RBM15B-driven m6A hypomethylation destabilizes lncRNA SCAMP1 and trophoblast function in unexplained recurrent miscarriage

RBM15B-driven m6A hypomethylation destabilizes lncRNA SCAMP1 and trophoblast function in unexplained recurrent miscarriage | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article RBM15B-driven m6A hypomethylation destabilizes lncRNA SCAMP1 and trophoblast function in unexplained recurrent miscarriage juntao feng, Zhiwei Zhu, shisi wei, Yiyun Wei, Changqiang Wei, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8695999/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Recurrent spontaneous abortion (RSA) affects numerous women worldwide, with a significant proportion categorized as unexplained recurrent spontaneous abortion (URSA). Recent evidence suggests that N6-methyladenosine (m6A) methylation, a critical post-transcriptional modification influencing RNA stability and function, plays a key role in URSA pathogenesis. Notably, long non-coding RNAs (lncRNAs) are key targets of m6A modification, and their dysregulation contributes to trophoblast dysfunction—a core pathological feature of URSA. However, the m6A-mediated regulatory mechanisms of lncRNAs in URSA remain unclear. Results Global m6A levels were significantly reduced in URSA villous tissues, accompanied by downregulated expression of m6A methyltransferase RBM15B and lncRNA SCAMP1. SCAMP1 was confirmed to undergo m6A modification, and its hypomethylation in URSA decreased its stability. Functional assays showed that SCAMP1 knockdown impaired HTR-8/SVneo cell proliferation, migration, and invasion, while RBM15B regulated SCAMP1 expression via m6A methylation. Further, SCAMP1 interacted with m6A reader IGF2BP2 to regulate LIN28B mRNA stability. Silencing SCAMP1 or IGF2BP2 reduced LIN28B expression, and LIN28B overexpression partially rescued trophoblast function. Collectively, the RBM15B-SCAMP1-LIN28B axis was found to regulate trophoblast function. Conclusions Reduced m6A methylation in URSA tissues, associated with RBM15B downregulation, destabilizes lncRNA SCAMP1 and impairs trophoblast function via the IGF2BP2-LIN28B pathway. The RBM15B/SCAMP1/ IGF2BP2/LIN28B axis provides novel insights into URSA pathogenesis and suggests potential therapeutic targets. Unexplained recurrent pregnancy loss HTR-8/SVneo RBM15B SCAMP1 LIN28B Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Recurrent spontaneous abortion (RSA) is a significant clinical challenge affecting women of reproductive age, defined as the loss of two or more consecutive pregnancies before 20–24 weeks of gestation, including both embryonic and fetal losses[ 1 ]. Notably, approximately 50% of RSA cases remain unexplained (unexplained recurrent spontaneous abortion, (URSA)[ 2 ], which not only complicates subsequent pregnancies but also imposes long-term physical risks (e.g., cardiovascular diseases, venous thromboembolism) and psychological distress (e.g., anxiety, depression) on affected individuals[ 3 ]. Despite extensive investigations into potential etiologies such as chromosomal abnormalities, uterine defects, and maternal age-related factors, the molecular mechanisms driving URSA remain poorly elucidated[ 3 ]. Thus, identifying novel epigenetic regulatory pathways and molecular biomarkers is critical for improving diagnostic accuracy, developing targeted therapies, and optimizing prevention strategies for URSA. In recent years, RNA post-transcriptional modifications have emerged as key regulators of gene expression, with N6-methyladenosine (m6A) methylation standing out as the most prevalent and functionally important modification in eukaryotic mRNAs[ 4 ]. m6A methylation is dynamically regulated by a complex network of methyltransferases ("writers," e.g., METTL3, METTL14, WTAP), demethylases ("erasers," e.g., FTO, ALKBH5), and RNA-binding proteins ("readers," e.g., YTHDF family, IGF2BP family). This modification modulates nearly all stages of the RNA lifecycle, including splicing, stability, translation, and decay [ 5 – 7 ], and is involved in diverse physiological and pathological processes such as cell differentiation[ 5 ], immune responses[ 8 ], and the development of various cancers[ 4 , 9 ]. Importantly, accumulating evidence highlights the critical role of m6A methylation in female reproductive health, including oocyte maturation, embryo development[ 10 ], and female fertility[ 11 ]. Dysregulated m6A modification patterns have been implicated in several reproductive disorders, including pregnancy loss, preeclampsia, and polycystic ovary syndrome[ 12 , 13 ], suggesting that aberrant m6A-mediated gene regulation may contribute to URSA pathogenesis. Long non-coding RNAs (lncRNAs), defined as non-coding RNAs longer than 200 nucleotides, are key downstream targets of m6A modification and play pivotal roles in regulating cellular functions through chromatin remodeling, transcriptional regulation, and post-transcriptional RNA stabilization[ 14 ]. The m6A modification of lncRNAs adds an additional layer of regulatory complexity, influencing their stability, subcellular localization, and interactions with RNA-binding proteins (RBPs)[ 15 , 16 ]. In reproductive biology, lncRNAs are essential for oocyte development[ 17 ], trophoblast development[ 18 ], and implantation[ 19 ], positioning them as critical regulators of pregnancy outcomes. However, the role of m6A-modified lncRNAs in URSA remains largely unexplored, representing a significant gap in our understanding of URSA pathophysiology. Notably, many protein-coding gene loci can generate alternatively spliced lncRNA variants with independent biological functions[ 20 , 21 ]. Secretory carrier membrane protein 1 (SCAMP1) is traditionally recognized as a protein-coding gene, but its alternatively spliced variant 2 (RefSeq: NR_110885.2) is explicitly annotated as a lncRNA in RefSeq[ 22 , 23 ]. This lncRNA SCAMP1 has been implicated in oncogenic processes, such as breast cancer progression and renal cell carcinoma pathogenesis[ 22 , 23 ], but its role in reproductive disorders and whether it is regulated by N6-methyladenosine (m6A) methylation remain unknown. Given the well-established role of m6A methylation in fine-tuning lncRNA stability, subcellular localization, and functional output[ 4 , 15 ], and considering that dysregulated m6A-modified lncRNAs are increasingly linked to reproductive disorders including pregnancy loss, we hypothesized that SCAMP1 may be subjected to m6A modification, which in turn modulates its expression and biological function in trophoblast cells—key players in placental development and implantation whose dysfunction is a core pathological feature of URSA. Therefore, we aimed to systematically investigate the epitranscriptomic regulation of lncRNA SCAMP1 in URSA, focusing on: (1) its expression and m6A modification status; (2) the upstream methyltransferase responsible; (3) the downstream reader protein and effector; and (4) the functional impact of this axis on trophoblast biology. By elucidating the interplay between m6A methylation and lncRNA SCAMP1 in trophoblast biology, we seek to uncover novel molecular mechanisms underlying URSA and provide potential therapeutic targets for this clinically challenging disorder. Methods 1. Human-Tissue Samples Pregnancy villous tissues were collected from 20 women diagnosed with URSA and 20 women who underwent elective pregnancy termination for non-medical reasons (NC group) at the First Affiliated Hospital of Guangxi Medical University between January 2023 and December 2023. The URSA group included patients with two or more consecutive pregnancy losses before 24 weeks, as defined by the 2022 Chinese guidelines and international consensus[ 24 , 25 ]. The NC group was matched for gestational age and maternal age. All participants had no history of major reproductive or systemic diseases, and exclusion criteria included chromosomal abnormalities, acute infections, and adverse lifestyle factors. For the basic information of the patients, please refer to supplementary Table S1 . Both groups of specimens were collected from sterile villous tissue following electric negative pressure aspiration. Within 10 minutes of excision, the villi were isolated, cleaned, and cut into 2–4 mm pieces. One portion was fixed in 10% formalin for 48 hours, then embedded in paraffin for immunohistochemistry and pathological analysis. The remaining portions were rapidly frozen in liquid nitrogen and stored at -80°C for RNA and protein extraction. This study was conducted in accordance with the principles outlined in the Declaration of Helsinki. All experimental protocols were approved by the Ethics Committee of the First Affiliated Hospital of Guangxi Medical University (Ethics No: 2023-K057-01). Written informed consent was obtained from all participants prior to sample collection. 2. Cell culture Human cytotrophoblastic cell line HTR-8/SVneo was purchased from Pricella Company ( Wuhan, China) and was cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and Penicillin/Streptomycin antibiotics. Cells were maintained at 37°C in a 5% CO2 atmosphere. 3. Quantification of global m6A RNA was extracted from villous tissues using the Trizol method, following RNAse-free procedures. RNA concentration and purity were determined using a Nanodrop spectrophotometer, with samples having OD260/OD280 ratios between 1.8 and 2.0 considered suitable for subsequent analyses. m6A levels in total RNA were quantified using a colorimetric m6A RNA Methylation Assay Kit (P-9005, EPIGENTEK, USA) according to the manufacturer’s instructions. The relative m6A percentage was calculated using the following formula: m6A% = [(sample OD − NC OD)/S] / [(PC OD − NC OD)/P] × 100%. where S represents the input sample RNA amount (ng) and P represents the positive control input amount (ng). 4. Reverse Transcription and Quantitative Real-Time PCR (RT-qPCR) Total RNA was extracted from villus tissues, as well as HTR-8/SVneo cells using Trizol reagent. RNA concentration and quality were assessed via the 260/280 nm ratio using a Nanodrop spectrophotometer. cDNA was synthesized with a MightyScript Plus cDNA Synthesis Kit (Sangon Biotech, Shanghai, China ). qRT-PCR was performed using SYBR PrimeScript RT-PCR Kit(Takara Bio, Inc, Japan)and analyzed on the 7500 Fast Real-Time PCR System. Expression levels were normalized to β-actin, and fold changes were calculated using the 2 − ΔΔCt method. For the primers used, refer to Supplementary Table S2 5. Western Blot Assay Total protein was extracted from villous tissues and trophoblast cells, quantified, and separated by SDS-PAGE. Proteins were transferred to PVDF membranes and probed with primary antibodies against RBM15B (1:1000, Proteintech Group, Wuhan, China), IGF2BP2 and LIN28B (1:500, Proteintech Group, Wuhan, China), followed by appropriate secondary antibodies. Protein bands were visualized using an infrared fluorescence imaging system (Li-COR Odyssey Clx, USA), with quantification performed using ImageJ software. Full-length, uncropped images of all Western blots are provided in supplementary information for original full gel scans of blots. 6. Immunohistochemistry (IHC) Formalin-fixed, paraffin-embedded tissue sections were deparaffinized in xylene, rehydrated in graded ethanol, and subjected to antigen retrieval in 0.01 M citrate buffer (pH 6.0) at 95–100°C for 15 minutes. After cooling, sections were washed with PBS. Endogenous peroxidase activity was blocked with a specific inhibitor for 10 minutes, followed by incubation with 10% goat serum for 30 minutes. Sections were then incubated with primary antibodies against RBM15B (1:1000, Proteintech Group, Wuhan, China) at 4°C overnight, followed by incubation with secondary antibodies for 1 hour at room temperature. Images were captured under a light microscope (Nikon, Tokyo, Japan). RBM15B nuclear staining was assessed for each case. Staining intensity and the proportion of positive cells were used as criteria for quantitative scoring. The staining intensity was classified as follows: no staining (0), weak positive (1), moderate positive (2), and strong positive (3). The proportion of positive cells was scored as: ≤25% (1), 26%–50% (2), 51%–75% (3), and 76%–100% (4). The final score was calculated by multiplying the intensity score by the proportion score. A total score of ≤ 5 was defined as negative, while a score > 5 was defined as positive[ 26 , 27 ]. 7. Construction of stable cell line GenePharma (Shanghai, China) designed and synthesized short hairpin RNAs (shRNAs) targeting SCAMP1 and IGF2BP2, as well as the control shRNA. Lentiviruses for RBM15B overexpression, LIN28B overexpression, and their respective controls were obtained from Hanbio Biotechnology (Shanghai, China). HTR-8/SVneo cells were infected with the lentiviruses at a multiplicity of infection (MOI) of 30 and subsequently selected using puromycin (5 µg/mL) to establish stable cell lines. Transfection efficiency was assessed 48 hours post-infection using qRT-PCR and western blotting. 8. Plasmid construction Lipofectamine 3000 (Thermo Fisher Scientific, USA) was used to perform siRNA and plasmid transfections following the manufacturer’s instructions. Briefly, HTR-8/SVneo cells were plated in 6-well plates and transfected with siRNAs at a final concentration of 50 nM. After 48 hours, cells were collected for RNA and protein extraction to assess knockdown efficiency. RBM15B and SCAMP1 siRNAs were designed and synthesized by GenePharma (Suzhou, China), and the sequences are provided in Table S3. 9. Gene-Specific MeRIP-qPCR To quantify m6A-modified SCAMP1 levels, methylated RNA immunoprecipitation (MeRIP) was conducted following previously reported protocols. The EpiQuik™ CUT&RUN m6A RNA Enrichment Kit (P-9018, EPIGENTEK, USA) was employed according to the manufacturer's instructions. In brief, total RNA was extracted and treated with DNase I to eliminate genomic DNA contamination. For input samples, 200–400 ng of mRNA was reserved. Approximately 10 µg of total RNA was combined with an immunocapture solution consisting of 174–189 µL immune capture buffer, 2 µL m6A antibody (or non-immune IgG), 5–20 µL RNA sample, and 4 µL affinity beads. The mixture was incubated at room temperature on a rotating platform for 90 minutes. Next, 10 µL Nucleic Digestion Enhancer and 2 µL Cleavage Enzyme Mix were added, followed by a 4-minute incubation at room temperature. After three washes with wash buffer, the m6A-immunoprecipitated RNA was resuspended in 20 µL protein digestion solution (proteinase K diluted 1:10 in protein digestion buffer) and incubated at 55°C for 15 minutes in a thermocycler without a heated lid. The solution was then transferred to a new PCR tube, and 20 µL RNA purification solution, 160 µL 100% ethanol, and 2 µL RNA-binding beads were added. After a 5-minute incubation at room temperature, the RNA was bound to the beads, and the m6A-enriched RNA was eluted with 13 µL elution buffer. Subsequent quantification of the cDNA products was performed as outlined in the RT-qPCR procedure. Primers for SCAMP1 were designed to specifically target the lncRNA variant 2 (NR_110885.2) and avoid cross-reactivity with the protein-coding variant (NM_004866.6). The specificity of the primers was verified by BLAST against the human genome database and Sanger sequencing of the PCR products. The qRT-PCR primers for the SCAMP1 gene were as follows: SCAMP1 primer for MeRIP-qPCR #1: Forward: 5’- ACCAACAGAGGAACATCCAGC − 3’ Reverse: 5’- TCCCGACGATCTAATTCTGCG − 3’ Relative m6A mRNA expression levels were determined using the 2−(∆∆Ct) method. 