Toxoplasma GRA16 attenuates tau hyperphosphorylation and enhances autophagy in thrombin-treated HT-22 hippocampal neuronal cells

preprint OA: closed
Full text JSON View at publisher
Full text 139,671 characters · extracted from preprint-html · click to expand
Toxoplasma GRA16 attenuates tau hyperphosphorylation and enhances autophagy in thrombin-treated HT-22 hippocampal neuronal cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Toxoplasma GRA16 attenuates tau hyperphosphorylation and enhances autophagy in thrombin-treated HT-22 hippocampal neuronal cells Seung-Hwan Seo, Do-Won Ham, Ji-Eun Lee, Eun-Hee Shin This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5586914/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 20 May, 2025 Read the published version in Scientific Reports → Version 1 posted 8 You are reading this latest preprint version Abstract This study investigated whether Toxoplasma gondii -derived dense granule protein 16 (GRA16) modulates tau protein to attenuate tau hyperphosphorylation and promotes autophagy to facilitate the removal of tau aggregates. HT-22 murine hippocampal neuronal cells were treated with thrombin to induce rapid hyperphosphorylations and tau aggregation. Thrombin increased hyperphosphorylated tau protein levels and activated NF-κB, contributing to tau pathology and neuroinflammation. NF-κB activation increased apolipoprotein E (APOE) expression and decreased forkhead box O3A (FOXO3A) expression, a factor involved in autophagy regulation, consequently limiting the expression of autophagy-related genes directly regulated by FOXO3A. Meanwhile, in GRA16-transfected HT-22 cells treated with thrombin, GRA16 upregulated proteins involved in tau dephosphorylation but downregulated protein involved in tau phosphorylation. Moreover, GRA16 inhibited thrombin-induced NF-κB activation and increased FOXO3A levels, thereby enhancing the expression of autophagy-related genes, including those directly regulated by FOXO3A. GRA16 enhanced intracellular autophagic flux and inhibited tau hyperphosphorylations in thrombin-treated HT-22 cells, as evidenced by increased autophagic fluorescence and significant reductions in phosphorylated tau protein levels and fluorescence intensity. These findings suggest that GRA16 possesses therapeutic potential in tauopathies by enhancing tau dephosphorylation and autophagy-mediated tau clearance, establishing a conceptual foundation for developing new therapeutic approaches targeting tau pathology. Biological sciences/Cell biology Biological sciences/Molecular biology Biological sciences/Neuroscience Autophagy Dense granule protein 16 Hippocampal neuronal cell Hyperphosphorylated tau Tauopathy Toxoplasma gondii Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Introduction Alzheimer’s disease (AD) remains the leading cause of dementia, accounting for 60–80% of cases among the elderly population [ 1 ]. This condition is characterized by a progressive and irreversible decline in cognition, behavior, and responsiveness to the environment, with affected individuals presenting with various symptoms, such as memory loss, impaired learning, and difficulties with cognition and language [ 1 , 2 ]. The development of AD can be attributed to two main pathological features: extracellular neuritic plaques resulting from β-amyloid (Aβ) accumulation and intracellular neurofibrillary tangles (NFTs) composed of hyperphosphorylated tau protein [ 3 ]. In particular, misfolded, hyperphosphorylated tau proteins have been considered a pivotal factor in the pathogenesis of AD and other tauopathies. Consequently, inhibiting the aggregation of hyperphosphorylated tau proteins could be a promising strategy for the discovery and development of therapeutics against AD [ 3 , 4 ]. Tau pathologies tend to directly promote neuroinflammation [ 5 ]. Tau is mainly localized to neurons and, to a lesser extent, is also expressed in oligodendrocytes and astrocytes. Its primary function is its role in the assembly and stabilization of neuronal microtubules [ 3 ]. However, the neurofibrillary lesions observed in brain tauopathies, including NFTs in AD, are characterized by highly-ordered aggregations of hyperphosphorylated tau filaments [ 6 ]. In 2003, Suo et al. demonstrated that treatment with nanomolar concentrations of thrombin can induce rapid hyperphosphorylation and aggregation of tau in hippocampal neurons [ 7 ]. Thrombin, a pleiotropic enzyme and serine protease involved in blood coagulation, can exert pathogenic effects on neurons [ 8 ]. Under pathological conditions, thrombin levels are usually elevated. Alternatively, thrombin may abnormally infiltrate neuronal tissue. Thrombin activates protease-activated receptors (PARs), leading to tau aggregation and hippocampal degeneration [ 9 ]. These findings pathogenetically link thrombin to neuroinflammation, including brain tauopathies, associated with cerebrovascular damage, and suggest that thrombin can be employed in in vitro cell models to investigate these tauopathies. Autophagy is a lysosome-dependent, evolutionarily conserved cellular process in eukaryotes. This process has been closely associated with the regulation of protein metabolism considering that it enables the degradation and recycling of damaged organelles and misfolded proteins to maintain protein homeostasis. Increasing evidence suggests that autophagy is involved in the regulation of AD pathogenesis [ 10 ]. A reduction in autophagy can cause neurodegeneration, whereas its stimulation can protect against some proteinopathies. Silva et al. (2020) used neurons from patients with AD to demonstrate that tau reduction in these cells requires autophagy through the sequestration of the cells into phagolysosomes [ 11 ]. Notably, tau clearance in neurons was predominantly achieved through the inhibition of mammalian target of rapamycin (mTOR) and mammalian target of rapamycin complex 1 (mTORC1). This is induced by mTOR inhibitors that promote autophagy-mediated tau clearance [ 11 ]. Therefore, in AD, especially with tau pathology, autophagy evidently serves as an essential defense of brain cells through its degradation of NFTs formed by hyperphosphorylated tau protein. Studies have also highlighted the importance of activating autophagy in a neuroinflammatory environment [ 11 – 13 ]. Apolipoprotein E (APOE) plays a crucial role in the pathogenesis of AD. Notably, three predominant APOE variants exist in humans, namely ε2, ε3, and ε4 [ 14 ]. Among these variants, APOE ε4 has been strongly associated with an increased risk of AD. Reports have also shown that polymorphisms in the APOE promoter were correlated with increased AD susceptibility. Aside from humans, mouse models of APOE expression have long been used to study the mechanisms underlying the pathogenesis of AD [ 15 ]. In the context of AD pathogenesis, Sohn et al. (2021) demonstrated that APOE variants increase the accumulation of hyperphosphorylated tau by impairing autophagy through the repression of forkhead box O3A (FOXO3A) [ 16 ], a transcription factor that plays a crucial role in regulating various cellular processes, particularly autophagy. More specifically, FOXO3A activates autophagy by upregulating the expression of autophagy-related genes [ 16 , 17 ]. Numerous studies suggest that the activation of FOXO3A and subsequent enhancement of autophagy may serve as a neuroprotective mechanism against the accumulation of hyperphosphorylated tau and other toxic proteins