Serum kynurenine and beta-alanine levels are associated with Wnt pathway gene expression in leukocytes of patients with Parkinson's disease | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Serum kynurenine and beta-alanine levels are associated with Wnt pathway gene expression in leukocytes of patients with Parkinson's disease Afsaneh Hajihassani, Alireza Nourazarian, Masoud Nikanfar, Delara Laghousi, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2676291/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Parkinson's disease (PD) is the second most common neurodegenerative disease in the world. Despite its worldwide prevalence, there is currently no clear explanation of the mechanism of this disease. Moreover, the lack of reliable and accurate biomarkers makes the early detection of PD difficult. Therefore, we aimed to investigate serum beta-alanine and kynurenine levels and the expression of Wnt pathway genes in leukocytes from patients with PD. Methods: Ninety patients (45 with PD and 45 healthy individuals) were enrolled in this study. 10 mL of blood samples were taken from all participants. The serum levels of beta-alanine and kynurenine were measured using ELISA, and the expression of Wnt pathway genes in leukocytes was determined using real-time PCR. Results: Serum levels of kynurenine and beta-alanine were higher in patients with PD than in the control group. Data analysis also showed that the expression of some genes of the Wnt signaling pathway in leukocytes was decreased. Conclusions: A correlation was observed between serum beta-alanine and kynurenine levels and the expression of the Wnt pathway gene in leukocytes in patients with PD. Therefore, these biomarkers can be used for early detection, monitoring, and treatment of patients with PD. kynurenine beta-alanine Parkinson's disease Wnt Signaling pathway Figures Figure 1 Figure 2 Introduction Parkinson's disease (PD) is the second most common neurodegenerative disease after Alzheimer's disease (AD) [1]. Currently, more than six million people have Parkinson's disease. By 2040, this number is expected to double to twelve million. In PD, there is a progressive loss of neurons in the substantia nigra pars compacta (SNPC). These neurons release dopamine naturally as a neurotransmitter. In the brain, dopamine release decreases as the disease gradually destroys neurons. The symptoms of this disease are caused by abnormal brain activity [2]. Low dopamine production in patients with PD leads to movement and cognitive dysfunctions. The disease is diagnosed when 70–80% of dopaminergic cells are destroyed, as these symptoms can persist for a prolonged period [3] . Genetic and environmental factors can influence disease pathogenesis. Therefore, researchers have focused on identifying biomarkers for early detection and effective treatment [2]. However, it is difficult for patients with PD to obtain an early diagnosis and distinguish the disease from similar conditions. In addition, the early diagnosis of PD is difficult because of frequent diagnostic errors and the need for specific biomarkers. The evaluation of motor symptoms is an effective diagnostic tool. However, it cannot overcome barriers to early diagnosis because many patients with PD also have non-motor symptoms before they develop them. Therefore, these tests cannot be used for early diagnosis of PD. In contrast, other diagnostic tools, such as structural and functional imaging of body fluids and biochemical measurements, can be used to improve diagnosis and monitor disease progression. For example, an early diagnosis of PD can be made by measuring α-synuclein, a biomarker that forms Lewis bodies in the brain [3]. In addition, the biomarkers Aβ 1-42 and tau protein indicate the development of cognitive impairment and deterioration in patients with PD. Aβ-42 and T-42 levels decrease in PD, while tau levels increase [3, 4]. A two-year study in patients with PD found that tau levels were directly related to Syn, tau, p-tau, NFL, and Ykl-40 levels in the CSF [5]. In diseases associated with axonal degeneration, NFL levels increase in CNS fluid and blood [6]. Several biomarkers, including oligomeric synuclein, can be used to diagnose PD [4]. The amino acid tryptophan is required for protein synthesis. Tryptophan is also affected by several metabolic pathways, including the kynurenine (Kyn) pathway [7]. The discovery of a link between neurodegenerative diseases and the Kyn pathway has led to further research into this pathway. Trp is enzymatically converted to quinoline. Quinoline is one of the most potent metabolites of PD, as it increases the amount of Kyn in neurons. In addition, kyn increases the level of quinoline metabolites in neurons by converting them to other metabolites, such as kynurenic acid (quin), a toxic and neurotoxic compound. β-alanine is a non-standard amino acid that is not involved in protein synthesis [8] [9]. As an antioxidant, carnosine inactivates ROS in the brain and protects ceruloplasmin and superoxide dismutase from damage. In addition, the consumption of beta-alanine increases the concentration of carnosine in neurons promotes neurogenesis and improves memory [10]. Wnt signaling is conserved and begins with a lipid-modified glycoprotein. β-catenin is released from the intracellular complex when the Wnt molecule binds to its receptors on the cell surface [11]. β-catenin is released from the intracellular complex when the Wnt molecule binds to its receptors on the cell surface. This leads to phosphorylation reactions inside the cell and allows it to migrate to the nucleus, thereby affecting its expression by binding to TCF/elf. This signaling pathway is activated by a protein called parkin. Parkin, a ubiquitin ligase, degrades β-catenin and prevents its accumulation, keeping the Wnt signaling pathway inactive. However, β-catenin accumulates in cells and activates the Wnt signaling pathway. Parkin protects dopaminergic neurons by preventing β-catenin accumulation and excessive activation of the Wnt pathway. The LRRK2 protein is also involved in the Wnt signaling pathway, and mutations in this protein are associated with PD. NURR1 is a β-catenin-binding factor. Inhibition of α-syn gene transcription prevents the accumulation of α-syn protein and the formation of the corpus luteum [12]. Studies on the Wnt pathway have shown that Wnt/β-catenin damages neurogenic areas and rejuvenates and repairs the elderly and adults with PD. Another study examined the Wnt/β-catenin signaling pathway and novel methods to explore this pathway for the treatment of neurodegenerative diseases [13]. As there are no reliable biomarkers for the early diagnosis of PD, it is crucial to explore new biomarkers with high sensitivity and properties. Furthermore, this will enable the early detection and evaluation of potential treatments. This study aimed to investigate the relationship between serum kynurenine and β-alanine levels and Wnt pathway gene expression in leukocytes. Materials And Methods Study population This case-control study was conducted in 2022. The participants were divided into two groups: control and case. Each group consisted of 45 individuals. Based on clinical examination and magnetic resonance imaging (MRI) results, the case group consisted of participants aged 60–75 years without neurological disease. Written informed consent was obtained from all participants in the study. Ethics statement The Ethics Committee of Tabriz University of Medical Sciences approved this study under ethical code IRTBZMED.REC.1401.537. In addition, both patients and their relatives supported this study. Sampling Ten milliliters of blood were drawn from all subjects. Sera were separated by centrifugation at 3000 rpm for 15 min at room temperature. The samples were stored at -70°C for biochemical analysis. Furthermore, 2.5 ml of blood in complete blood count (CBC) vials were used to determine gene expression. Measurement of beta-alanine and kynurenine ELISA kits were used to measure serum beta-alanine and L-kynurenine levels (My BioSource, USA: cat. MBS727570 and MBS495082, respectively). The OD curves of alanine and L-kynurenine were compared with the standard curve at 450 nm. RNA extraction and cDNA synthesis The expression of genes involved in the Wnt pathway was examined by real-time PCR. RNA was extracted from leukocytes in blood samples using chloroform (Roche, Company, Germany). The primer sequences used for cDNA preparation are listed in Table 1. Table 1. Sequence of primers Sequence Gene F: TCGCCATCAAGAAGGTTCTCC R: ACACTGTCTCGGGCACATATT GSK3A F: GGAACTCCAACAAGGGAGCA R: TTCGGGGTCGGAAGACCTTA GSK3B F: TTGTTGCTTTATGCAAACAGACG R: CGTTTAATGGCTTCTTCGCTGAC LRP6 Real-Time PCR The RNA content was determined using the Nanodrop (NanoDrop-ND1000) instrument at 260 and 280 nm wavelengths after the RNA was extracted from the samples according to the manufacturer's instructions. The samples were subjected to denaturing RNA electrophoresis on agarose gels to visualise 18S and 28S rRNAs and evaluate their integrity. The 18S and 28S rRNAs genes remained intact in isolated RNA samples. A small amount of RNA (1000 ng) was used for further reverse transcription using oligo (dT) primers (Takara) and the Prime Script RT reagent kit (Takara; cat. No. RR037A). Target gene expression was evaluated using an iQ5 real-time PCR system (Bio-Rad, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (a housekeeping gene) was used to normalize CT levels of the target genes, and correlative expression was determined for both groups. Statistical analysis Frequency and percentage were used to express qualitative data, while mean and standard deviation were used to express quantitative data. The Kolmogorov-Smirnov test was used to determine whether the quantitative data were normal. The Mann-Whitney U test was used to compare qualitative variables of sex, smoking, alcohol consumption, and diabetes between the case and control groups using the chi-square test. The quantitative variables of age and body mass index were also compared using the chi-square test. The association between serum kynurenine and beta-alanine levels and leukocyte expression of genes from the Wnt pathway in PD was examined using multivariate logistic regression tests. The Spearman test was used to evaluate the association between serum kynurenine and beta-alanine and leukocyte expression of Wnt pathway genes in patients with PD and controls. Statistical analyses were performed with SPSS version 21. Graphs were generated using GraphPad Prism version 8 software. Statistical significance was defined as a p-value < 0.05. Results Demographic characteristics of the study population The demographic characteristics are shown in Table 2. A total of 90 participants (45 in the control and case groups) were included. There were equal numbers of men and women in both groups. The mean age of the participants was 61.5 ± 2.2 years in the case group and 59 ± 3.7 years in the control group. There was a significant age difference between the case and control groups (P = 0.001). Statistically significant differences were also observed in the use of tobacco, alcohol, and diabetes between the two groups (p < 0.05). The median age of the patients in the case group was 59.8 years (range:57-64 years). The case group had a median PD of one year (minimum, one year; maximum, seven years). Table 2. Demographic and disease-related characteristics of the study population Variable Control, N (%) (n=45) Case, N ( %) (n=45) P-value Gender Male Female 28 (62.2%) 17(37.8 %) 28 (62.2%) 17(37.8 %) 1.00 * Age Median (IQR) *** 59 (57-61.5) 61 (60-63) 0.002 ** Alcohol use Yes No 0 (0%) 45 (100%) 6 (13.3%) 39 (86.7 %) 0.011 * Diabetic disease history Yes No 0 (0%) 45 (100%) 12 (26.7%) 33 (73.3 %) <0.0001 * * Chi-square test was used. ** Mann-Whitney U test was used. ***IQR: Interquartile range=(Q 25% -Q 75 % ) Evaluation of serum levels of biochemical factors and Wnt pathway genes We examined the serum levels of kynurenine and beta-alanine and the leukocyte expression of Wnt pathway genes in patients with PD and the control group. We found that the serum kynurenine levels were higher in patients with PD than in the control group. However, serum beta-alanine levels and expression of LRP6, GSK3A, and GSK3B were significantly lower than those in the control group (Table 3 and Figure 1). Table 3. The mean concentrations of kynurenine and beta-alanine and the expression of Wnt pathway genes in the case and control groups Variables Case Control Mean d ifference ( SE) P-value * Mean SD Mean SD Kynurenine(ng/mL) 778.27 55.31 539.82 93.08 -238.44 (16.14) <0.001 beta-alanine (ng/mL) 10.58 1.05 14.16 1.15 -238.44 (16.14) <0.001 LRP6 gene expression (ΔΔCT) 3.2622 0.41873 4.0164 0.43560 0.75 (0.09) <0.001 GSK3A gene expression (ΔΔCT) 8.0893 0.31352 9.6989 0.62187 1.61 (0.10) <0.001 GSK3B gene expression (ΔΔCT) 4.0018 0.46409 5.3378 0.63619 1.34 (0.12) <0.001 Association between kynurenine and beta-alanine levels and leukocyte expression of Wnt pathway genes in PD Patients in the PD and control groups had statistically significant differences in serum levels of kynurenine and beta-alanine and leukocyte expression of Wnt pathway genes (P < 0.05). There was also a statistically significant difference in serum beta-alanine levels and expression of LRP6, GSK3A, and GSK3B genes compared to the control group (Table 4). Table 4: Relationship between kynurenine and beta-alanine and the expression of LRP6, GSK3A, and GSK3B genes between control and case groups Variables Unadjusted Adjusted * B S.E. Exp(B) P-value ** B S.E. Exp(B) P-value *** Kynurenine(ng/mL) 0.035 0.008 1.036 <0.001 0.050 0.019 1.051 0.008 Beta-Alanine (ng/mL) -2.697 0.723 0.067 <0.001 -3.695 1.577 0.025 0.019 LRP6 gene expression (ΔΔCT) -3.355 0.620 0.035 <0.001 -3.859 0.843 0.021 <0.001 GSK3A gene expression (ΔΔCT) -7.249 1.935 0.001 <0.001 -6.773 2.125 0.001 0.001 GSK3B gene expression (ΔΔCT) -4.582 0.935 0.010 <0.001 -4.856 1.252 0.008 <0.001 *P-value adjusted for age, diabetes, alcohol and cigarette use, and BMI. ** Uni-variate logistic regression was used. *** Multivariate logistic regression was used. Correlation between serum levels of kynurenine and beta-alanine and leukocyte expression of Wnt signaling pathway genes There was a statistically weak and significant correlation between serum levels of kynurenine and beta-alanine and leukocyte expression of Wnt signaling genes in patients with PD (Table 5 and Figure 2). Table 5. Correlation between the expression levels of LRP6, GSK3A, and GSKSB genes and blood concentrations of kynurenine and beta-alanine in patients with PD. Kynurenine beta-Alanine LRP6 gene expression GSK3A gene expression GSK3B gene expression Parkinson's disease Kynurenine r 1.000 -0.148 -0.010 -0.082 -0.104 P-value . 