csub\u003e2\u003c/sub\u003e generations.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eAdult Mosquito Bioassays\u003c/h3\u003e\n\u003cp\u003eAdult bioassays were conducted using the standardized protocol established by the World Health Organization [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The study used non-blood-fed adult female mosquitoes of the field strain. All field strains of \u003cem\u003eAe. aegypti\u003c/em\u003e were tested with PY and OP insecticides in four replicates, each comprising 25 non-blood-fed female mosquitoes aged between 3 and 5 days.\u003c/p\u003e\u003cp\u003eAdult mosquito bioassay functions as a direct response to insecticides. This susceptibility test on \u003cem\u003eAe. aegypti\u003c/em\u003e was done using the WHO-impregnated paper of discriminating doses for pyrethroid (0.4% permethrin and 0.03% deltamethrin) and organophosphate (60mg/m\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\u003cp\u003epirimiphos-methyl and 5% malathion). Controls were conducted in duplicate for each insecticide, employing silicone oil for PY control and olive oil for OP control.\u003c/p\u003e\u003cp\u003eTwenty-five adult female \u003cem\u003eAe. aegypti\u003c/em\u003e mosquitoes were placed within the holding tubes and acclimatized for one hour. Following this acclimation interval, any damaged, injured, or dead mosquitoes were substituted with healthy individuals. Subsequently, the mosquitoes were transferred from the holding tube into a test tube that contained insecticide-impregnated paper. Data pertaining to knockdown effects were systematically recorded at five-minute intervals throughout one hour of exposure to the insecticides. At the end of the exposure period, the mosquitoes were promptly returned to the holding tubes, where they were provided with cotton wool moistened with a 10% sucrose solution as a nutritional source. The mortality rate was subsequently assessed 24 hours post-exposure. The test was run at a temperature of 28\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C, a relative humidity of 78\u0026thinsp;\u0026plusmn;\u0026thinsp;10%, and a photoperiod of 12 hours of light followed by 12 hours of darkness.\u003c/p\u003e\u003cp\u003e\u003cb\u003eStatistical Test for Susceptibility of\u003c/b\u003e \u003cb\u003eAedes aegypti\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe percentage mortality observed after 24-hour exposure to insecticides in adult bioassay experiments was evaluated for susceptibility status utilizing the criteria established by the World Health Organization (WHO), wherein mosquitoes are classified as: (1) susceptible if the mortality percentage ranges from 98 to 100%, (2) incipiently resistant if mortality falls within the 90\u0026ndash;97% range, and (3) resistant if mortality is less than 90% [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. In instances where the mortality rate of the control mosquitoes exceeded 20%, the experimental data will be discarded. Conversely, when the control mortality rate was observed to be between 5% and 20%, the calculated percentage of mortality was adjusted utilizing Abbot\u0026rsquo;s formula [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]:\u003cdiv id=\"Equa\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e\n$$\\:=\\frac{\\text{%}\\:\\text{T}\\text{r}\\text{e}\\text{a}\\text{t}\\text{e}\\text{d}\\:\\text{m}\\text{o}\\text{r}\\text{t}\\text{a}\\text{l}\\text{i}\\text{t}\\text{y}-\\:\\text{%}\\:\\text{C}\\text{o}\\text{n}\\text{t}\\text{r}\\text{o}\\text{l}\\:\\text{m}\\text{o}\\text{r}\\text{t}\\text{a}\\text{l}\\text{i}\\text{t}\\text{y}\\:}{100-\\text{%}\\:\\text{C}\\text{o}\\text{n}\\text{t}\\text{r}\\text{o}\\text{l}\\:\\text{m}\\text{o}\\text{r}\\text{t}\\text{a}\\text{l}\\text{i}\\text{t}\\text{y}}\\:x\\:100%$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eIn the present study, Abbot's correction concerning the control mortality was not applied due to the 0% mortality. The 24-hour mortality data were subjected to a one-way ANOVA analysis to determine the significant differences between localities for each insecticide. Data were tested for homogeneity and normality before the test. The transformation was done using a log transformation to fulfill the assumption of one-way ANOVA. IBM SPSS Statistics Version 28.0 of probit analysis was used for the statistical analysis to determine the knockdown times for 50% and 95% of the tested population (KdT\u003csub\u003e50\u003c/sub\u003e and KdT\u003csub\u003e95\u003c/sub\u003e). We used Kaplan-Meier survival analysis with 95% confidence intervals (CIs) in SPSS Version 28.0 to examine the survival rate of \u003cem\u003eAe. aegypti\u003c/em\u003e in response to insecticides within 1 hour of exposure. The survival differences between the studied insecticides were then ascertained through pairwise comparisons using the log-rank test.\u003c/p\u003e\u003cp\u003e\u003cb\u003eKnockdown resistance mutations (\u003c/b\u003e\u003cb\u003ekdr\u003c/b\u003e\u003cb\u003e) of the voltage-gated sodium channel (VGSC) gene\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTen specimens of alive \u003cem\u003eAe. aegypti\u003c/em\u003e mosquitoes' DNA that exhibited resistance after being tested with PY and OP insecticides was extracted using the DNeasy extraction Kit (Qiagen, Germany) following the manufacturer's protocol. The DNA concentration and purity were measured using a Nanodrop spectrophotometer at 260 nm. To ascertain \u003cem\u003ekdr\u003c/em\u003e mutations, two segments of the coding region of the VGSC gene, encompassing exon 19 through exon 31 (including the 989, 1011, 1016, 1007, and 1534 coding positions), were amplified from DNA samples and subsequently subjected to direct sequencing. A polymerase chain reaction (PCR) mixture totaling 25 \u0026micro;l was formulated utilizing 7.5 \u0026micro;l of Platinum SuperFi II DNA Polymerase, 0.2 \u0026micro;l of the Forward primer, 0.2 \u0026micro;l of the Reverse primer, 5 \u0026micro;l of DNA template, and ultimately 2.1 \u0026micro;l of dH2O maintained on ice. To guarantee a homogeneous distribution of the PCR mixture, the formulation was centrifuged for 10 seconds using a mini centrifuge apparatus before PCR analysis.\u003c/p\u003e\u003cp\u003eA comprehensive total of two sets of PCR mixtures were prepared for each DNA specimen for (1) domain II (which includes mutations at S989P, A1007G, I1011M/V, L1014F, V1016G/I, and T1520I), where the initial amplification of fragments was conducted utilizing primers AaSCF1 (AGACAATGTGGATCGCTTCC) and AaSCR4 (GGACGCAATCTGGCTTGTTA), whereas (2) for domain III, primers AaSCF7 (GAGAACTCGCCGATGAACTT) and AaSCR7 (GACGACGAAATCGAACAGGT) were employed in the polymerase chain reaction to identify the F1534C mutation [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]The parameters for the PCR were established at an initial denaturation temperature of 98\u0026deg;C for 30 seconds, followed by 30 cycles consisting of denaturation at 98\u0026deg;C for 15 seconds, annealing at 60\u0026deg;C for 30 seconds, and extension at 72\u0026deg;C for 1 minute. This ended in a final elongation phase at 72\u0026deg;C for 10 minutes and was subsequently maintained at 4\u0026deg;C \u0026infin;.\u003c/p\u003e\u003cp\u003eThe polymerase chain reaction (PCR) products were subjected to size-based separation on a 1.1% agarose gel. The gel-containing PCR products were stained with 1\u0026micro;l Biorad UView 6x loading dye and run at 140 V for 40 minutes in TAE buffer. The results were visualized under UV light. The PCR products were purified using ExoSAP at a 5:2 ratio and sent to Retrogen Inc., California, USA, for the sequencing service. The DNA sequencing process was completed with primers AaSCF3 (GTGGAACTTCACCGACTTCA) and AaSCR6 (CGACTTGATCCAGTTTGGAGA) for domain II, and AaSCR8 (TAGCTTTCAGCGGCTTCTTC) for domain III of \u003cem\u003eAe. aegypti\u003c/em\u003e [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Sequencing data obtained from Retrogen Sequencing Service were aligned using ClustalW, and protein sequences were translated using Mega v12.\u003c/p\u003e\n\u003ch3\u003eQuantification of Metabolic Detoxification Enzyme\u003c/h3\u003e\n\u003cp\u003eThe experimental assays were performed on newly emerged F\u003csub\u003e0\u003c/sub\u003e generation female mosquitoes (within 24 hours) of the species \u003cem\u003eAe. aegypti\u003c/em\u003e collected from Asian countries and the USA, which were obtained through field collection methods described in the previous section. The quantification of metabolic enzymes was established using a standard protocol for assessing metabolic resistance described by Hemingway and Brogdon [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] and Valle et al. [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. The chemicals used for the biochemical assays are: 1-naphthyl acetate (\u0026ge;\u0026thinsp;98%, Sigma Aldrich Corporation, St. Louis, MO, USA), 1-naphthol (\u0026ge;\u0026thinsp;99%, Spectrum Chemical Mfg. Corp., Gardena, CA, USA), 2-naphthol (\u0026ge;\u0026thinsp;99%, Spectrum Chemical Mfg. Corp., Gardena, CA, USA), 2-naphthyl acetate (\u0026ge;\u0026thinsp;98%, Sigma Aldrich Corporation, St. Louis, MO, USA), -nitrophenyl acetate (\u0026ge;\u0026thinsp;98%, Sigma Aldrich Corporation, St. Louis, MO, USA), p1-chloro-2,4-dinitrobenzene (CDNB) (99%, Acros Organics, Carlsbad, CA, USA), fast blue B salt (MP Biomedicals, LLC, Irvine CA, USA), and reduced glutathione (GSH) (99%, Chem-Impex International, Inc., Wood Dale, IL, USA).\u003c/p\u003e\n\u003ch3\u003eHomogenization of Aedes aegypti\u003c/h3\u003e\n\u003cp\u003eForty individuals of adult \u003cem\u003eAe. aegypti\u003c/em\u003e on the first day of emergence without a bloodmeal from each locality were selected for biochemical assay. Each individual was homogenized using a pestle motor in 300\u0026micro;l of grade water and kept on ice to minimize proteolysis. For the reference strain of VCRU, five individuals were subjected to homogenization. Uncentrifuged aliquots of 25\u0026micro;l were used to quantify acetylcholinesterase (ACE) and 20\u0026micro;l for Mixed Function Oxidase (MFO). The remaining aliquots were centrifuged at 12000x g for 60 seconds. The supernatant was collected and used for esterases, Glutathione S-transferase, and total protein assays.\u003c/p\u003e\n\u003ch3\u003eMixed function oxidase (MFO) assay on the cytochrome P450\u003c/h3\u003e\n\u003cp\u003eThe assay used to measure mixed\u0026ndash;function oxidases measures an increase in haem content, which is consequently converted into cytochrome P450. The cytochrome P450 quantification process was based on the methodology described in WHO WHO [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. To summarise, 20 \u0026micro;l of microfuge supernatant was mixed with 60 \u0026micro;l of 0.625M potassium phosphate buffer (pH 7.2) and 200 \u0026micro;l of tetramethyl benzidine (TMBZ) solution (0.012 g 3,3,5,5-tetramethylbenzidine\u0026thinsp;+\u0026thinsp;6 ml methanol\u0026thinsp;+\u0026thinsp;18 ml sodium acetate buffer 250 mM, pH 5.0). After adding 25 \u0026micro;l of 3% hydrogen peroxide, the mixture was left to sit at room temperature with light protection for 90 minutes.