associated with AD [ 17 ]. Dense granule protein 16 (GRA16), which is secreted by the parasitic protozoan Toxoplasma gondii (T. gondii) , has been found to play an important role in modulating the host cell environment to favor T. gondii survival and replication [ 18 ]. Once secreted, GRA16 is transported across the parasitophorous vacuole into the cytoplasm and nucleus of the host cell [ 18 ]. GRA16 directly interacts with B55 regulatory subunit of protein phosphatase 2A (PP2A-B55) and ubiquitin-specific protease 7 (USP7) or indirectly with phosphatase and tensin homolog (PTEN) within host cells to regulate key signaling pathways associated with the cell cycle, apoptosis, and immune responses [ 18 – 20 ]. By leveraging the functional properties of GRA16, our previous studies demonstrated that GRA16 upregulates the critical tumor suppressors PP2A-B55 and PTEN in cancer cells located in the liver, lungs, and colon and downregulates nuclear factor kappa B (NF-κB), a transcriptional factor that promotes cell cycle progression, proliferation, invasion, and metastasis of cancer cells [ 21 – 23 ]. With this background, the current study aimed to investigate the following. First, AD was associated with hyperphosphorylated tau, which directly promotes the progression of neuroinflammation. Second, autophagy functions as an essential defense mechanism for degrading NFTs formed by hyperphosphorylated tau in brain cells. Third, during the pathogenesis of AD, the upregulated APOE suppresses FOXO3A, a key regulator of the transcriptional expression of autophagy-related genes, thereby constraining autophagy activation. Therefore, we investigated whether GRA16 reduces the hyperphosphorylation and aggregation of tau protein and promotes autophagy by upregulating FOXO3A through the suppression of APOE in thrombin-induced neuroinflammatory hippocampal neuronal cells. Importantly, this study might foster a more profound understanding of the molecular processes involved in tau hyperphosphorylation and aggregation that drive neuroinflammation, as well as the autophagy mechanisms that counteract them. Furthermore, our results potentially provide a conceptual foundation for developing new therapeutic approaches that utilize GRA16 as a novel tauopathy downregulator and autophagy enhancer. 2. Methods 2.1. Cell culture Mouse hippocampal neuronal cell line (HT-22) was obtained from the Korean Cell Line Bank (Seoul, Korea). The retroviral packaging cell line (Platinum-A) was purchased from Cell Biolabs (San Diego, CA, USA). HT-22 and Platinum-A cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM) (Welgene, Gyeongsan, Korea) supplemented with 10% fetal bovine serum (FBS) (Welgene) and 1% antibiotic–antimycotic (AA) (Welgene). HT-22 cells were differentiated in neurobasal medium (Thermo Fisher Scientific, Waltham, MA, USA) containing 2 mM L-glutamine (Thermo Fisher Scientific) and 1 × N-2 supplement (Thermo Fisher Scientific) for 24 h prior to use. 2.2. Cell transduction To produce HT-22 cells stably expressing the GRA16 protein, we prepared a retrovirus transfer plasmid ( pBABE-HAII-GRA16 ) containing the gra16 gene constructed in a previous study [ 23 ]. Platinum-A cells were seeded into 6-well plates at 5 × 10 5 cells per well 24 h before transfection. Thereafter, 2.5 µg of DNA constructs were transfected into each well using Lipofectamine 3000 kit (Thermo Fisher Scientific) and Opti-Minimal Essential Medium (Opti-MEM) (Thermo Fisher Scientific). Afterward, 1.5 µg of pBABE-HAII-GRA16 , 0.75 µg of pCMV-Gag-Pol (Retrovirus packaging plasmid), and 0.25 µg of pMD2.G (Retrovirus envelop plasmid) were mixed with 5 µL of P3000 reagent and 5 µL of Lipofectamine 3000 reagent in 250 µL of Opti-MEM (Thermo Fisher Scientific). After 15 min of incubation at room temperature, the mixture was added to the Platinum-A cells. After 48 h of transfection, the cell culture medium was harvested, centrifuged for 5 min with 1,000 × g and filtered using a 0.45-µm filter. The supernatant was frozen using liquid nitrogen and stored at − 80°C before using. For viral transduction, HT-22 cells were seeded into 6-well plates at 5 × 10 5 cells per well. After 24 h, the viral supernatant was distributed to each well with 8 µg of polybrene (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and incubated for 48 h. GRA16 protein-expressing HT-22 cells were selected using a fresh DMEM medium supplemented with 10% FBS and 1% AA with 2 µg/mL of puromycin (Santa Cruz Biotechnology). 2.3. RNA extraction and real-time quantitative polymerase chain reaction (qPCR) Total RNA from the cells was extracted using the HiGene™ Total RNA Prep Kit (BioFact, Daejeon, Korea). Using a Reverse-Transcription Premix (Elpis Biotech, Daejeon, Korea), 1 µg of the RNA was incubated at 70°C for 5 min and reverse transcribed to cDNA using the following conditions: 42°C for 1 h, then 94°C for 5 min, in a 20 µL of reaction volume. Subsequently, real-time qPCR was performed using 20 µL of reaction mixture comprising 1 µL of cDNA, 10 pmol of primers, and 10 µL of TOPreal™ qPCR 2X PreMIX (SYBR Green with low ROX) (Enzynomics, Daejeon, Korea). Amplification reactions were performed at 95°C for 15 min, followed by 40 cycles of 95°C for 20 s, 59°C for 20 s, and 72°C for 30 s. SYBR Green fluorescent signals were assessed using iQ™5 optical system software (Bio-Rad Laboratories, Hercules, CA, USA). The relative expression of the target gene was compared to that of the control group after normalizing it to the Ct value of GAPDH . The primer sequences of the target genes were obtained from OriGene™ Technologies (Rockville, MD, USA). All primer sequences are listed in Table 1 . Table 1 Primer sequences used in real-time quantitative polymerase chain reaction Gene Forward primer (5′-3′) Reverse primer (5′-3′) CDK5 GTACTCCACGTCCATCGACATG GCCATTGTTCCTCAGTCGGTGT ATG12 GAAGGCTGTAGGAGACACTCCT GGAAGGGGCAAAGGACTGATTC BNIP3 GCTCCAAGAGTTCTCACTGTGAC GTTTTTCTCGCCAAAGCTGTGGC LC3 CTGCCTGTCCTGGATAAGACCA CTGGTTGACCAGCAGGAAGAAG BECN1 CAGCCTCTGAAACTGGACACGA CTCTCCTGAGTTAGCCTCTTCC SQSTM1/p62 GCTCTTCGGAAGTCAGCAAACC GCAGTTTCCCGACTCCATCTGT PINK1 CGACAACATCCTTGTGGAGTGG CATTGCCACCACGCTCTACACT OPTN AGGTGGAGAGACTTGAAGTCGC TCCTCGCTGTCTGCTTCTCAGT P21 TCGCTGTCTTGCACTCTGGTGT CCAATCTGCGCTTGGAGTGATAG GAPDH CATCACTGCCACCCAGAAGACTG ATGCCAGTGAGCTTCCCGTTCAG ATG12, autophagy-related gene 12; BECN1, Beclin 1; BNIP3, BCL2 interacting protein 3; CDK5, cyclin-dependent kinase 5; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LC3, microtubule-associated protein light chain 3; OPTN, optineurin; PINK1, PTEN-induced kinase 1; SQSTM1/p62, sequestosome 1 2.4. Western blot analysis Total proteins from HT-22 cells were extracted using M-PER™ Mammalian Protein Extraction Reagent (Thermo Fisher Scientific). Proteins were quantified using Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific). A total of 30 µg of proteins per mini-gel well was separated using 12% SDS-PAGE and transferred onto polyvinylidene fluoride membranes at 100 V for 1 h at 4°C using the Mini Trans-Blot® Electrophoretic Transfer Cell (Bio-Rad Laboratories) instrument. The transferred membranes were blocked in 5% bovine serum albumin (BSA) in TBS-T (TBS with 0.1% Tween-20) for 1.5 h at room temperature. The blocked membranes were incubated with primary antibodies for 16 h at 4°C. Thereafter, the membranes were washed three times with TBS-T and incubated with horseradish peroxidase-conjugated secondary antibodies for 1 h at room