0.330 0.948 0.593 0.497 beta-alanine r -0.148 1.000 -0.019 0.102 -0.032 P-value 0.330 . 0.900 0.503 0.836 LRP6 gene expression r -0.010 -0.019 1.000 -0.068 0.126 P-value 0.948 0.900 . 0.656 0.411 GSK3A gene expression r -0.082 0.102 -0.068 1.000 0.024 P-value 0.593 0.503 0.656 . 0.875 GSK3B gene expression r -0.104 -0.032 0.126 0.024 1.000 P-value 0.497 0.836 0.411 0.875 . ** Spearman's rho test was used. Discussion This study investigated the relationship between serum levels of kynurenine and beta-alanine and the leukocyte expression of Wnt pathway genes. The results of this study show that the relationship between these variables remains significant even after considering confounding factors such as age, diabetes, smoking, alcohol consumption, and body mass index, as well as the correlation between serum levels of kynurenine and beta-alanine and leukocyte activity. However, a weak and statistically insignificant association was found between the Wnt signaling pathway and PD [ 11 ]. Serum levels of kynurenine, a tryptophan metabolite, are higher in individuals with Parkinson's disease than in controls or healthy individuals. In addition, CSF levels of hydroxykynurenine and kynurenine were significantly higher in patients with PD than in healthy control subjects. [ 14 ]. Another study examined whether metabolites of tryptophan, kynurenine, and other compounds were present in the plasma of patients with Parkinson's and Huntington's diseases. A decrease in kynurenic acid levels, a reduction in the ratio of kynurenic acid to kynurenine (KA/Kyn), and a decrease in the amount of quinolinic acid were observed. Furthermore, the patients had a higher QA/KA ratio than Huntington's patients and the control group. The kynurenic acid concentration and the ratios KA /KYN, quinoline concentration, and QA/KA showed significant changes in patients with advanced PD compared to early-stage patients [ 15 ]. The activity of immune cells in inflammatory processes has been shown to increase the production of interferon-gamma, which is responsible for stimulating indole-2 and 3-dioxygenases through its action on enzymes of the kynurenine pathway. In the kynurenine pathway, tryptophan degradation increases significantly, resulting in a decrease in tryptophan levels and an increase in serum kynurenine levels in patients with PD [ 16 ]. A study of blood and CSF samples from patients with AD and PD showed elevated levels of kynurenine pathway metabolites. Alterations in age- and disease-related kynurenine metabolism are associated with decreased neurogenesis and increased excitotoxicity in neurodegenerative diseases. Serum kynurenic acid levels were measured in patients with psychosis. Previous studies have shown that kynurenic acid levels and KA/QA ratio decrease in patients with acute depression 18. According to another study, kynurenic acid, a metabolite of the kynurenine pathway, is more abundant in the brain and blood of older mice. Tryptophan metabolites such as KA may explain the functional differences in the brains of newborn and old mice [ 17 ] . In contrast, the liver and kidney tissues showed no change in KA concentration. Another study examined the concentration of metabolites in the kynurenine pathway in the plasma and CSF. This study showed that the concentrations of neurotoxic compounds such as 3-hydroxykynurenine and quinolic acid increased significantly in the plasma of patients with PD. This shows that there may be a relationship between the severity of the symptoms of this disease and, in addition, the concentration of kynurenic acid, a neuron-protective compound, decreased in the CSF of patients with PD [ 17 ]. According to the results, there is a relationship between the kynurenine pathway and PD. Thus, more tryptophan enters the kynurenine pathway in PD, and changes occur in the metabolites of the kynurenine pathway. Tryptophan is first converted to kynurenine and kynurenic acid through the kynurenine pathway. This increase in kynurenine inhibits the enzymes involved in the dopamine synthesis pathway and prevents dopamine synthesis. However, the conversion of kynurenine to other toxic compounds, such as 3-hydroxykynurenine and quinolinic acid, further increased the levels of these compounds. Toxic compounds generate free radicals that cause oxidative stress and the accumulation of α-synuclein, leading to apoptosis and neuronal death [ 2 ]. Beta-alanine, a non-essential amino acid in the body, synthesizes carnosine and homocarnosine. Measuring beta-alanine in the serum of patients with PD and healthy subjects showed that the amount of beta-alanine in the serum of patients with PD decreased. Therefore, we investigated the short-term effects of beta-alanine intake on the activity and quality of life of PD patients. Four weeks after administering the recommended doses, no changes or improvements in physical activity or quality of life were observed in the patients with PD 20. This study investigated the effects of taurine and beta-alanine ingestion on the behavioral and neurochemical parameters of rats and their brain metabolites. The results showed that the intake of beta-alanine supplements reduced the concentration of 5-hydroxy groups compared with that of rats in the other groups. The hypothalamus produces indoleacetic acid (5-HIAA), a serotonin metabolite. In addition, the concentrations of carnosine in the cerebral cortex and hypothalamus are similar to those of neurotrophic factors in the brain. Beta-alanine supplementation also had an effect. Additionally, it can be used as an anxiolytic agent [ 18 ]. In an experiment in rats to study the effects of long-term beta-alanine intake, it was found that long-term and chronic beta-alanine intake could increase oxidative stress and alter energy metabolism in the cerebral cortex and cerebellum. If an increase in beta-alanine leads to an increase in reactive oxygen species in the brain, ROS can also have an inhibitory effect on antioxidant enzymes and the activity of these enzymes. Long-term and regular intake of beta-alanine was concluded to cause damage from oxidative stress and changes in energy metabolism that may lead to diseases such as AD because the concentration of beta-alanine is high in this disease [ 19 ]. Another study examined the effects of a 14-day (short-term) intake of 12 g of beta-alanine per day on cognitive function, mood, and brain-derived neurotrophic factor (BDNF) blood flow in healthy men with limited oxidative stress and inflammation before simulating a 24-hour military deployment. No changes in cognitive function or BDNF levels were observed, although the consumption of β-alanine reduced feelings of depression [ 20 ]. Carnosine, a product of the β-alanine compound, was investigated in a study of the effects of carnosine alone and vitamin E on oxidative status and antioxidant activity in rats. Rats were given vitamin E and carnosine for 15 weeks. The results showed that 1000 mg/kg carnosine had no antioxidant effect [ 21 ]. In another study, carnosine and similar compounds protected neurons from reactive oxygen species when added to a neuronal suspension [ 22 ]. Another study examined the effect of carnosine with L- DOPA as a primary treatment for PD. This showed that individuals who used carnosine with L-DOPA in their treatment had positive effects on PD compared with those who used L-DOPA alone. They improve neurological symptoms and decrease carbonylation of blood plasma proteins and lipid hydroperoxides, among other effects. The combination of carnosine and essential therapies could have a beneficial effect on the treatment of PD [ 23 ]. According to the results of the study, the concentration of β-alanine in the serum of the patients decreased, and according to the reviewed studies, it can be said that there is a relationship between PD and the concentration of β-alanine in the serum and brain. Therefore, the use of beta-alanine for the treatment of PD may lead to positive results. Although long-term and short-term use of this supplement may or may not have different effects on this disease, a notable finding is the correlation and effect of beta-alanine on this disease. The recommended mechanism of action of beta-alanine is that, when it enters the body, it forms carnosine and hemocarnosine in conjunction with other compounds with antioxidant activity. These react with superoxide free radicals and decrease active oxygen species, which are protected by antioxidant enzymes, such as ceruloplasmin and superoxide dismutase. Therefore, they act as protective agents against oxidative damage and protect neurons from neurotropic diseases [ 10 ]. The third and final variable studied in patients with PD was the leukocyte expression of the Wnt pathway by real-time PCR. A study of this pathway showed that the expression of genes from the Wnt pathway, namely, LRP6, GSK3α, and GSK3B, decreased in patients with PD. Additionally, a study in mice investigating the catenin/β protein, which is the main component of the Wnt signaling pathway, showed that inactivation of the pathway and β-catenin in shh-cre mice resulted in decreased neurogenetics and impaired migration and detachment of dopaminergic neurons. However, inactivation of Wnt and β-catenin signaling pathways in Th-Ires-Cre mice impaired several neural progenitor cells without altering the integrity and structure of the neural network. This study demonstrated the role of β-catenin in neurogenesis and the efficacy of stem cell replacement therapy in patients with PD [ 24 ]. A recent study that examined the effects of the β-catenin-dependent Wnt pathway on midbrain dopaminergic neurons found that in patients with PD, with increased expression of NGOB1 causing a decrease in the expression of RSPO2, RSPO2 activates the Wnt pathway. The activity of this pathway decreases with increased expression of NROB1. In vitro, decreased activity of the Wnt pathway due to increased expression of the transcriptional repressor NROB1 affects the nature of dopaminergic neurons. This suggests that regulation of Wnt signaling may be effective in some genetic forms of PD [ 25 ]. Another study showed that neurogenesis in the hippocampal region of the brain decreases with age and environmental changes in neurons due to regulation of the Wnt signaling pathway. Proper regulation of this pathway may play a role in neurogenesis in adulthood [ 26 ]. Another study examined the role of the parkin protein in Wnt signaling in PD. Parkin has ubiquitin ligase activity and acts on β-catenin, the main protein in the Wnt signaling pathway. It degrades catenin and affects its levels in vivo. The deficiency of the parkin protein leads to the accumulation of β-catenin in neurons and increases the activation of the Wnt signaling pathway. These factors may lead to neuronal death. The Parkin protein has been found to protect dopaminergic neurons through Wnt signaling and prevent activation of the Wnt/β-catenin pathway [ 23 ]. A study in SAMP8 mice showed an association between down-regulation of Wnt/canonical signaling and loss of neurons in the hippocampal region of SAMP8 mice. Regulated Wnt signaling can protect neurons from age-related cognitive decline and AD [ 27 ]. In another study, Drosophila flies were used as the study model, and rotenone toxin was used to create conditions for PD. In this experiment, the activity