\u003c/p\u003e\u003cp\u003eMFO activity values were computed using the standard absorbance curve at 650 nm based on known cytochrome C concentrations. Equivalent cytochrome P450/min/mg protein was used to measure enzymatic activity using an Epoch 2 Microplate Spectrophotometer (BioTek Instruments Inc., Winooski, VT, USA). Three positive controls were run using 20 \u0026micro;l of cytochrome C in place of mosquito homogenate, and three negative controls were performed using 20 \u0026micro;l of 0.625M potassium phosphate buffer (pH 7.2).\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eAltered acetylcholinesterase (AChE) assay\u003c/h2\u003e\u003cp\u003eThe activity of acetylcholinesterase was assessed either with or without the propoxur inhibitor present, labeled as AChE and AChI, using two separate 96-well plates. A total of 145 \u0026micro;l of Triton/Na phosphate (prepared with 5 ml of 100% Triton X-100 in 50 ml of 1M sodium phosphate buffer at pH 7.8 and 455 ml of distilled water) and 10 \u0026micro;l of DTNB/Na phosphate (prepared before used with 10mMDTNB in 100mM sodium phosphate buffer at pH 7.0) were added to 25 \u0026micro;l of mosquito homogenates prepared in duplicate.\u003c/p\u003e\u003cp\u003eEach well in the AChE plates contained 10 mM acetylcholine iodide in grade water without propoxur. Propoxur (6 \u0026micro;l of 0.1M in acetone) was applied to the AChI plates in addition to 10 mM acetylcholine iodide in grade water. Both AChE and AChI plates were incubated for an hour at room temperature and were read at 405 nm using an Epoch 2 Microplate Spectrophotometer (BioTek Instruments Inc., Winooski, VT, USA). Three negative and three positive controls were provided by replacing the mosquito homogenate with 25 \u0026micro;l of sterile distilled water only. The findings were presented as a percentage of remaining activity in both the inhibited control and the inhibited fraction.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eEsterase (EST) assays\u003c/h3\u003e\n\u003cp\u003eFirst, 10 \u0026micro;l of the mosquito homogenates' supernatant was applied to each well in duplicate. Then, 200 \u0026micro;l of 30mM α-naphthyl acetate was added to one set of samples, while 200 \u0026micro;l of 30mM β-naphthyl acetate was added to the other set. The plate was incubated at room temperature for 15 minutes. After incubation, each well was filled with 50 \u0026micro;l of fast-blue stain, and the mixture was left to incubate for an additional five minutes. The reaction was read at 570 nm using an Epoch 2 Microplate Spectrophotometer (BioTek Instruments Inc., Winooski, VT, USA).\u003c/p\u003e\u003cp\u003eThree positive controls were run at 10 \u0026micro;l of α-naphthol at 0.5 \u0026micro;g/mL, and three negative controls were run using 10 \u0026micro;l of sterile distilled water for the α-esterase assay. On the other hand, three negative controls were performed using 10 \u0026micro;l of sterile distilled water for the β-esterase test, and three positive controls were run using 10 \u0026micro;l of 0.5 \u0026micro;g/mL β-naphthol. EST activity against each substrate was calculated using standard absorbance curves corresponding to known α\u0026ndash;naphthol or β\u0026ndash;naphthol concentrations. Quantified enzymatic activities were expressed as nmol of either α-naphthol or β-naphthol/min/mg protein.\u003c/p\u003e\n\u003ch3\u003eGlutathione S-transferase (GST) assay\u003c/h3\u003e\n\u003cp\u003eFifteen microlitres of mosquito homogenate were applied to each microtiter plate well in two test duplicates. 195 \u0026micro;l of a working solution of 1-chloro-2,4-dinitrobenzene (CDNB) was used to measure glutathione S-transferase activity. This working solution, which was prepared by combining 0.0615 g of reduced glutathione (GSH) in 20 ml of 100 mM potassium phosphate buffer at pH 6.5 with 0.0042 g of 1-chloro-2,4-dinitrobenzene diluted in 1 ml of methanol, was administered to each duplicate of the mosquito homogenate. Three positive and negative controls were prepared using 15 \u0026micro;l of sterile distilled water. The absorbance was read at 340nm every minute for 20 minutes using an Epoch 2 Microplate Spectrophotometer (BioTek Instruments Inc., Winooski, VT, USA). The GST activity was calculated by converting the data with Beer\u0026rsquo;s Law (\u003cem\u003eA\u003c/em\u003e\u0026thinsp;=\u0026thinsp;\u003cem\u003eεcl\u003c/em\u003e) using a path length of 0.6 cm and an extinction coefficient of 4.29\u0026micro;M\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eTotal protein assay\u003c/h2\u003e\u003cp\u003eAll enzyme activity assays were normalized using protein concentration as a correction factor to take individual mosquito size variations into consideration. A commercial protein assay kit (Bio-Rad, USA) was used to produce the BSA standard curve, which was used to convert and calculate the protein concentration for each sample.\u003c/p\u003e\u003cp\u003eAfter centrifugation, duplicates of 10 \u0026micro;l mosquito homogenates were plated in 96-well plates. Ten microlitres of mosquito homogenates and 300 microlitres of diluted Bio-Rad dye reagent were mixed to perform the protein test. After that, this combination was incubated for three to five minutes at room temperature. For the negative controls, 10 \u0026micro;l of distilled water was used in three wells, and for the positive controls, 10 \u0026micro;l of 1\u0026micro;g/mL BSA was used in three wells. The plate was then read at the optical density at 620 nm. Protein levels were calculated using a standard curve derived from the absorbance of bovine serum albumin.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eBiochemical data analysis\u003c/h2\u003e\u003cp\u003eThe mean absorbance readings from replicate wells were converted into mean values, which were then divided by the corresponding protein values to determine each mosquito's enzyme activity. A one-way ANOVA was carried out to determine whether the \u003cem\u003eAe. aegypti\u003c/em\u003e strains' activities of acetylcholinesterase (AChE) after inhibition with propoxur, monooxygenases, esterases, and glutathione S-transferases (GSTs) differed significantly from one another (Welsch, Post hoc Test, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The data were log-transformed and subjected to a normality test before analysis in IBM SPSS Statistics version 28.0 to fulfill the assumptions of ANOVA.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eSusceptibility to Pyrethroids and Organophosphates\u003c/h2\u003e\u003cp\u003e\u003cem\u003eAedes aegypti\u003c/em\u003e Malaysia strain from both FH and TBJ showed significantly high phenotype resistance towards PY and OP insecticides (mortality between 9\u0026ndash;22%; one-way ANOVA, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) compared to other localities, except possible resistance for TBJ exposed to malathion (mortality 95%; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The Riverside strain from the USA also exhibited high phenotypic resistance to PY and was not significantly different from the Malaysian strain (mortality 22\u0026ndash;33%; one-way ANOVA, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), but remained susceptible to malathion. \u003cem\u003eAedes aegypti\u003c/em\u003e collected from ST, Thailand, showed phenotypic resistance to PY and OP (mortality 58\u0026ndash;87%). However, the SK strain, also from Thailand, remained susceptible to PY (mortality rate 99%), but not to the OP group. However, no significant differences were found in the mortality of \u003cem\u003eAe. aegypti\u003c/em\u003e between SK and ST strains, Thailand (one-way ANOVA, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Mosquitoes from Indonesia were found to be less resistant to PY, which represents possible resistance and susceptible status to the OP group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). One-way ANOVA revealed significant differences between strains collected from Asian countries and the USA when exposed to insecticides (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThe results of a one-way ANOVA represent the mean differences of 24 hours of \u003cem\u003eAedes aegypti\u003c/em\u003e mortality between each locality against pyrethroid and organophosphate insecticides.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"7\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eClass\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eInsecticides\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMS\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003edf\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eSign.\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eOrganophosphate\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e5% malathion\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBetween group\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e674.667\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e28.184\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eWithin group\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e25.333\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e21\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e27\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e60mg/m\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBetween group\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e5052.267\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e21.416\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003epirimiphos-methyl\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eWithin group\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e280.