10. HTR-8/SVneo Functional Assays Cell Proliferation Assay (CCK-8) Cell viability was assessed using the Cell Counting Kit-8 (CCK-8). Transfected HTR-8/SVneo cells were seeded in 96-well plates, and absorbance was measured at 450 nm at 8, 24, 48, and 72 hours. Scratch Migration Assay The migration capacity of transfected cells was evaluated using a scratch wound healing assay. Cells were seeded in 6-well plates, and the wound closure was monitored by imaging at 0 and 24 hours. Transwell Invasion Assay Invasion potential was assessed using Transwell chambers coated with Matrigel. Transfected cells were seeded in the upper chamber, and the migrated cells were fixed, stained, and counted after 24 hours. 11. RNA Immunoprecipitation (RIP) RNA-binding protein interactions with SCAMP1 were analyzed using the RNA immunoprecipitation (RIP) assay, following the manufacturer's protocol (Bersinbio, Guangzhou, China). HTR-8/SVneo cells were lysed, and the cell lysates were incubated with magnetic beads conjugated to IGF2BP2 antibodies. Co-precipitated RNAs were then purified and analyzed by qRT-PCR to confirm the binding of IGF2BP2 to SCAMP1. 12. RNA stability assay The RNA stability assay was performed as previously described[ 28 ].Briefly, cells were seeded in 6-well plates and cultured overnight. Actinomycin D (5 µg/ml, Cell Signaling Technology, Danvers, MA, USA)) was then added to HTR8/SVneo cells to inhibit transcription for the indicated time points. RNA was subsequently extracted and quantified by RT-qPCR. The RNA levels at each time point were normalized to β-actin. 13. Statistical Analysis All experiments were performed with at least three independent biological replicates, and data are presented as mean ± standard deviation (SD). GraphPad Prism 8 (GraphPad Software, La Jolla, CA, USA)was used to statistically analyze all data. Paired t-tests were used to compare the villous tissues of URSA and those of normal Pregnancies. Meanwhile, independent samples t-tests were used for other comparisons between two groups, and one-way ANOVA was used for comparisons among multiple groups. A p-value of 0.05 or lower was regarded as statistically significant. Results 1. Reduced m6A RNA Methylation in URSA Is Associated with RBM15B Downregulation Previous studies have suggested that impaired RNA methylation could play a role in the pathogenesis of recurrent miscarriage[ 29 ]. To explore this hypothesis in URSA, we first measured global m6A RNA modification levels in chorionic villous tissues from URSA patients (n = 20) and healthy early pregnancy termination controls (n = 20) using a colorimetric assay. The results revealed that m6A modification levels were significantly reduced in the URSA group compared to the control group (P < 0.0001, Fig. 1 A). To investigate the potential molecular basis for this reduction, we analyzed GEO datasets (GSE43256 and GSE22490) for differentially expressed genes related to RNA methylation. Both datasets identified RBM15B, a key m6A methyltransferase, as significantly downregulated in URSA tissues(Figure 1BC). This finding raised the possibility that RBM15B downregulation might contribute to the observed m6A reduction. To validate the bioinformatics predictions, we performed RT-qPCR, IHC, and western blot analyses on clinical samples. Consistently, RBM15B expression was significantly lower in the URSA group than in controls at both the mRNA and protein levels (Figs. 1 D–F). Moreover, IHC revealed that RBM15B was predominantly localized in the nuclei of trophoblast cells, which aligns with its function as a methyltransferase. 2. RBM15B Regulates Trophoblast Proliferation, Migration, and Invasion in URSA To further investigate the functional role of RBM15B in URSA, we generated RBM15B knockdown and overexpression models in HTR-8/SVneo cells. Among the tested siRNAs, si-297 exhibited the highest knockdown efficiency, as confirmed by RT-qPCR and Western blot (Fig. 2AB), and was selected for subsequent experiments. Stable overexpression of RBM15B was achieved using lentiviral transduction, and successful overexpression was verified at both mRNA and protein levels (Fig. 2CD). Cell proliferation, migration, and invasion were then assessed. Knockdown of RBM15B resulted in significantly reduced proliferation, as indicated by lower absorbance values in the CCK-8 assay over three days (Fig. 2 E). Conversely, RBM15B overexpression enhanced proliferation (Fig. 2 F). Migration assays revealed that RBM15B knockdown inhibited cell movement (Fig. 2GH), while overexpression promoted migration (Fig. 2IJ). Similarly, transwell assays showed that RBM15B knockdown decreased invasion (Fig. 2KL), whereas overexpression increased the number of invading cells (Fig. 2MN). These findings confirm that RBM15B plays a crucial role in regulating trophoblast cell function, with its downregulation impairing key cellular processes, which may contribute to the pathogenesis of URSA. 3.RBM15B Regulates SCAMP1 Expression via m6A Modifications Building on our previous findings that global m6A methylation is dysregulated in URSA and that the m6A "writer" RBM15B contributes to this epigenetic aberration by regulating trophoblast function, we next focused on investigating the prespecified lncRNA SCAMP1 (RefSeq: NR_110885.2)—a key candidate of interest from our study design—with the goal of clarifying whether SCAMP1 is subjected to m6A modification and if this modification is dysregulated in URSA, whether RBM15B directly regulates SCAMP1 through m6A methylation, and the functional significance of SCAMP1 in URSA pathogenesis. To initially assess the potential for m6A-mediated regulation of SCAMP1, we used the SRAMP tool[ 30 ], to predict m6A modification sites, identifying three highly reliable candidates at positions 313, 334, and 756 (Fig. 3 A). We then validated these predictions and addressed our core research questions through analyses of SCAMP1 expression, m6A methylation status, and functional effects in trophoblast cells and clinical samples. We first assessed SCAMP1 expression in trophoblast tissues from 20 normal and 20 URSA patients. SCAMP1 expression was significantly downregulated in the URSA group compared to the control group (P < 0.05, Fig. 3 B), suggesting its potential involvement in URSA pathogenesis. Next, we evaluated the m6A modification of SCAMP1 using MeRIP-qPCR to confirm its modification status in HTR-8/SVneo cells. Our results demonstrated that SCAMP1 undergoes m6A modification at key sites (Figure 3 C), with a notable reduction in m6A modification in URSA patient samples ༈Figure 3 D༉, indicating a potential link between impaired m6A modification and reduced SCAMP1 expression in URSA. To investigate the functional significance of SCAMP1, we transfected HTR-8/SVneo cells with three siRNAs targeting SCAMP1. After 48 hours, RT-qPCR analysis showed significant downregulation of SCAMP1 in all siRNA groups compared to the negative control (Fig. 3 E). si-SCAMP1-565, with the highest transfection efficiency, was selected for further experiments. We then generated stable SCAMP1 knockdown cell lines using lentiviral vectors (Fig. 3 F) for subsequent functional assays. Knockdown of SCAMP1 in HTR-8/SVneo cells led to a significant decrease in cell proliferation, migration, and invasion, as assessed by CCK-8, wound healing, and transwell invasion assays (Figure 3 G-K). These findings indicate that SCAMP1 plays a crucial role in regulating trophoblast cell functions that are essential for placental development and implantation, and its downregulation may impair these processes. Based on the methyltransferase characteristics of RBM15B, we speculate that RBM15B regulates SCAMP1 in an m6A-dependent manner. Knockdown of RBM15B in HTR-8/SVneo cells resulted in a significant reduction in both overall m6A levels (Figure 3 L) and the m6A modification of SCAMP1༈Figure 3 M༉, which was accompanied by a corresponding decrease in SCAMP1 expression ༈Figure 3 M༉. In contrast, stable overexpression of RBM15B led to an increase in both SCAMP1 m6A modification and SCAMP1 expression ༈Figure 3 O-Q༉. These results indicate that RBM15B regulates SCAMP1 expression through m6A methylation. Given that m6A modification is known to influence RNA stability, we hypothesized that RBM15B might regulate SCAMP1 mRNA stability through m6A modification. To test this, we treated HTR-8/SVneo cells with actinomycin D and measured SCAMP1 mRNA decay rates after stable overexpression of RBM15B. As shown in Fig. 3 R, compared to the empty vector group, SCAMP1 mRNA degradation was significantly slower in the RBM15B overexpression group at 3 hours, 6 hours, and 9 hours, with statistically significant differences (P < 0.01, P < 0.01, P < 0.05). These results suggest that RBM15B increases SCAMP1 mRNA stability by enhancing its m6A modification. 4. IGF2BP2 Identified as a Key m6A Reader Mediating SCAMP1 Regulation in URSA Having confirmed the m6A-dependent regulation of SCAMP1, we next investigated its functional role by identifying potential m6A readers that interpret the m6A modification of SCAMP1 and mediate its biological functions. Bioinformatics analyses using public databases, including StarBase, RPIseq, and catRAPID, highlighted IGF2BP2 and IGF2BP3—members of the IGF2BP family recognized as m6A readers—as likely SCAMP1-binding proteins (Fig. 4 A). To identify the specific m6A reader for SCAMP1, we conducted RT-qPCR to examine the expression levels of IGF2BP family members following SCAMP1 knockdown. Interestingly, knockdown of SCAMP1 resulted in a significant upregulation of IGF2BP2 mRNA levels, while the expression of IGF2BP1 and IGF2BP3 remained unchanged (Fig. 4 B). Clinical samples from the URSA cohort further supported this finding, showing significantly elevated IGF2BP2 mRNA levels compared to controls (Fig. 4 C). These observations led us to hypothesize that reduced m6A modification of SCAMP1 might influence the expression of its m6A reader, suggesting a potential reciprocal regulatory mechanism between SCAMP1 and IGF2BP2. To test this hypothesis, we performed RNA immunoprecipitation (RIP) assays in HTR-8/SVneo cells. The results demonstrated that SCAMP1 was significantly enriched in IGF2BP2 precipitates (Fig. 4 D), confirming IGF2BP2 as a direct m6A reader of SCAMP1. 5. SCAMP1-IGF2BP2 Complex Regulates LIN28B mRNA Stability and Trophoblast Functions To investigate the functional role of SCAMP1 within the SCAMP1-IGF2BP2 complex, we first analyzed its subcellular localization, as the cellular distribution of lncRNAs is critical for their functional roles[ 31 ]. Bioinformatics predictions using lncLocator and iLoc-LncRNA indicated that SCAMP1 predominantly resides in the cytoplasm. This was experimentally validated through nuclear-cytoplasmic fractionation in HTR-8/SVneo trophoblast cells, followed by RT-qPCR with U2sn (nuclear marker) and S14 (cytoplasmic marker). The results confirmed that SCAMP1 is primarily localized in the cytoplasm (Fig. 5 A). These suggested that SCAMP1 is involved in post-transcriptional regulatory processes, such as mRNA stability, translation efficiency, and protein post-translational modifications. Given that IGF2BP2 is known to stabilize target mRNAs through its conserved RNA-binding domains, we hypothesized that SCAMP1 cooperates with IGF2BP2 to regulate the stability of downstream genes, potentially contributing to the pathogenesis of URSA. To identify shared target genes, we integrated transcriptomic data from the GSE21575 dataset, which profiles differentially expressed mRNAs following the knockdown of all three IGF2BP family proteins, with SCAMP1-bound mRNAs predicted by StarBase. After filtering for |logFC| > 1 and adj.P.Val < 0.05, we identified 89 overlapping targets (Table S4). Among these, LIN28B emerged as a candidate of interest due to its low expression in trophoblast tissues from recurrent pregnancy loss patients and its critical role in trophoblast proliferation, migration, and invasion[ 32 , 33 ]. This prompted us to hypothesize that SCAMP1 and IGF2BP2 co-regulate LIN28B expression. To further validate LIN28B as a downstream target of IGF2BP2 and SCAMP1, we examined LIN28B protein expression in HTR-8/SVneo cells with stable knockdown of IGF2BP2 (sh-IGF2BP2, Fig. 5 B) or SCAMP1 (sh-SCAMP1). Western blot analysis revealed that knockdown of either IGF2BP2 or SCAMP1 significantly reduced LIN28B protein levels (Fig. 5 C). We next explored whether IGF2BP2 and SCAMP1 regulate LIN28B at the post-transcriptional level by influencing its mRNA stability. Using actinomycin D treatment to assess LIN28B mRNA decay in HTR-8/SVneo cells, we found that stable knockdown of either IGF2BP2 or SCAMP1 accelerated LIN28B mRNA degradation compared to the control group, with statistically significant differences (Fig. 5 D). Previous studies have shown that lncRNAs can influence the binding of RNA-binding proteins (RBPs) to their target genes. To determine if SCAMP1 mediates the interaction between IGF2BP2 and LIN28B, we performed RIP assays in HTR-8/SVneo cells with stable SCAMP1 knockdown. The results demonstrated that SCAMP1 knockdown reduced the binding of IGF2BP2 to LIN28B mRNA, with statistical significance (Fig. 5 E, p < 0.01). These findings further support the role of SCAMP1 in regulating the interaction between IGF2BP2 and LIN28B. To explore whether upregulation of LIN28B expression can rescue the effects of SCAMP1 and IGF2BP2 knockdown on HTR-8/SVneo cell function, we overexpressed LIN28B in cells with stable knockdown of SCAMP1 and IGF2BP2. Western blot analysis showed that overexpression of LIN28B partially restored the reduced LIN28B protein levels caused by SCAMP1 and IGF2BP2 knockdown (Fig. 5 F). Furthermore, upregulation of LIN28B partially rescued the inhibitory effects of IGF2BP2 knockdown on cell proliferation, migration, and invasion (Fig. 5 G-K). Compared to the control group, cells with stable IGF2BP2 knockdown exhibited significantly reduced proliferation, migration, and invasion. Notably, cells overexpressing LIN28B (shIGF2BP2 + LIN28B) exhibited higher