of the EGFR MAPK and TGFβ pathways increased, while the activity of the Wnt pathway decreased in cells. This demonstrated the effect of the Wnt pathway on the production of dopaminergic neurons in PD [ 28 ]. This study also examined the LRRK2 protein and its effects on PD. Therefore, LRRK2 is an influential protein in the Wnt signaling pathway because it binds to the DVL protein, a molecule in this pathway. Therefore, it causes changes in the Wnt signaling pathway and affects PD [ 29 ]. Furthermore, a study using ESCs lacking wnt1 and LRP6 molecules to examine the effects of the Wnt pathway on the expansion of dopaminergic neurons showed that reducing the pathway had a positive effect on the differentiation of neurons and dopaminergic neurons in ESC mice. Wnt1 or LRP6 is no longer required to differentiate dopaminergic neurons in vitro [ 30 ]. In this study, investigating the significant role of the catenin-β/wnt pathway in dopaminergic neuron precursors and examining the effects of age on the Wnt pathway, it is shown that age is a factor that affects the neurogenesis potential of mNPC brain cells and that aging affects the pathway. Additionally, it has an inhibitory effect. β-catenin activation with a specific GSK3β antagonist significantly improved the neuroregeneration of dopaminergic neurons, which is essential for neurodegenerative approaches in PD [ 30 ]. In addition, it has an inhibitory effect. Activation of β-catenin with a specific GSK3β antagonist significantly improves neuroregeneration of dopaminergic neurons, which is important for neurodegenerative approaches in PD [ 31 ]. According to the results of our study, a decrease in leukocyte expression of Wnt pathway genes was observed. Previous studies have shown an association between the Wnt signaling pathway and neurodegenerative diseases such as Parkinson's and AD. Genetic abnormalities in pathway proteins and molecules can lead to changes in the expression of pathway genes that affect various cellular processes, such as neurogenesis, neuron repair, and neuron migration, causing disorders. However, there is a relationship between the Wnt signaling pathway and PD. Wnt begins with the binding of the Wnt molecule to its membrane receptor and a series of intracellular phosphorylation reactions that result in β-catenin detaching from the intracellular complex and entering the nucleus where it transcribes genes. Changes in gene expression and mutations in proteins involved in this pathway contribute to the disruption of the pathway and expression of its genes, which are associated with PD [ 12 ]. Conclusion Based on earlier studies and the results of the present study showing a decrease in leukocyte expression of Wnt pathway genes, we concluded that there is an association between the Wnt pathway and neurodegenerative diseases, such as PD and AD. Furthermore, genetic abnormalities in proteins, as well as in molecules in the pathway, lead to changes in the expression of genes in the pathway and affect and cause disorders in various cellular processes such as neurogenesis, neuron repair, and neuron migration. Therefore, we propose the use of a large sample and measurement of other parameters so that, if the results of this study are confirmed, the measurement of kynurenine and beta-alanine and the expression of genes of the Wnt signaling pathway in leukocytes can be used for the early diagnosis, treatment, and follow-up of the disease. Declarations Acknowledgments We gratefully acknowledge the kind support of the Neuroscience Research Center of the Tabriz University of Medical Sciences. Author's contributions AN and FK participated in the study design, and AH and AN performed the practical work. DL contributed to the data analysis and interpretation. MN and AN contributed to the revision of the manuscript. AH wrote the manuscript. FK provided consent for the last version of this manuscript. Sources of Funding This work was supported by grants from the Vice Chancellor for Research, Tabriz University of Medical Sciences, Tabriz, IRAN grant no. IRTBZMED.REC.1401.537. Availability of data and materials the data and materials used in this study are available. Compliance with ethical standards Conflict of interest The authors declare that there are no conflicts of interest Ethical approval The Ethics Committee of the Tabriz University of Medical Sciences approved the study protocol in accordance with the Declaration of Helsinki. Informed consent was obtained from all the patients in this study The Ethics Committee of the Tabriz University of Medical Sciences approved the study protocol, which was conducted in accordance with the Declaration of Helsinki of the World Medical Association. Consent for publication: Not applicable. References De Virgilio A, Greco A, Fabbrini G, Inghilleri M, Rizzo MI, Gallo A, Conte M, Rosato C, Ciniglio Appiani M and de Vincentiis M (2016) Parkinson's disease: Autoimmunity and neuroinflammation. Autoimmun Rev 15:1005-11. doi: 10.1016/j.autrev.2016.07.022 Cabreira V and Massano J (2019) [Parkinson's Disease: Clinical Review and Update]. Acta Med Port 32:661-670. doi: 10.20344/amp.11978 Maass F, Schulz I, Lingor P, Mollenhauer B and Bähr M (2019) Cerebrospinal fluid biomarker for Parkinson's disease: An overview. Mol Cell Neurosci 97:60-66. doi: 10.1016/j.mcn.2018.12.005 Kwon EH, Tennagels S, Gold R, Gerwert K, Beyer L and Tönges L (2022) Update on CSF Biomarkers in Parkinson's Disease. Biomolecules 12. doi: 10.3390/biom12020329 Hall S, Surova Y, Öhrfelt A, Blennow K, Zetterberg H and Hansson O (2016) Longitudinal Measurements of Cerebrospinal Fluid Biomarkers in Parkinson's Disease. Mov Disord 31:898-905. doi: 10.1002/mds.26578 Gaetani L, Blennow K, Calabresi P, Di Filippo M, Parnetti L and Zetterberg H (2019) Neurofilament light chain as a biomarker in neurological disorders. J Neurol Neurosurg Psychiatry 90:870-881. doi: 10.1136/jnnp-2018-320106 Chen L-M, Bao C-H, Wu Y, Liang S-H, Wang D, Wu L-Y, Huang Y, Liu H-R and Wu H-G (2021) Tryptophan-kynurenine metabolism: a link between the gut and brain for depression in inflammatory bowel disease. Journal of Neuroinflammation 18:135. doi: 10.1186/s12974-021-02175-2 Behl T, Kaur I, Sehgal A, Singh S, Bhatia S, Al-Harrasi A, Zengin G, Bumbu AG, Andronie-Cioara FL, Nechifor AC, Gitea D, Bungau AF, Toma MM and Bungau SG (2021) The Footprint of Kynurenine Pathway in Neurodegeneration: Janus-Faced Role in Parkinson's Disorder and Therapeutic Implications. Int J Mol Sci 22. doi: 10.3390/ijms22136737 Perim P, Marticorena FM, Ribeiro F, Barreto G, Gobbi N, Kerksick C, Dolan E and Saunders B (2019) Can the Skeletal Muscle Carnosine Response to Beta-Alanine Supplementation Be Optimized? Front Nutr 6:135. doi: 10.3389/fnut.2019.00135 Fu H, Katsumura Y, Lin M, Muroya Y, Hata K, Fujii K, Yokoya A and Hatano Y (2009) Free radical scavenging and radioprotective effects of carnosine and anserine. Radiation Physics and Chemistry 78:1192-1197. doi: https://doi.org/10.1016/j.radphyschem.2009.07.023 Arenas E (2014) Wnt signaling in midbrain dopaminergic neuron development and regenerative medicine for Parkinson's disease. J Mol Cell Biol 6:42-53. doi: 10.1093/jmcb/mju001 Berwick DC and Harvey K (2012) The importance of Wnt signalling for neurodegeneration in Parkinson's disease. Biochem Soc Trans 40:1123-8. doi: 10.1042/bst20120122 Serafino A, Giovannini D, Rossi S and Cozzolino M (2020) Targeting the Wnt/β-catenin pathway in neurodegenerative diseases: recent approaches and current challenges. Expert Opin Drug Discov 15:803-822. doi: 10.1080/17460441.2020.1746266 Iwaoka K, Otsuka C, Maeda T, Yamahara K, Kato K, Takahashi K, Takahashi K and Terayama Y (2020) Impaired metabolism of kynurenine and its metabolites in CSF of parkinson's disease. Neurosci Lett 714:134576. doi: 10.1016/j.neulet.2019.134576 Chang KH, Cheng ML, Tang HY, Huang CY, Wu YR and Chen CM (2018) Alternations of Metabolic Profile and Kynurenine Metabolism in the Plasma of Parkinson's Disease. Mol Neurobiol 55:6319-6328. doi: 10.1007/s12035-017-0845-3 Widner B, Leblhuber F and Fuchs D (2002) Increased neopterin production and tryptophan degradation in advanced Parkinson's disease. J Neural Transm (Vienna) 109:181-9. doi: 10.1007/s007020200014 Heilman PL, Wang EW, Lewis MM, Krzyzanowski S, Capan CD, Burmeister AR, Du G, Escobar Galvis ML, Brundin P, Huang X and Brundin L (2020) Tryptophan Metabolites Are Associated With Symptoms and Nigral Pathology in Parkinson's Disease. Mov Disord 35:2028-2037. doi: 10.1002/mds.28202 Murakami T and Furuse M (2010) The impact of taurine- and beta-alanine-supplemented diets on behavioral and neurochemical parameters in mice: antidepressant versus anxiolytic-like effects. Amino Acids 39:427-34. doi: 10.1007/s00726-009-0458-x Gemelli T, de Andrade RB, Rojas DB, Zanatta Â, Schirmbeck GH, Funchal C, Wajner M, Dutra-Filho CS and Wannmacher CMD (2018) Chronic Exposure to β-Alanine Generates Oxidative Stress and Alters Energy Metabolism in Cerebral Cortex and Cerebellum of Wistar Rats. Mol Neurobiol 55:5101-5110. doi: 10.1007/s12035-017-0711-3 Varanoske AN, Wells AJ, Boffey D, Harat I, Frosti CL, Kozlowski GJ, Gepner Y and Hoffman JR (2021) Effects of High-Dose, Short-Duration β-Alanine Supplementation on Cognitive Function, Mood, and Circulating Brain-Derived Neurotropic Factor (BDNF) in Recreationally-Active Males Before Simulated Military Operational Stress. J Diet Suppl 18:147-168. doi: 10.1080/19390211.2020.1733730 Ibrahim W, Tatumi V, Yeh CC, Hong CB and Chow CK (2008) Effects of dietary carnosine and vitamin E on antioxidant and oxidative status of rats. Int J Vitam Nutr Res 78:230-7. doi: 10.1024/0300-9831.78.45.230 Boldyrev A, Bulygina E, Leinsoo T, Petrushanko I, Tsubone S and Abe H (2004) Protection of neuronal cells against reactive oxygen species by carnosine and related compounds. Comp Biochem Physiol B Biochem Mol Biol 137:81-8. doi: 10.1016/j.cbpc.2003.10.008 Rawal N, Corti O, Sacchetti P, Ardilla-Osorio H, Sehat B, Brice A and Arenas E (2009) Parkin protects dopaminergic neurons from excessive Wnt/beta-catenin signaling. Biochem Biophys Res Commun 388:473-8. doi: 10.1016/j.bbrc.2009.07.014 Tang M, Miyamoto Y and Huang EJ (2009) Multiple roles of beta-catenin in controlling the neurogenic niche for midbrain dopamine neurons. Development 136:2027-38. doi: 10.1242/dev.034330 Haynes JM, Sibuea SM, Aguiar AA, Li F, Ho JK and Pouton CW (2021) Inhibition of β-catenin dependent WNT signalling upregulates the transcriptional repressor NR0B1 and downregulates markers of an A9 phenotype in human embryonic stem cell-derived dopaminergic neurons: Implications for Parkinson's disease. PLoS One 16:e0261730. doi: 10.1371/journal.pone.0261730 Miranda CJ, Braun L, Jiang Y, Hester ME, Zhang L, Riolo M, Wang H, Rao M, Altura RA and Kaspar BK (2012) Aging brain microenvironment decreases hippocampal neurogenesis through Wnt-mediated survivin signaling. Aging Cell 11:542-52. doi: 10.1111/j.1474-9726.2012.00816.x Bayod S, Felice P, Andrés P, Rosa P, Camins A, Pallàs M and Canudas AM (2015) Downregulation of canonical Wnt signaling in hippocampus of SAMP8 mice. Neurobiol Aging 36:720-9. doi: 10.1016/j.neurobiolaging.2014.09.017 Stephano F, Nolte S, Hoffmann J, El-Kholy S, von Frieling J, Bruchhaus I, Fink C and Roeder T (2018) Impaired Wnt signaling in dopamine containing neurons is associated with pathogenesis in a rotenone triggered Drosophila Parkinson's disease model. Sci Rep 8:2372. doi: 10.1038/s41598-018-20836-w Sancho RM, Law BM and Harvey K (2009) Mutations in the LRRK2 Roc-COR tandem domain link Parkinson's disease to Wnt signalling pathways. Hum Mol Genet 18:3955-68. doi: 10.1093/hmg/ddp337 Cajánek L, Ribeiro D, Liste I, Parish CL, Bryja V and Arenas E (2009) Wnt/beta-catenin signaling blockade promotes neuronal induction and dopaminergic differentiation in embryonic stem cells. Stem Cells 27:2917-27. doi: 10.1002/stem.210 L'Episcopo F, Tirolo C, Testa N, Caniglia S, Morale MC, Serapide MF, Pluchino S and Marchetti B (2014) Wnt/β-catenin signaling is required to rescue midbrain dopaminergic progenitors and promote neurorepair in ageing mouse model of Parkinson's disease. Stem Cells 32:2147-63. doi: 10.1002/stem.1708 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2676291","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":182473641,"identity":"07ea8717-63b9-47d0-b21b-90848aefb22f","order_by":0,"name":"Afsaneh Hajihassani","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Afsaneh","middleName":"","lastName":"Hajihassani","suffix":""},{"id":182473644,"identity":"08677393-d585-4813-9ad9-b7ecf0602ffc","order_by":1,"name":"Alireza Nourazarian","email":"","orcid":"","institution":"Khoy University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Alireza","middleName":"","lastName":"Nourazarian","suffix":""},{"id":182473648,"identity":"876e5271-aec2-4852-80b4-ef816fb6779f","order_by":2,"name":"Masoud Nikanfar","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Masoud","middleName":"","lastName":"Nikanfar","suffix":""},{"id":182473651,"identity":"f8a3b700-025e-4188-86c4-3263bf099857","order_by":3,"name":"Delara Laghousi","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Delara","middleName":"","lastName":"Laghousi","suffix":""},{"id":182473653,"identity":"3492f260-4156-4f1e-8261-560772e780e1","order_by":4,"name":"Fatemeh Khaki-Khatibi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABJ0lEQVRIie3PsUrEMACA4dRAukS7tvQ4XyESOBFEX8VSOJd2cjm4Q3sU4qLuh/gO5+bYEKjLQdeCN5gr1MXhRBBBOEy7ibWcm0j+QEJCPkgA0On+YGZULwkhAAE+VjtkG+NHdfIjwQn8SmxFYrI2MSqiBrJbiZnxRT6Y010z9fjk7uB0y43ZEI/mXQtAucgbCPYhDWZlb++in/DbmW+jDmcPOC2pEyFKg+/kEPjIDZnYJ8lxxCWD6i+eIkh40wQjt4FgqzA/wpUi2VNFzmpyglctxPYRDCPRI3n1MCZqAjdZGymoG6SCkrw84hN277AOj52bK0GduPkv2PLkazASO9OsT18u2dDavj6Xy+c30bXMWBYNpLkNXM1w3etVxvtvbut0Ot1/7xP3YnNWbIdahAAAAABJRU5ErkJggg==","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Fatemeh","middleName":"","lastName":"Khaki-Khatibi","suffix":""}],"badges":[],"createdAt":"2023-03-10 05:44:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2676291/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2676291/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":34356724,"identity":"ca2c14ef-8a21-439c-8769-cfd8e4d9d747","added_by":"auto","created_at":"2023-03-16 14:13:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":783323,"visible":true,"origin":"","legend":"\u003cp\u003eMean concentrations of \u003cstrong\u003ekynurenine (A)\u003c/strong\u003e and beta-alanine (B) and expression levels of LRP6 (C), GSK3A (D) and GSK3B (E) between control and case groups\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-2676291/v1/3aaa1aa3d0896751293eeb58.png"},{"id":34356725,"identity":"e97755b1-9677-41a9-b82d-3e23741c9f34","added_by":"auto","created_at":"2023-03-16 14:13:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":285134,"visible":true,"origin":"","legend":"\u003cp\u003eCorrelation between LRP6, GSK3A, GSKSB expression and blood kynurenine and beta-alanine concentrations in patients with PD.