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e21\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e27\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0.4%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBetween group\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e8666.267\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e92.909\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePyrethroid\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003epermethrin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eWithin group\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e107.333\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e121\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e27\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0.03%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBetween group\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e5103.842\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e25.684\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003edeltamethrin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eWithin group\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e261.931\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e21\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e27\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eKnockdown Time (KT) after Exposure to Pyrethroids and Organophosphates\u003c/h2\u003e\u003cp\u003eWhen comparing the impact of malathion on the knockdown time between strains, the Malaysia strain from FH showed the highest KT\u003csub\u003e50\u003c/sub\u003e at 69.88 minutes and KT\u003csub\u003e95\u003c/sub\u003e at 148.92 minutes (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The KT\u003csub\u003e95\u003c/sub\u003e levels of FH and TBJ in Malaysia showed no significant differences (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Knockdown of \u003cem\u003eAe. aegypti\u003c/em\u003e exposed to the OP group (malathion and pirimiphos-methyl) cannot be determined within one hour in most strains due to the delayed toxic effects of these compounds, which manifest after exposure, and mortality effects can be observed at 24 hours.\u003c/p\u003e\u003cp\u003eThe ST strains showed the highest KT\u003csub\u003e50\u003c/sub\u003e for permethrin, 876.61 minutes, indicating that a longer time was needed to cause knockdown (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Since no knockdown occurred after an hour of exposure, the KT\u003csub\u003e50\u003c/sub\u003e and KT\u003csub\u003e95\u003c/sub\u003e of permethrin for TBJ and FH from Malaysia, cannot be ascertained. The strong resistance status identified at 24-hour mortality in the previous section (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) supports a high likelihood of rapid recovery, and the knockdown effect was temporary following exposure. The lowest KT\u003csub\u003e50\u003c/sub\u003e (15.30 minutes) and KT\u003csub\u003e95\u003c/sub\u003e (29.79 minutes) for deltamethrin were observed in the Depok strain from Indonesia, indicating that the fastest knockdown occurred upon exposure to deltamethrin (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). In addition, the VCRU susceptible strains exhibited significantly faster knockdown, as indicated by both KT\u003csub\u003e50\u003c/sub\u003e and KT\u003csub\u003e95\u003c/sub\u003e, compared to other strains following exposure to PY insecticides. Meanwhile, the KT\u003csub\u003e50\u003c/sub\u003e and KT\u003csub\u003e95\u003c/sub\u003e of OP were unable to compute due to no knockdown within one hour of exposure, but 100% mortality was observed after 24 hours post-treatment.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eSurvival after Exposure to Insecticides\u003c/h2\u003e\u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, the survival analysis using the Kaplan-Meier method revealed a similar survival curve pattern for all strains and insecticides, except for the DP strain from Indonesia (pairwise, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Based on the log-rank test, the mean survival time varied less within 17.001\u0026ndash;18.209 minutes with no significant differences between strains and insecticides (log-rank, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The most susceptible strain towards OP with a low KT\u003csub\u003e50\u003c/sub\u003e value was determined in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e and Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, represented by DP, Indonesia. This strain also showed the highest survival mean in the survival analysis, ranging from 18.549 to 29.127 minutes (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Whereas the VCRU susceptible strain exhibited a similar survival pattern for OP with other strains, with no dead mosquitoes, indicating a delayed effect. However, 100% mortality, indicating susceptible status, was achieved after 24 hours post-treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). VCRU strains also showed significantly lower survival in the PY treatment compared to other strains (pairwise, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01), but were similar to DP, Indonesia (pairwise, p\u0026thinsp;\u0026gt;\u0026thinsp;0.01).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eMean survival time and log-rank test analysis for \u003cem\u003eAedes aegypti\u003c/em\u003e from different countries after insecticide exposure.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"8\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eInsecticide\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eCountry\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eLocality\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003eMean survival time\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"3\" nameend=\"c8\" namest=\"c6\"\u003e\u003cp\u003eLog-rank test\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eEstimates\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eStd. error\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eChi-square\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003edf\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003eSign.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"6\" rowspan=\"7\"\u003e\u003cp\u003e5% malathion\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMalaysia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eVCRU susceptible\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e17.268\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.372\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eMalaysia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHamna\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e17.268\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.372\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\" morerows=\"5\" rowspan=\"6\"\u003e\u003cp\u003e111.326\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\" morerows=\"5\" rowspan=\"6\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\" morerows=\"5\" rowspan=\"6\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTaman Bukit Jambul\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e18.203\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.405\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eThailand\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSongkhla\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e17.993\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.391\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSurat Thani\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e17.759\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.389\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIndonesia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eDepok\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e22.177\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.513\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eUnited States of America\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRiverside\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e17.167\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.367\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"6\" rowspan=\"7\"\u003e\u003cp\u003e60mg/m\u003csup\u003e2\u003c/sup\u003e pirimiphos-methyl\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMalaysia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eVCRU susceptible\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e17.147\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.140\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eMalaysia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHamna\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e17.001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.359\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\" morerows=\"5\" rowspan=\"6\"\u003e\u003cp\u003e36.218\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\" morerows=\"5\" rowspan=\"6\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\" morerows=\"5\" rowspan=\"6\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTaman Bukit Jambul\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e17.001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.359\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eThailand\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSongkhla\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e17.001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.359\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSurat Thani\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e17.043\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.361\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIndonesia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eDepok\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e18.549\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.420\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eUnited States of America\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRiverside\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e16.993\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.359\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"6\" rowspan=\"7\"\u003e\u003cp\u003e0.4% permethrin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMalaysia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eVCRU susceptible\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e54.539\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.391\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eMalaysia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHamna\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e17.023\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.360\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\" morerows=\"5\" rowspan=\"6\"\u003e\u003cp\u003e1975.926\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\" morerows=\"5\" rowspan=\"6\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\" morerows=\"5\" rowspan=\"6\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTaman Bukit Jambul\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e17.001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.359\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eThailand\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSongkhla\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e18.020\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.383\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSurat Thani\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e18.020\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.383\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIndonesia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eDepok\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e29.127\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.559\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eUnited