temperature. Target proteins on the membrane were visualized using Pierce™ ECL western Blotting Substrate (Thermo Fisher Scientific). Images were captured using Amersham Imager 680 (GE healthcare, Chicago, IL, USA), and the signal intensities were calculated using ImageJ (free software provided by the National Institutes of Health). The relative expression of the target protein was normalized to the density value of β-actin and compared to that in the control group. All antibodies are listed in Table 2 . Table 2 Antibodies used in immunofluorescence and western blot analysis Primary antibody Antibody dilution Source Cat. no. Phospho-tau (Ser202, Thr205) (AT8) 1:1,000 Invitrogen MN1020 Phospho-tau (Ser422) 1:1,000 Invitrogen 44-764G Tau 1:1,000 Invitrogen PA5-29610 Phospho-NF-κB p65 (Ser536) 1:1,000 ABclonal PA1294 NF-κB p65 1:1,000 Cell Signaling Technology 8242 HA tag (For GRA16) 1:1,000 Cell Signaling Technology 3724 PP2A-B55 1:1,000 Santa Cruz Biotechnology sc-365282 Phospho-PTEN (Ser380) 1:1,000 Santa Cruz Biotechnology sc-377573 PTEN 1:1,000 Santa Cruz Biotechnology sc-7974 Phospho-GSK3β (Ser389) 1:1,000 Proteintech 14850-1-AP GSK3β 1:1,000 Cell Signaling Technology 9315 APOE 1:1,000 Santa Cruz Biotechnology sc-390925 FOXO3A 1:1,000 Santa Cruz Biotechnology sc-48348 Caspase 3 1:1,000 Santa Cruz Biotechnology sc-56053 β-actin 1:1,000 Santa Cruz Biotechnology sc-47778 Secondary antibody Antibody dilution Source Cat. no. m-IgG K BP-HRP 1:2,000 Santa Cruz Biotechnology sc-516102 Goat antirabbit IgG (H + L)-HRP 1:4,000 Invitrogen 32460 Donkey antimouse IgG (H + L)-Alexa Fluor 594 1:2,000 Invitrogen A-21203 2.5. Immunofluorescence HT-22 cells were fixed with 4% paraformaldehyde solution for 10 min at room temperature. After washing with PBS (pH 7.5), the cells were treated for 15 min at room temperature with a permeabilization solution (PBS with 0.2% Triton X-100), incubated with a blocking buffer (PBS with 0.1% Tween-20 containing 1% BSA and 22.52 mg/mL glycine) for 1 h at room temperature, washed with PBS-T (TBS with 0.1% Tween-20) buffer, and then stained with antiphospho-Tau antibody (Ser202/Thr205, AT8) (Invitrogen) for 16 h at 4°C. After washing with PBS-T, the cells were stained with donkey antimouse IgG (H + L)-Alexa Fluor 594 antibody (Invitrogen) as a secondary antibody for 1 h at room temperature in the dark. Thereafter, the cells were washed with PBS-T and stained with Hoechst33342 (Sigma–Aldrich, St. Louis, MO, USA) diluted in PBS (5 µg/mL) for 5 min at room temperature in the dark. After another wash with PBS-T, the cell samples were visualized under a DE/DMI6000B inverted fluorescence microscope (Leica, Wetzlar, HE, Germany). 2.6. Autophagy assay HT-22 cells were seeded into 96-well plates at 4 × 10 4 cells/well and incubated for 24 h at 37°C before the autophagy assay. The cells were treated with 100 nM thrombin for 24 h at 37°C. As a positive control, the cells were treated with 500 nM rapamycin, an autophagy inducer, for 24 h at 37°C, washed with 1 × assay buffer, dispensed in the Microscopy Dual Detection Reagent, and then incubated for 30 min at 37°C away from light. Thereafter, the cells were washed with 1 × assay buffer and stained with 5 µg/mL of Hoechst33342 (Sigma–Aldrich) for 5 min at room temperature in the dark. After another round of washing with 1 × assay buffer, 100 µL of 1 × assay buffer was added to the cells in each well. Autophagic fluorescence intensity was measured at a wavelength of 480 nm using Infinite® 200 PRO fluorescence microplate reader (Tecan). In addition, the fluorescence autophagic flux was visualized under a DE/DMI6000B inverted fluorescence microscope (Leica). 2.7. Cell proliferation assay HT-22 cells were seeded into 96-well plates at 2.5 × 10 3 cells/well and incubated for 24 h at 37°C before treatment with thrombin. Thereafter, the cells were exposed to 100 nM of thrombin and incubated for 0, 24, 48, 72, and 96 h. At each time point, the cells were treated with CCK-8 reagent and incubated for 1.5 h at 37°C. Finally, the optical density was determined at a wavelength of 450 nm using the Infinite® 200 PRO microplate reader (Tecan, Männedorf, Switzerland). 2.8. Statistical analysis All statistical analyses were conducted using GraphPad Prism 5 (GraphPad, La Jolla, CA, USA). Data are presented as mean ± standard deviation (SD). A t-test was implemented for comparisons between two groups. One-way analysis of variance (ANOVA) followed by a Bonferroni post-hoc comparison test was applied for comparisons between three groups. Two-way ANOVAs followed by Bonferroni post-hoc comparison tests were used to compare cell viability data. Statistical significance ( P < 0.05) was designated as follows: * indicates a difference between the control group and the control + thrombin-group, † indicates a difference between the control group and the GRA16 group, and ‡ indicates a difference between the vector group and the GRA16 group. 3. Results 3.1. Thrombin induces tau hyperphosphorylation and APOE expression, which are pathologically relevant targets of AD, and partially attenuates the expression of autophagy-related factors regulated by FOXO3A Immunofluorescence staining and western blotting were performed to determine whether thrombin treatment induces tau protein hyperphosphorylation in hippocampal neuronal cells (Figs. 1 A– 1 D). During immunofluorescence staining, thrombin treatment induced a significant increase in the fluorescence expression of hyperphosphorylated tau protein (Ser202/Thr205, AT8) in HT-22 cells (Fig. 1 A). We evaluated changes in p-tau (Ser202/Thr205, AT8) protein expression by measuring fluorescence intensity (as arbitrary units [AU]). The results showed p-tau (S202/T205, AT8) levels to be significantly elevated in thrombin-treated HT-22 cells (46.1 AU) compared with untreated HT-22 cells (4.63 AU) ( P < 0.05) (Fig. 1 B). Using western blotting, we analyzed the total amounts of tau protein, as well as p-tau (Ser202/Thr205 and Ser422) levels. Notably, thrombin treatment increased in total tau protein and enhanced tau phosphorylation ( p < 0.05) (Figs. 1 C and 1 D). Thereafter, to investigate the activation of NF-κB, which is known to be a major cause of tau hyperphosphorylation and tangling of hippocampal neuronal cells, NF-κB protein expression in thrombin-treated HT-22 cells was analyzed. Our results showed a significant increase in the phosphorylation of NF-κB (Ser536) ( P < 0.05) (Fig. 1 E). Meanwhile, NF-κB is a well-known inflammatory transcription factor that regulates neurodegeneration in the context of common neurodegenerative diseases. NF-κB activation increases neuroinflammation and triggers an increase in the APOE promoter function associated with AD development [ 24 ]. APOE attenuates autophagy, causing phosphorylated tau accumulation by repressing FOXO3A in the pathogenesis of AD [ 16 ]. The results of thrombin treatment, which activated NF-κB, demonstrated increased APOE protein expression and decreased FOXO3A protein expression ( P < 0.05) (Fig. 1 F). Under thrombin-induced tau hyperphosphorylation conditions, these results were characterized by a decrease in the expression of direct downstream targets of FOXO3A, such as autophagy-related gene/protein 12 (ATG12), BCL2 interacting protein 3 (BNIP3), and microtubule-associated protein light chain 3 (LC3), along with only a limited increase in certain autophagy-related genes (Beclin 1 [BECN1], sequestosome 1 [SQSTM1/p62], PTEN-induced kinase 1 [PINK1], and optineurin [OPTN]). Meanwhile, the expression of cyclin-dependent kinase 5 (CDK5), known to inhibit autophagy and induce tau hyperphosphorylation, did not show any significant difference ( P < 0.05) (Fig. 1 G). Next, to investigate the effect of thrombin on cell growth, a cell proliferation assay was analyzed over time following thrombin treatment. Reportedly, thrombin treatment reduced the rate of cell proliferation ( P < 0.05) (Fig. 1 H). In addition, the expression of caspase-3, a key mediator of apoptosis in neuronal cells, was increased in thrombin-treated HT-22 cells ( P < 0.05) (Fig. 1 I). 