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-2676291/v1/06ad7e6636a24a38e0bc8f29.png"},{"id":39019706,"identity":"cf6c75ba-207f-4d6c-8f4a-5a89ea642802","added_by":"auto","created_at":"2023-06-24 19:14:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":882874,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2676291/v1/4c743b5e-73a0-4748-a1d8-abfb7d7a741d.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Serum kynurenine and beta-alanine levels are associated with Wnt pathway gene expression in leukocytes of patients with Parkinson's disease","fulltext":[{"header":"Introduction","content":"\u003cp\u003e\u003cstrong\u003eParkinson\u0026apos;s disease (PD) is the second most common neurodegenerative disease after Alzheimer\u0026apos;s disease (AD)\u0026nbsp;\u003c/strong\u003e[1].\u0026nbsp;Currently, more than six million people have Parkinson\u0026apos;s disease. By 2040, this number is expected to double to twelve million. In PD, there is a progressive loss of neurons in the substantia nigra pars compacta (SNPC). These neurons release dopamine naturally as a neurotransmitter. In the brain, dopamine release decreases as the disease gradually destroys neurons. The symptoms of this disease are caused by abnormal brain activity\u0026nbsp;[2].\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eLow dopamine production in patients with PD leads to movement and cognitive dysfunctions. The disease is diagnosed when 70\u0026ndash;80% of dopaminergic cells are destroyed, as these symptoms can persist for a prolonged period\u0026nbsp;\u003c/em\u003e\u003cem\u003e[3]\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e Genetic and environmental factors can influence disease pathogenesis. Therefore, researchers have focused on identifying biomarkers for early detection and effective treatment\u0026nbsp;[2]. However, it is difficult for patients with PD to obtain an early diagnosis and distinguish the disease from similar conditions. In addition, the early diagnosis of PD is difficult because of frequent diagnostic errors and the need for specific biomarkers. The evaluation of motor symptoms is an effective diagnostic tool. However, it cannot overcome barriers to early diagnosis because many patients with PD also have non-motor symptoms before they develop them. Therefore, these tests cannot be used for early diagnosis of PD.\u003c/p\u003e\n\u003cp\u003eIn contrast, other diagnostic tools, such as structural and functional imaging of body fluids and biochemical measurements, can be used to improve diagnosis and monitor disease progression. For example, an early diagnosis of PD can be made by measuring \u0026alpha;-synuclein, a biomarker that forms Lewis bodies in the brain\u0026nbsp;[3].\u0026nbsp;In addition, the biomarkers A\u0026beta; 1-42 and tau protein indicate the development of cognitive impairment and deterioration in patients with PD. A\u0026beta;-42 and T-42 levels decrease in PD, while tau levels increase\u0026nbsp;[3, 4]. A two-year study in patients with PD found that tau levels were directly related to Syn, tau, p-tau, NFL, and Ykl-40 levels in the CSF\u0026nbsp;[5]. In diseases associated with axonal degeneration, NFL levels increase in CNS fluid and blood\u0026nbsp;[6]. Several biomarkers, including oligomeric synuclein, can be used to diagnose PD\u0026nbsp;[4].\u003c/p\u003e\n\u003cp\u003eThe amino acid tryptophan is required for protein synthesis. Tryptophan is also affected by several metabolic pathways, including the kynurenine (Kyn) pathway\u0026nbsp;[7]. The discovery of a link between neurodegenerative diseases and the Kyn pathway has led to further research into this pathway. Trp is enzymatically converted to quinoline. Quinoline is one of the most potent metabolites of PD, as it increases the amount of Kyn in neurons. In addition, kyn increases the level of quinoline metabolites in neurons by converting them to other metabolites, such as kynurenic acid (quin), a toxic and neurotoxic compound. \u0026beta;-alanine is a non-standard amino acid that is not involved in protein synthesis\u0026nbsp;[8]\u0026nbsp;[9].\u003c/p\u003e\n\u003cp\u003eAs an antioxidant, carnosine inactivates ROS in the brain and protects ceruloplasmin and superoxide dismutase from damage. In addition, the consumption of beta-alanine increases the concentration of carnosine in neurons promotes neurogenesis and improves memory\u0026nbsp;[10].\u0026nbsp;Wnt signaling is conserved and begins with a lipid-modified glycoprotein. \u0026beta;-catenin is released from the intracellular complex when the Wnt molecule binds to its receptors on the cell surface\u0026nbsp;[11].\u0026nbsp;\u0026beta;-catenin is released from the intracellular complex when the Wnt molecule binds to its receptors on the cell surface. This leads to phosphorylation reactions inside the cell and allows it to migrate to the nucleus, thereby affecting its expression by binding to TCF/elf. This signaling pathway is activated by a protein called parkin. Parkin, a ubiquitin ligase, degrades \u0026beta;-catenin and prevents its accumulation, keeping the Wnt signaling pathway inactive.\u003c/p\u003e\n\u003cp\u003eHowever, \u0026beta;-catenin accumulates in cells and activates the Wnt signaling pathway. Parkin protects dopaminergic neurons by preventing \u0026beta;-catenin accumulation and excessive activation of the Wnt pathway. The LRRK2 protein is also involved in the Wnt signaling pathway, and mutations in this protein are associated with PD. NURR1 is a \u0026beta;-catenin-binding factor. Inhibition of \u0026alpha;-syn gene transcription prevents the accumulation of \u0026alpha;-syn protein and the formation of the corpus luteum\u0026nbsp;[12].\u0026nbsp;Studies on the Wnt pathway have shown that Wnt/\u0026beta;-catenin damages neurogenic areas and rejuvenates and repairs the elderly and adults with PD. Another study examined the Wnt/\u0026beta;-catenin signaling pathway and novel methods to explore this pathway for the treatment of neurodegenerative diseases\u0026nbsp;[13].\u003c/p\u003e\n\u003cp\u003eAs there are no reliable biomarkers for the early diagnosis of PD, it is crucial to explore new biomarkers with high sensitivity and properties. Furthermore, this will enable the early detection and evaluation of potential treatments. This study aimed to investigate the relationship between serum kynurenine and \u0026beta;-alanine levels and Wnt pathway gene expression in leukocytes.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003eStudy population\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis case-control study was conducted in 2022. The participants were divided into two groups: control and case. Each group consisted of 45 individuals. Based on clinical examination and magnetic resonance imaging (MRI) results, the case group consisted of participants aged 60\u0026ndash;75 years without neurological disease. Written informed consent was obtained from all participants in the study.\u003c/p\u003e\n\u003cp dir=\"RTL\" style=\"text-align: left;\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eEthics statement\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Ethics Committee of Tabriz University of Medical Sciences approved this study under ethical code IRTBZMED.REC.1401.537. In addition, both patients and their relatives supported this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSampling\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTen milliliters of blood were drawn from all subjects. Sera were separated by centrifugation at\u0026nbsp;3000 rpm for 15 min at room temperature. The samples were stored at -70\u0026deg;C for biochemical analysis. Furthermore, 2.5 ml of blood in complete blood count (CBC) vials were used to determine gene expression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasurement of beta-alanine and kynurenine\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eELISA kits were used to measure serum beta-alanine and L-kynurenine levels (My BioSource, USA: cat. MBS727570 and MBS495082, respectively). The OD curves of alanine and L-kynurenine were compared with the standard curve at\u0026nbsp;450 nm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA extraction and cDNA synthesis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe expression of genes involved in the Wnt pathway was examined by real-time PCR. RNA was extracted from leukocytes in blood samples using chloroform (Roche, Company, Germany). The primer sequences used for cDNA preparation are listed in Table 1.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1.\u0026nbsp;\u003c/strong\u003eSequence of primers\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv align=\"\"\u003e\n \u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" dir=\"rtl\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"66.4319248826291%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eSequence\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.568075117370896%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp; \u0026nbsp; Gene \u0026nbsp;\u0026nbsp;\u003c/span\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"66.4319248826291%\"\u003e\n \u003cp dir=\"LTR\"\u003eF:\u0026nbsp;TCGCCATCAAGAAGGTTCTCC\u003c/p\u003e\n \u003cp dir=\"LTR\"\u003eR:\u0026nbsp;ACACTGTCTCGGGCACATATT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.568075117370896%\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u0026nbsp;\u003c/span\u003eGSK3A\u003cspan dir=\"RTL\"\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"66.4319248826291%\"\u003e\n \u003cp dir=\"LTR\"\u003eF:\u0026nbsp;GGAACTCCAACAAGGGAGCA\u003c/p\u003e\n \u003cp dir=\"LTR\"\u003eR:\u0026nbsp;TTCGGGGTCGGAAGACCTTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.568075117370896%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp; \u0026nbsp;GSK3B\u003c/span\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"66.4319248826291%\"\u003e\n \u003cp dir=\"LTR\"\u003eF:\u0026nbsp;TTGTTGCTTTATGCAAACAGACG\u003c/p\u003e\n \u003cp dir=\"LTR\"\u003eR:\u0026nbsp;CGTTTAATGGCTTCTTCGCTGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.568075117370896%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp; \u0026nbsp; LRP6\u003c/span\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReal-Time PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe RNA content was determined using the Nanodrop (NanoDrop-ND1000) instrument at 260 and 280 nm wavelengths after the RNA was extracted from the samples according to the manufacturer\u0026apos;s instructions. The samples were subjected to denaturing RNA electrophoresis on agarose gels to visualise 18S and 28S rRNAs and evaluate their integrity. The 18S and 28S rRNAs genes remained intact in isolated RNA samples. A small amount of RNA (1000 ng) was used for further reverse transcription using oligo (dT) primers (Takara) and the Prime Script RT reagent kit (Takara; cat. No. RR037A). Target gene expression was evaluated using an iQ5 real-time PCR system (Bio-Rad, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (a housekeeping gene) was used to normalize CT levels of the target genes, and correlative expression was determined for both groups.