States of America\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRiverside\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e17.942\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.360\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"6\" rowspan=\"7\"\u003e\u003cp\u003e0.03% deltamethrin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMalaysia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eVCRU susceptible\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e53.138\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.176\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eMalaysia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHamna\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e17.434\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.375\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\" morerows=\"5\" rowspan=\"6\"\u003e\u003cp\u003e1777.871\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\" morerows=\"5\" rowspan=\"6\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\" morerows=\"5\" rowspan=\"6\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTaman Bukit Jambul\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e17.001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.359\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eThailand\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSongkhla\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e17.001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.359\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSurat Thani\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e18.105\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.384\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIndonesia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eDepok\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e27.403\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.588\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eUnited States of America\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRiverside\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e18.209\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.399\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eDetection of Target Site\u003c/b\u003e \u003cb\u003ekdr\u003c/b\u003e \u003cb\u003eMutation at Domain II and III of VGSC\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe VGSC resistance allele frequencies were detected in insecticide-resistant mosquitoes from DIIS6 regions (codons 989, 1007, 1011, 1016) and DIII6 for codons 1520 and 1534 among four countries (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Thailand-resistant mosquitoes showed a lower frequency of resistance alleles. Only 10% I1011M in SK-pirimiphos-methyl and 10% in ST-deltamethrin. The changes at codon position 1016 from Isoleucine (ATA) to Methionine (ATG) and codon position 1534 from phenylalanine (TTC) to cysteine (TGC) were discovered for pirimiphos-methyl-resistant, permethrin-resistant, and deltamethrin-resistant \u003cem\u003eAe. aegypti\u003c/em\u003e mosquitoes of the RS, USA strain. Surprisingly, the same mutation of V1016I was also detected in DP, Indonesia, for PY-possible-resistant individuals.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eA mixture of \u003cem\u003ekdr\u003c/em\u003e mutation alleles was found in both Malaysian strains. TBJ exhibited four resistance codons with S989P and V1016G at domain II and T1520I and F1534C for domain III for pirimiphos-methyl-resistance and permethrin-resistant \u003cem\u003eAe. aegypti\u003c/em\u003e with different frequencies (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb, c, and d). Interestingly, this is the first time the detection of T1520I in Malaysia, which was reported in India earlier [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. At codon position 1520, the wild-type amino acid Threonine (ACC) changes to Isoleucine (ATC) due to a C to T substitution. Our sequencing also detected I1011V at a 15% frequency in deltamethrin-resistant mosquitoes. Meanwhile, only three mutations were detected in malathion-resistance TBJ mosquitoes: S989P, V1016G, and F1534C. The same mutations were detected in the FH strain for pirimiphos-methyl-resistant and deltamethrin-resistant mosquitoes. In the malathion-resistant FH strain, changes at position 1011, from Isoleucine (ATA) to Methionine (ATG), were also detected.\u003c/p\u003e\u003cp\u003e\u003cb\u003eDistribution of\u003c/b\u003e \u003cb\u003ekdr\u003c/b\u003e \u003cb\u003emutations and multiple loci of the genotypes\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe have identified eight combinations of substitutions, comprising six double-locus, one triple-locus, and one quadruple-locus, from four countries genotyped for DIIS6 and DIIIS6 out of 188 samples (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The locus genotype with a combination of two amino acid substitutions, DIIS6 and DIIIS6, type 5 (V1016I\u0026thinsp;+\u0026thinsp;F1534C), was found in pirimiphos-resistant, permethrin-resistant, and deltamethrin-resistant USA samples. We observed that the presence of these substitution patterns led to high resistance to both PY and OP insecticides.\u003c/p\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eBiochemical Assays on Enzymatic Activities\u003c/h2\u003e\u003cp\u003eThe mean enzymatic activities of each strain were reported in Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, and the percentage frequency distribution of enzymes was tabulated in Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e for the remaining activity of acetylcholinesterase after inhibition with propoxur, MFO, α-EST, β-EST, and GST. The USA RS strain was found to have significantly higher elevated enzyme activities between 3\u0026ndash;10 times than the VCRU susceptible strain (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e; one-way ANOVA, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). This frequency distribution is well distributed and skewed to the right side, indicating resistance had occurred at the metabolic sites (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e), thus including a high frequency of \u003cem\u003ekdr\u003c/em\u003e mutations (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e and Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). SK strain has also shown a pattern of increasing all enzymes, but only the remaining acetylcholinesterase after inhibition with propoxur and GST showed significant figures (one-way ANOVA, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Meanwhile, less frequency of \u003cem\u003ekdr\u003c/em\u003e mutations was detected in the samples from SK (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The DP strain from Indonesia was found to be susceptible to OP and possibly resistant to PY (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). These results were supported by the metabolic enzymes, where the upregulation of α-EST and GST was not significantly different from that of the VCRU reference strain (one-way ANOVA, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Malaysia strains from both TBJ and FH showed high resistance to insecticides (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), with the presence of multiple \u003cem\u003ekdr\u003c/em\u003e mutations (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e), indicating an upregulation of α-EST, β-EST, and GST enzymes as a mechanism of resistance for the FH strain. Still, it is not significantly different from the VCRU reference strain (one-way ANOVA, p\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eMean enzyme activity of remaining activity of acetylcholinesterase (ACHE), mixed function oxidase (MFO), esterases, and glutathione S-transferase (GST) for \u003cem\u003eAedes aegypti\u003c/em\u003e mosquitoes from different countries (n\u0026thinsp;=\u0026thinsp;40).\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"7\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eCountry\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eStrain\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACHE\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMFO\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eα-EST\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eΒ-EST\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eGST\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eMean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eMean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eMean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eReference (Susceptible)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eVCRU\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e16.91\u0026thinsp;\u0026plusmn;\u0026thinsp;1.24\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e10.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.84\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.39\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e3.36x10\u003csup\u003e4\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cb\u003eMalaysia\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eTaman Bukit Jambul\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5.46\u0026thinsp;\u0026plusmn;\u0026thinsp;2.45\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e4.24\u0026thinsp;\u0026plusmn;\u0026thinsp;1.34\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.82\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e3.74x10\u003csup\u003e3\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea,b\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eHamna\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e14.04\u0026thinsp;\u0026plusmn;\u0026thinsp;1.88\u003csup\u003ea,b\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e24.85\u0026thinsp;\u0026plusmn;\u0026thinsp;6.51\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.59\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003csup\u003ea,b\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.88\u0026thinsp;\u0026plusmn;\u0026thinsp;0.24\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e9.64x10\u003csup\u003e4\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cb\u003eThailand\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eSurat