proliferation rates and increased migration and invasion compared to cells with IGF2BP2 knockdown alone (shIGF2BP2). These results suggest that upregulation of LIN28B can partially restore cellular functions inhibited by IGF2BP2 knockdown. A similar trend was observed in the SCAMP1 knockdown rescue experiment with LIN28B overexpression, with detailed results shown in Fig. 6 A-C. These findings further underscore the potential role of LIN28B in reversing the functional effects of SCAMP1 knockdown in HTR-8/SVneo cells. Discussion Recurrent spontaneous abortion of unknown etiology (URSA) presents a formidable challenge due to the absence of clear mechanistic underpinnings. Our study unveils a novel epitranscriptomic pathway contributing to URSA pathogenesis. We demonstrate that global m6A hypomethylation in URSA villi is linked to the downregulation of the methyltransferase RBM15B. Functionally, RBM15B deficiency directly impairs trophoblast proliferation, migration, and invasion—processes vital for successful implantation. At the molecular level, we identify the long non-coding RNA SCAMP1 as a critical substrate of RBM15B. In URSA, reduced RBM15B-mediated m6A modification destabilizes SCAMP1 transcripts, leading to its downregulation. This loss of SCAMP1 disrupts its interaction with the m6A reader protein IGF2BP2, thereby compromising the stability of LIN28B mRNA, a well-established promoter of trophoblast invasiveness. Collectively, our work delineates a coherent RBM15B-SCAMP1-IGF2BP2-LIN28B regulatory axis, providing a direct link between aberrant m6A methylation and trophoblast dysfunction in URSA. The role of m6A methylation in female reproductive health is increasingly recognized, with dysregulation implicated in disorders such as preeclampsia and recurrent miscarriage[ 12 , 13 , 29 , 34 ]. While studies have often focused on core methyltransferases like METTL3/METTL14[ 11 , 34 ], our findings highlight RBM15B as a pivotal and underappreciated regulator in trophoblast biology. RBM15B, along with its paralog RBM15, is known to recruit the m6A methyltransferase complex to specific RNA targets, including lncRNAs like XIST, to mediate transcriptional silencing[ 35 ]. Our data extend this function to the realm of placental development. The pronounced nuclear localization of RBM15B in trophoblasts and its significant downregulation in URSA suggest that it governs a specific subset of m6A modifications crucial for early pregnancy maintenance. This positions RBM15B not merely as a redundant writer but as a specialized epigenetic regulator whose loss-of-function may represent a distinct sub-type of URSA characterized by lncRNA dysregulation. The functional consequences of m6A modification are profoundly influenced by its effects on different RNA species. For lncRNAs, m6A can act as a structural “switch” altering RBP binding, a recruitment signal for readers[ 36 , 37 ], or a determinant of RNA stability[ 38 , 39 ]. Our study on SCAMP1 offers a concrete example of this regulation in a reproductive pathology context. We show that m6A modification, catalyzed by RBM15B, is essential for SCAMP1 stability. The subsequent cytoplasmic SCAMP1-IGF2BP2 interaction exemplifies how an m6A-modified lncRNA can serve as a scaffold or co-factor for a stabilizing reader protein. A particularly intriguing observation is the concomitant upregulation of IGF2BP2 mRNA in URSA tissues despite reduced SCAMP1 m6A modification and expression. While the precise mechanism awaits further investigation, this dissociation between reader and target expression aligns with the concept of compensatory feedback within dysregulated networks. Cells may attempt to counteract the loss of functional SCAMP1-IGF2BP2 complexes by increasing IGF2BP2 abundance. Alternatively, IGF2BP2 upregulation may represent an independent pathological event driven by the URSA microenvironment, as IGF2BP2 is known to be transcriptionally activated by various stress and oncogenic signals[ 40 , 41 ]. Regardless of the trigger, our RIP and functional data demonstrate that this elevated IGF2BP2 is insufficient to restore LIN28B stabilization, revealing a critical functional uncoupling within the axis. This imbalance—where the writer (RBM15B) and a key substrate (SCAMP1) are deficient, while the reader (IGF2BP2) is paradoxically abundant but ineffective—epitomizes the profound epitranscriptomic dysregulation in URSA. The convergence of the RBM15B-SCAMP1-IGF2BP2 axis on LIN28B underscores its role as a critical effector in trophoblast function. LIN28B, an RNA-binding protein that promotes proliferation and invasion by repressing let-7 miRNA and stabilizing mRNAs like IGF2, is vital for placental development[ 32 , 33 , 42 ]. Our data mechanistically connect upstream epitranscriptomic regulation to this key protein: reduced SCAMP1/IGF2BP2 interaction accelerates LIN28B mRNA decay. The partial but significant rescue of proliferation, migration, and invasion upon LIN28B overexpression in SCAMP1- or IGF2BP2-deficient cells powerfully validates LIN28B as the major functional output of this pathway. It also suggests that while LIN28B is a dominant downstream target, other effectors are likely to contribute to the full phenotypic spectrum, inviting future exploration. Limitations of the study Despite its strengths, we acknowledge several limitations that define the scope of our study and chart future directions. First, while the HTR-8/SVneo cell line is a validated model for human extravillous trophoblast function, validation in primary human trophoblasts and in vivo models (e.g., using conditional knockout mice) is essential to confirm the physiological relevance of this axis. Second, our clinical sample size, though statistically informative, warrants expansion in multi-center cohorts to assess the generalizability and diagnostic power of these markers. Third, the upstream drivers of RBM15B downregulation in URSA—whether transcriptional, post-translational, or due to genetic variants—remain an open and critical question. Finally, the potential involvement of other m6A writers or readers in the global hypomethylation phenotype observed in URSA merits investigation. Addressing these points will be crucial in translating our mechanistic findings into clinical impact. Conclusion Our study identifies the RBM15B-SCAMP1-IGF2BP2-LIN28B axis as a crucial regulatory circuit linking epitranscriptomic information to cellular function in the placenta. By demonstrating how a defect in m6A “writing” on a specific lncRNA cascades into impaired RNA “reading” and destabilization of a key pro-trophoblast factor, we provide a novel molecular framework for understanding URSA. This work not only deepens our knowledge of RNA methylation in reproductive biology but also illuminates new potential pathways for diagnosis and therapeutic development in this distressing condition. Abbreviations RSA recurrent spontaneous abortion URSA unexplained recurrent spontaneous abortion RBM15B RNA binding motif protein 15B SCAMP1 secretory carrier membrane protein 1 LIN28B protein lin-28 homolog B IGF2BPs insulin-like growth factor 2 mRNA-binding proteins GEO Gene Expression Omnibus m6A N6-methyladenosine Declarations Ethics statement The studies involving human participants were reviewed and approved by Ethics Committee of The First Affiliated Hospital of Guangxi Medical University. The patients provided their written informed consent to participate in this study. Declaration of interests None. Consent for Publication All participants included in this study provided written informed consent for the publication of the data obtained from their samples. Funding This research was funded by grants from the National Natural Science Foundation of China (Nos. 81960281, 82260306);The construction of clinical intervention protocols Guangxi key R&D program (Guike AB20159031 ༛AB24010080 ༉, and Clinical Research Climbing Program Innovation Project of the First Affiliated Hospital of Guangxi Medical University (NO YYZS202008). Author Contribution Juntao Feng, Zhiwei Zhu and Lihong Pang conceived and designed research; Juntao Feng and Shisi Wei performed experiments; Changqiang Wei, Zhiwei Zhu and Yiyun Wei analysed data; Ling Shi and Wenyao Jing interpreted results of experiments and prepared figures; Juntao Feng drafted manuscript; Zhiwei Zhu revised the manuscript; Lihong Pang approved final version of manuscript. Acknowledgments None. Data Availability The datasets generated and/or analyzed during the current study are available in the Gene Expression Omnibus (GEO) repository under accession numbers GSE43256 and GSE22490. Other raw data and materials supporting the findings of this study are available from the corresponding author upon reasonable request. References Dimitriadis E, Menkhorst E, Saito S, Kutteh WH, Brosens JJ. Recurrent pregnancy loss. Nat reviews Disease primers. 2020;6(1):98. Arias-Sosa LA, Acosta ID, Lucena-Quevedo E, Moreno-Ortiz H, Esteban-Perez C, Forero-Castro M. Genetic and epigenetic variations associated with idiopathic recurrent pregnancy loss. J Assist Reprod Genet. 2018;35(3):355–66. Quenby S, Gallos ID, Dhillon-Smith RK, Podesek M, Stephenson MD, Fisher J, Brosens JJ, Brewin J, Ramhorst R, Lucas ES, et al. Miscarriage matters: the epidemiological, physical, psychological, and economic costs of early pregnancy loss. Lancet. 2021;397(10285):1658–67. Jiang X, Liu B, Nie Z, Duan L, Xiong Q, Jin Z, Yang C, Chen Y. The role of m6A modification in the biological functions and diseases. Signal Transduct Target Ther. 2021;6(1):74. Zhao X, Yang Y, Sun BF, Shi Y, Yang X, Xiao W, Hao YJ, Ping XL, Chen YS, Wang WJ, et al. FTO-dependent demethylation of N6-methyladenosine regulates mRNA splicing and is required for adipogenesis. Cell Res. 2014;24(12):1403–19. Xiao W, Adhikari S, Dahal U, Chen YS, Hao YJ, Sun BF, Sun HY, Li A, Ping XL, Lai WY, et al. Nuclear m(6)A Reader YTHDC1 Regulates mRNA Splicing. Mol Cell. 2016;61(4):507–19. Wang X, Zhao BS, Roundtree IA, Lu Z, Han D, Ma H, Weng X, Chen K, Shi H, He C. N(6)-methyladenosine Modulates Messenger RNA Translation Efficiency. Cell. 2015;161(6):1388–99. Zhang L, Li Y, Zhou L, Zhou H, Ye L, Ou T, Hong H, Zheng S, Zhou Z, Wu K, et al. The m6A Reader YTHDF2 Promotes Bladder Cancer Progression by Suppressing RIG-I-Mediated Immune Response. Cancer Res. 2023;83(11):1834–50. An Y, Duan H. The role of m6A RNA methylation in cancer metabolism. Mol Cancer. 2022;21(1):14. Wang Y, Yang C, Sun H, Jiang H, Zhang P, Huang Y, Liu Z, Yu Y, Xu Z, Xiang H, Yi C. The Role of N6-methyladenosine Modification in Gametogenesis and Embryogenesis: Impact on Fertility. Genom Proteom Bioinform 2024, 22(4). Wan S, Sun Y, Zong J, Meng W, Yan J, Chen K, Wang S, Guo D, Xiao Z, Zhou Q, et al. METTL3-dependent m(6)A methylation facilitates uterine receptivity and female fertility via balancing estrogen and progesterone signaling. Cell Death Dis. 2023;14(6):349. Chen J, Fang Y, Xu Y, Sun H. Role of m6A modification in female infertility and reproductive system diseases. Int J Biol Sci. 2022;18(9):3592–604. Huang E, Chen L. RNA N(6)-methyladenosine modification in female reproductive biology and pathophysiology. Cell Commun Signal. 2023;21(1):53. Qian X, Zhao J, Yeung PY, Zhang QC, Kwok CK. Revealing lncRNA Structures and Interactions by Sequencing-Based Approaches. Trends Biochem Sci. 2019;44(1):33–52. Jin Y, Fan Z. New insights into the interaction between m6A modification and lncRNA in cancer drug resistance. Cell Prolif. 2024;57(4):e13578. Herman AB, Tsitsipatis D, Gorospe M. Integrated lncRNA function upon genomic and epigenomic regulation. Mol Cell. 2022;82(12):2252–66. Iyyappan R, Aleshkina D, Zhu L, Jiang Z, Kinterova V, Susor A. Oocyte specific lncRNA variant Rose influences oocyte and embryo development. Non-coding RNA Res. 2021;6(2):107–13. Kong X, Li R, Chen M, Zheng R, Wang J, Sun C, Qu Y. Endogenous retrovirus HERVH-derived lncRNA UCA1 controls human trophoblast development. Proc Natl Acad Sci USA. 2024;121(12):e2318176121. Feng C, Shen JM, Lv PP, Jin M, Wang LQ, Rao JP, Feng L. Construction of implantation failure related lncRNA-mRNA network and identification of lncRNA biomarkers for predicting endometrial receptivity. Int J Biol Sci. 2018;14(10):1361–77. Ma S, Chen C, Ji X, Liu J, Zhou Q, Wang G, Yuan W, Kan Q, Sun Z. The interplay between m6A RNA methylation and noncoding RNA in cancer. J Hematol Oncol. 2019;12(1):121. Huang H, Weng H, Chen J. m(6)A Modification in Coding and Non-coding RNAs: Roles and Therapeutic Implications in Cancer. Cancer Cell. 2020;37(3):270–88. Vadakekolathu J, Al-Juboori SIK, Johnson C, Schneider A, Buczek ME, Di Biase A, Pockley AG, Ball GR, Powe DG, Regad T. Correction: MTSS1 and SCAMP1 cooperate to prevent invasion in breast cancer. Cell Death Dis. 2020;11(3):205. Shao Q, Wang Q, Wang J. LncRNA SCAMP1 regulates ZEB1/JUN and autophagy to promote pediatric renal cell carcinoma under oxidative stress via miR-429. Biomed Pharmacother. 2019;120:109460. RPL, EGGo B, Atik R, Christiansen OB, Elson J, Kolte AM, Lewis S, Middeldorp S, Nelen W, Peramo B, Quenby S, et al. ESHRE guideline: recurrent pregnancy loss. Hum Reprod open. 2018;2018(2):hoy004. Practice Committee of the American Society for Reproductive M. Evaluation and treatment of recurrent pregnancy loss: a committee opinion. Fertil Steril. 2012;98(5):1103–11. Russell-Goldman E, Hornick JL, Qian X, Jo VY. NKX2.2 immunohistochemistry in the distinction of Ewing sarcoma from cytomorphologic mimics: Diagnostic utility and pitfalls. Cancer Cytopathol. 2018;126(11):942–9. Guo Z, Zhang X, Zhu H, Zhong N, Luo X, Zhang Y, Tu F, Zhong J, Wang X, He J, Huang L. TELO2 induced progression of colorectal cancer by binding with RICTOR through mTORC2. Oncol Rep. 2021;45(2):523–34. Chen K, Zhang J, Meng L, Kong L, Lu M, Wang Z, Wang W. The epigenetic downregulation of LncGHRLOS mediated by RNA m6A methylase ZCCHC4 promotes colorectal cancer tumorigenesis. J experimental Clin cancer research: CR. 2024;43(1):44. Li XC, Jin F, Wang BY, Yin XJ, Hong W, Tian FJ. The m6A demethylase ALKBH5 controls trophoblast invasion at the maternal-fetal interface by regulating the stability of CYR61 mRNA. Theranostics. 2019;9(13):3853–65. Zhou Y, Zeng P, Li YH, Zhang Z, Cui Q. SRAMP: prediction of mammalian N6-methyladenosine (m6A) sites based on sequence-derived features. Nucleic Acids Res. 2016;44(10):e91. Bridges MC, Daulagala AC, Kourtidis A. LNCcation: lncRNA localization and function. J Cell Biol 2021, 220(2). Canfield J, Arlier S, Mong EF, Lockhart J, VanWye J, Guzeloglu-Kayisli O, Schatz F, Magness RR, Lockwood CJ, Tsibris JCM, et al. Decreased LIN28B in preeclampsia impairs human trophoblast differentiation and migration. FASEB J. 2019;33(2):2759–69. Huang Q, Niu Y, Song L, Huang J, Wang C, Ma T. Does LIN28B gene dysregulation make women more likely to abort? Reprod Fertil. 