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFrequency and percentage were used to express qualitative data, while mean and standard deviation were used to express quantitative data. The Kolmogorov-Smirnov test was used to determine whether the quantitative data were normal. The Mann-Whitney U test was used to compare qualitative variables of sex, smoking, alcohol consumption, and diabetes between the case and control groups using the chi-square test. The quantitative variables of age and body mass index were also compared using the chi-square test. The association between serum kynurenine and beta-alanine levels and leukocyte expression of genes from the Wnt pathway in PD was examined using multivariate logistic regression tests. The Spearman test was used to evaluate the association between serum kynurenine and beta-alanine and leukocyte expression of Wnt pathway genes in patients with PD and controls. Statistical analyses were performed with SPSS version 21. Graphs were generated using GraphPad Prism version 8 software. Statistical significance was defined as a p-value \u0026lt; 0.05.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eDemographic characteristics of the study population\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe demographic characteristics are shown in Table 2. A total of 90 participants (45 in the control and case groups) were included. There were equal numbers of men and women in both groups. The mean age of the participants was 61.5 \u0026plusmn; 2.2 years in the case group and 59 \u0026plusmn; 3.7 years in the control group. There was a significant age difference between the case and control groups (P = 0.001). Statistically significant differences were also observed in the use of tobacco, alcohol, and diabetes between the two groups (p \u0026lt; 0.05). The median age of the patients in the case group was 59.8 years (range:57-64 years). The case group had a median PD of one year (minimum, one year; maximum, seven years).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2.\u003c/strong\u003e Demographic and disease-related characteristics of the study population\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"38%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eVariable\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eControl, N (%)\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;(n=45)\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eCase, N\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003e(\u003c/span\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003e%)\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003e(n=45)\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eP-value\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"38%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eGender\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eMale\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eFemale\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e28 (62.2%)\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e17(37.8 %)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e28 (62.2%)\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e17(37.8 %)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e1.00\u003csup\u003e*\u003c/sup\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"38%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eAge\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eMedian (IQR)\u003csup\u003e***\u003c/sup\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e59 (57-61.5)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e61 (60-63)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e0.002\u003csup\u003e**\u003c/sup\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"38%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eAlcohol use\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eYes\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eNo\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e0 (0%)\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e45 (100%)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e6 (13.3%)\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e39 (86.7 %)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e0.011\u003csup\u003e*\u003c/sup\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"38%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eDiabetic disease history\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eYes\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eNo\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e0 (0%)\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e45 (100%)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e12 (26.7%)\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e33 (73.3 %)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026lt;0.0001\u003csup\u003e*\u003c/sup\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e* Chi-square test was used. **\u0026nbsp;Mann-Whitney U test was used. ***IQR: Interquartile range=(Q\u003csub\u003e25%\u003c/sub\u003e-Q\u003csub\u003e75\u003c/sub\u003e\u003csub\u003e%\u003c/sub\u003e)\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEvaluation of serum levels of biochemical factors and Wnt pathway genes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe examined the serum levels of kynurenine and beta-alanine and the leukocyte expression of Wnt pathway genes in patients with PD and the control group. We found that the serum kynurenine levels were higher in patients with PD than in the control group. However, serum beta-alanine levels and expression of LRP6, GSK3A, and GSK3B were significantly lower than those in the control group (Table 3 and Figure 1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3.\u003c/strong\u003e The mean concentrations of kynurenine and beta-alanine and the expression of Wnt pathway genes in the case and control groups\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"708\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" width=\"28.8135593220339%\"\u003e\n \u003cp\u003e\u003cstrong\u003eVariables\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"20.338983050847457%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCase\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"20.338983050847457%\"\u003e\n \u003cp\u003e\u003cstrong\u003eControl\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" width=\"20.338983050847457%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eMean d\u003c/strong\u003e\u003cstrong\u003eifference\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003e(\u003c/strong\u003e\u003cstrong\u003eSE)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e\u003cstrong\u003eP-value\u003csup\u003e*\u003c/sup\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"25%\"\u003e\n \u003cp\u003eMean\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25%\"\u003e\n \u003cp\u003eSD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25%\"\u003e\n \u003cp\u003eMean\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25%\"\u003e\n \u003cp\u003eSD\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"28.8135593220339%\"\u003e\n \u003cp\u003e\u003cstrong\u003eKynurenine(ng/mL)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e778.27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e55.31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e539.82\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e93.08\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.338983050847457%\"\u003e\n \u003cp\u003e-238.44 (16.14)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"28.8135593220339%\"\u003e\n \u003cp\u003e\u003cstrong\u003ebeta-alanine (ng/mL)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e10.58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e1.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e14.16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e1.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.338983050847457%\"\u003e\n \u003cp\u003e-238.44 (16.14)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"28.8135593220339%\"\u003e\n \u003cp\u003e\u003cstrong\u003eLRP6 gene expression (\u0026Delta;\u0026Delta;CT)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e3.2622\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e0.41873\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e4.0164\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e0.43560\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.338983050847457%\"\u003e\n \u003cp\u003e0.75 (0.09)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"28.8135593220339%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGSK3A gene expression (\u0026Delta;\u0026Delta;CT)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e8.0893\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e0.31352\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e9.6989\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e0.62187\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.338983050847457%\"\u003e\n \u003cp\u003e1.61 (0.10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"28.8135593220339%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGSK3B gene expression (\u0026Delta;\u0026Delta;CT)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e4.0018\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e0.46409\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e5.3378\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e0.63619\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.338983050847457%\"\u003e\n \u003cp\u003e1.34 (0.12)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.169491525423728%\"\u003e\n \u003cp\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eAssociation between kynurenine and beta-alanine levels and leukocyte expression of Wnt pathway genes in PD\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePatients in the PD and control groups had statistically significant differences in serum levels of kynurenine and beta-alanine and leukocyte expression of Wnt pathway genes (P \u0026lt; 0.05). There was also a statistically significant difference in serum beta-alanine levels and expression of LRP6, GSK3A, and GSK3B genes compared to the control group (Table 4).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 4:\u0026nbsp;\u003c/strong\u003eRelationship between kynurenine and beta-alanine and the expression of LRP6, GSK3A, and GSK3B genes between control and case groups\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"669\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"22.869955156950674%\"\u003e\n \u003cp\u003eVariables\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"4\" valign=\"top\" width=\"38.56502242152467%\"\u003e\n \u003cp\u003eUnadjusted\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"4\" valign=\"top\" width=\"38.56502242152467%\"\u003e\n \u003cp\u003eAdjusted\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"22.869955156950674%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.762331838565023%\"\u003e\n \u003cp\u003eB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003eS.E.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003eExp(B)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.865470852017937%\"\u003e\n \u003cp\u003eP-value\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003eB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003eS.E.