Thani\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.40\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e11.64\u0026thinsp;\u0026plusmn;\u0026thinsp;0.65\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003csup\u003ea,b\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e1.37x10\u003csup\u003e3\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea,b\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eSongkhla\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e16.92\u0026thinsp;\u0026plusmn;\u0026thinsp;7.49\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e33.70\u0026thinsp;\u0026plusmn;\u0026thinsp;12.51\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.64\u003csup\u003ea,b\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e2.34\u0026thinsp;\u0026plusmn;\u0026thinsp;1.15\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e3.49x10\u003csup\u003e3\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eIndonesia\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eDepok\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e8.92\u0026thinsp;\u0026plusmn;\u0026thinsp;2.14\u003csup\u003eb,c\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e3.10\u0026thinsp;\u0026plusmn;\u0026thinsp;0.49\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003csup\u003ea,b\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e9.16x10\u003csup\u003e4\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eUSA\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eRiverside\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e126.21\u0026thinsp;\u0026plusmn;\u0026thinsp;19.10\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e24.36\u0026thinsp;\u0026plusmn;\u0026thinsp;5.36\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e6.03\u0026thinsp;\u0026plusmn;\u0026thinsp;0.70\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e3.61x10\u003csup\u003e3\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eUnderstanding the mechanisms underlying insecticide resistance in \u003cem\u003eAedes aegypti\u003c/em\u003e is essential for designing sustainable vector control strategies. Resistance arises through multiple pathways, including observable phenotypical resistance, enhanced metabolic detoxification, and target-site mutations in the mosquito nervous system. These mechanisms can act independently or synergistically, leading to varying levels of resistance across populations and geographic regions.\u003c/p\u003e\u003cp\u003eOur study detected high phenotypic resistance of \u003cem\u003eAe. aegypti\u003c/em\u003e to pyrethroids (permethrin and deltamethrin) and organophosphates (malathion and pirimiphos-methyl) in strains from Penang, Malaysia, and Riverside, USA. In contrast, the Depok, Indonesia strain showed susceptibility to organophosphates and only incipient resistance to pyrethroids. Interestingly, Thai strains (Songkhla and Surat Thani) exhibited strong resistance to pyrethroids despite lacking detectable \u003cem\u003ekdr\u003c/em\u003e mutations. This suggests that phenotypic resistance can occur independently of genetic markers, possibly driven by other physiological or environmental factors.\u003c/p\u003e\u003cp\u003eSeveral elements, including insecticide resistance, environmental adaptations, and human activities, play critical roles in shaping this phenomenon [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. The surge in cases highlights how critical it is to comprehend the dynamics influencing the \u003cem\u003eAe. aegypti\u003c/em\u003e's resilience in both countries. The intensive use of insecticides for vector control has inadvertently exerted selective pressure on mosquito populations, favoring individuals with genetic mutations that confer resistance [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The escalating resistance to PY and OP insecticides presents a complex challenge rooted in distinct agricultural practices and environmental conditions. For example, the same insecticides used to control agricultural pests are employed in vector control programs for diseases like malaria and dengue [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Pests exposed to insecticides in one sector (e.g., agriculture) may develop resistance mechanisms that confer cross-resistance to insecticides used in the other sector (e.g., public health). Pests often develop resistance to multiple insecticide classes through various mechanisms, including target-site modifications, enzymatic detoxification, and reduced penetration or excretion of insecticides [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eNew mutation detections of T1520I, which has never been reported in Malaysia, as well as the presence of I1011M in domain SII6 were found in this study. The T1520I mutation in \u003cem\u003eAe. aegypti\u003c/em\u003e is part of a broader context of knockdown resistance (\u003cem\u003ekdr\u003c/em\u003e) mutations that contribute to insecticide resistance, particularly against PY and DDT, and this T1520I novel gene was first reported in Delhi [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. The presence of T1520I, although less prevalent than other mutations, plays a role in enhancing resistance when combined with F1534C, which enhances resistance to permethrin but does not affect sensitivity to deltamethrin [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Our results revealed a high frequency of dual-loci mutations of T1520I\u0026thinsp;+\u0026thinsp;F1534C from TBJ, Malaysia (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The distribution of these mutations varies across regions, with studies indicating a lack of recombination among haplogroups in Indian populations, suggesting stable resistance mechanisms [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. The I1011M \u003cem\u003ekdr\u003c/em\u003e mutation in \u003cem\u003eAe. aegypti\u003c/em\u003e is less prevalent in Asia and only detected at a low prevalence in malathion-resistant FH Malaysia strains. This mutation has been formally reported in Thailand, Vietnam, Brazil, French Guyana, and Martinique [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eRegional variations were evident in V1016G and S989P mutations, which dominated Southeast Asian populations, whereas V1016I was prevalent in the Americas but has now emerged in Asian strains. In our study, homozygous V1016I was found in pirimiphos-resistant and deltamethrin-resistant RS USA strain. The V1016I mutation is not commonly found in \u003cem\u003eAe. aegypti\u003c/em\u003e in Asia; instead, the V1016G mutation is prevalent. Interestingly, V1016I was found in Depok, Indonesia, among the PY-possible resistant individuals. Such findings underscore the global dissemination and regional adaptation of resistance alleles. As supported by a review by Uemura et al. (2024) [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e], V1016I resistance mutations have been found in Argentina, Brazil, Burkina Faso, Colombia, Ghana, Iran, the USA, and Venezuela (since 2023). The mutation occurred at DII6 for codons 1016, suggesting that the dissemination of resistance has transitioned from the Americas to Asia. This mutation, along with others in the voltage-gated sodium channel (VGSC) gene, has been linked to a substantial reduction in pyrethroid binding and efficacy of PY insecticides, which are commonly used for vector control.\u003c/p\u003e\u003cp\u003eThe V1016I mutation may not autonomously diminish PY sensitivity; however, it could engage in a synergistic interaction with other knockdown resistance mutations, such as F1534C or V410L, which can lead to resistance levels varying from 3.9- to 56-fold depending on the specific pyrethroid used [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. PY-resistant \u003cem\u003eAe. aegypti\u003c/em\u003e populations, V1016I is often linked to another mutation, F1534C, which confers sodium channel resistance only to Type I pyrethroids, including permethrin, but not to Type II PY including deltamethrin [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Whereas, the mosquitoes carrying both V1016G and F1534C exhibited greater PY resistance than those carrying F1534C alone [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In which, \u003cem\u003eAe. aegypti\u003c/em\u003e mosquitoes with a high frequency of double homozygous resistant genotypes (II/CC), contributing to increased survivorship of mosquitoes at varying distances from insecticide application sites [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. In our study, this interaction implies that V1016I or V1016G could be integral in augmenting mosquitoes' comprehensive resistance profile when conjoined with F1534C, resulting in resistance to permethrin and deltamethrin.\u003c/p\u003e\u003cp\u003eMultiple knockdown resistance (\u003cem\u003ekdr\u003c/em\u003e) mutations in the voltage-gated sodium channel (VGSC) gene were identified. The V1016G, S989P, and F1534C mutations are typically associated with the Indo-Pacific region [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. The presence and frequency of these mutations across various populations can provide insights into the potential for resistance development similar to that found in this study in Malaysia and Indonesia. This mutation, when present with other \u003cem\u003ekdr\u003c/em\u003e mutations, significantly enhances the survival of mosquitoes under insecticide exposure [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Specific haplotypes, particularly those containing multiple \u003cem\u003ekdr\u003c/em\u003e mutations, are associated with higher resistance levels, emphasizing the need for targeted monitoring [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. This mutation enhances resistance levels, impacting the effectiveness of insecticides and complicating vector control efforts against dengue and other viral transmissions [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. For instance, the combination of V1016G and F1534C can confer up to a 1100-fold increase in resistance to PY [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Instead, the study highlights V1016G, S989P, and F1269C mutations associated with PY resistance in Southeast Asia, Asia particularly Singapore and Indonesia [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. In Vietnam and Cambodia, high frequencies of V1016G, along with L982W and F1534C mutations, have been reported, which are associated with high levels of PY resistance, indicating a concerning trend of increasing resistance [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eBeyond \u003cem\u003ekdr\u003c/em\u003e mutations, other resistance mechanisms may also play a role, indicating that reliance solely on \u003cem\u003ekdr\u003c/em\u003e mutation monitoring may not capture the complete picture of resistance dynamics [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. Thus, solely relying on \u003cem\u003ekdr\u003c/em\u003e mutations may not accurately predict the emergence of high resistance in mosquito populations. OP resistance is less frequently associated with genetic mutations, making it less likely to develop in insect populations [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. The mode of action primarily involves the inhibition of acetylcholinesterase, leading to an accumulation of acetylcholine at nerve synapses [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. In