2021;2(3):211–20. Huang N, Gao Y, Zhang M, Guo L, Qin L, Liao S, Wang H. METTL3-Mediated m(6)A RNA Methylation of ZBTB4 Interferes With Trophoblast Invasion and Maybe Involved in RSA. Front Cell Dev Biol. 2022;10:894810. Patil DP, Chen CK, Pickering BF, Chow A, Jackson C, Guttman M, Jaffrey SR. m(6)A RNA methylation promotes XIST-mediated transcriptional repression. Nature. 2016;537(7620):369–73. Liu N, Dai Q, Zheng G, He C, Parisien M, Pan T. N(6)-methyladenosine-dependent RNA structural switches regulate RNA-protein interactions. Nature. 2015;518(7540):560–4. Dai F, Wu Y, Lu Y, An C, Zheng X, Dai L, Guo Y, Zhang L, Li H, Xu W, Gao W. Crosstalk between RNA m(6)A Modification and Non-coding RNA Contributes to Cancer Growth and Progression. Mol Ther Nucleic Acids. 2020;22:62–71. Chang YZ, Chai RC, Pang B, Chang X, An SY, Zhang KN, Jiang T, Wang YZ. METTL3 enhances the stability of MALAT1 with the assistance of HuR via m6A modification and activates NF-kappaB to promote the malignant progression of IDH-wildtype glioma. Cancer Lett. 2021;511:36–46. Xue L, Li J, Lin Y, Liu D, Yang Q, Jian J, Peng J. m(6) A transferase METTL3-induced lncRNA ABHD11-AS1 promotes the Warburg effect of non-small-cell lung cancer. J Cell Physiol. 2021;236(4):2649–58. Hu C, Liu T, Han C, Xuan Y, Jiang D, Sun Y, Zhang X, Zhang W, Xu Y, Liu Y, et al. HPV E6/E7 promotes aerobic glycolysis in cervical cancer by regulating IGF2BP2 to stabilize m(6)A-MYC expression. Int J Biol Sci. 2022;18(2):507–21. Yao B, Zhang Q, Yang Z, An F, Nie H, Wang H, Yang C, Sun J, Chen K, Zhou J, et al. CircEZH2/miR-133b/IGF2BP2 aggravates colorectal cancer progression via enhancing the stability of m(6)A-modified CREB1 mRNA. Mol Cancer. 2022;21(1):140. Wang T, Wang G, Hao D, Liu X, Wang D, Ning N, Li X. Aberrant regulation of the LIN28A/LIN28B and let-7 loop in human malignant tumors and its effects on the hallmarks of cancer. Mol Cancer. 2015;14:125. Additional Declarations No competing interests reported. Supplementary Files SupplementalInformationDocument2.docx SupplementalInformationDocument1.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8695999","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":585188739,"identity":"6e2bbc7d-e356-4451-940c-4392df39bdec","order_by":0,"name":"juntao feng","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9UlEQVRIiWNgGAWjYBAC9gYgIQFmMh+AiiXg18JzAKIFiNhgSonRAtHFY0CkFvbewy8s2+7U8bf3fH7Nm3OYgZ89x4Dh5w48WnjOpVlItj2TkDhzdpvlzG2HGSR73hgw9p7BrcVeIsfMQLLtsATDjdxtBh+BWgxu5BgwM7bhsUX+DUSL/I2cZwaJQC32BLVI8Bg/AGkBGs78AGyLBCEtPDlmDBLnDktuPHPMjHHmtnQeiTPPCg724tPCfsb4s0TZYX65482PP/Nus5bjb0/e+OAnHi1AwCYtAWWAaB4Q6wBeDcCE8vEDlPGBgMpRMApGwSgYoQAA73xRV9fn0TgAAAAASUVORK5CYII=","orcid":"","institution":"First Affiliated Hospital of GuangXi Medical University","correspondingAuthor":true,"prefix":"","firstName":"juntao","middleName":"","lastName":"feng","suffix":""},{"id":585188740,"identity":"dad23049-fa1e-42cb-87cd-07b555425c62","order_by":1,"name":"Zhiwei Zhu","email":"","orcid":"","institution":"University College London","correspondingAuthor":false,"prefix":"","firstName":"Zhiwei","middleName":"","lastName":"Zhu","suffix":""},{"id":585188743,"identity":"803db3c0-8075-4d03-99a6-31a068ea8c53","order_by":2,"name":"shisi wei","email":"","orcid":"","institution":"First Affiliated Hospital of GuangXi Medical University","correspondingAuthor":false,"prefix":"","firstName":"shisi","middleName":"","lastName":"wei","suffix":""},{"id":585188745,"identity":"11bbe3cd-e724-4fdb-b23b-014dc3a4d8f8","order_by":3,"name":"Yiyun Wei","email":"","orcid":"","institution":"First Affiliated Hospital of GuangXi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yiyun","middleName":"","lastName":"Wei","suffix":""},{"id":585188747,"identity":"8ae3dd40-ef77-4715-9558-de658c787393","order_by":4,"name":"Changqiang Wei","email":"","orcid":"","institution":"First Affiliated Hospital of GuangXi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Changqiang","middleName":"","lastName":"Wei","suffix":""},{"id":585188749,"identity":"7ed18404-a84d-41ed-b3cb-dac46ee00b15","order_by":5,"name":"Ling Shi","email":"","orcid":"","institution":"First Affiliated Hospital of GuangXi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ling","middleName":"","lastName":"Shi","suffix":""},{"id":585188750,"identity":"cfea0ea2-75e3-4dfa-a8a6-30aed7c5cec4","order_by":6,"name":"Wenyao Jing","email":"","orcid":"","institution":"First Affiliated Hospital of GuangXi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Wenyao","middleName":"","lastName":"Jing","suffix":""},{"id":585188751,"identity":"689055cc-809b-4c39-8589-8a354fbe6f41","order_by":7,"name":"Lihong Pang","email":"","orcid":"","institution":"First Affiliated Hospital of GuangXi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Lihong","middleName":"","lastName":"Pang","suffix":""}],"badges":[],"createdAt":"2026-01-26 03:10:26","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8695999/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8695999/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":101947284,"identity":"049aec9d-6eb8-4e89-b25a-4a1097537e49","added_by":"auto","created_at":"2026-02-05 10:04:15","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2057038,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eReduced m6A RNA methylation and RBM15B downregulation in URSA patients.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Global m6A methylation levels in chorionic villous tissues from URSA patients (n = 20) and healthy controls (n = 20) were measured using a colorimetric assay. m6A levels were significantly decreased in the URSA group compared to controls (****P \u0026lt; 0.0001).\u003c/p\u003e\n\u003cp\u003e(B) Differential expression analysis of RNA methylation-related genes from GEO datasets GSE43256 (top) and GSE22490 (bottom). RBM15B was significantly downregulated in URSA tissues in both datasets.\u003c/p\u003e\n\u003cp\u003e(C) Venn diagram showing overlap of differentially expressed genes between GSE43256 and GSE22490. RBM15B was identified as a shared downregulated gene.\u003c/p\u003e\n\u003cp\u003e(D) RT-qPCR analysis of RBM15B mRNA expression in clinical samples. RBM15B expression was significantly lower in URSA samples compared to controls (**P \u0026lt; 0.01).\u003c/p\u003e\n\u003cp\u003e(E) Immunohistochemistry (IHC) of RBM15B in chorionic villous tissues. RBM15B was localized predominantly in the nuclei of trophoblast cells and was significantly reduced in URSA tissues.\u003c/p\u003e\n\u003cp\u003e(F) Western blot analysis of RBM15B protein expression in NC and URSA tissues, showing consistent downregulation of RBM15B in URSA.\u003c/p\u003e","description":"","filename":"figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8695999/v1/4beab1f77c3e1066448f3dca.png"},{"id":101947195,"identity":"144b3891-e034-4b67-8d65-5be231eea577","added_by":"auto","created_at":"2026-02-05 10:03:55","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3293739,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRBM15B regulates trophoblast cell proliferation, migration, and invasion in URSA.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A–B) RBM15B knockdown efficiency in HTR-8/SVneo cells was assessed using RT-qPCR (A) and Western blot analysis (B). Among the three siRNAs tested, si-297 exhibited the highest knockdown efficiency.\u003c/p\u003e\n\u003cp\u003e(C–D) Stable overexpression of RBM15B in HTR-8/SVneo cells was confirmed at the mRNA level by RT-qPCR (C) and at the protein level by Western blot (D).\u003c/p\u003e\n\u003cp\u003e(E–F) Proliferation of HTR-8/SVneo cells was measured using the CCK-8 assay. RBM15B knockdown significantly reduced cell proliferation over 72 hours (E), whereas RBM15B overexpression enhanced proliferation (F).\u003c/p\u003e\n\u003cp\u003e(G–H) Scratch wound healing assays demonstrated that RBM15B knockdown inhibited trophoblast migration. Representative images (G) and quantification of migration rate (H) are shown.\u003c/p\u003e\n\u003cp\u003e(I–J) Overexpression of RBM15B promoted trophoblast migration, as shown in wound healing assay images (I) and migration rate quantification (J).\u003c/p\u003e\n\u003cp\u003e(K–L) Transwell invasion assays revealed that RBM15B knockdown decreased cell invasion. Representative images (K) and quantification of invading cells (L) are shown.\u003c/p\u003e\n\u003cp\u003e(M–N) Overexpression of RBM15B significantly increased trophoblast invasion in Transwell assays. Representative images (M) and quantification of invading cells (N) are displayed.\u003c/p\u003e\n\u003cp\u003eStatistical significance: *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8695999/v1/84c503a6cbfaea098f22ca4a.png"},{"id":101947469,"identity":"9406fcb2-62b0-45c7-8e4a-a12525f071e9","added_by":"auto","created_at":"2026-02-05 10:04:36","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":4487711,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRBM15B regulates SCAMP1 expression via m6A modifications in trophoblast cells and URSA patients.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Prediction of m6A modification sites on SCAMP1 using the SRAMP algorithm. Three highly reliable m6A sites were identified at positions 313, 334, and 756.\u003c/p\u003e\n\u003cp\u003e(B) SCAMP1 expression in trophoblast tissues from normal controls (NC, n=20) and unexplained recurrent spontaneous abortion (URSA, n=20) patients, measured by RT-qPCR.\u003c/p\u003e\n\u003cp\u003e(C) MeRIP-qPCR confirmed the m6A modification of SCAMP1 in HTR-8/SVneo cells.\u003c/p\u003e\n\u003cp\u003e(D) Relative m6A levels of SCAMP1 in trophoblast tissues from NC and URSA groups, showing reduced m6A modification in URSA.\u003c/p\u003e\n\u003cp\u003e(E) Knockdown efficiency of SCAMP1 in HTR-8/SVneo cells using three siRNAs, measured by RT-qPCR. si-SCAMP1-565 showed the highest efficiency and was selected for further experiments.\u003c/p\u003e\n\u003cp\u003e(F) GFP visualization of stable SCAMP1 knockdown HTR-8/SVneo cell lines generated using lentiviral vectors.\u003c/p\u003e\n\u003cp\u003e(G) CCK-8 assay showing reduced proliferation in SCAMP1 knockdown cells compared to controls.\u003c/p\u003e\n\u003cp\u003e(H, I) Wound healing assay illustrating impaired migration in SCAMP1 knockdown cells. Quantification of the cell migration rate is shown in (I).\u003c/p\u003e\n\u003cp\u003e(J, K) Transwell invasion assay demonstrating decreased invasion ability in SCAMP1 knockdown cells. Quantification of invaded cells is shown in (K).\u003c/p\u003e\n\u003cp\u003e(L) Global m6A methylation levels in HTR-8/SVneo cells with RBM15B knockdown, showing a significant reduction.\u003c/p\u003e\n\u003cp\u003e(M) MeRIP-qPCR analysis of SCAMP1 m6A modification in RBM15B knockdown cells, revealing decreased m6A enrichment and SCAMP1 expression.\u003c/p\u003e\n\u003cp\u003e(N) SCAMP1 expression levels in RBM15B knockdown cells, measured by RT-qPCR.\u003c/p\u003e\n\u003cp\u003e(O-Q) Overexpression of RBM15B in HTR-8/SVneo cells increased global m6A methylation (O), SCAMP1 m6A enrichment (P), and SCAMP1 expression (Q).\u003c/p\u003e\n\u003cp\u003e(R) Actinomycin D assay showing reduced mRNA degradation of SCAMP1 in RBM15B-overexpressing cells compared to controls, suggesting enhanced mRNA stability.\u003c/p\u003e\n\u003cp\u003eStatistical significance: *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8695999/v1/10563f07b84ef77e25443546.png"},{"id":101947192,"identity":"daec19d4-5412-46df-9556-93d204162973","added_by":"auto","created_at":"2026-02-05 10:03:54","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":570744,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIGF2BP2 is identified as a key m6A reader mediating SCAMP1 regulation in URSA.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Venn diagram depicting bioinformatic analysis results from public databases (StarBase, RPIseq, and catRAPID) identifying IGF2BP2 and IGF2BP3 as potential SCAMP1 m6A readers.\u003c/p\u003e\n\u003cp\u003e(B) Relative mRNA expression levels of IGF2BP family members (IGF2BP1, IGF2BP2, and IGF2BP3) in SCAMP1 knockdown HTR-8/SVneo cells, measured by RT-qPCR.\u003c/p\u003e\n\u003cp\u003e(C) Elevated IGF2BP2 mRNA expression levels in trophoblast tissues from the URSA cohort (n=20) compared to normal controls (NC, n=20), determined by RT-qPCR.\u003c/p\u003e\n\u003cp\u003e(D) RNA immunoprecipitation (RIP) assay showing significant enrichment of SCAMP1 in IGF2BP2 immunoprecipitates in HTR-8/SVneo cells, confirming IGF2BP2 as a direct m6A reader of SCAMP1.\u003c/p\u003e\n\u003cp\u003eStatistical significance: *P \u0026lt; 0.05, **P \u0026lt; 0.01, ****P \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8695999/v1/1849eea9503399063326249f.png"},{"id":101947239,"identity":"bbc6ad41-a2b0-4131-ad9f-ca527d4ceb33","added_by":"auto","created_at":"2026-02-05 10:04:12","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2553877,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSCAMP1-IGF2BP2 complex regulates LIN28B mRNA stability and trophoblast cell functions.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Subcellular localization of SCAMP1 in HTR-8/SVneo cells was analyzed using nuclear-cytoplasmic fractionation followed by RT-qPCR. U2sn and S14 served as nuclear and cytoplasmic markers, respectively.\u003c/p\u003e\n\u003cp\u003e(B) Western blot analysis of IGF2BP2 expression after stable knockdown (sh-IGF2BP2) in HTR-8/SVneo cells.\u003c/p\u003e\n\u003cp\u003e(C) Western blot analysis of LIN28B protein levels following stable knockdown of IGF2BP2 (sh-IGF2BP2) or SCAMP1 (sh-SCAMP1).\u003c/p\u003e\n\u003cp\u003e(D) LIN28B mRNA stability was evaluated using actinomycin D treatment in control (NC), sh-SCAMP1, and sh-IGF2BP2 HTR-8/SVneo cells. LIN28B mRNA degradation was significantly accelerated in knockdown groups.\u003c/p\u003e\n\u003cp\u003e(E) RNA immunoprecipitation (RIP) assay showing that SCAMP1 knockdown reduces the binding of IGF2BP2 to LIN28B mRNA.\u003c/p\u003e\n\u003cp\u003e(F) Western blot confirming LIN28B protein rescue after overexpression in sh-IGF2BP2 and sh-SCAMP1 cells.\u003c/p\u003e\n\u003cp\u003e(G) CCK-8 assay showing proliferation rates of HTR-8/SVneo cells in control (NC), sh-IGF2BP2, and sh-IGF2BP2+LIN28B groups.\u003c/p\u003e\n\u003cp\u003e(H-I) Wound healing assay demonstrating impaired migration in sh-IGF2BP2 cells, partially rescued by LIN28B overexpression. Quantification of migration rates is shown in (I).\u003c/p\u003e\n\u003cp\u003e(J-K) Transwell invasion assay showing reduced invasion in sh-IGF2BP2 cells, with partial restoration after LIN28B overexpression. Quantification of invasive cell numbers is presented in (K).