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.865470852017937%\"\u003e\n \u003cp\u003eExp(B)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.762331838565023%\"\u003e\n \u003cp\u003eP-value\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"22.869955156950674%\"\u003e\n \u003cp\u003eKynurenine(ng/mL)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.762331838565023%\"\u003e\n \u003cp\u003e0.035\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e0.008\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e1.036\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.865470852017937%\"\u003e\n \u003cp\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e0.050\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e0.019\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.865470852017937%\"\u003e\n \u003cp\u003e1.051\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.762331838565023%\"\u003e\n \u003cp\u003e0.008\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"22.869955156950674%\"\u003e\n \u003cp\u003eBeta-Alanine (ng/mL)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.762331838565023%\"\u003e\n \u003cp\u003e-2.697\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e0.723\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e0.067\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.865470852017937%\"\u003e\n \u003cp\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e-3.695\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e1.577\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.865470852017937%\"\u003e\n \u003cp\u003e0.025\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.762331838565023%\"\u003e\n \u003cp\u003e0.019\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"22.869955156950674%\"\u003e\n \u003cp\u003eLRP6 gene expression (\u0026Delta;\u0026Delta;CT)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.762331838565023%\"\u003e\n \u003cp\u003e-3.355\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e0.620\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e0.035\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.865470852017937%\"\u003e\n \u003cp\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e-3.859\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e0.843\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.865470852017937%\"\u003e\n \u003cp\u003e0.021\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.762331838565023%\"\u003e\n \u003cp\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"22.869955156950674%\"\u003e\n \u003cp\u003eGSK3A gene expression (\u0026Delta;\u0026Delta;CT)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.762331838565023%\"\u003e\n \u003cp\u003e-7.249\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e1.935\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.865470852017937%\"\u003e\n \u003cp\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e-6.773\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e2.125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.865470852017937%\"\u003e\n \u003cp\u003e0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.762331838565023%\"\u003e\n \u003cp\u003e0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"22.869955156950674%\"\u003e\n \u003cp\u003eGSK3B gene expression (\u0026Delta;\u0026Delta;CT)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.762331838565023%\"\u003e\n \u003cp\u003e-4.582\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e0.935\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e0.010\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.865470852017937%\"\u003e\n \u003cp\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e-4.856\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.968609865470851%\"\u003e\n \u003cp\u003e1.252\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.865470852017937%\"\u003e\n \u003cp\u003e0.008\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.762331838565023%\"\u003e\n \u003cp\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e*P-value adjusted for age, diabetes, alcohol and cigarette use, and BMI.\u0026nbsp;** Uni-variate logistic regression was used.\u0026nbsp;*** Multivariate logistic regression was used.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorrelation between serum levels of kynurenine and beta-alanine and leukocyte expression of Wnt signaling pathway genes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere was a statistically weak and significant correlation between serum levels of kynurenine and beta-alanine and leukocyte expression of Wnt signaling genes in patients with PD (Table 5 and Figure 2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 5.\u0026nbsp;\u003c/strong\u003eCorrelation between the expression levels of LRP6, GSK3A, and GSKSB genes and blood concentrations of kynurenine and beta-alanine in patients with PD.\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"721\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" valign=\"top\" width=\"35.922330097087375%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.0374479889043%\"\u003e\n \u003cp\u003eKynurenine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.008321775312067%\"\u003e\n \u003cp\u003ebeta-Alanine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.57004160887656%\"\u003e\n \u003cp\u003eLRP6 gene expression\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.147018030513177%\"\u003e\n \u003cp\u003eGSK3A gene expression\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.314840499306518%\"\u003e\n \u003cp\u003eGSK3B gene expression\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"10\" valign=\"top\" width=\"13.314840499306518%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eParkinson\u0026apos;s disease\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" width=\"13.453536754507628%\"\u003e\n \u003cp\u003eKynurenine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.153952843273231%\"\u003e\n \u003cp\u003er\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.0374479889043%\"\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.008321775312067%\"\u003e\n \u003cp\u003e-0.148\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.57004160887656%\"\u003e\n \u003cp\u003e-0.010\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.147018030513177%\"\u003e\n \u003cp\u003e-0.082\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.314840499306518%\"\u003e\n \u003cp\u003e-0.104\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"12.5%\"\u003e\n \u003cp\u003eP-value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.803030303030305%\"\u003e\n \u003cp\u003e.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"19.12878787878788%\"\u003e\n \u003cp\u003e0.330\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.068181818181818%\"\u003e\n \u003cp\u003e0.948\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"19.318181818181817%\"\u003e\n \u003cp\u003e0.593\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.181818181818183%\"\u003e\n \u003cp\u003e0.497\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" width=\"15.52%\"\u003e\n \u003cp\u003ebeta-alanine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.56%\"\u003e\n \u003cp\u003er\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.04%\"\u003e\n \u003cp\u003e-0.148\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.16%\"\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.04%\"\u003e\n \u003cp\u003e-0.019\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.32%\"\u003e\n \u003cp\u003e0.102\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.36%\"\u003e\n \u003cp\u003e-0.032\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"12.5%\"\u003e\n \u003cp\u003eP-value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.803030303030305%\"\u003e\n \u003cp\u003e0.330\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"19.12878787878788%\"\u003e\n \u003cp\u003e.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.068181818181818%\"\u003e\n \u003cp\u003e0.900\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"19.318181818181817%\"\u003e\n \u003cp\u003e0.503\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.181818181818183%\"\u003e\n \u003cp\u003e0.836\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" width=\"15.52%\"\u003e\n \u003cp\u003eLRP6 gene expression\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.56%\"\u003e\n \u003cp\u003er\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.04%\"\u003e\n \u003cp\u003e-0.010\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.16%\"\u003e\n \u003cp\u003e-0.019\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.04%\"\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.32%\"\u003e\n \u003cp\u003e-0.068\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.36%\"\u003e\n \u003cp\u003e0.126\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"12.5%\"\u003e\n \u003cp\u003eP-value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.803030303030305%\"\u003e\n \u003cp\u003e0.948\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"19.12878787878788%\"\u003e\n \u003cp\u003e0.900\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.068181818181818%\"\u003e\n \u003cp\u003e.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"19.318181818181817%\"\u003e\n \u003cp\u003e0.656\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.181818181818183%\"\u003e\n \u003cp\u003e0.411\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" width=\"15.52%\"\u003e\n \u003cp\u003eGSK3A gene expression\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.56%\"\u003e\n \u003cp\u003er\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.04%\"\u003e\n \u003cp\u003e-0.082\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.16%\"\u003e\n \u003cp\u003e0.102\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.04%\"\u003e\n \u003cp\u003e-0.068\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.32%\"\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.36%\"\u003e\n \u003cp\u003e0.024\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"12.5%\"\u003e\n \u003cp\u003eP-value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.803030303030305%\"\u003e\n \u003cp\u003e0.593\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"19.12878787878788%\"\u003e\n \u003cp\u003e0.503\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.068181818181818%\"\u003e\n \u003cp\u003e0.656\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"19.318181818181817%\"\u003e\n \u003cp\u003e.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.181818181818183%\"\u003e\n \u003cp\u003e0.875\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" width=\"15.52%\"\u003e\n \u003cp\u003eGSK3B gene expression\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.56%\"\u003e\n \u003cp\u003er\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.04%\"\u003e\n \u003cp\u003e-0.104\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.16%\"\u003e\n \u003cp\u003e-0.032\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.04%\"\u003e\n \u003cp\u003e0.126\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.32%\"\u003e\n \u003cp\u003e0.024\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.36%\"\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"12.5%\"\u003e\n \u003cp\u003eP-value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.803030303030305%\"\u003e\n \u003cp\u003e0.497\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"19.12878787878788%\"\u003e\n \u003cp\u003e0.836\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.068181818181818%\"\u003e\n \u003cp\u003e0.411\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"19.318181818181817%\"\u003e\n \u003cp\u003e0.875\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.181818181818183%\"\u003e\n \u003cp\u003e.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;** Spearman\u0026apos;s rho test was used.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study investigated the relationship between serum levels of kynurenine and beta-alanine and the leukocyte expression of Wnt pathway genes. The results of this study show that the relationship between these variables remains significant even after considering confounding factors such as age, diabetes, smoking, alcohol consumption, and body mass index, as well as the correlation between serum levels of kynurenine and beta-alanine and leukocyte activity. However, a weak and statistically insignificant association was found between the Wnt signaling pathway and PD [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSerum levels of kynurenine, a tryptophan metabolite, are higher in individuals with Parkinson's disease than in controls or healthy individuals. In addition, CSF levels of hydroxykynurenine and kynurenine were significantly higher in patients with PD than in healthy control subjects. [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Another study examined whether metabolites of tryptophan, kynurenine, and other compounds were present in the plasma of patients with Parkinson's and Huntington's diseases. A decrease in kynurenic acid levels, a reduction in the ratio of kynurenic acid to kynurenine (KA/Kyn), and a decrease in the amount of quinolinic acid were observed. Furthermore, the patients had a higher QA/KA ratio than Huntington's patients and the control group. The kynurenic acid concentration and the ratios KA /KYN, quinoline concentration, and QA/KA showed significant changes in patients with advanced PD compared to early-stage patients [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe activity of immune cells in inflammatory processes has been shown to increase the production of interferon-gamma, which is responsible for stimulating indole-2 and 3-dioxygenases through its action on enzymes of the kynurenine pathway. In the kynurenine pathway, tryptophan degradation increases significantly, resulting in a decrease in tryptophan levels and an increase in serum kynurenine levels in patients with PD [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. A study of blood and CSF samples from patients with AD and PD showed elevated levels of kynurenine pathway metabolites. Alterations in age- and disease-related kynurenine metabolism are associated with decreased neurogenesis and increased excitotoxicity in neurodegenerative diseases. Serum kynurenic acid levels were measured in patients with psychosis. Previous studies have shown that kynurenic acid levels and KA/QA ratio decrease in patients with acute depression 18. According to another study, kynurenic acid, a metabolite of the kynurenine pathway, is more abundant in the brain and blood of older mice. Tryptophan metabolites such as KA may explain the functional differences in the brains of newborn and old mice [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] .