3.2. GRA16 affects upstream signaling pathways that modulate the inhibition and activation of tau hyperphosphorylation To investigate how T. gondii- derived GRA16 affects tau hyperphosphorylation induced by thrombin through the regulation of PP2A and PTEN in hippocampal neuronal cells, GRA16-expressing HT-22 cells were generated using retroviral transfection. Following thrombin treatment, continuous GRA16 protein expression was confirmed by western blotting (Fig. 2 A). Upon thrombin treatment, a specific increase in the expression of PP2A-B55, which dephosphorylates tau protein, was observed exclusively in GRA16-expressing HT-22 cells, accompanied by increased PTEN protein levels and enhanced dephosphorylation (Ser380) of PTEN to its active form ( P < 0.05) (Figs. 2 B and 2 C). Meanwhile, GSK3β, which acts antagonistically to PP2A and PTEN during tau phosphorylation and directly induces tau hyperphosphorylation, is a key protein involved in neurodegenerative diseases and aging. Notably, Ser389 phosphorylation indicates the inactive form of GSK3β [ 25 ]. Therefore, we also analyzed the expression of GSK3β. Notably, we found that GRA16 decreased GSK3β expression and relatively inactivated GSK3β through phosphorylation at Ser389 ( P < 0.05) (Figs. 2 D and 2 E). As shown in Fig. 2 , GRA16 upregulates PP2A and PTEN, enzymes responsible for directly dephosphorylating p-tau proteins, and inhibits GSK3β, which promotes tau phosphorylation under thrombin-induced pathological neuroinflammation conditions. 3.3. NF-κB inhibition by GRA16 suppresses APOE and upregulates autophagy-related factors via FOXO3A increase in thrombin-induced HT-22 cells We subsequently investigated whether GRA16 could suppress thrombin-induced activation of NF-κB/APOE signaling and enhance autophagy-related factors via FOXO3A (Fig. 3 ). Notably, we found that GRA16 inhibited the phosphorylation of NF-κB (Ser536) in HT-22 cells at the basal state before thrombin treatment ( P < 0.05) (Fig. 3 A). Additionally, we observed a decrease in APOE protein expression and an increase in FOXO3A protein expression ( P < 0.05) (Fig. 3 B). However, no significant difference in the expression of autophagy-related genes was noted, except for PINK1 ( P < 0.05) (Fig. 3 C). In the case of PINK1, an autophagy-inducing gene activated by PTEN, evidence suggests that the activation of PTEN by GRA16 influenced the expression of PINK1 [ 23 , 26 ]. Meanwhile, in the thrombin-induced intracellular neuroinflammatory environment, dephosphorylation of NF-κB (Ser536) continued to occur in GRA16-expressing HT-22 cells ( P < 0.05) (Fig. 3 D). Simultaneously, the decrease in APOE protein and increase in FOXO3A protein were significantly more pronounced in the thrombin-induced neuroinflammatory state than in the basal state ( P < 0.05) (Fig. 3 E). Notably, we found a marked increase in FOXO3A protein, highlighting the substantial impact of the thrombin-induced neuroinflammatory environment in GRA16-expressing HT-22 cells. These findings also had a positive effect on autophagy-related factors. In thrombin-treated HT-22 cells expressing GRA16, all autophagy-related genes (BECN1, SQSTM1/p62, PINK1, OPTN) except CDK5, including ATG12, BNIP3, and LC3, which are directly regulated by FOXO3A, showed a more pronounced increase ( p < 0.05) (Fig. 3 F). These results confirmed that GRA16 can suppress NF-κB/APOE signaling and promote the upregulation of autophagy-related factors centered on FOXO3A under thrombin-induced neuroinflammatory conditions in HT-22 cells. 3.4. GRA16 blocks tau hyperphosphorylation by further enhancing the thrombin-induced autophagic flux Based on our results regarding the expression of autophagy-related signaling pathway factors regulated by GRA16, we analyzed whether GRA16 could further enhance the intracellular autophagic flux under thrombin-induced neuroinflammatory conditions and whether this could inhibit tau hyperphosphorylations in HT-22 cells (Fig. 4 ). Using an autophagy assay, we examined autophagic fluorescence and quantified the corresponding fluorescence intensity in HT-22 cells following thrombin treatment and observed changes in autophagic flux induced by GRA16 ( P < 0.05) (Figs. 4 A and 4 B). Rapamycin, a well-known autophagy inducer, served as a positive control and significantly increased autophagic fluorescence (23,138 AU) ( P < 0.05) (Figs. 4 A and 4 B). Under basal conditions (i.e., nontreated HT-22 cells), there were no significant differences in autophagic fluorescence among the control (9,883 AU), vector (10,005 AU), and GRA16 (11,090 AU) groups ( P < 0.05) (Figs. 4 A and 4 B). In contrast, following thrombin treatment, autophagic fluorescence increased in all experimental groups, with GRA16-expressing HT-22 cells displaying the highest fluorescence levels (27,273 AU) compared with the control (17,175 AU) and vector (16,769 AU) groups ( P < 0.05) (Figs. 4 A and 4 B). Next, we used fluorescence microscopy to analyze the fluorescence intensity of hyperphosphorylated tau proteins after thrombin treatment. Under basal conditions (i.e., nontreated HT-22 cells), we found no significant differences in the fluorescence intensity of phosphorylated tau (Ser202/Thr205, AT8) between the control (7.19 AU), vector (6.71 AU), and GRA16 (5.92 AU) groups ( P < 0.05) (Figs. 4 C and 4 D). In contrast, following thrombin treatment, phosphorylated tau (Ser202/Thr205, AT8) levels were markedly lower in GRA16-expressing cells (17.06 AU) compared with those in the control (50.2 AU) and vector (53.51 AU) groups ( P < 0.05) (Figs. 4 E and 4 F). We conducted a western blot analysis to assess the phosphorylation of tau proteins at two sites (Ser202/Thr205 and Ser422). Under basal conditions (i.e., nontreated HT-22 cells), there were no significant differences in phosphorylated tau (Ser202/Thr205 and Ser422) relative to total tau between any of the experimental groups ( P < 0.05) (Figs. 4 G and 4 H). Conversely, following thrombin treatment, GRA16-expressing cells exhibited a significantly greater reduction in phosphorylation at both sites (Ser202/Thr205 and Ser422) compared with the control and vector groups (P < 0.05) (Figs. 4 I and 4 J). Next, we analyzed cell growth based on changes in autophagy under thrombin-mediated cellular tau aggregates conditions. Following thrombin treatment, GRA16-expressing HT-22 cells exhibited relatively low proliferation ( P < 0.05) (Fig. 4 K), similar to that observed in control HT-22 cells treated with rapamycin. However, cell proliferation tended to gradually increase over time across all HT-22 cell groups ( P < 0.05) (Fig. 4 K). We analyzed the effects of suppression of cell proliferation due to increased autophagy on cell apoptosis and cell-cycle arrest. Caspase-3 protein, a marker of cell apoptosis, including its active form did not differ significantly, either generally or in its active form (cleaved caspase-3), between the experimental groups with nontreated or thrombin-treated HT-22 cells ( P < 0.05) (Figs. 4 L and 4 M). Conversely, we found significantly elevated levels of cell-cycle arrest marker p21 in nontreated and thrombin-treated GRA16-expressing HT-22 cells ( P < 0.05) (Figs. 4 O and 4 P). Reportedly, under thrombin-induced neuroinflammatory conditions, GRA16 enhances intracellular autophagic flux, effectively reducing the accumulation of tau and concurrently slowing cell proliferation by modulating the cell-cycle to promote autophagy. 