\u003c/p\u003e\n\u003cp\u003eStatistical significance: *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8695999/v1/95c2fa31383966701a61beb8.png"},{"id":101947454,"identity":"6ed29e7c-438d-4b3f-91c9-1e09ed07cd9e","added_by":"auto","created_at":"2026-02-05 10:04:30","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2002033,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLIN28B overexpression rescues the impaired functions caused by SCAMP1 knockdown.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Cell proliferation was assessed using the CCK-8 assay in HTR-8/SVneo cells with stable SCAMP1 knockdown (sh-SCAMP1) and LIN28B overexpression (sh-SCAMP1 + LIN28B).\u003c/p\u003e\n\u003cp\u003e(B) Wound healing assay showing migration rates in control (NC), sh-SCAMP1, and sh-SCAMP1 + LIN28B groups at 0 and 24 hours. Quantification of migration rates is shown on the right.\u003c/p\u003e\n\u003cp\u003e(C) Transwell invasion assay demonstrating reduced invasion in sh-SCAMP1 cells, partially rescued by LIN28B overexpression. Quantification of invasive cell numbers is shown on the right.\u003c/p\u003e\n\u003cp\u003eStatistical significance: *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8695999/v1/dff685c4d54de814d87dddb7.png"},{"id":101947198,"identity":"7672e13d-3f5f-4465-b7c0-8d51e19c292e","added_by":"auto","created_at":"2026-02-05 10:03:55","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":898550,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic diagram illustrating the proposed pathway. \u003c/strong\u003eThe methyltransferase RBM15B is involved in the m6A methylation of SCAMP1. Reduced RBM15B expression leads to decreased m6A modification on SCAMP1, promoting SCAMP1 degradation and reducing its expression. Downregulation of SCAMP1 affects the ability of IGF2BP2 to stabilize LIN28B mRNA, resulting in decreased LIN28B expression. LIN28B downregulation impairs extravillous trophoblast (EVT) proliferation, migration, and invasion, potentially contributing to abortion pathogenesis.\u003c/p\u003e","description":"","filename":"figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-8695999/v1/4b51ba078f4d8c1bb56d9952.png"},{"id":107315587,"identity":"ea277e7b-f54a-424f-b9db-8f5c60e83e4e","added_by":"auto","created_at":"2026-04-20 09:44:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":16076580,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8695999/v1/6b64ebba-3007-4ae6-80ba-b7c61fe6d6a7.pdf"},{"id":101947151,"identity":"2068f662-3394-4842-a150-e8a6a7ef487b","added_by":"auto","created_at":"2026-02-05 10:03:53","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":23897,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalInformationDocument2.docx","url":"https://assets-eu.researchsquare.com/files/rs-8695999/v1/9693fd5cff0aeaa317817c6a.docx"},{"id":101947139,"identity":"abb3ba3b-f376-4537-86e5-eeb281578a3b","added_by":"auto","created_at":"2026-02-05 10:03:48","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":482033,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalInformationDocument1.docx","url":"https://assets-eu.researchsquare.com/files/rs-8695999/v1/59671bb7e27c24adc25eeaa8.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"RBM15B-driven m6A hypomethylation destabilizes lncRNA SCAMP1 and trophoblast function in unexplained recurrent miscarriage","fulltext":[{"header":"Introduction","content":"\u003cp\u003eRecurrent spontaneous abortion (RSA) is a significant clinical challenge affecting women of reproductive age, defined as the loss of two or more consecutive pregnancies before 20\u0026ndash;24 weeks of gestation, including both embryonic and fetal losses[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Notably, approximately 50% of RSA cases remain unexplained (unexplained recurrent spontaneous abortion, (URSA)[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], which not only complicates subsequent pregnancies but also imposes long-term physical risks (e.g., cardiovascular diseases, venous thromboembolism) and psychological distress (e.g., anxiety, depression) on affected individuals[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Despite extensive investigations into potential etiologies such as chromosomal abnormalities, uterine defects, and maternal age-related factors, the molecular mechanisms driving URSA remain poorly elucidated[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Thus, identifying novel epigenetic regulatory pathways and molecular biomarkers is critical for improving diagnostic accuracy, developing targeted therapies, and optimizing prevention strategies for URSA.\u003c/p\u003e \u003cp\u003eIn recent years, RNA post-transcriptional modifications have emerged as key regulators of gene expression, with N6-methyladenosine (m6A) methylation standing out as the most prevalent and functionally important modification in eukaryotic mRNAs[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. m6A methylation is dynamically regulated by a complex network of methyltransferases (\"writers,\" e.g., METTL3, METTL14, WTAP), demethylases (\"erasers,\" e.g., FTO, ALKBH5), and RNA-binding proteins (\"readers,\" e.g., YTHDF family, IGF2BP family). This modification modulates nearly all stages of the RNA lifecycle, including splicing, stability, translation, and decay [\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], and is involved in diverse physiological and pathological processes such as cell differentiation[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], immune responses[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], and the development of various cancers[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Importantly, accumulating evidence highlights the critical role of m6A methylation in female reproductive health, including oocyte maturation, embryo development[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], and female fertility[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Dysregulated m6A modification patterns have been implicated in several reproductive disorders, including pregnancy loss, preeclampsia, and polycystic ovary syndrome[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], suggesting that aberrant m6A-mediated gene regulation may contribute to URSA pathogenesis.\u003c/p\u003e \u003cp\u003eLong non-coding RNAs (lncRNAs), defined as non-coding RNAs longer than 200 nucleotides, are key downstream targets of m6A modification and play pivotal roles in regulating cellular functions through chromatin remodeling, transcriptional regulation, and post-transcriptional RNA stabilization[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The m6A modification of lncRNAs adds an additional layer of regulatory complexity, influencing their stability, subcellular localization, and interactions with RNA-binding proteins (RBPs)[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. In reproductive biology, lncRNAs are essential for oocyte development[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], trophoblast development[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], and implantation[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], positioning them as critical regulators of pregnancy outcomes. However, the role of m6A-modified lncRNAs in URSA remains largely unexplored, representing a significant gap in our understanding of URSA pathophysiology.\u003c/p\u003e \u003cp\u003eNotably, many protein-coding gene loci can generate alternatively spliced lncRNA variants with independent biological functions[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Secretory carrier membrane protein 1 (SCAMP1) is traditionally recognized as a protein-coding gene, but its alternatively spliced variant 2 (RefSeq: NR_110885.2) is explicitly annotated as a lncRNA in RefSeq[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. This lncRNA SCAMP1 has been implicated in oncogenic processes, such as breast cancer progression and renal cell carcinoma pathogenesis[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], but its role in reproductive disorders and whether it is regulated by N6-methyladenosine (m6A) methylation remain unknown. Given the well-established role of m6A methylation in fine-tuning lncRNA stability, subcellular localization, and functional output[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], and considering that dysregulated m6A-modified lncRNAs are increasingly linked to reproductive disorders including pregnancy loss, we hypothesized that SCAMP1 may be subjected to m6A modification, which in turn modulates its expression and biological function in trophoblast cells\u0026mdash;key players in placental development and implantation whose dysfunction is a core pathological feature of URSA.\u003c/p\u003e \u003cp\u003eTherefore, we aimed to systematically investigate the epitranscriptomic regulation of lncRNA SCAMP1 in URSA, focusing on: (1) its expression and m6A modification status; (2) the upstream methyltransferase responsible; (3) the downstream reader protein and effector; and (4) the functional impact of this axis on trophoblast biology. By elucidating the interplay between m6A methylation and lncRNA SCAMP1 in trophoblast biology, we seek to uncover novel molecular mechanisms underlying URSA and provide potential therapeutic targets for this clinically challenging disorder.\u003c/p\u003e "},{"header":"Methods","content":"\n\u003ch3\u003e1. Human-Tissue Samples\u003c/h3\u003e\n\u003cp\u003ePregnancy villous tissues were collected from 20 women diagnosed with URSA and 20 women who underwent elective pregnancy termination for non-medical reasons (NC group) at the First Affiliated Hospital of Guangxi Medical University between January 2023 and December 2023. The URSA group included patients with two or more consecutive pregnancy losses before 24 weeks, as defined by the 2022 Chinese guidelines and international consensus[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The NC group was matched for gestational age and maternal age. All participants had no history of major reproductive or systemic diseases, and exclusion criteria included chromosomal abnormalities, acute infections, and adverse lifestyle factors. For the basic information of the patients, please refer to supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003eBoth groups of specimens were collected from sterile villous tissue following electric negative pressure aspiration. Within 10 minutes of excision, the villi were isolated, cleaned, and cut into 2\u0026ndash;4 mm pieces. One portion was fixed in 10% formalin for 48 hours, then embedded in paraffin for immunohistochemistry and pathological analysis. The remaining portions were rapidly frozen in liquid nitrogen and stored at -80\u0026deg;C for RNA and protein extraction.\u003c/p\u003e \u003cp\u003e This study was conducted in accordance with the principles outlined in the Declaration of Helsinki. All experimental protocols were approved by the Ethics Committee of the First Affiliated Hospital of Guangxi Medical University (Ethics No: 2023-K057-01). Written informed consent was obtained from all participants prior to sample collection.\u003c/p\u003e\n\u003ch3\u003e2. Cell culture\u003c/h3\u003e\n\u003cp\u003eHuman cytotrophoblastic cell line HTR-8/SVneo was purchased from Pricella Company ( Wuhan, China) and was cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and Penicillin/Streptomycin antibiotics. Cells were maintained at 37\u0026deg;C in a 5% CO2 atmosphere.\u003c/p\u003e\n\u003ch3\u003e3. Quantification of global m6A\u003c/h3\u003e\n\u003cp\u003eRNA was extracted from villous tissues using the Trizol method, following RNAse-free procedures. RNA concentration and purity were determined using a Nanodrop spectrophotometer, with samples having OD260/OD280 ratios between 1.8 and 2.0 considered suitable for subsequent analyses. m6A levels in total RNA were quantified using a colorimetric m6A RNA Methylation Assay Kit (P-9005, EPIGENTEK, USA) according to the manufacturer\u0026rsquo;s instructions. The relative m6A percentage was calculated using the following formula:\u003c/p\u003e \u003cp\u003em6A% = [(sample OD\u0026thinsp;\u0026minus;\u0026thinsp;NC OD)/S] / [(PC OD\u0026thinsp;\u0026minus;\u0026thinsp;NC OD)/P] \u0026times; 100%. where S represents the input sample RNA amount (ng) and P represents the positive control input amount (ng).\u003c/p\u003e\n\u003ch3\u003e4. Reverse Transcription and Quantitative Real-Time PCR (RT-qPCR)\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from villus tissues, as well as HTR-8/SVneo cells using Trizol reagent. RNA concentration and quality were assessed via the 260/280 nm ratio using a Nanodrop spectrophotometer. cDNA was synthesized with a MightyScript Plus cDNA Synthesis Kit (Sangon Biotech, Shanghai, China ). qRT-PCR was performed using SYBR PrimeScript RT-PCR Kit(Takara Bio, Inc, Japan)and analyzed on the 7500 Fast Real-Time PCR System. Expression levels were normalized to β-actin, and fold changes were calculated using the 2\u0026thinsp;\u0026minus;\u0026thinsp;ΔΔCt method. For the primers used, refer to Supplementary Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e\u003c/p\u003e\n\u003ch3\u003e5. Western Blot Assay\u003c/h3\u003e\n\u003cp\u003eTotal protein was extracted from villous tissues and trophoblast cells, quantified, and separated by SDS-PAGE. Proteins were transferred to PVDF membranes and probed with primary antibodies against RBM15B (1:1000, Proteintech Group, Wuhan, China), IGF2BP2 and LIN28B (1:500, Proteintech Group, Wuhan, China), followed by appropriate secondary antibodies. Protein bands were visualized using an infrared fluorescence imaging system (Li-COR Odyssey Clx, USA), with quantification performed using ImageJ software. Full-length, uncropped images of all Western blots are provided in supplementary information for original full gel scans of blots.