\u003c/p\u003e \u003cp\u003eIn contrast, the liver and kidney tissues showed no change in KA concentration. Another study examined the concentration of metabolites in the kynurenine pathway in the plasma and CSF. This study showed that the concentrations of neurotoxic compounds such as 3-hydroxykynurenine and quinolic acid increased significantly in the plasma of patients with PD. This shows that there may be a relationship between the severity of the symptoms of this disease and, in addition, the concentration of kynurenic acid, a neuron-protective compound, decreased in the CSF of patients with PD [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. According to the results, there is a relationship between the kynurenine pathway and PD. Thus, more tryptophan enters the kynurenine pathway in PD, and changes occur in the metabolites of the kynurenine pathway.\u003c/p\u003e \u003cp\u003eTryptophan is first converted to kynurenine and kynurenic acid through the kynurenine pathway. This increase in kynurenine inhibits the enzymes involved in the dopamine synthesis pathway and prevents dopamine synthesis. However, the conversion of kynurenine to other toxic compounds, such as 3-hydroxykynurenine and quinolinic acid, further increased the levels of these compounds. Toxic compounds generate free radicals that cause oxidative stress and the accumulation of α-synuclein, leading to apoptosis and neuronal death [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBeta-alanine, a non-essential amino acid in the body, synthesizes carnosine and homocarnosine. Measuring beta-alanine in the serum of patients with PD and healthy subjects showed that the amount of beta-alanine in the serum of patients with PD decreased. Therefore, we investigated the short-term effects of beta-alanine intake on the activity and quality of life of PD patients. Four weeks after administering the recommended doses, no changes or improvements in physical activity or quality of life were observed in the patients with PD 20. This study investigated the effects of taurine and beta-alanine ingestion on the behavioral and neurochemical parameters of rats and their brain metabolites. The results showed that the intake of beta-alanine supplements reduced the concentration of 5-hydroxy groups compared with that of rats in the other groups. The hypothalamus produces indoleacetic acid (5-HIAA), a serotonin metabolite.\u003c/p\u003e \u003cp\u003eIn addition, the concentrations of carnosine in the cerebral cortex and hypothalamus are similar to those of neurotrophic factors in the brain. Beta-alanine supplementation also had an effect. Additionally, it can be used as an anxiolytic agent [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In an experiment in rats to study the effects of long-term beta-alanine intake, it was found that long-term and chronic beta-alanine intake could increase oxidative stress and alter energy metabolism in the cerebral cortex and cerebellum. If an increase in beta-alanine leads to an increase in reactive oxygen species in the brain, ROS can also have an inhibitory effect on antioxidant enzymes and the activity of these enzymes. Long-term and regular intake of beta-alanine was concluded to cause damage from oxidative stress and changes in energy metabolism that may lead to diseases such as AD because the concentration of beta-alanine is high in this disease [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Another study examined the effects of a 14-day (short-term) intake of 12 g of beta-alanine per day on cognitive function, mood, and brain-derived neurotrophic factor (BDNF) blood flow in healthy men with limited oxidative stress and inflammation before simulating a 24-hour military deployment. No changes in cognitive function or BDNF levels were observed, although the consumption of β-alanine reduced feelings of depression [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Carnosine, a product of the β-alanine compound, was investigated in a study of the effects of carnosine alone and vitamin E on oxidative status and antioxidant activity in rats. Rats were given vitamin E and carnosine for 15 weeks. The results showed that 1000 mg/kg carnosine had no antioxidant effect [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn another study, carnosine and similar compounds protected neurons from reactive oxygen species when added to a neuronal suspension [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Another study examined the effect of carnosine with L- DOPA as a primary treatment for PD. This showed that individuals who used carnosine with L-DOPA in their treatment had positive effects on PD compared with those who used L-DOPA alone. They improve neurological symptoms and decrease carbonylation of blood plasma proteins and lipid hydroperoxides, among other effects. The combination of carnosine and essential therapies could have a beneficial effect on the treatment of PD [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. According to the results of the study, the concentration of β-alanine in the serum of the patients decreased, and according to the reviewed studies, it can be said that there is a relationship between PD and the concentration of β-alanine in the serum and brain. Therefore, the use of beta-alanine for the treatment of PD may lead to positive results. Although long-term and short-term use of this supplement may or may not have different effects on this disease, a notable finding is the correlation and effect of beta-alanine on this disease. The recommended mechanism of action of beta-alanine is that, when it enters the body, it forms carnosine and hemocarnosine in conjunction with other compounds with antioxidant activity. These react with superoxide free radicals and decrease active oxygen species, which are protected by antioxidant enzymes, such as ceruloplasmin and superoxide dismutase. Therefore, they act as protective agents against oxidative damage and protect neurons from neurotropic diseases [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe third and final variable studied in patients with PD was the leukocyte expression of the Wnt pathway by real-time PCR. A study of this pathway showed that the expression of genes from the Wnt pathway, namely, LRP6, GSK3α, and GSK3B, decreased in patients with PD. Additionally, a study in mice investigating the catenin/β protein, which is the main component of the Wnt signaling pathway, showed that inactivation of the pathway and β-catenin in shh-cre mice resulted in decreased neurogenetics and impaired migration and detachment of dopaminergic neurons. However, inactivation of Wnt and β-catenin signaling pathways in Th-Ires-Cre mice impaired several neural progenitor cells without altering the integrity and structure of the neural network. This study demonstrated the role of β-catenin in neurogenesis and the efficacy of stem cell replacement therapy in patients with PD [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. A recent study that examined the effects of the β-catenin-dependent Wnt pathway on midbrain dopaminergic neurons found that in patients with PD, with increased expression of NGOB1 causing a decrease in the expression of RSPO2, RSPO2 activates the Wnt pathway. The activity of this pathway decreases with increased expression of NROB1. In vitro, decreased activity of the Wnt pathway due to increased expression of the transcriptional repressor NROB1 affects the nature of dopaminergic neurons. This suggests that regulation of Wnt signaling may be effective in some genetic forms of PD [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAnother study showed that neurogenesis in the hippocampal region of the brain decreases with age and environmental changes in neurons due to regulation of the Wnt signaling pathway. Proper regulation of this pathway may play a role in neurogenesis in adulthood [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Another study examined the role of the parkin protein in Wnt signaling in PD. Parkin has ubiquitin ligase activity and acts on β-catenin, the main protein in the Wnt signaling pathway. It degrades catenin and affects its levels in vivo. The deficiency of the parkin protein leads to the accumulation of β-catenin in neurons and increases the activation of the Wnt signaling pathway. These factors may lead to neuronal death. The Parkin protein has been found to protect dopaminergic neurons through Wnt signaling and prevent activation of the Wnt/β-catenin pathway [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. A study in SAMP8 mice showed an association between down-regulation of Wnt/canonical signaling and loss of neurons in the hippocampal region of SAMP8 mice. Regulated Wnt signaling can protect neurons from age-related cognitive decline and AD [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In another study, Drosophila flies were used as the study model, and rotenone toxin was used to create conditions for PD. In this experiment, the activity of the EGFR MAPK and TGFβ pathways increased, while the activity of the Wnt pathway decreased in cells. This demonstrated the effect of the Wnt pathway on the production of dopaminergic neurons in PD [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThis study also examined the LRRK2 protein and its effects on PD.\u003c/p\u003e \u003cp\u003eTherefore, LRRK2 is an influential protein in the Wnt signaling pathway because it binds to the DVL protein, a molecule in this pathway. Therefore, it causes changes in the Wnt signaling pathway and affects PD [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Furthermore, a study using ESCs lacking wnt1 and LRP6 molecules to examine the effects of the Wnt pathway on the expansion of dopaminergic neurons showed that reducing the pathway had a positive effect on the differentiation of neurons and dopaminergic neurons in ESC mice. Wnt1 or LRP6 is no longer required to differentiate dopaminergic neurons in vitro [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. In this study, investigating the significant role of the catenin-β/wnt pathway in dopaminergic neuron precursors and examining the effects of age on the Wnt pathway, it is shown that age is a factor that affects the neurogenesis potential of mNPC brain cells and that aging affects the pathway. Additionally, it has an inhibitory effect. β-catenin activation with a specific GSK3β antagonist significantly improved the neuroregeneration of dopaminergic neurons, which is essential for neurodegenerative approaches in PD [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn addition, it has an inhibitory effect. Activation of β-catenin with a specific GSK3β antagonist significantly improves neuroregeneration of dopaminergic neurons, which is important for neurodegenerative approaches in PD [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. According to the results of our study, a decrease in leukocyte expression of Wnt pathway genes was observed. Previous studies have shown an association between the Wnt signaling pathway and neurodegenerative diseases such as Parkinson's and AD. Genetic abnormalities in pathway proteins and molecules can lead to changes in the expression of pathway genes that affect various cellular processes, such as neurogenesis, neuron repair, and neuron migration, causing disorders. However, there is a relationship between the Wnt signaling pathway and PD. Wnt begins with the binding of the Wnt molecule to its membrane receptor and a series of intracellular phosphorylation reactions that result in β-catenin detaching from the intracellular complex and entering the nucleus where it transcribes genes. Changes in gene expression and mutations in proteins involved in this pathway contribute to the disruption of the pathway and expression of its genes, which are associated with PD [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eBased on earlier studies and the results of the present study showing a decrease in leukocyte expression of Wnt pathway genes, we concluded that there is an association between the Wnt pathway and neurodegenerative diseases, such as PD and AD. Furthermore, genetic abnormalities in proteins, as well as in molecules in the pathway, lead to changes in the expression of genes in the pathway and affect and cause disorders in various cellular processes such as neurogenesis, neuron repair, and neuron migration. Therefore, we propose the use of a large sample and measurement of other parameters so that, if the results of this study are confirmed, the measurement of kynurenine and beta-alanine and the expression of genes of the Wnt signaling pathway in leukocytes can be used for the early diagnosis, treatment, and follow-up of the disease.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp style=\"text-align: left;\"\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp dir=\"RTL\" style=\"text-align: left;\"\u003e\u003cspan dir=\"LTR\"\u003eWe gratefully acknowledge the kind support of the Neuroscience Research Center of the Tabriz University of Medical Sciences.