4. Discussion The current study investigated the interplay between T. gondii GRA16, tau hyperphosphorylation and aggregation, and autophagy in hippocampal neurons experimentally induced with neurofibrillary degeneration at the cellular level. For this purpose, HT-22 cells, a murine hippocampal neuronal cell line, were treated with thrombin to induce tau hyperphosphorylation, after which the mechanisms regulating tau phosphorylation and autophagy following GRA16 transduction were analyzed. Thrombin induces hyperphosphorylation of tau. In so doing, it can contribute to tauopathy, a condition associated with AD [ 27 ]. Tau hyperphosphorylation occurs at multiple sites along the tau protein, including Thr181 (AT270), Ser202/Thr205 (AT8), Ser214/Thr212 (AT100), Ser396/Ser404 (PHF1), and Ser422 (AP422) [ 28 ]. Herein, we selected the p-taus Ser202/Thr205 and Ser422 as marker proteins for tau hyperphosphorylation and thrombin-induced tau aggregation [ 7 ]. These two phosphorylation sites are help form NFTs in HT-22 cells following thrombin treatment. They have previously been employed in neuroinflammation research as markers in cellular models, including AD [ 7 – 9 ]. Meanwhile, Neddens et al. (2018) and Alonso et al. (2018) provided evidence to distinguish hyperphosphorylated tau (Ser202/Thr205 and Ser422) from regular p-tau, demonstrating that hyperphosphorylated tau exhibits a three- to four-fold increase in the number of phosphate moles per mole compared to regular p-tau [ 28 , 29 ]. Also, Elevated total tau (t-tau) levels in cerebrospinal fluid (CSF) are a hallmark of Alzheimer’s disease (AD) and are believed to reflect ongoing neurodegeneration [ 30 ]. Therefore, based on our western blot analysis, which revealed that the relative expression of p-tau (Ser202/Thr205) increased by 5.34-fold and that of p-tau (Ser422) increased by 3.7-fold following treatment with 100 nM thrombin in HT-22 cells, we can conclude that intracellular tau hyperphosphorylation and aggregation were induced. NF-κB, a well-established inflammatory transcription factor that drives neurodegeneration, has emerged as a significant target in inflammatory disease research owing to its broad involvement in cellular inflammatory responses [ 24 ]. APOE, which promotes neuroinflammation by reducing amyloid-β clearance and increasing phosphorylated tau accumulation in AD, is an NF-κB-dependent factor whose expression is elevated by activated NF-κB. The increase in NF-κB-dependent APOE promoter activity may attenuate autophagy by repressing FOXO3A in the pathogenesis of AD [ 16 ]. Notably, our results revealed that NF-κB and APOE were upregulated in thrombin-treated HT-22 cells, which consequently decreased FOXO3A through NF-κB-dependent APOE activation. In contrast, GRA16-expressing HT-22 cells showed an increase in PP2A-B55 expression despite thrombin treatment, whereas NF-κB and APOE levels significantly decreased. The inactivation of NF-κB-dependent APOE by GRA16 markedly increased FOXO3A expression. FOXO3A has been associated with the transcriptional regulation of autophagy in neuronal cells. Mounting evidence indicates that FOXO3A directly activates the transcription of ATG12, BNIP3, and LC3, thereby protecting neuronal cells from the toxic effects of abnormal protein aggregation or misfolding [ 16 ]. Our results indicated that inhibiting FOXO3A in thrombin-treated HT-22 cells suppressed the expression of these genes, thereby restricting the autophagic flux. In contrast, GRA16-expressing HT-22 cells exhibited an increase in the expression of all autophagy-related genes, including FOXO3A downstream genes, thereby inducing a more pronounced induction of the autophagic flux. Meanwhile, CDK5, a serine/threonine kinase, induces tau hyperphosphorylation at multiple epitopes associated with AD [ 31 ]. Under pathological conditions such as the excessive stimulation of N-methyl-D-aspartate (NMDA) receptors, the calcium-dependent protease calpain is activated. This leads to the cleavage of p35, a CDK5 regulatory protein, and to the generation of a truncated fragment known as p25 [ 31 ]. The hyperactive CDK5/p25 complex aberrantly phosphorylates multiple residual serines and threonines on the tau protein [ 31 ]. Despite the occurrence of thrombin-induced tau hyperphosphorylation, we found no significant changes in CDK5 expression in the present study. This discrepancy may be because thrombin induces tau hyperphosphorylation by activating the GSK3β pathway, which is distinct from the CDK5-mediated mechanism. However, further investigation is required to confirm this hypothesis. Previous studies have shown that PP2A-B55 and PTEN act as upstream phosphatases in the tau dephosphorylation process [ 32 , 33 ] and are also tumor suppressors upregulated by GRA16 [ 21 – 23 ]. GSK3β is a direct tau-phosphorylating enzyme that is highly expressed in neurodegenerative diseases, with recent studies showing a correlation between GSK3β and activated NF-κB [ 25 ]. Our results have been the first to demonstrate that, in the context of thrombin-induced tau hyperphosphorylation and aggregation in hippocampal neuronal cells, GRA16 actively induces autophagy to facilitate the clearance of hyperphosphorylated and misfolded tau proteins and aggregates. Rapamycin inhibits cell proliferation and induces autophagy, a cellular process responsible for removing or recycling cellular components. It is also an inhibitor of the protein kinase, mammalian target of rapamycin (mTOR) [ 34 ]. Clinically, it is widely used as an immunosuppressant [ 34 ]. Herein, rapamycin treatment simultaneously enhances autophagic flux and inhibits cell proliferation in HT-22 cells. We found similar effects in thrombin-treated GRA16-expressing cells. To investigate possible causes of the observed suppression of cell proliferation, we compared the expression levels of the cell-cycle arrest factor p21 and caspase 3 and cleaved caspase 3, which are the markers of apoptosis [ 35 , 36 ]. We found no significant differences between groups in the expression levels of caspase 3 and cleaved caspase 3, despite thrombin treatment. In contrast, we saw high levels of p21 expression in GRA16-expressing cells, with and without thrombin treatment. Notably, GRA16 induced high expression of PP2A-B55 and FOXO3A, which are involved in autophagy regulation and cell-cycle arrest. Therefore, GRA16 activates autophagy in response to thrombin-induced neuroinflammation. This causes the suppression of tau hyperphosphorylation and tau aggregate formation, and the attenuation of cell proliferation through the induction of cell-cycle arrest. T. gondii is an obligate intracellular protozoan capable of invading and replicating in the cells of warm-blooded animals [ 37 ]. During host cell infection, T. gondii induces immune evasion mechanisms that suppress innate and adaptive immunity by releasing several secretory proteins from three types of specialized