\u003c/p\u003e\n\u003ch3\u003e6. Immunohistochemistry (IHC)\u003c/h3\u003e\n\u003cp\u003eFormalin-fixed, paraffin-embedded tissue sections were deparaffinized in xylene, rehydrated in graded ethanol, and subjected to antigen retrieval in 0.01 M citrate buffer (pH 6.0) at 95\u0026ndash;100\u0026deg;C for 15 minutes. After cooling, sections were washed with PBS. Endogenous peroxidase activity was blocked with a specific inhibitor for 10 minutes, followed by incubation with 10% goat serum for 30 minutes. Sections were then incubated with primary antibodies against RBM15B (1:1000, Proteintech Group, Wuhan, China) at 4\u0026deg;C overnight, followed by incubation with secondary antibodies for 1 hour at room temperature. Images were captured under a light microscope (Nikon, Tokyo, Japan). RBM15B nuclear staining was assessed for each case. Staining intensity and the proportion of positive cells were used as criteria for quantitative scoring. The staining intensity was classified as follows: no staining (0), weak positive (1), moderate positive (2), and strong positive (3). The proportion of positive cells was scored as: \u0026le;25% (1), 26%\u0026ndash;50% (2), 51%\u0026ndash;75% (3), and 76%\u0026ndash;100% (4). The final score was calculated by multiplying the intensity score by the proportion score. A total score of \u0026le;\u0026thinsp;5 was defined as negative, while a score\u0026thinsp;\u0026gt;\u0026thinsp;5 was defined as positive[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003e7. Construction of stable cell line\u003c/h3\u003e\n\u003cp\u003eGenePharma (Shanghai, China) designed and synthesized short hairpin RNAs (shRNAs) targeting SCAMP1 and IGF2BP2, as well as the control shRNA. Lentiviruses for RBM15B overexpression, LIN28B overexpression, and their respective controls were obtained from Hanbio Biotechnology (Shanghai, China). HTR-8/SVneo cells were infected with the lentiviruses at a multiplicity of infection (MOI) of 30 and subsequently selected using puromycin (5 \u0026micro;g/mL) to establish stable cell lines. Transfection efficiency was assessed 48 hours post-infection using qRT-PCR and western blotting.\u003c/p\u003e\n\u003ch3\u003e8. Plasmid construction\u003c/h3\u003e\n\u003cp\u003eLipofectamine 3000 (Thermo Fisher Scientific, USA) was used to perform siRNA and plasmid transfections following the manufacturer\u0026rsquo;s instructions. Briefly, HTR-8/SVneo cells were plated in 6-well plates and transfected with siRNAs at a final concentration of 50 nM. After 48 hours, cells were collected for RNA and protein extraction to assess knockdown efficiency. RBM15B and SCAMP1 siRNAs were designed and synthesized by GenePharma (Suzhou, China), and the sequences are provided in Table S3.\u003c/p\u003e\n\u003ch3\u003e9. Gene-Specific MeRIP-qPCR\u003c/h3\u003e\n\u003cp\u003eTo quantify m6A-modified SCAMP1 levels, methylated RNA immunoprecipitation (MeRIP) was conducted following previously reported protocols. The EpiQuik\u0026trade; CUT\u0026amp;RUN m6A RNA Enrichment Kit (P-9018, EPIGENTEK, USA) was employed according to the manufacturer's instructions. In brief, total RNA was extracted and treated with DNase I to eliminate genomic DNA contamination. For input samples, 200\u0026ndash;400 ng of mRNA was reserved. Approximately 10 \u0026micro;g of total RNA was combined with an immunocapture solution consisting of 174\u0026ndash;189 \u0026micro;L immune capture buffer, 2 \u0026micro;L m6A antibody (or non-immune IgG), 5\u0026ndash;20 \u0026micro;L RNA sample, and 4 \u0026micro;L affinity beads. The mixture was incubated at room temperature on a rotating platform for 90 minutes. Next, 10 \u0026micro;L Nucleic Digestion Enhancer and 2 \u0026micro;L Cleavage Enzyme Mix were added, followed by a 4-minute incubation at room temperature. After three washes with wash buffer, the m6A-immunoprecipitated RNA was resuspended in 20 \u0026micro;L protein digestion solution (proteinase K diluted 1:10 in protein digestion buffer) and incubated at 55\u0026deg;C for 15 minutes in a thermocycler without a heated lid. The solution was then transferred to a new PCR tube, and 20 \u0026micro;L RNA purification solution, 160 \u0026micro;L 100% ethanol, and 2 \u0026micro;L RNA-binding beads were added. After a 5-minute incubation at room temperature, the RNA was bound to the beads, and the m6A-enriched RNA was eluted with 13 \u0026micro;L elution buffer. Subsequent quantification of the cDNA products was performed as outlined in the RT-qPCR procedure. Primers for SCAMP1 were designed to specifically target the lncRNA variant 2 (NR_110885.2) and avoid cross-reactivity with the protein-coding variant (NM_004866.6). The specificity of the primers was verified by BLAST against the human genome database and Sanger sequencing of the PCR products.\u003c/p\u003e \u003cp\u003eThe qRT-PCR primers for the SCAMP1 gene were as follows:\u003c/p\u003e \u003cp\u003eSCAMP1 primer for MeRIP-qPCR #1:\u003c/p\u003e \u003cp\u003eForward: 5\u0026rsquo;- ACCAACAGAGGAACATCCAGC\u0026thinsp;\u0026minus;\u0026thinsp;3\u0026rsquo;\u003c/p\u003e \u003cp\u003eReverse: 5\u0026rsquo;- TCCCGACGATCTAATTCTGCG\u0026thinsp;\u0026minus;\u0026thinsp;3\u0026rsquo;\u003c/p\u003e \u003cp\u003eRelative m6A mRNA expression levels were determined using the 2\u0026minus;(∆∆Ct) method.\u003c/p\u003e\n\u003ch3\u003e10. HTR-8/SVneo Functional Assays\u003c/h3\u003e\n\u003cp\u003e \u003cstrong\u003eCell Proliferation Assay (CCK-8)\u003c/strong\u003e \u003cp\u003eCell viability was assessed using the Cell Counting Kit-8 (CCK-8). Transfected HTR-8/SVneo cells were seeded in 96-well plates, and absorbance was measured at 450 nm at 8, 24, 48, and 72 hours.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eScratch Migration Assay\u003c/strong\u003e \u003cp\u003eThe migration capacity of transfected cells was evaluated using a scratch wound healing assay. Cells were seeded in 6-well plates, and the wound closure was monitored by imaging at 0 and 24 hours.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eTranswell Invasion Assay\u003c/strong\u003e \u003cp\u003eInvasion potential was assessed using Transwell chambers coated with Matrigel. Transfected cells were seeded in the upper chamber, and the migrated cells were fixed, stained, and counted after 24 hours.\u003c/p\u003e \u003c/p\u003e\n\u003ch3\u003e11. RNA Immunoprecipitation (RIP)\u003c/h3\u003e\n\u003cp\u003eRNA-binding protein interactions with SCAMP1 were analyzed using the RNA immunoprecipitation (RIP) assay, following the manufacturer's protocol (Bersinbio, Guangzhou, China). HTR-8/SVneo cells were lysed, and the cell lysates were incubated with magnetic beads conjugated to IGF2BP2 antibodies. Co-precipitated RNAs were then purified and analyzed by qRT-PCR to confirm the binding of IGF2BP2 to SCAMP1.\u003c/p\u003e\n\u003ch3\u003e12. RNA stability assay\u003c/h3\u003e\n\u003cp\u003eThe RNA stability assay was performed as previously described[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].Briefly, cells were seeded in 6-well plates and cultured overnight. Actinomycin D (5 \u0026micro;g/ml, Cell Signaling Technology, Danvers, MA, USA)) was then added to HTR8/SVneo cells to inhibit transcription for the indicated time points. RNA was subsequently extracted and quantified by RT-qPCR. The RNA levels at each time point were normalized to β-actin.\u003c/p\u003e\n\u003ch3\u003e13. Statistical Analysis\u003c/h3\u003e\n\u003cp\u003eAll experiments were performed with at least three independent biological replicates, and data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). GraphPad Prism 8 (GraphPad Software, La Jolla, CA, USA)was used to statistically analyze all data. Paired t-tests were used to compare the villous tissues of URSA and those of normal Pregnancies. Meanwhile, independent samples t-tests were used for other comparisons between two groups, and one-way ANOVA was used for comparisons among multiple groups. A p-value of 0.05 or lower was regarded as statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\n\u003ch3\u003e1. Reduced m6A RNA Methylation in URSA Is Associated with RBM15B Downregulation\u003c/h3\u003e\n\u003cp\u003ePrevious studies have suggested that impaired RNA methylation could play a role in the pathogenesis of recurrent miscarriage[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. To explore this hypothesis in URSA, we first measured global m6A RNA modification levels in chorionic villous tissues from URSA patients (n\u0026thinsp;=\u0026thinsp;20) and healthy early pregnancy termination controls (n\u0026thinsp;=\u0026thinsp;20) using a colorimetric assay. The results revealed that m6A modification levels were significantly reduced in the URSA group compared to the control group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo investigate the potential molecular basis for this reduction, we analyzed GEO datasets (GSE43256 and GSE22490) for differentially expressed genes related to RNA methylation. Both datasets identified RBM15B, a key m6A methyltransferase, as significantly downregulated in URSA tissues(Figure 1BC). This finding raised the possibility that RBM15B downregulation might contribute to the observed m6A reduction.\u003c/p\u003e \u003cp\u003eTo validate the bioinformatics predictions, we performed RT-qPCR, IHC, and western blot analyses on clinical samples. Consistently, RBM15B expression was significantly lower in the URSA group than in controls at both the mRNA and protein levels (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD\u0026ndash;F). Moreover, IHC revealed that RBM15B was predominantly localized in the nuclei of trophoblast cells, which aligns with its function as a methyltransferase.\u003c/p\u003e\n\u003ch3\u003e2. RBM15B Regulates Trophoblast Proliferation, Migration, and Invasion in URSA\u003c/h3\u003e\n\u003cp\u003eTo further investigate the functional role of RBM15B in URSA, we generated RBM15B knockdown and overexpression models in HTR-8/SVneo cells. Among the tested siRNAs, si-297 exhibited the highest knockdown efficiency, as confirmed by RT-qPCR and Western blot (Fig.\u0026nbsp;2AB), and was selected for subsequent experiments. Stable overexpression of RBM15B was achieved using lentiviral transduction, and successful overexpression was verified at both mRNA and protein levels (Fig.\u0026nbsp;2CD).\u003c/p\u003e \u003cp\u003eCell proliferation, migration, and invasion were then assessed. Knockdown of RBM15B resulted in significantly reduced proliferation, as indicated by lower absorbance values in the CCK-8 assay over three days (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Conversely, RBM15B overexpression enhanced proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). Migration assays revealed that RBM15B knockdown inhibited cell movement (Fig.\u0026nbsp;2GH), while overexpression promoted migration (Fig.\u0026nbsp;2IJ). Similarly, transwell assays showed that RBM15B knockdown decreased invasion (Fig.\u0026nbsp;2KL), whereas overexpression increased the number of invading cells (Fig.\u0026nbsp;2MN). These findings confirm that RBM15B plays a crucial role in regulating trophoblast cell function, with its downregulation impairing key cellular processes, which may contribute to the pathogenesis of URSA.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003e3.RBM15B Regulates SCAMP1 Expression via m6A Modifications\u003c/h3\u003e\n\u003cp\u003eBuilding on our previous findings that global m6A methylation is dysregulated in URSA and that the m6A \"writer\" RBM15B contributes to this epigenetic aberration by regulating trophoblast function, we next focused on investigating the prespecified lncRNA SCAMP1 (RefSeq: NR_110885.2)\u0026mdash;a key candidate of interest from our study design\u0026mdash;with the goal of clarifying whether SCAMP1 is subjected to m6A modification and if this modification is dysregulated in URSA, whether RBM15B directly regulates SCAMP1 through m6A methylation, and the functional significance of SCAMP1 in URSA pathogenesis. To initially assess the potential for m6A-mediated regulation of SCAMP1, we used the SRAMP tool[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], to predict m6A modification sites, identifying three highly reliable candidates at positions 313, 334, and 756 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). We then validated these predictions and addressed our core research questions through analyses of SCAMP1 expression, m6A methylation status, and functional effects in trophoblast cells and clinical samples.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe first assessed SCAMP1 expression in trophoblast tissues from 20 normal and 20 URSA patients. SCAMP1 expression was significantly downregulated in the URSA group compared to the control group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB), suggesting its potential involvement in URSA pathogenesis. Next, we evaluated the m6A modification of SCAMP1 using MeRIP-qPCR to confirm its modification status in HTR-8/SVneo cells. Our results demonstrated that SCAMP1 undergoes m6A modification at key sites (Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC), with a notable reduction in m6A modification in URSA patient samples ༈Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD༉, indicating a potential link between impaired m6A modification and reduced SCAMP1 expression in URSA.\u003c/p\u003e \u003cp\u003eTo investigate the functional significance of SCAMP1, we transfected HTR-8/SVneo cells with three siRNAs targeting SCAMP1. After 48 hours, RT-qPCR analysis showed significant downregulation of SCAMP1 in all siRNA groups compared to the negative control (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). si-SCAMP1-565, with the highest transfection efficiency, was selected for further experiments. We then generated stable SCAMP1 knockdown cell lines using lentiviral vectors (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF) for subsequent functional assays. Knockdown of SCAMP1 in HTR-8/SVneo cells led to a significant decrease in cell proliferation, migration, and invasion, as assessed by CCK-8, wound healing, and transwell invasion assays (Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG-K). These findings indicate that SCAMP1 plays a crucial role in regulating trophoblast cell functions that are essential for placental development and implantation, and its downregulation may impair these processes.\u003c/p\u003e \u003cp\u003eBased on the methyltransferase characteristics of RBM15B, we speculate that RBM15B regulates SCAMP1 in an m6A-dependent manner. Knockdown of RBM15B in HTR-8/SVneo cells resulted in a significant reduction in both overall m6A levels (Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eL) and the m6A modification of SCAMP1༈Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eM༉, which was accompanied by a corresponding decrease in SCAMP1 expression ༈Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eM༉. In contrast, stable overexpression of RBM15B led to an increase in both SCAMP1 m6A modification and SCAMP1 expression ༈Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eO-Q༉. These results indicate that RBM15B regulates SCAMP1 expression through m6A methylation.\u003c/p\u003e \u003cp\u003eGiven that m6A modification is known to influence RNA stability, we hypothesized that RBM15B might regulate SCAMP1 mRNA stability through m6A modification. To test this, we treated HTR-8/SVneo cells with actinomycin D and measured SCAMP1 mRNA decay rates after stable overexpression of RBM15B. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eR, compared to the empty vector group, SCAMP1 mRNA degradation was significantly slower in the RBM15B overexpression group at 3 hours, 6 hours, and 9 hours, with statistically significant differences (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These results suggest that RBM15B increases SCAMP1 mRNA stability by enhancing its m6A modification.