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cstrong\u003eAuthor\u0026apos;s contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: left;\"\u003eAN and FK participated in the study design, and AH and AN performed the practical work. DL contributed to the data analysis and interpretation. MN and AN contributed to the revision of the manuscript. AH wrote the manuscript. FK provided consent for the last version of this manuscript.\u003c/p\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cstrong\u003eSources of Funding\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: left;\"\u003eThis work was supported by grants from the Vice Chancellor for Research, Tabriz University of Medical Sciences, Tabriz, IRAN grant no. IRTBZMED.REC.1401.537.\u003c/p\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e the data and materials used in this study are available.\u003c/p\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cstrong\u003eCompliance with ethical standards\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: left;\"\u003eThe authors declare that there are no conflicts of interest\u003c/p\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cstrong\u003eEthical approval\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: left;\"\u003eThe Ethics Committee of the Tabriz University of Medical Sciences approved the study protocol in accordance with the Declaration of Helsinki.\u003c/p\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cstrong\u003eInformed consent was obtained from all the patients in this study\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: left;\"\u003eThe Ethics Committee of the Tabriz University of Medical Sciences approved the study protocol, which was conducted in accordance with the Declaration of Helsinki of the World Medical Association.\u003c/p\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cstrong\u003eConsent for publication:\u0026nbsp;\u003c/strong\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eDe Virgilio A, Greco A, Fabbrini G, Inghilleri M, Rizzo MI, Gallo A, Conte M, Rosato C, Ciniglio Appiani M and de Vincentiis M (2016) Parkinson\u0026apos;s disease: Autoimmunity and neuroinflammation. Autoimmun Rev 15:1005-11. doi: 10.1016/j.autrev.2016.07.022\u003c/li\u003e\n\u003cli\u003eCabreira V and Massano J (2019) [Parkinson\u0026apos;s Disease: Clinical Review and Update]. Acta Med Port 32:661-670. doi: 10.20344/amp.11978\u003c/li\u003e\n\u003cli\u003eMaass F, Schulz I, Lingor P, Mollenhauer B and B\u0026auml;hr M (2019) Cerebrospinal fluid biomarker for Parkinson\u0026apos;s disease: An overview. Mol Cell Neurosci 97:60-66. doi: 10.1016/j.mcn.2018.12.005\u003c/li\u003e\n\u003cli\u003eKwon EH, Tennagels S, Gold R, Gerwert K, Beyer L and T\u0026ouml;nges L (2022) Update on CSF Biomarkers in Parkinson\u0026apos;s Disease. Biomolecules 12. doi: 10.3390/biom12020329\u003c/li\u003e\n\u003cli\u003eHall S, Surova Y, \u0026Ouml;hrfelt A, Blennow K, Zetterberg H and Hansson O (2016) Longitudinal Measurements of Cerebrospinal Fluid Biomarkers in Parkinson\u0026apos;s Disease. Mov Disord 31:898-905. doi: 10.1002/mds.26578\u003c/li\u003e\n\u003cli\u003eGaetani L, Blennow K, Calabresi P, Di Filippo M, Parnetti L and Zetterberg H (2019) Neurofilament light chain as a biomarker in neurological disorders. J Neurol Neurosurg Psychiatry 90:870-881. doi: 10.1136/jnnp-2018-320106\u003c/li\u003e\n\u003cli\u003eChen L-M, Bao C-H, Wu Y, Liang S-H, Wang D, Wu L-Y, Huang Y, Liu H-R and Wu H-G (2021) Tryptophan-kynurenine metabolism: a link between the gut and brain for depression in inflammatory bowel disease. Journal of Neuroinflammation 18:135. doi: 10.1186/s12974-021-02175-2\u003c/li\u003e\n\u003cli\u003eBehl T, Kaur I, Sehgal A, Singh S, Bhatia S, Al-Harrasi A, Zengin G, Bumbu AG, Andronie-Cioara FL, Nechifor AC, Gitea D, Bungau AF, Toma MM and Bungau SG (2021) The Footprint of Kynurenine Pathway in Neurodegeneration: Janus-Faced Role in Parkinson\u0026apos;s Disorder and Therapeutic Implications. Int J Mol Sci 22. doi: 10.3390/ijms22136737\u003c/li\u003e\n\u003cli\u003ePerim P, Marticorena FM, Ribeiro F, Barreto G, Gobbi N, Kerksick C, Dolan E and Saunders B (2019) Can the Skeletal Muscle Carnosine Response to Beta-Alanine Supplementation Be Optimized? Front Nutr 6:135. doi: 10.3389/fnut.2019.00135\u003c/li\u003e\n\u003cli\u003eFu H, Katsumura Y, Lin M, Muroya Y, Hata K, Fujii K, Yokoya A and Hatano Y (2009) Free radical scavenging and radioprotective effects of carnosine and anserine. Radiation Physics and Chemistry 78:1192-1197. doi: https://doi.org/10.1016/j.radphyschem.2009.07.023\u003c/li\u003e\n\u003cli\u003eArenas E (2014) Wnt signaling in midbrain dopaminergic neuron development and regenerative medicine for Parkinson\u0026apos;s disease. J Mol Cell Biol 6:42-53. doi: 10.1093/jmcb/mju001\u003c/li\u003e\n\u003cli\u003eBerwick DC and Harvey K (2012) The importance of Wnt signalling for neurodegeneration in Parkinson\u0026apos;s disease. Biochem Soc Trans 40:1123-8. doi: 10.1042/bst20120122\u003c/li\u003e\n\u003cli\u003eSerafino A, Giovannini D, Rossi S and Cozzolino M (2020) Targeting the Wnt/\u0026beta;-catenin pathway in neurodegenerative diseases: recent approaches and current challenges. Expert Opin Drug Discov 15:803-822. doi: 10.1080/17460441.2020.1746266\u003c/li\u003e\n\u003cli\u003eIwaoka K, Otsuka C, Maeda T, Yamahara K, Kato K, Takahashi K, Takahashi K and Terayama Y (2020) Impaired metabolism of kynurenine and its metabolites in CSF of parkinson\u0026apos;s disease. Neurosci Lett 714:134576. doi: 10.1016/j.neulet.2019.134576\u003c/li\u003e\n\u003cli\u003eChang KH, Cheng ML, Tang HY, Huang CY, Wu YR and Chen CM (2018) Alternations of Metabolic Profile and Kynurenine Metabolism in the Plasma of Parkinson\u0026apos;s Disease. Mol Neurobiol 55:6319-6328. doi: 10.1007/s12035-017-0845-3\u003c/li\u003e\n\u003cli\u003eWidner B, Leblhuber F and Fuchs D (2002) Increased neopterin production and tryptophan degradation in advanced Parkinson\u0026apos;s disease. J Neural Transm (Vienna) 109:181-9. doi: 10.1007/s007020200014\u003c/li\u003e\n\u003cli\u003eHeilman PL, Wang EW, Lewis MM, Krzyzanowski S, Capan CD, Burmeister AR, Du G, Escobar Galvis ML, Brundin P, Huang X and Brundin L (2020) Tryptophan Metabolites Are Associated With Symptoms and Nigral Pathology in Parkinson\u0026apos;s Disease. Mov Disord 35:2028-2037. doi: 10.1002/mds.28202\u003c/li\u003e\n\u003cli\u003eMurakami T and Furuse M (2010) The impact of taurine- and beta-alanine-supplemented diets on behavioral and neurochemical parameters in mice: antidepressant versus anxiolytic-like effects. Amino Acids 39:427-34. doi: 10.1007/s00726-009-0458-x\u003c/li\u003e\n\u003cli\u003eGemelli T, de Andrade RB, Rojas DB, Zanatta \u0026Acirc;, Schirmbeck GH, Funchal C, Wajner M, Dutra-Filho CS and Wannmacher CMD (2018) Chronic Exposure to \u0026beta;-Alanine Generates Oxidative Stress and Alters Energy Metabolism in Cerebral Cortex and Cerebellum of Wistar Rats. Mol Neurobiol 55:5101-5110. doi: 10.1007/s12035-017-0711-3\u003c/li\u003e\n\u003cli\u003eVaranoske AN, Wells AJ, Boffey D, Harat I, Frosti CL, Kozlowski GJ, Gepner Y and Hoffman JR (2021) Effects of High-Dose, Short-Duration \u0026beta;-Alanine Supplementation on Cognitive Function, Mood, and Circulating Brain-Derived Neurotropic Factor (BDNF) in Recreationally-Active Males Before Simulated Military Operational Stress. J Diet Suppl 18:147-168. doi: 10.1080/19390211.2020.1733730\u003c/li\u003e\n\u003cli\u003eIbrahim W, Tatumi V, Yeh CC, Hong CB and Chow CK (2008) Effects of dietary carnosine and vitamin E on antioxidant and oxidative status of rats. Int J Vitam Nutr Res 78:230-7. doi: 10.1024/0300-9831.78.45.230\u003c/li\u003e\n\u003cli\u003eBoldyrev A, Bulygina E, Leinsoo T, Petrushanko I, Tsubone S and Abe H (2004) Protection of neuronal cells against reactive oxygen species by carnosine and related compounds. Comp Biochem Physiol B Biochem Mol Biol 137:81-8. doi: 10.1016/j.cbpc.2003.10.008\u003c/li\u003e\n\u003cli\u003eRawal N, Corti O, Sacchetti P, Ardilla-Osorio H, Sehat B, Brice A and Arenas E (2009) Parkin protects dopaminergic neurons from excessive Wnt/beta-catenin signaling. Biochem Biophys Res Commun 388:473-8. doi: 10.1016/j.bbrc.2009.07.014\u003c/li\u003e\n\u003cli\u003eTang M, Miyamoto Y and Huang EJ (2009) Multiple roles of beta-catenin in controlling the neurogenic niche for midbrain dopamine neurons. Development 136:2027-38. doi: 10.1242/dev.034330\u003c/li\u003e\n\u003cli\u003eHaynes JM, Sibuea SM, Aguiar AA, Li F, Ho JK and Pouton CW (2021) Inhibition of \u0026beta;-catenin dependent WNT signalling upregulates the transcriptional repressor NR0B1 and downregulates markers of an A9 phenotype in human embryonic stem cell-derived dopaminergic neurons: Implications for Parkinson\u0026apos;s disease. PLoS One 16:e0261730. doi: 10.1371/journal.pone.0261730\u003c/li\u003e\n\u003cli\u003eMiranda CJ, Braun L, Jiang Y, Hester ME, Zhang L, Riolo M, Wang H, Rao M, Altura RA and Kaspar BK (2012) Aging brain microenvironment decreases hippocampal neurogenesis through Wnt-mediated survivin signaling. Aging Cell 11:542-52. doi: 10.1111/j.1474-9726.2012.00816.x\u003c/li\u003e\n\u003cli\u003eBayod S, Felice P, Andr\u0026eacute;s P, Rosa P, Camins A, Pall\u0026agrave;s M and Canudas AM (2015) Downregulation of canonical Wnt signaling in hippocampus of SAMP8 mice. Neurobiol Aging 36:720-9. doi: 10.1016/j.neurobiolaging.2014.09.017\u003c/li\u003e\n\u003cli\u003eStephano F, Nolte S, Hoffmann J, El-Kholy S, von Frieling J, Bruchhaus I, Fink C and Roeder T (2018) Impaired Wnt signaling in dopamine containing neurons is associated with pathogenesis in a rotenone triggered Drosophila Parkinson\u0026apos;s disease model. Sci Rep 8:2372. doi: 10.1038/s41598-018-20836-w\u003c/li\u003e\n\u003cli\u003eSancho RM, Law BM and Harvey K (2009) Mutations in the LRRK2 Roc-COR tandem domain link Parkinson\u0026apos;s disease to Wnt signalling pathways. Hum Mol Genet 18:3955-68. doi: 10.1093/hmg/ddp337\u003c/li\u003e\n\u003cli\u003eCaj\u0026aacute;nek L, Ribeiro D, Liste I, Parish CL, Bryja V and Arenas E (2009) Wnt/beta-catenin signaling blockade promotes neuronal induction and dopaminergic differentiation in embryonic stem cells. Stem Cells 27:2917-27. doi: 10.1002/stem.210\u003c/li\u003e\n\u003cli\u003eL\u0026apos;Episcopo F, Tirolo C, Testa N, Caniglia S, Morale MC, Serapide MF, Pluchino S and Marchetti B (2014) Wnt/\u0026beta;-catenin signaling is required to rescue midbrain dopaminergic progenitors and promote neurorepair in ageing mouse model of Parkinson\u0026apos;s disease. Stem Cells 32:2147-63. doi: 10.1002/stem.1708\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"kynurenine, beta-alanine, Parkinson's disease, Wnt Signaling pathway","lastPublishedDoi":"10.21203/rs.3.rs-2676291/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2676291/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eParkinson's disease (PD) is the second most common neurodegenerative disease in the world. Despite its worldwide prevalence, there is currently no clear explanation of the mechanism of this disease. Moreover, the lack of reliable and accurate biomarkers makes the early detection of PD difficult. Therefore, we aimed to investigate serum beta-alanine and kynurenine levels and the expression of Wnt pathway genes in leukocytes from patients with PD.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eNinety patients (45 with PD and 45 healthy individuals) were enrolled in this study. 10 mL of blood samples were taken from all participants. The serum levels of beta-alanine and kynurenine were measured using ELISA, and the expression of Wnt pathway genes in leukocytes was determined using real-time PCR.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e Serum levels of kynurenine and beta-alanine were higher in patients with PD than in the control group. Data analysis also showed that the expression of some genes of the Wnt signaling pathway in leukocytes was decreased.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e A correlation was observed between serum beta-alanine and kynurenine levels and the expression of the Wnt pathway gene in leukocytes in patients with PD. Therefore, these biomarkers can be used for early detection, monitoring, and treatment of patients with PD.\u003c/p\u003e","manuscriptTitle":"Serum kynurenine and beta-alanine levels are associated with Wnt pathway gene expression in leukocytes of patients with Parkinson's disease","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-03-16 14:13:05","doi":"10.21203/rs.3.rs-2676291/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"019a51cc-2971-4173-82bf-108faa0eeece","owner":[],"postedDate":"March 16th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-06-24T19:14:17+00:00","versionOfRecord":[],"versionCreatedAt":"2023-03-16 14:13:05","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2676291","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2676291","identity":"rs-2676291","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.