secretory organelles: micronemes, rhoptries, and dense granules [ 23 , 37 ]. This host signaling pathway is essential for T. gondii fitness, enabling its survival and proliferation within host cells [ 23 ]. Conversely, this immune evasion mechanism could serve to protect the host brain cells in the context of neurodegenerative diseases. Our previous study demonstrated that enhancing the production of anti-inflammatory cytokines in disease-related inflammatory states suppresses neuroinflammation and restores homeostasis [ 38 , 39 ]. These results therefore suggest the possibility that proteins secreted during T. gondii infection, such as GRA16, may have a mitigating effect on diseases, including AD. In conclusion, the current study confirmed that GRA16 enhances tau dephosphorylation in tauopathies driven by tau hyperphosphorylation and promotes the clearance of tau aggregates through autophagy. Our results uncover a unique regulatory mechanism of GRA16 at the cellular level of the AD environment, with intracellular NFTs being a pathological feature, and suggest that GRA16 could be a novel therapeutic strategy for targeting tau and autophagy. Declarations 6. Author Contributions All authors contributed to this study. Conceptualization was performed by S.H.S. and E.H.S. Material preparation and methodology were performed by S.H.S. and J.E.L. Data collection and analysis were performed by S.H.S, D.W.H, and J.E.L. Project administration and supervision were performed by E.H.S. The first draft of the manuscript was written by S.H.S. and E.H.S. and all authors commented on previous versions of the manuscript. All authors have read and approved the final manuscript. 7. Data availability statement The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. 8. Additional information 8 .1. Funding This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIT) (No. NRF-2022R1A2C1009234) and by grant no. 14-2023-0005 from the Seoul National University Bundang Hospital (SNUBH) Research Fund. 8 .2. Competing Interests The authors declare no competing interests. References Ciurea, V. A. et al. Alzheimer's disease: 120 years of research and progress. J. Med. Life 16, 173–177 (2023). Deture, M. A. et al. The neuropathological diagnosis of Alzheimer’s disease. Mol. Neurodegener. 14, 32 (2019). Chen, Y. et al. Tau and neuroinflammation in Alzheimer’s disease: Interplay mechanisms and clinical translation. J. Neuroinflammation 20, 165 (2023). Moore, K. B. E. et al. Hyperphosphorylated tau (p-tau) and drug discovery in the context of Alzheimer's disease and related tauopathies. Drug Discov. Today 28, 103487 (2023). Laurent, C. et al. Tau and neuroinflammation: What impact for Alzheimer's disease and tauopathies? Biomed. J. 41, 21–33 (2018). Noble, W. et al. The importance of Tau phosphorylation for neurodegenerative diseases. Front. Neurol. 4, 83 (2013). Suo, Z. et al. Rapid Tau aggregation and delayed hippocampal neuronal death induced by persistent thrombin signaling. J. Biol. Chem. 278, 37681–37689 (2003). Iannucci, J. et al. Thrombin, a key driver of pathological inflammation in the brain. Cells 12, 1222 (2023). Bihaqi, S. W. et al. Dabigatran reduces thrombin-induced neuroinflammation and AD markers in vitro: Therapeutic relevance for Alzheimer's disease. Cereb. Circ. - Cogn. Behav. 2, 100014 (2021). Zhang, Z. et al. Autophagy in Alzheimer’s disease pathogenesis: Therapeutic potential and future perspectives. Ageing Res. Rev. 72, 101464 (2021). Silva, M. C. et al. Prolonged tau clearance and stress vulnerability rescue by pharmacological activation of autophagy in tauopathy neurons. Nat. Commun. 11, 3258 (2020). Liu, X. et al. The emerging role of autophagy and mitophagy in tauopathies: From pathogenesis to translational implications in Alzheimer’s disease. Front. Aging Neurosci. 14, 1022821 (2022). Bai, I. et al. Epigenetic regulation of autophagy in neuroinflammation and synaptic plasticity. Front. Immunol. 15, 1322842 (2024). Williams, T. et al. Therapeutic approaches targeting Apolipoprotein E function in Alzheimer’s disease. Mol. Neurodegener. 15, 1–19 (2020). Maloney, B. et al. Important differences between human and mouse APOE gene promoters: limitation of mouse APOE model in studying Alzheimer’s disease. J. Neurochem. 103, 1237–1257 (2007). Sohn, H. Y. et al. ApoE4 attenuates autophagy via FoxO3a repression in the brain. Sci. Rep. 11, 17604 (2021). Liu, Q. Q. et al. The role of Foxo3a in neuron-mediated cognitive impairment. Front. Mol. Neurosci. 17 (2024). Bougdour, A. et al. Host cell subversion by toxoplasma gra16, an exported dense granule protein that targets the host cell nucleus and alters gene expression. Cell Host & Microbe 13, 489–500 (2013). Lu, X. X. et al. PTEN inhibits cell proliferation, promotes cell apoptosis, and induces cell cycle arrest via downregulating the PI3K/AKT/ hTERT Pathway in lung adenocarcinoma A549 cells. BioMed Res. Int. 2016, 2476842 (2016). Pan, J. et al. Targeting protein phosphatases for the treatment of inflammation-related diseases: From signaling to therapy. Signal Transduct. Target. Ther. 7, 177 (2022). Kim, S. G. et al. Increase in the nuclear localization of PTEN by the Toxoplasma GRA16 protein and subsequent induction of p53‐dependent apoptosis and anticancer effect. J. Cell. Mol. Med. 23, 3234–3245 (2019). Seo, S. H. et al. Toxoplasma GRA16 Inhibits NF-κB Activation through PP2A-B55 Upregulation in Non-Small-Cell Lung Carcinoma Cells. Int. J. Mol. Sci. 21, 6642 (2020). Seo, S. H. et al. PTEN/AKT signaling pathway related to hTERT downregulation and telomere shortening induced in Toxoplasma GRA16-expressing colorectal cancer cells. Biomed. Pharmacother. 153, 113366 (2022). Sun, E. et al. The Pivotal Role of NF-kB in the Pathogenesis and Therapeutics of Alzheimer’s Disease. Int. J. Mol. Sci. 23, 8972 (2022). Calvo, B. et al. GSK3β inhibition by phosphorylation at Ser389 controls neuroinflammation. Int. J. Mol. Sci. 24, 337 (2022). Han, Y. et al. Roles of PINK1 in regulation of systemic growth inhibition induced by mutations of PTEN in Drosophila. Cell Rep. 34, 108875 (2021). Toral-Rios, D. et al. GSK3β and tau protein in Alzheimer’s disease and epilepsy. Front. Cell. Neurosci. 14, 19 (2020). Neddens, J. et al. Phosphorylation of different tau sites during progression of Alzheimer’s disease. Acta Neuropathol. Commun. 6, 52 (2018). Alonso, A. D. et al. Hyperphosphorylation of Tau associates with changes in its function beyond microtubule stability. Front. Cell. Neurosci. 12, 338 (2018). Visser, P. J. et al. Cerebrospinal fluid tau levels are associated with abnormal neuronal plasticity markers in Alzheimer’s disease. Mol. Neurodegener. 17, 27 (2022). Pao, P. C. et al. Three decades of Cdk5. J. Biomed. Sci. 28, 79 (2021). Xu, Y. et al. Structure of a protein phosphatase 2A holoenzyme: Insights into B55-mediated tau dephosphorylation. Mol. Cell 31, 873–885 (2008). Zhang, X. et al. Tumor suppressor PTEN affects tau phosphorylation, aggregation, and binding to microtubules. FASEB J. 20, 1272–1274 (2006). Lin, X. et al. Rapamycin inhibits proliferation and induces autophagy in human neuroblastoma cells. Biosci. Rep. 38, BSR20181822 (2018). D’Amelio, M. et al. Caspase-3 in the central nervous system: beyond apoptosis. Trends Neurosci. 35, 700-709 (2012). Engeland, K. Cell cycle regulation: p53-p21-RB signaling. Cell Death Differ. 