\u003c/p\u003e\n\u003ch3\u003e4. IGF2BP2 Identified as a Key m6A Reader Mediating SCAMP1 Regulation in URSA\u003c/h3\u003e\n\u003cp\u003eHaving confirmed the m6A-dependent regulation of SCAMP1, we next investigated its functional role by identifying potential m6A readers that interpret the m6A modification of SCAMP1 and mediate its biological functions. Bioinformatics analyses using public databases, including StarBase, RPIseq, and catRAPID, highlighted IGF2BP2 and IGF2BP3\u0026mdash;members of the IGF2BP family recognized as m6A readers\u0026mdash;as likely SCAMP1-binding proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). To identify the specific m6A reader for SCAMP1, we conducted RT-qPCR to examine the expression levels of IGF2BP family members following SCAMP1 knockdown. Interestingly, knockdown of SCAMP1 resulted in a significant upregulation of IGF2BP2 mRNA levels, while the expression of IGF2BP1 and IGF2BP3 remained unchanged (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Clinical samples from the URSA cohort further supported this finding, showing significantly elevated IGF2BP2 mRNA levels compared to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). These observations led us to hypothesize that reduced m6A modification of SCAMP1 might influence the expression of its m6A reader, suggesting a potential reciprocal regulatory mechanism between SCAMP1 and IGF2BP2. To test this hypothesis, we performed RNA immunoprecipitation (RIP) assays in HTR-8/SVneo cells. The results demonstrated that SCAMP1 was significantly enriched in IGF2BP2 precipitates (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD), confirming IGF2BP2 as a direct m6A reader of SCAMP1.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003e5. SCAMP1-IGF2BP2 Complex Regulates LIN28B mRNA Stability and Trophoblast Functions\u003c/h3\u003e\n\u003cp\u003eTo investigate the functional role of SCAMP1 within the SCAMP1-IGF2BP2 complex, we first analyzed its subcellular localization, as the cellular distribution of lncRNAs is critical for their functional roles[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Bioinformatics predictions using lncLocator and iLoc-LncRNA indicated that SCAMP1 predominantly resides in the cytoplasm. This was experimentally validated through nuclear-cytoplasmic fractionation in HTR-8/SVneo trophoblast cells, followed by RT-qPCR with U2sn (nuclear marker) and S14 (cytoplasmic marker). The results confirmed that SCAMP1 is primarily localized in the cytoplasm (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). These suggested that SCAMP1 is involved in post-transcriptional regulatory processes, such as mRNA stability, translation efficiency, and protein post-translational modifications. Given that IGF2BP2 is known to stabilize target mRNAs through its conserved RNA-binding domains, we hypothesized that SCAMP1 cooperates with IGF2BP2 to regulate the stability of downstream genes, potentially contributing to the pathogenesis of URSA.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo identify shared target genes, we integrated transcriptomic data from the GSE21575 dataset, which profiles differentially expressed mRNAs following the knockdown of all three IGF2BP family proteins, with SCAMP1-bound mRNAs predicted by StarBase. After filtering for |logFC| \u0026gt; 1 and adj.P.Val\u0026thinsp;\u0026lt;\u0026thinsp;0.05, we identified 89 overlapping targets (Table S4). Among these, LIN28B emerged as a candidate of interest due to its low expression in trophoblast tissues from recurrent pregnancy loss patients and its critical role in trophoblast proliferation, migration, and invasion[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. This prompted us to hypothesize that SCAMP1 and IGF2BP2 co-regulate LIN28B expression.\u003c/p\u003e \u003cp\u003eTo further validate LIN28B as a downstream target of IGF2BP2 and SCAMP1, we examined LIN28B protein expression in HTR-8/SVneo cells with stable knockdown of IGF2BP2 (sh-IGF2BP2, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB) or SCAMP1 (sh-SCAMP1). Western blot analysis revealed that knockdown of either IGF2BP2 or SCAMP1 significantly reduced LIN28B protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eWe next explored whether IGF2BP2 and SCAMP1 regulate LIN28B at the post-transcriptional level by influencing its mRNA stability. Using actinomycin D treatment to assess LIN28B mRNA decay in HTR-8/SVneo cells, we found that stable knockdown of either IGF2BP2 or SCAMP1 accelerated LIN28B mRNA degradation compared to the control group, with statistically significant differences (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003ePrevious studies have shown that lncRNAs can influence the binding of RNA-binding proteins (RBPs) to their target genes. To determine if SCAMP1 mediates the interaction between IGF2BP2 and LIN28B, we performed RIP assays in HTR-8/SVneo cells with stable SCAMP1 knockdown. The results demonstrated that SCAMP1 knockdown reduced the binding of IGF2BP2 to LIN28B mRNA, with statistical significance (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). These findings further support the role of SCAMP1 in regulating the interaction between IGF2BP2 and LIN28B.\u003c/p\u003e \u003cp\u003eTo explore whether upregulation of LIN28B expression can rescue the effects of SCAMP1 and IGF2BP2 knockdown on HTR-8/SVneo cell function, we overexpressed LIN28B in cells with stable knockdown of SCAMP1 and IGF2BP2. Western blot analysis showed that overexpression of LIN28B partially restored the reduced LIN28B protein levels caused by SCAMP1 and IGF2BP2 knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003eFurthermore, upregulation of LIN28B partially rescued the inhibitory effects of IGF2BP2 knockdown on cell proliferation, migration, and invasion (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG-K). Compared to the control group, cells with stable IGF2BP2 knockdown exhibited significantly reduced proliferation, migration, and invasion. Notably, cells overexpressing LIN28B (shIGF2BP2\u0026thinsp;+\u0026thinsp;LIN28B) exhibited higher proliferation rates and increased migration and invasion compared to cells with IGF2BP2 knockdown alone (shIGF2BP2). These results suggest that upregulation of LIN28B can partially restore cellular functions inhibited by IGF2BP2 knockdown.\u003c/p\u003e \u003cp\u003eA similar trend was observed in the SCAMP1 knockdown rescue experiment with LIN28B overexpression, with detailed results shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-C. These findings further underscore the potential role of LIN28B in reversing the functional effects of SCAMP1 knockdown in HTR-8/SVneo cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eRecurrent spontaneous abortion of unknown etiology (URSA) presents a formidable challenge due to the absence of clear mechanistic underpinnings. Our study unveils a novel epitranscriptomic pathway contributing to URSA pathogenesis. We demonstrate that global m6A hypomethylation in URSA villi is linked to the downregulation of the methyltransferase RBM15B. Functionally, RBM15B deficiency directly impairs trophoblast proliferation, migration, and invasion\u0026mdash;processes vital for successful implantation. At the molecular level, we identify the long non-coding RNA SCAMP1 as a critical substrate of RBM15B. In URSA, reduced RBM15B-mediated m6A modification destabilizes SCAMP1 transcripts, leading to its downregulation. This loss of SCAMP1 disrupts its interaction with the m6A reader protein IGF2BP2, thereby compromising the stability of LIN28B mRNA, a well-established promoter of trophoblast invasiveness. Collectively, our work delineates a coherent RBM15B-SCAMP1-IGF2BP2-LIN28B regulatory axis, providing a direct link between aberrant m6A methylation and trophoblast dysfunction in URSA.\u003c/p\u003e \u003cp\u003eThe role of m6A methylation in female reproductive health is increasingly recognized, with dysregulation implicated in disorders such as preeclampsia and recurrent miscarriage[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. While studies have often focused on core methyltransferases like METTL3/METTL14[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], our findings highlight RBM15B as a pivotal and underappreciated regulator in trophoblast biology. RBM15B, along with its paralog RBM15, is known to recruit the m6A methyltransferase complex to specific RNA targets, including lncRNAs like XIST, to mediate transcriptional silencing[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Our data extend this function to the realm of placental development. The pronounced nuclear localization of RBM15B in trophoblasts and its significant downregulation in URSA suggest that it governs a specific subset of m6A modifications crucial for early pregnancy maintenance. This positions RBM15B not merely as a redundant writer but as a specialized epigenetic regulator whose loss-of-function may represent a distinct sub-type of URSA characterized by lncRNA dysregulation.\u003c/p\u003e \u003cp\u003eThe functional consequences of m6A modification are profoundly influenced by its effects on different RNA species. For lncRNAs, m6A can act as a structural \u0026ldquo;switch\u0026rdquo; altering RBP binding, a recruitment signal for readers[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], or a determinant of RNA stability[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Our study on SCAMP1 offers a concrete example of this regulation in a reproductive pathology context. We show that m6A modification, catalyzed by RBM15B, is essential for SCAMP1 stability. The subsequent cytoplasmic SCAMP1-IGF2BP2 interaction exemplifies how an m6A-modified lncRNA can serve as a scaffold or co-factor for a stabilizing reader protein. A particularly intriguing observation is the concomitant upregulation of IGF2BP2 mRNA in URSA tissues despite reduced SCAMP1 m6A modification and expression. While the precise mechanism awaits further investigation, this dissociation between reader and target expression aligns with the concept of compensatory feedback within dysregulated networks. Cells may attempt to counteract the loss of functional SCAMP1-IGF2BP2 complexes by increasing IGF2BP2 abundance. Alternatively, IGF2BP2 upregulation may represent an independent pathological event driven by the URSA microenvironment, as IGF2BP2 is known to be transcriptionally activated by various stress and oncogenic signals[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Regardless of the trigger, our RIP and functional data demonstrate that this elevated IGF2BP2 is insufficient to restore LIN28B stabilization, revealing a critical functional uncoupling within the axis. This imbalance\u0026mdash;where the writer (RBM15B) and a key substrate (SCAMP1) are deficient, while the reader (IGF2BP2) is paradoxically abundant but ineffective\u0026mdash;epitomizes the profound epitranscriptomic dysregulation in URSA.\u003c/p\u003e \u003cp\u003eThe convergence of the RBM15B-SCAMP1-IGF2BP2 axis on LIN28B underscores its role as a critical effector in trophoblast function. LIN28B, an RNA-binding protein that promotes proliferation and invasion by repressing let-7 miRNA and stabilizing mRNAs like IGF2, is vital for placental development[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Our data mechanistically connect upstream epitranscriptomic regulation to this key protein: reduced SCAMP1/IGF2BP2 interaction accelerates LIN28B mRNA decay. The partial but significant rescue of proliferation, migration, and invasion upon LIN28B overexpression in SCAMP1- or IGF2BP2-deficient cells powerfully validates LIN28B as the major functional output of this pathway. It also suggests that while LIN28B is a dominant downstream target, other effectors are likely to contribute to the full phenotypic spectrum, inviting future exploration.\u003c/p\u003e \u003cp\u003eLimitations of the study\u003c/p\u003e \u003cp\u003eDespite its strengths, we acknowledge several limitations that define the scope of our study and chart future directions. First, while the HTR-8/SVneo cell line is a validated model for human extravillous trophoblast function, validation in primary human trophoblasts and in vivo models (e.g., using conditional knockout mice) is essential to confirm the physiological relevance of this axis. Second, our clinical sample size, though statistically informative, warrants expansion in multi-center cohorts to assess the generalizability and diagnostic power of these markers. Third, the upstream drivers of RBM15B downregulation in URSA\u0026mdash;whether transcriptional, post-translational, or due to genetic variants\u0026mdash;remain an open and critical question. Finally, the potential involvement of other m6A writers or readers in the global hypomethylation phenotype observed in URSA merits investigation. Addressing these points will be crucial in translating our mechanistic findings into clinical impact.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur study identifies the RBM15B-SCAMP1-IGF2BP2-LIN28B axis as a crucial regulatory circuit linking epitranscriptomic information to cellular function in the placenta. By demonstrating how a defect in m6A \u0026ldquo;writing\u0026rdquo; on a specific lncRNA cascades into impaired RNA \u0026ldquo;reading\u0026rdquo; and destabilization of a key pro-trophoblast factor, we provide a novel molecular framework for understanding URSA. This work not only deepens our knowledge of RNA methylation in reproductive biology but also illuminates new potential pathways for diagnosis and therapeutic development in this distressing condition.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eRSA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003erecurrent spontaneous abortion\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eURSA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eunexplained recurrent spontaneous abortion\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eRBM15B\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eRNA binding motif protein 15B\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSCAMP1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003esecretory carrier membrane protein 1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLIN28B\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eprotein lin-28 homolog B\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eIGF2BPs\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003einsulin-like growth factor 2 mRNA-binding proteins\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGEO\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGene Expression Omnibus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003em6A\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eN6-methyladenosine\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eEthics statement\u003c/h2\u003e \u003cp\u003e The studies involving human participants were reviewed and approved by Ethics Committee of The First Affiliated Hospital of Guangxi Medical University. The patients provided their written informed consent to participate in this study.