this study, metabolic detoxification, particularly through the overexpression of cytochrome P450 monooxygenases, esterases, and glutathione S-transferases, contributes significantly to insecticide resistance. In the Riverside, USA strain, resistance was associated with upregulated α-esterases, β-esterases, GSTs, and mixed-function oxidases, which were upregulated between 3 and 100 times compared to the VCRU reference strain. Resistance is most severe when metabolic and site mutation mechanisms co-occur. For example, the Riverside strain exhibited both high enzymatic activity and multiple \u003cem\u003ekdr\u003c/em\u003e mutations, resulting in strong resistance to both pyrethroids and organophosphates. Similarly, dual-loci mutations such as T1520I\u0026thinsp;+\u0026thinsp;F1534C or V1016G\u0026thinsp;+\u0026thinsp;F1534C conferred markedly higher resistance levels than single mutations. This interplay highlights the complexity of resistance evolution and the challenge of relying on insecticides with a single mode of action [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eBy contrast, the FH Malaysia strain displayed high resistance without notable upregulation of detoxifying enzymes, suggesting the predominance of genetic rather than metabolic mechanisms. Whereas the TBJ, Malaysia strain showed increased MFO activity alone. According to Rubio-Palis et al. [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e], elevated metabolic enzyme activity, such as mixed-function oxidases and GSTs, plays a significant role in resistance. In \u003cem\u003eAe. aegypti\u003c/em\u003e, while \u003cem\u003ekdr\u003c/em\u003e mutations increased significantly after deltamethrin selection, only α-esterase activity remained elevated, indicating a complex relationship between mutations and enzyme upregulation [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. While PY faces significant resistance challenges, the development of OP resistance remains limited. This suggests that the mechanisms and evolutionary pressures differ markedly between these two classes of insecticides.\u003c/p\u003e\u003cp\u003eIn addition, although the phenotypic resistance exhibited by the Thailand strains (Songkhla and Surat Thani) was high in PY exposure, they showed a limited frequency of \u003cem\u003ekdr\u003c/em\u003e mutations. In \u003cem\u003eAe. aegypti\u003c/em\u003e from C\u0026ocirc;te d'Ivoire, phenotypic resistance was observed against several insecticides, with mortality rates varying significantly across different sites, yet no \u003cem\u003ekdr\u003c/em\u003e mutations were detected [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. Thus, the upregulation of the remaining acetylcholinesterase after inhibition with propoxur and GST mainly contributed to the resistance status of the Thai strains. The Indonesian strain from Depok showed a high susceptibility to OP and incipient resistance to PY, as indicated by their phenotypic resistance. Depok, Indonesia, is a suburban extension of Jakarta and a rapidly growing urban area that has yet to experience less insecticide pressure, allowing for a more susceptible mosquito population. However, the growing urban area may lead to more resistant individuals due to the selective pressures of insecticides [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e] and habitat availability, which is increasingly at risk of vector-borne diseases that require management effort using insecticides such as \u003cem\u003eAe. aegypti\u003c/em\u003e expands its range [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe Depok, Indonesia, and Riverside, USA strains are still susceptible to malathion. Despite resistance mechanisms in some mosquito populations, malathion remains effective against many species due to specific genetic and enzymatic factors that limit the development of resistance. Overexpression of cytochrome P450 enzymes, which detoxify PY, may increase susceptibility to malathion. These enzymes can activate pro-insecticides, enhancing malathion's effectiveness [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. Conversion through the metabolic enzymatic activation process of less toxic malathion to malathion-oxon, which is significantly more toxic due to its potent inhibition of acetylcholinesterase (AChE), and these detoxification enzymes are often upregulated in resistant populations. However, their role in malathion resistance is complex and not always sufficient to confer resistance, as seen in various studies where mosquitoes remained susceptible despite enzyme overexpression [\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e, \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e].\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn conclusion, this study demonstrated that resistance in \u003cem\u003eAe. aegypti\u003c/em\u003e is shaped by multiple, interacting mechanisms, including phenotypical traits, metabolic detoxification, and \u003cem\u003ekdr\u003c/em\u003e mutations. High resistance to pyrethroids and organophosphates was observed across Malaysia, Indonesia, Thailand, and the USA, with novel detections of T1520I and I1011M in Malaysia and V1016I in Indonesia. These findings underscore the complexity of resistance evolution under selective pressure from insecticide use and environmental change. Thus, insecticides that are often applied at higher doses or with greater frequency than necessary exert strong selective pressure on pest populations. This practice accelerates the survival and reproduction of individuals with resistant traits, leading to the rapid evolution of resistant populations. The environmental degradation of insecticides can leave sub-lethal residues, further select resistant individuals [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e], and allowing the expansion of resistant individuals. Without proper monitoring of pest populations and economic thresholds, insecticides are often applied prophylactically, further exacerbating resistance. Other than that, climate change is expected to exacerbate resistance by expanding the ranges of invasive pests and altering the effectiveness of insecticides [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]. As highlighted earlier, managing resistance requires continuous surveillance and the integration of adaptive vector control strategies to sustain the effectiveness of current insecticides.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to express our sincere gratitude to Universiti Sains Malaysia, the University of California, Riverside, the National Research and Innovation Agency of the Republic of Indonesia (BRIN), and Prince of Songkhla University for their invaluable support throughout this research. The institution\u0026apos;s resources and facilities greatly contributed to the successful completion of this work. We want to acknowledge the collaborative efforts of our colleagues, whose guidance and insights have significantly contributed to the development of this work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe also extend our heartfelt appreciation to the Ministry of Higher Education Malaysia (FRGS/1/2023/STG03/USM/02/4) and the UC Riverside Urban Entomology Endowed Chair Research Fund. This funding was essential in facilitating the research and enabling the publication of this manuscript. Special thanks to the Malaysian American Commission on Educational Exchange (MACEE) and the Bureau of Educational and Cultural Affairs of the United States Department of State for the US-ASEAN Fulbright Fellowship to Wan Fatma Zuharah that enabled her to pursue research at UC Riverside.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this article and its supplementary materials.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; Contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors\u0026apos; contributions are as follows: WFZ: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Validation, Writing\u0026mdash;original draft; CYL: Conceptualization, Methodology, Funding acquisition, Resources, Supervision, Validation, Writing\u0026mdash;review \u0026amp; editing; FNA, ANZA, EB, TK, IG, TP, TSS- Methodology, Investigation; SHL: Data curation, Formal Analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eJeffrey RP, Andrea G-S, Panayiota K. Recent History of Aedes aegypti: Vector Genomics and Epidemiology Records. BioScience. 2018;68 11:854\u0026ndash;60; doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/biosci/biy119\u003c/span\u003e\u003cspan address=\"10.1093/biosci/biy119\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCapinha C, Rocha J, Sousa CA. Macroclimate determines the global range limit of Aedes aegypti. EcoHealth. 2014;11:420\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHahn MB, Eisen RJ, Eisen L, Boegler KA, Moore CG, McAllister J, et al. Reported distribution of Aedes (stegomyia) aegypti and Aedes (stegomyia) albopictus in the United States, 1995\u0026ndash;2016 (diptera: Culicidae). Journal of medical entomology. 2016;53 5:1169\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBracco JE, Capurro ML, Louren\u0026ccedil;o-de-Oliveira R, Sallum MAM. Genetic variability of Aedes aegypti in the Americas using a mitochondrial gene: evidence of multiple introductions. Memorias do Instituto Oswaldo Cruz. 2007;102:573\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHopperstad K, Reiskind M. Recent changes in the local distribution of Aedes aegypti (Diptera: Culicidae) in South Florida, USA. Journal of medical entomology. 2016;53 4:836\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSelvaraj P, Wenger EA, Bridenbecker D, Windbichler N, Russell JR, Gerardin J, et al. Vector genetics, insecticide resistance and gene drives: An agent-based modeling approach to evaluate malaria transmission and elimination. PLoS computational biology. 2020;16 8:e1008121.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAhdika A, Lusiyana N. Investigation of Aedes aegypti's resistance toward insecticides exposure using Markov modeling. 2018.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKarunamoorthi K, Sabesan S. Insecticide resistance in insect vectors of disease with special reference to mosquitoes: a potential threat to global public health. 2013.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOakeshott JG, Home I, Sutherland TD, Russell RJ. The genomics of insecticide resistance. Genome Biology. 2003;4 1:202.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSato Y, Jang S, Takeshita K, Itoh H, Koike H, Tago K, et al. Insecticide resistance by a host-symbiont reciprocal detoxification. Nature Communications. 2021;12 1:6432.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKasai S, Komagata O, Itokawa K, Shono T, Ng LC, Kobayashi M, et al. Mechanisms of pyrethroid resistance in the dengue mosquito vector, Aedes aegypti: target site insensitivity, penetration, and metabolism. PLoS neglected tropical diseases. 