29, 946-960 (2022). Seo, S. H. et al. Toxoplasma gondii IST suppresses inflammatory and apoptotic responses by inhibiting STAT1-mediated signaling in IFN-γ/TNF-α-stimulated hepatocytes. Parasites Hosts Dis. 62, 30–41 (2024). Ham, D. W. et al. Chronic Toxoplasma gondii infection alleviates experimental autoimmune encephalomyelitis by the immune regulation inducing reduction in IL-17A/Th17 via upregulation of SOCS3. Neurother. 18, 430–447 (2021). Shin, J. H. et al. Reduction of amyloid burden by proliferated homeostatic microglia in Toxoplasma gondii- infected Alzheimer’s disease model mice. Int. J. Mol. Sci. 22, 2764 (2021). Additional Declarations No competing interests reported. Supplementary Files Seoetal.RawdatafinalfileR1.pdf Cite Share Download PDF Status: Published Journal Publication published 20 May, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Accepted 28 Apr, 2025 Reviews received at journal 12 Apr, 2025 Reviewers agreed at journal 28 Mar, 2025 Reviews received at journal 28 Mar, 2025 Reviewers agreed at journal 28 Mar, 2025 Reviewers invited by journal 26 Mar, 2025 Submission checks completed at journal 25 Mar, 2025 First submitted to journal 18 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5586914","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":434104326,"identity":"73e684c7-1e63-46a2-9ab4-63355398bd81","order_by":0,"name":"Seung-Hwan Seo","email":"","orcid":"","institution":"Seoul National University","correspondingAuthor":false,"prefix":"","firstName":"Seung-Hwan","middleName":"","lastName":"Seo","suffix":""},{"id":434104329,"identity":"6b8a1efa-2954-4823-9e2d-84a53c41975c","order_by":1,"name":"Do-Won Ham","email":"","orcid":"","institution":"Seoul National University College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Do-Won","middleName":"","lastName":"Ham","suffix":""},{"id":434104331,"identity":"18730380-5262-4941-92f5-f11604b87286","order_by":2,"name":"Ji-Eun Lee","email":"","orcid":"","institution":"Seoul National University College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ji-Eun","middleName":"","lastName":"Lee","suffix":""},{"id":434104332,"identity":"30f834cc-93ba-402d-bcc2-dc30d2b613ad","order_by":3,"name":"Eun-Hee Shin","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvUlEQVRIiWNgGAWjYDACCQY2hgQGGxg3gWgtaaRqYWA4TIIWfun2Zw8e7jhvby6RwPjhB0NaPkEtknPOmBsknrmduHNGArNkD0OOZQMhLQY3ctgkEttuJxjcSGCQZmCoMCBoi/2N9GdALefsgVqYfxOlxUAiwQyo5QDjhhsJbEBbcghrkbiRA9KSnLjhzMM2yx6DNMJa+GekP5P82WZnb3A8+fCNHxXJhLUgAcYGoDtJ0TAKRsEoGAWjACcAAPJWOA/7ceEgAAAAAElFTkSuQmCC","orcid":"","institution":"Seoul National University","correspondingAuthor":true,"prefix":"","firstName":"Eun-Hee","middleName":"","lastName":"Shin","suffix":""}],"badges":[],"createdAt":"2024-12-05 12:23:27","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5586914/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5586914/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-00271-4","type":"published","date":"2025-05-20T15:58:08+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":79342838,"identity":"d439b270-457f-41a8-88d0-0691caf51436","added_by":"auto","created_at":"2025-03-27 08:57:08","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3896750,"visible":true,"origin":"","legend":"\u003cp\u003eThrombin induces tau hyperphosphorylation in hippocampal neuronal cells and suppresses FOXO3A via NF-kB and APOE activation, thereby limiting the expression of autophagy-related genes. \u003cstrong\u003e(A)\u003c/strong\u003e Fluorescence analysis of phosphorylated tau (p-tau) (Ser202/Thr205) protein expression after thrombin treatment in HT-22 cells. The red areas are p-tau (Ser202/Thr205), while the blue are nuclei. Scale bar = 85 μm; \u003cstrong\u003e(B)\u003c/strong\u003e Quantification of the fluorescence intensity of p-tau (Ser202/Thr205) expression using ImageJ software; \u003cstrong\u003e(C) \u003c/strong\u003eProtein expression of tau and p-tau (Ser202/Thr205) after thrombin treatment in HT-22 cells based on Western blot analysis (n = 3); \u003cstrong\u003e(D)\u003c/strong\u003e Protein expression of tau and p-tau (Ser422) after thrombin treatment in HT-22 cells based on Western blot analysis (n = 3); \u003cstrong\u003e(E)\u003c/strong\u003e Protein expression of NF-κB and p-NF-κB (Ser536) after thrombin treatment in HT-22 cells based on western blot analysis (n = 3); \u003cstrong\u003e(F)\u003c/strong\u003e Protein expression of APOE and FOXO3Aafter thrombin treatment in HT-22 cells based on western blot analysis (n = 3); \u003cstrong\u003e(G)\u003c/strong\u003e Relative mRNA expression of autophagy-related factors responding to thrombin in HT-22 cells based on real-time quantitative polymerase chain reaction (n = 5); \u003cstrong\u003e(H)\u003c/strong\u003e Cell proliferation after thrombin treatment in HT-22 cells (n = 5); \u003cstrong\u003e(I) \u003c/strong\u003eProtein expression of caspase-3 after thrombin treatment in HT-22 cells based on western blot analysis (n = 3).\u003cstrong\u003e \u003c/strong\u003e* Significant at \u003cem\u003eP \u0026lt; \u003c/em\u003e0.05 between nontreated HT-22 cells and thrombin-treated HT-22 cells\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5586914/v1/6e50f53c32c2db7725e1045a.jpg"},{"id":79342839,"identity":"34a4a359-b39c-4832-b373-ff570fb3d154","added_by":"auto","created_at":"2025-03-27 08:57:08","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1540578,"visible":true,"origin":"","legend":"\u003cp\u003eGRA16 upregulated PP2A and PTEN but downregulated GSK3β in thrombin-treated HT-22 cells. \u003cstrong\u003e(A)\u003c/strong\u003e GRA16 protein expression in the experimental HT-22 cell groups (control, vector, and GRA16) after thrombin treatment based on Western blot analysis; \u003cstrong\u003e(B)\u003c/strong\u003e PP2A-B55 protein expression in the experimental HT-22 cell groups after thrombin treatment based on Western blot analysis and their relative protein expression (n = 3); \u003cstrong\u003e(C)\u003c/strong\u003eWestern blot image of PTEN and p-PTEN (Ser380) in the experimental HT-22 cell groups after thrombin treatment and their relative protein expression (n = 3); \u003cstrong\u003e(D)\u003c/strong\u003eWestern blot image of GSK3β and p-GSK3β (Ser389) in the experimental HT-22 cell groups after thrombin treatment and their relative protein expressions (n = 3). † Significant at \u003cem\u003eP \u0026lt; \u003c/em\u003e0.05 between the control and GRA16 in the thrombin-treated experimental HT-22 cell groups. ‡ Significant at \u003cem\u003eP \u0026lt; \u003c/em\u003e0.05 between the vector and GRA16 in thrombin-treated experimental HT-22 cell groups\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5586914/v1/8c23c7b4db00b4fe59d835b2.jpg"},{"id":79343833,"identity":"f1615165-64e2-40b2-a479-a4c131e08cd6","added_by":"auto","created_at":"2025-03-27 09:13:08","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3061448,"visible":true,"origin":"","legend":"\u003cp\u003eGRA16 inhibited NF-κB, thereby enhancing the expression of autophagy-related factors by suppressing APOE and increasing FOXO3A in thrombin-induced cellular neuroinflammation. \u003cstrong\u003e(A)\u003c/strong\u003e Western blot images of NF-κB and p-NF-κB (Ser536) in the experimental HT-22 cell groups without thrombin (n = 3); \u003cstrong\u003e(B)\u003c/strong\u003e Protein expressions of APOE and FOXO3A in the experimental HT-22 cell groups without thrombin based on western blot analysis (n =3); \u003cstrong\u003e(C)\u003c/strong\u003e Relative mRNA expressions of autophagy-related genes in the experimental HT-22 cell groups