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eDeclaration of interests\u003c/h2\u003e \u003cp\u003eNone.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent for Publication\u003c/strong\u003e \u003cp\u003eAll participants included in this study provided written informed consent for the publication of the data obtained from their samples.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis research was funded by grants from the National Natural Science Foundation of China (Nos. 81960281, 82260306);The construction of clinical intervention protocols Guangxi key R\u0026amp;D program (Guike AB20159031 ༛AB24010080 ༉, and Clinical Research Climbing Program Innovation Project of the First Affiliated Hospital of Guangxi Medical University (NO YYZS202008).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eJuntao Feng, Zhiwei Zhu and Lihong Pang conceived and designed research; Juntao Feng and Shisi Wei performed experiments; Changqiang Wei, Zhiwei Zhu and Yiyun Wei analysed data; Ling Shi and Wenyao Jing interpreted results of experiments and prepared figures; Juntao Feng drafted manuscript; Zhiwei Zhu revised the manuscript; Lihong Pang approved final version of manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eNone.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets generated and/or analyzed during the current study are available in the Gene Expression Omnibus (GEO) repository under accession numbers\u0026nbsp;GSE43256\u0026nbsp;and\u0026nbsp;GSE22490. Other raw data and materials supporting the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eDimitriadis E, Menkhorst E, Saito S, Kutteh WH, Brosens JJ. Recurrent pregnancy loss. Nat reviews Disease primers. 2020;6(1):98.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArias-Sosa LA, Acosta ID, Lucena-Quevedo E, Moreno-Ortiz H, Esteban-Perez C, Forero-Castro M. Genetic and epigenetic variations associated with idiopathic recurrent pregnancy loss. J Assist Reprod Genet. 2018;35(3):355\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQuenby S, Gallos ID, Dhillon-Smith RK, Podesek M, Stephenson MD, Fisher J, Brosens JJ, Brewin J, Ramhorst R, Lucas ES, et al. Miscarriage matters: the epidemiological, physical, psychological, and economic costs of early pregnancy loss. Lancet. 2021;397(10285):1658\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang X, Liu B, Nie Z, Duan L, Xiong Q, Jin Z, Yang C, Chen Y. The role of m6A modification in the biological functions and diseases. Signal Transduct Target Ther. 2021;6(1):74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao X, Yang Y, Sun BF, Shi Y, Yang X, Xiao W, Hao YJ, Ping XL, Chen YS, Wang WJ, et al. FTO-dependent demethylation of N6-methyladenosine regulates mRNA splicing and is required for adipogenesis. Cell Res. 2014;24(12):1403\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao W, Adhikari S, Dahal U, Chen YS, Hao YJ, Sun BF, Sun HY, Li A, Ping XL, Lai WY, et al. Nuclear m(6)A Reader YTHDC1 Regulates mRNA Splicing. Mol Cell. 2016;61(4):507\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Zhao BS, Roundtree IA, Lu Z, Han D, Ma H, Weng X, Chen K, Shi H, He C. N(6)-methyladenosine Modulates Messenger RNA Translation Efficiency. Cell. 2015;161(6):1388\u0026ndash;99.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang L, Li Y, Zhou L, Zhou H, Ye L, Ou T, Hong H, Zheng S, Zhou Z, Wu K, et al. The m6A Reader YTHDF2 Promotes Bladder Cancer Progression by Suppressing RIG-I-Mediated Immune Response. Cancer Res. 2023;83(11):1834\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAn Y, Duan H. The role of m6A RNA methylation in cancer metabolism. Mol Cancer. 2022;21(1):14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Yang C, Sun H, Jiang H, Zhang P, Huang Y, Liu Z, Yu Y, Xu Z, Xiang H, Yi C. The Role of N6-methyladenosine Modification in Gametogenesis and Embryogenesis: Impact on Fertility. Genom Proteom Bioinform 2024, 22(4).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWan S, Sun Y, Zong J, Meng W, Yan J, Chen K, Wang S, Guo D, Xiao Z, Zhou Q, et al. METTL3-dependent m(6)A methylation facilitates uterine receptivity and female fertility via balancing estrogen and progesterone signaling. Cell Death Dis. 2023;14(6):349.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen J, Fang Y, Xu Y, Sun H. Role of m6A modification in female infertility and reproductive system diseases. Int J Biol Sci. 2022;18(9):3592\u0026ndash;604.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang E, Chen L. RNA N(6)-methyladenosine modification in female reproductive biology and pathophysiology. Cell Commun Signal. 2023;21(1):53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQian X, Zhao J, Yeung PY, Zhang QC, Kwok CK. Revealing lncRNA Structures and Interactions by Sequencing-Based Approaches. Trends Biochem Sci. 2019;44(1):33\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin Y, Fan Z. New insights into the interaction between m6A modification and lncRNA in cancer drug resistance. Cell Prolif. 2024;57(4):e13578.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHerman AB, Tsitsipatis D, Gorospe M. Integrated lncRNA function upon genomic and epigenomic regulation. Mol Cell. 2022;82(12):2252\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIyyappan R, Aleshkina D, Zhu L, Jiang Z, Kinterova V, Susor A. Oocyte specific lncRNA variant Rose influences oocyte and embryo development. Non-coding RNA Res. 2021;6(2):107\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKong X, Li R, Chen M, Zheng R, Wang J, Sun C, Qu Y. Endogenous retrovirus HERVH-derived lncRNA UCA1 controls human trophoblast development. Proc Natl Acad Sci USA. 2024;121(12):e2318176121.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng C, Shen JM, Lv PP, Jin M, Wang LQ, Rao JP, Feng L. Construction of implantation failure related lncRNA-mRNA network and identification of lncRNA biomarkers for predicting endometrial receptivity. Int J Biol Sci. 2018;14(10):1361\u0026ndash;77.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa S, Chen C, Ji X, Liu J, Zhou Q, Wang G, Yuan W, Kan Q, Sun Z. The interplay between m6A RNA methylation and noncoding RNA in cancer. J Hematol Oncol. 2019;12(1):121.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang H, Weng H, Chen J. m(6)A Modification in Coding and Non-coding RNAs: Roles and Therapeutic Implications in Cancer. Cancer Cell. 2020;37(3):270\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVadakekolathu J, Al-Juboori SIK, Johnson C, Schneider A, Buczek ME, Di Biase A, Pockley AG, Ball GR, Powe DG, Regad T. Correction: MTSS1 and SCAMP1 cooperate to prevent invasion in breast cancer. Cell Death Dis. 2020;11(3):205.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShao Q, Wang Q, Wang J. LncRNA SCAMP1 regulates ZEB1/JUN and autophagy to promote pediatric renal cell carcinoma under oxidative stress via miR-429. Biomed Pharmacother. 2019;120:109460.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRPL, EGGo B, Atik R, Christiansen OB, Elson J, Kolte AM, Lewis S, Middeldorp S, Nelen W, Peramo B, Quenby S, et al. ESHRE guideline: recurrent pregnancy loss. Hum Reprod open. 2018;2018(2):hoy004.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePractice Committee of the American Society for Reproductive M. Evaluation and treatment of recurrent pregnancy loss: a committee opinion. Fertil Steril. 2012;98(5):1103\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRussell-Goldman E, Hornick JL, Qian X, Jo VY. NKX2.2 immunohistochemistry in the distinction of Ewing sarcoma from cytomorphologic mimics: Diagnostic utility and pitfalls. Cancer Cytopathol. 2018;126(11):942\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo Z, Zhang X, Zhu H, Zhong N, Luo X, Zhang Y, Tu F, Zhong J, Wang X, He J, Huang L. TELO2 induced progression of colorectal cancer by binding with RICTOR through mTORC2. Oncol Rep. 2021;45(2):523\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen K, Zhang J, Meng L, Kong L, Lu M, Wang Z, Wang W. The epigenetic downregulation of LncGHRLOS mediated by RNA m6A methylase ZCCHC4 promotes colorectal cancer tumorigenesis. J experimental Clin cancer research: CR. 2024;43(1):44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi XC, Jin F, Wang BY, Yin XJ, Hong W, Tian FJ. The m6A demethylase ALKBH5 controls trophoblast invasion at the maternal-fetal interface by regulating the stability of CYR61 mRNA. Theranostics. 2019;9(13):3853\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou Y, Zeng P, Li YH, Zhang Z, Cui Q. SRAMP: prediction of mammalian N6-methyladenosine (m6A) sites based on sequence-derived features. Nucleic Acids Res. 2016;44(10):e91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBridges MC, Daulagala AC, Kourtidis A. LNCcation: lncRNA localization and function. J Cell Biol 2021, 220(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCanfield J, Arlier S, Mong EF, Lockhart J, VanWye J, Guzeloglu-Kayisli O, Schatz F, Magness RR, Lockwood CJ, Tsibris JCM, et al. Decreased LIN28B in preeclampsia impairs human trophoblast differentiation and migration. FASEB J. 2019;33(2):2759\u0026ndash;69.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang Q, Niu Y, Song L, Huang J, Wang C, Ma T. Does LIN28B gene dysregulation make women more likely to abort? Reprod Fertil. 2021;2(3):211\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang N, Gao Y, Zhang M, Guo L, Qin L, Liao S, Wang H. METTL3-Mediated m(6)A RNA Methylation of ZBTB4 Interferes With Trophoblast Invasion and Maybe Involved in RSA. Front Cell Dev Biol. 2022;10:894810.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePatil DP, Chen CK, Pickering BF, Chow A, Jackson C, Guttman M, Jaffrey SR. m(6)A RNA methylation promotes XIST-mediated transcriptional repression. Nature. 2016;537(7620):369\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu N, Dai Q, Zheng G, He C, Parisien M, Pan T. N(6)-methyladenosine-dependent RNA structural switches regulate RNA-protein interactions. Nature. 2015;518(7540):560\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDai F, Wu Y, Lu Y, An C, Zheng X, Dai L, Guo Y, Zhang L, Li H, Xu W, Gao W. Crosstalk between RNA m(6)A Modification and Non-coding RNA Contributes to Cancer Growth and Progression. Mol Ther Nucleic Acids. 2020;22:62\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang YZ, Chai RC, Pang B, Chang X, An SY, Zhang KN, Jiang T, Wang YZ. METTL3 enhances the stability of MALAT1 with the assistance of HuR via m6A modification and activates NF-kappaB to promote the malignant progression of IDH-wildtype glioma. Cancer Lett. 2021;511:36\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXue L, Li J, Lin Y, Liu D, Yang Q, Jian J, Peng J. m(6) A transferase METTL3-induced lncRNA ABHD11-AS1 promotes the Warburg effect of non-small-cell lung cancer. J Cell Physiol. 2021;236(4):2649\u0026ndash;58.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu C, Liu T, Han C, Xuan Y, Jiang D, Sun Y, Zhang X, Zhang W, Xu Y, Liu Y, et al. HPV E6/E7 promotes aerobic glycolysis in cervical cancer by regulating IGF2BP2 to stabilize m(6)A-MYC expression. Int J Biol Sci. 2022;18(2):507\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYao B, Zhang Q, Yang Z, An F, Nie H, Wang H, Yang C, Sun J, Chen K, Zhou J, et al. CircEZH2/miR-133b/IGF2BP2 aggravates colorectal cancer progression via enhancing the stability of m(6)A-modified CREB1 mRNA. Mol Cancer. 2022;21(1):140.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang T, Wang G, Hao D, Liu X, Wang D, Ning N, Li X. Aberrant regulation of the LIN28A/LIN28B and let-7 loop in human malignant tumors and its effects on the hallmarks of cancer. Mol Cancer. 2015;14:125.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Unexplained recurrent pregnancy loss, HTR-8/SVneo, RBM15B, SCAMP1, LIN28B","lastPublishedDoi":"10.21203/rs.3.rs-8695999/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8695999/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eRecurrent spontaneous abortion (RSA) affects numerous women worldwide, with a significant proportion categorized as unexplained recurrent spontaneous abortion (URSA). Recent evidence suggests that N6-methyladenosine (m6A) methylation, a critical post-transcriptional modification influencing RNA stability and function, plays a key role in URSA pathogenesis. Notably, long non-coding RNAs (lncRNAs) are key targets of m6A modification, and their dysregulation contributes to trophoblast dysfunction\u0026mdash;a core pathological feature of URSA. However, the m6A-mediated regulatory mechanisms of lncRNAs in URSA remain unclear.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eGlobal m6A levels were significantly reduced in URSA villous tissues, accompanied by downregulated expression of m6A methyltransferase RBM15B and lncRNA SCAMP1. SCAMP1 was confirmed to undergo m6A modification, and its hypomethylation in URSA decreased its stability. Functional assays showed that SCAMP1 knockdown impaired HTR-8/SVneo cell proliferation, migration, and invasion, while RBM15B regulated SCAMP1 expression via m6A methylation. Further, SCAMP1 interacted with m6A reader IGF2BP2 to regulate LIN28B mRNA stability. Silencing SCAMP1 or IGF2BP2 reduced LIN28B expression, and LIN28B overexpression partially rescued trophoblast function. Collectively, the RBM15B-SCAMP1-LIN28B axis was found to regulate trophoblast function.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eReduced m6A methylation in URSA tissues, associated with RBM15B downregulation, destabilizes lncRNA SCAMP1 and impairs trophoblast function via the IGF2BP2-LIN28B pathway. The RBM15B/SCAMP1/ IGF2BP2/LIN28B axis provides novel insights into URSA pathogenesis and suggests potential therapeutic targets.\u003c/p\u003e","manuscriptTitle":"RBM15B-driven m6A hypomethylation destabilizes lncRNA SCAMP1 and trophoblast function in unexplained recurrent miscarriage","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-05 09:58:14","doi":"10.21203/rs.3.rs-8695999/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"28070ada-c995-4d0c-9715-d2a522d1bae4","owner":[],"postedDate":"February 5th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-04-20T09:42:03+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-05 09:58:14","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8695999","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8695999","identity":"rs-8695999","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}