2014;8 6:e2948.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSaavedra-Rodriguez K, Strode C, Flores Suarez A, Fernandez Salas I, Ranson H, Hemingway J, et al. Quantitative trait loci mapping of genome regions controlling permethrin resistance in the mosquito Aedes aegypti. Genetics. 2008;180 2:1137\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSeverson D, Anthony N, Andreev O, Ffrench-Constant R. Molecular mapping of insecticide resistance genes in the yellow fever mosquito (Aedes aegypti). Journal of Heredity. 1997;88 6:520\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSaavedra-Rodriguez K, Campbell CL, Lozano S, Penilla-Navarro P, Lopez-Solis A, Solis-Santoyo F, et al. Permethrin resistance in Aedes aegypti: Genomic variants that confer knockdown resistance, recovery, and death. PLoS Genetics. 2021;17 6:e1009606.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSaingamsook J, Yanola J, Lumjuan N, Walton C, Somboon P. Investigation of relative development and reproductivity fitness cost in three insecticide-resistant strains of Aedes aegypti from Thailand. Insects. 2019;10 9:265.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRosilawati R, HLa L, WAa N, AHa N, Aa R, Ma KA, et al. Pyrethroid Resistance Status of Aedes (Stegomyia) aegypti (Linneaus) from Dengue Endemic Areas in Peninsular Malaysia. development. 2017;16 2.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGan SJ, Leong YQ, bin Barhanuddin MFH, Wong ST, Wong SF, Mak JW, et al. Dengue fever and insecticide resistance in Aedes mosquitoes in Southeast Asia: a review. Parasites \u0026amp; vectors. 2021;14 1:315.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKawada H, Higa Y, Futami K, Muranami Y, Kawashima E, Osei JH, et al. Discovery of point mutations in the voltage-gated sodium channel from African Aedes aegypti populations: potential phylogenetic reasons for gene introgression. PLOS Neglected Tropical Diseases. 2016;10 6:e0004780.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRasli R, Lee HL, Wasi Ahmad N, Fikri SFF, Ali R, Muhamed KA, et al. Susceptibility status and resistance mechanisms in permethrin-selected, laboratory susceptible and field-collected Aedes aegypti from Malaysia. Insects. 2018;9 2:43.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZuharah WF, Sufian M. The discovery of a novel knockdown resistance (kdr) mutation A1007G in the Voltage-Gated Sodium Channel (vgsc) on Aedes aegypti (Diptera: Culicidae) from Malaysia. 2020.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAkhir MAM, Wajidi MF, Lavou\u0026eacute; S, Azzam G, Jaafar IS, Awang Besar NAU, et al. Knockdown resistance (kdr) gene of Aedes aegypti in Malaysia with the discovery of a novel regional specific point mutation A1007G. Parasites \u0026amp; Vectors. 2022;15 1:122.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHamid P, Prastowo J, Widyasari A. Knockdown resistance (kdr) of the voltage-gated sodium channel gene of Aedes aegypti population in Denpasar, Bali, Indonesia.. Parasites \u0026amp; Vectors 2017;10:283; doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13071-017-2215-4\u003c/span\u003e\u003cspan address=\"10.1186/s13071-017-2215-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWuliandari J, Hoffmann A, Tantowijoyo W. Frequency of kdr mutations in the voltage-sensitive sodium channel (VSSC) gene in Aedes aegypti from Yogyakarta and implications for Wolbachia-infected mosquito trials.. Parasites \u0026amp; Vectors. 2020;13:429; doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13071-020-04304-x\u003c/span\u003e\u003cspan address=\"10.1186/s13071-020-04304-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRidha M, Yudhastuti R, Notobroto H, Hidajat M, Diyanah K, Jassey B, et al. A systematic review of insecticide resistance in Aedes aegypti (Diptera: Culicidae) and implications for dengue control in Indonesia. Veterinary World. 2025;18 3:658; doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.14202/vetworld.2025.658-672\u003c/span\u003e\u003cspan address=\"10.14202/vetworld.2025.658-672\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStenhouse SA, Plernsub S, Yanola J, Lumjuan N, Dantrakool A, Choochote W, et al. Detection of the V1016G mutation in the voltage-gated sodium channel gene of Aedes aegypti (Diptera: Culicidae) by allele-specific PCR assay, and its distribution and effect on deltamethrin resistance in Thailand. Parasites \u0026amp; Vectors. 2013;6 253.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYanola J, Somboon P, Walton C, Nachaiwieng W, Somwang P, Prapanthadara L-a. High-throughput assays for detection of the F1534C mutation in the voltage-gated sodium channel gene in permethrin-resistant Aedes aegypti and the distribution of this mutation throughout Thailand. Trop Med Int Health. 2011;16 4:501\u0026thinsp;\u0026ndash;\u0026thinsp;19.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEstep AS, Sanscrainte ND, Waits CM, Bernard SJ, Lylod AM, Lucas KJ, et al. Quantification of permethrin resistance and kdr alleles in Florida strains of Aedes aegypti (L.) and Aedes albopictus (Skuse). PLoS Negl Trop Dis. 2018;12 10:e0006544.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchluep SM, Buckner EA. Metabolic resistance in permethrin-resistant Florida Aedes aegypti (Diptera: Culicidae). Insects. 2021;12 10:866.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eViana-Medeiros P, Bellinato D, Martins A, Valle D. Insecticide resistance, associated mechanisms and fitness aspects in two B razilian S tegomyia aegypti (=\u0026thinsp;A edes aegypti) populations. Medical and Veterinary Entomology. 2017;31 4:340\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWHO WHO. Standard operating procedure for testing insecticide susceptibility of adult mosquitoes in WHO tube tests. 2022.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbbott WS. A method of computing the effectiveness of an insecticide. J econ Entomol. 1925;18 2:265\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHemingway J, Brogdon W. Techniques to Detect Insecticide Resistance Mechanisms: Field and Laboratory Manual. World Health Organization; 1998.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eValle D, Montella I, Ribeiro R, Viana-Medeiros P, Martins Jr A, Lima J. Quantification methodology for enzyme activity related to insecticide resistance in Aedes aegypti. Ministry of Health Brazil; 2006.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWHO WHO: Techniques to detect insecticide resistance mechanisms (field and laboratory manual). World Health Organization; 1998.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKushwah RBS, Kaur T, Dykes CL, Ravi Kumar H, Kapoor N, Singh OP. A new knockdown resistance (kdr) mutation, F1534L, in the voltage-gated sodium channel of Aedes aegypti, co-occurring with F1534C, S989P and V1016G. Parasites \u0026amp; Vectors. 2020;13:1\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRedo T, Triwani T, Anwar C, Salni S. Larvicidal activity of Ketapang leaf fraction (Terminalia catappa L) on Aedes aegypti instar III. Open Access Macedonian Journal of Medical Sciences. 2019;7 21:3526.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSternberg ED, Thomas MB. Insights from agriculture for the management of insecticide resistance in disease vectors. Evolutionary applications. 2018;11 4:404\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSiddiqui SA, Fernando I, Nisa\u0026rsquo; K, Shah MA, Rahayu T, Rasool A, et al. Effects of undesired substances and their bioaccumulation on the black soldier fly larvae, Hermetia illucens (Diptera: Stratiomyidae)\u0026ndash;a literature review. Environmental Monitoring and Assessment. 2023;195 7:823.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKushwah RBS, Dykes CL, Kapoor N, Adak T, Singh OP. Pyrethroid-resistance and presence of two knockdown resistance (kdr) mutations, F1534C and a novel mutation T1520I, in Indian Aedes aegypti. PLoS Neglected Tropical Diseases. 2015;9 1:e3332.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen M, Du Y, Wu S, Nomura Y, Zhu G, Zhorov BS, et al. Molecular evidence of sequential evolution of DDT-and pyrethroid-resistant sodium channel in Aedes aegypti. PLoS neglected tropical diseases. 2019;13 6:e0007432.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKaur T, Kushwah RS, Pradhan S, Das MK, Kona MP, Anushrita, et al. Knockdown-resistance (kdr) mutations in Indian Aedes aegypti populations: lack of recombination among haplotypes bearing V1016G, F1534C, and F1534L kdr alleles. bioRxiv. 2024:2024.12. 11.627862.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDu Y, Nomura Y, Satar G, Hu Z, Nauen R, He SY, et al. Molecular evidence for dual pyrethroid-receptor sites on a mosquito sodium channel. Proceedings of the National Academy of Sciences. 2013;110 29:11785-90.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBrengues C, Hawkes NJ, Chandre F, McCarroll L, Duchon S, Guillet P, et al. Pyrethroid and DDT cross-resistance in Aedes aegypti is correlated with novel mutations in the voltage‐gated sodium channel gene. Medical and veterinary entomology. 2003;17 1:87\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eUemura N, Itokawa K, Komagata O, Kasai S. Recent advances in the study of knockdown resistance mutations in Aedes mosquitoes with a focus on several remarkable mutations. Current Opinion in Insect Science. 2024;63:101178.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSilva JJ, Kouam CN, Scott JG. Levels of cross-resistance to pyrethroids conferred by the Vssc knockdown resistance allele 410L\u0026thinsp;+\u0026thinsp;1016I\u0026thinsp;+\u0026thinsp;1534C in Aedes aegypti. PLoS Neglected Tropical Diseases. 2021;15 7:e0009549.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen T-Y, Smartt CT, Shin D. Combination of kdr mutation and detoxification gene expression associated with high tolerance for permethrin in a resistant Aedes aegypti population. bioRxiv. 2020:2020.06. 22.164483.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHernandez JR, Longnecker M, Fredregill CL, Debboun M, Pietrantonio PV. Kdr genotyping (V1016I, F1534C) of the Nav channel of Aedes aegypti (L.) mosquito populations in Harris County (Houston), Texas, USA, after Permanone 31\u0026ndash;66 field tests and its influence on probability of survival. PLoS Neglected Tropical Diseases. 2021;15 11:e0009833.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEndersby-Harshman NM, Schmidt TL, Chung J, van Rooyen A, Weeks AR, Hoffmann AA. Heterogeneous genetic invasions of three insecticide resistance mutations in Indo‐Pacific populations of Aedes aegypti (L.). Molecular Ecology. 2020;29 9:1628\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHernandez JR, Lee HJ, Vigilant ME, Crawford S, Pietrantonio PV. The V410L kdr allele in the VGSC confers higher levels of field resistance to permethrin in urban mosquito populations of Aedes aegypti (L.). Pest Management Science. 2025;81 2:923\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHernandez JR, Liu S, Fredregill CL, Pietrantonio PV. Impact of the V410L kdr mutation and co-occurring genotypes at kdr sites 1016 and 1534 in the VGSC on the probability of survival of the mosquito Aedes aegypti (L.) to Permanone in Harris County, TX, USA. PLoS neglected tropical diseases. 2023;17 1:e0011033.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAtencia\u0026ndash;Pineda MC, Diaz-Ortiz D, Pareja\u0026ndash;Loaiza P, Garc\u0026iacute;a\u0026ndash;Leal J, Hoyos\u0026ndash;L\u0026oacute;pez R, Calder\u0026oacute;n\u0026ndash;Rangel A, et al. Assessing pyrethroid resistance in Aedes aegypti from Cordoba Colombia: Implications of kdr mutations. Plos one. 2024;19 8:e0309201.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHassan MR, Azit NA, Fadzil SM, Abd Ghani SR, Ahmad N, Nawi AM. Insecticide resistance of Dengue vectors in South East Asia: a systematic review. African Health Sciences. 2021;21 3:1124\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKasai S, Itokawa K, Uemura N, Takaoka A, Furutani S, Maekawa Y, et al. Emergence of hyper insecticide-resistant dengue vectors in Indochina Peninsula: threats of concomitant knockdown resistance mutations. bioRxiv. 2022:2022.03. 05.483084.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHawkins NJ, Bass C, Dixon A, Neve P. The evolutionary origins of pesticide resistance. Biological Reviews. 2019;94 1:135\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBrito L, Barbieri F, Rocha R, Santos A, Silva R, Ribeiro E, et al. Pyrethroid and organophosphate pesticide resistance in field populations of horn fly in Brazil. Medical and veterinary entomology. 2019;33 1:121\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBucur B, Munteanu F-D, Marty J-L, Vasilescu A. Advances in enzyme-based biosensors for pesticide detection. Biosensors. 2018;8 2:27.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMarrs TC. Organophosphate poisoning. Pharmacology \u0026amp; therapeutics. 1993;58 1:51\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchoville SD, Cohen ZP, Crossley MS. Population genomic insights into insecticide resistance in the Colorado potato beetle. Springer; 2021.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRubio-Palis Y, Dzuris N, Sandi C, Vizcaino-Cabarrus RL, Corredor-Medina C, Gonz\u0026aacute;lez JA, et al. Insecticide resistance levels and associated mechanisms in three Aedes aegypti populations from Venezuela. Mem\u0026oacute;rias do Instituto Oswaldo Cruz. 2023;118:e220210.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eContreras-Perera Y, Ponce-Garcia G, Villanueva-Segura K, Lopez-Monroy B, Rodr\u0026iacute;guez-Sanchez IP, Lenhart A, et al. Impact of deltamethrin selection on kdr mutations and insecticide detoxifying enzymes in Aedes aegypti from Mexico. Parasites \u0026amp; Vectors. 2020;13:1\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKadjo YM-AE, Adja AM, Guindo-Coulibaly N, Zoh DD, Traor\u0026eacute; DF, Assouho KF, et al. Insecticide Resistance and Metabolic Mechanisms in Aedes aegypti from Two Agrosystems (Vegetable and Cotton Crops) in C\u0026ocirc;te d'Ivoire. Vector-Borne and Zoonotic Diseases. 2023;23 9:475\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFikrig K, Noriega AO, Rodriguez RA, Bardales J, Rivas J, Reyna B, et al. Changing dynamics of Aedes aegypti invasion and vector-borne disease risk for rural communities in the Peruvian Amazon. bioRxiv. 2024:2024.09. 04.611168.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWipf NC, Duchemin W, Kouadio F-PA, Fodjo BK, Sadia CG, Mouhamadou CS, et al. Multi-insecticide resistant malaria vectors in the field remain susceptible to malathion, despite the presence of Ace1 point mutations. PLoS Genetics. 2022;18 2:e1009963.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuang X, Kaufman PE, Athrey GN, Fredregill C, Alvarez C, Shetty V, et al. Potential key genes involved in metabolic resistance to malathion in the southern house mosquito, Culex quinquefasciatus, and functional validation of CYP325BC1 and CYP9M12 as candidate genes using RNA interference. BMC genomics. 2023;24 1:160.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNgangue-Siewe IN, Ndjeunia-Mbiakop P, Kala-Chouakeu NA, Bamou R, Talipouo A, Djamouko-Djonkam L, et al. Bendiocarb and Malathion resistance in two major malaria vector populations in Cameroon is associated with high frequency of the G119S mutation (Ace-1) and overexpression of detoxification genes. Pathogens. 2022;11 8:824.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBarathi S, Sabapathi N, Kandasamy S, Lee J. Present status of insecticide impacts and eco-friendly approaches for remediation-a review. Environmental Research. 2024;240:117432.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSharma S. Cultivating sustainable solutions: Integrated pest management (ipm) for safer and greener agronomy. Corporate Sustainable Management Journal. 2023;1 2:103\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTables 2 and 4 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"parasites-and-vectors","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"parv","sideBox":"Learn more about [Parasites \u0026 Vectors](http://parasitesandvectors.biomedcentral.com/)","snPcode":"13071","submissionUrl":"https://submission.nature.com/new-submission/13071/3","title":"Parasites \u0026 Vectors","twitterHandle":"@bugbittentweets","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Aedes aegypti, kdr mutation, Mosquitoes, Metabolic enzyme, Resistance","lastPublishedDoi":"10.21203/rs.3.rs-7486335/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7486335/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eFor decades, reliance on insecticides for vector control has been a common approach in combating the yellow fever mosquito, \u003cem\u003eAedes aegypti\u003c/em\u003e (L.), and this approach has led to the development of insecticide resistance. This study investigates the phenotypic and genotypic resistance of \u003cem\u003eAe. aegypti\u003c/em\u003e to pyrethroid (permethrin and deltamethrin) and organophosphate (malathion and pirimiphos-methyl) across Malaysia, Thailand, Indonesia, and the USA.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eAdult female \u003cem\u003eAedes aegypti\u003c/em\u003e were subjected to WHO-recommended insecticide bioassays to assess susceptibility to pyrethroids and organophosphates. Molecular analyses were performed to detect \u003cem\u003ekdr\u003c/em\u003e mutations, while biochemical assays quantified metabolic enzyme activities.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eHigh resistance levels were observed in Malaysian and the US strains to both pyrethroids and organophosphates, with intermediate resistance in Thailand and susceptibility in Indonesia. Notably, new mutations T1520I and I1011M were detected in \u003cem\u003eAe. aegypti\u003c/em\u003e Malaysian populations, marking the first report of T1520I in the region. Additionally, V1016I was newly identified in Indonesian strains, highlighting emerging resistance trends. The coexistence of multiple \u003cem\u003ekdr\u003c/em\u003e mutations (S989P, V1016G, F1534C, and T1520I) in Malaysian strains poses a significant challenge to vector control efforts. Interestingly, the Riverside strain from the USA exhibited up to a 10-fold increase in β-EST metabolic enzyme activity compared to the VCRU reference strain, indicating substantial metabolic resistance. In contrast, despite high phenotypic resistance, the Malaysian Hamna strain showed no significant increase in detoxifying enzymes, suggesting that \u003cem\u003ekdr\u003c/em\u003e mutations alone may drive resistance in these populations. Furthermore, resistance in Thai strains was not associated with \u003cem\u003ekdr\u003c/em\u003e mutations but rather with altered acetylcholinesterase and elevated GST activities, highlighting the diversity of resistance mechanisms. The study also identified multiple-loci mutations (triple and quadruple haplotypes) in Malaysian strains, suggesting an advanced stage of resistance evolution.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e\u003cp\u003eThese findings highlight the importance of continuous surveillance and targeted vector control strategies in mitigating the spread of resistance. The detection of novel mutations and diverse resistance mechanisms emphasizes the adaptability of \u003cem\u003eAe. aegypti\u003c/em\u003e to insecticide pressure and the need for innovative approaches to maintain the efficacy of vector control measures.\u003c/p\u003e","manuscriptTitle":"Phenotypic and Genotypic Resistances Associated with Pyrethroid and Organophosphate in Aedes aegypti (Diptera: Culicidae)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-26 20:37:12","doi":"10.21203/rs.3.rs-7486335/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-09-29T18:31:21+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-29T07:23:50+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"17378042878789549296902890895843163397","date":"2025-09-28T23:23:57+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-28T04:52:19+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"100312022802517913959735643118089481304","date":"2025-09-18T00:23:13+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-17T14:37:00+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-10T18:45:53+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-10T05:11:42+00:00","index":"","fulltext":""},{"type":"submitted","content":"Parasites \u0026 Vectors","date":"2025-08-29T07:55:33+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"parasites-and-vectors","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"parv","sideBox":"Learn more about [Parasites \u0026 Vectors](http://parasitesandvectors.biomedcentral.com/)","snPcode":"13071","submissionUrl":"https://submission.nature.com/new-submission/13071/3","title":"Parasites \u0026 Vectors","twitterHandle":"@bugbittentweets","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"68fc5c9f-3755-4454-b425-30a227462eb9","owner":[],"postedDate":"September 26th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-02-09T16:06:28+00:00","versionOfRecord":{"articleIdentity":"rs-7486335","link":"https://doi.org/10.1186/s13071-026-07252-0","journal":{"identity":"parasites-and-vectors","isVorOnly":false,"title":"Parasites \u0026 Vectors"},"publishedOn":"2026-02-07 15:59:56","publishedOnDateReadable":"February 7th, 2026"},"versionCreatedAt":"2025-09-26 20:37:12","video":"","vorDoi":"10.1186/s13071-026-07252-0","vorDoiUrl":"https://doi.org/10.1186/s13071-026-07252-0","workflowStages":[]},"version":"v1","identity":"rs-7486335","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7486335","identity":"rs-7486335","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}