without thrombin based on real-time qPCR (n = 5); \u003cstrong\u003e(D)\u003c/strong\u003eWestern blot images of NF-κB and p-NF-κB (Ser536) in the experimental HT-22 cell groups with thrombin treatment (n = 3); \u003cstrong\u003e(E)\u003c/strong\u003e protein expressions of APOE and FOXO3A in the experimental HT-22 cell groups with thrombin treatment based on western blot analysis (n = 3); \u003cstrong\u003e(F)\u003c/strong\u003e relative mRNA expressions of autophagy-related genes in the experimental HT-22 cell groups with thrombin treatment based on real-time qPCR (n = 5). † Significant at \u003cem\u003eP \u0026lt; \u003c/em\u003e0.05 between the control and GRA16 in the experimental HT-22 cell groups without or with thrombin treatment. ‡ Significant at \u003cem\u003eP \u0026lt; \u003c/em\u003e0.05 between the vector and GRA16 in the experimental HT-22 cell groups without or with thrombin treatment\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5586914/v1/9d02bb02eb9845658d2be0d0.jpg"},{"id":79342847,"identity":"e5f3e49e-25f8-4395-a8c3-69a850f24125","added_by":"auto","created_at":"2025-03-27 08:57:08","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":6958672,"visible":true,"origin":"","legend":"\u003cp\u003eGRA16 enhanced autophagy and suppressed the accumulation of hyperphosphorylated tau in thrombin-induced intracellular neurofibrillary changes. \u003cstrong\u003e(A)\u003c/strong\u003eImmunofluorescence images of autophagic flux in rapamycin-treated, nontreated (NT), and thrombin-treated experimental HT-22 cell groups. The green areas are regions of intracellular autophagic flux, while the blue areas are the nuclei. Scale bar = 75 μm; \u003cstrong\u003e(B)\u003c/strong\u003e quantification of the fluorescence intensity (AU) of autophagic flux using a fluorescence microplate reader (n = 5); \u003cstrong\u003e(C)\u003c/strong\u003e fluorescence images of nontreated (NT) HT-22 experimental cell groups. red indicates intracellular p-tau (Ser202/Thr205) proteins, whereas the areas stained blue are nuclei. Scale bar = 90 μm;\u003cstrong\u003e (D)\u003c/strong\u003e quantification of the AU of p-tau (Ser202/Thr205) using ImageJ (n = 3); \u003cstrong\u003e(E)\u003c/strong\u003e Fluorescence images of the thrombin-treated HT-22 experimental cell groups. The red areas are intracellular p-tau (Ser202/Thr205) proteins, while the blue areas are nuclei. Scale bar = 90 μm; \u003cstrong\u003e(F)\u003c/strong\u003e Quantification of the AU of p-tau (Ser202/Thr205) using ImageJ software (n = 3); \u003cstrong\u003e(G)\u003c/strong\u003e western blot images of tau and p-tau (Ser202/Thr205) proteins in NT HT-22 experimental cell groups (n = 3); \u003cstrong\u003e(H)\u003c/strong\u003e western blot images of tau and p-tau (Ser422) proteins in NT HT-22 experimental cell groups (n = 3); \u003cstrong\u003e(I) \u003c/strong\u003ewestern blot images of tau and p-tau (Ser202/Thr205) proteins in thrombin-treated HT-22 experimental cell groups (n = 3); \u003cstrong\u003e(J)\u003c/strong\u003e western blot images of tau and p-tau (Ser422) proteins in thrombin-treated HT-22 experimental cell groups (n = 3); \u003cstrong\u003e(K)\u003c/strong\u003e cell proliferation in rapamycin-treated HT-22 cells, NT experimental HT-22 cells, and thrombin-treated experimental HT-22 cells (n = 5); \u003cstrong\u003e(L)\u003c/strong\u003e western blot images of caspase-3 proteins in NT experimental HT-22 cells (n = 3); \u003cstrong\u003e(M)\u003c/strong\u003e western blot images of caspase-3 proteins in thrombin-treated experimental HT-22 cells (n = 3); \u003cstrong\u003e(O)\u003c/strong\u003e relative mRNA expression of p21 in the experimental HT-22 cell groups without thrombin (n = 5); \u003cstrong\u003e(P) \u003c/strong\u003erelative mRNA expression of p21 in the thrombin-treated experimental HT-22 cell groups (n = 5). * Significant at \u003cem\u003eP \u0026lt; \u003c/em\u003e0.05 between NT HT-22 cells and thrombin-treated HT-22 cells. † Significant at \u003cem\u003eP \u0026lt; \u003c/em\u003e0.05 between the control and GRA16 in the experimental HT-22 cell groups with thrombin treatment. ‡ Significant at \u003cem\u003eP \u0026lt; \u003c/em\u003e0.05 between the vector and GRA16 in the experimental HT-22 cell groups with thrombin treatment\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5586914/v1/d8c0ebfa11ccc01683386ec0.jpg"},{"id":83460663,"identity":"ca7b55fd-4fa1-4bf2-9717-96519562c9ca","added_by":"auto","created_at":"2025-05-26 16:13:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":16545434,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5586914/v1/7ecc5284-34c3-4135-ade2-d11b49ee429b.pdf"},{"id":79343059,"identity":"79f467e3-a3d6-4d4a-94a3-6096a0f3782b","added_by":"auto","created_at":"2025-03-27 09:05:08","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":4372309,"visible":true,"origin":"","legend":"","description":"","filename":"Seoetal.RawdatafinalfileR1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5586914/v1/744a19c4bf24b7b0c18c0277.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Toxoplasma GRA16 attenuates tau hyperphosphorylation and enhances autophagy in thrombin-treated HT-22 hippocampal neuronal cells","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAlzheimer\u0026rsquo;s disease (AD) remains the leading cause of dementia, accounting for 60\u0026ndash;80% of cases among the elderly population [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. This condition is characterized by a progressive and irreversible decline in cognition, behavior, and responsiveness to the environment, with affected individuals presenting with various symptoms, such as memory loss, impaired learning, and difficulties with cognition and language [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The development of AD can be attributed to two main pathological features: extracellular neuritic plaques resulting from β-amyloid (Aβ) accumulation and intracellular neurofibrillary tangles (NFTs) composed of hyperphosphorylated tau protein [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In particular, misfolded, hyperphosphorylated tau proteins have been considered a pivotal factor in the pathogenesis of AD and other tauopathies. Consequently, inhibiting the aggregation of hyperphosphorylated tau proteins could be a promising strategy for the discovery and development of therapeutics against AD [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTau pathologies tend to directly promote neuroinflammation [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Tau is mainly localized to neurons and, to a lesser extent, is also expressed in oligodendrocytes and astrocytes. Its primary function is its role in the assembly and stabilization of neuronal microtubules [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. However, the neurofibrillary lesions observed in brain tauopathies, including NFTs in AD, are characterized by highly-ordered aggregations of hyperphosphorylated tau filaments [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. In 2003, Suo \u003cem\u003eet al.\u003c/em\u003e demonstrated that treatment with nanomolar concentrations of thrombin can induce rapid hyperphosphorylation and aggregation of tau in hippocampal neurons [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Thrombin, a pleiotropic enzyme and serine protease involved in blood coagulation, can exert pathogenic effects on neurons [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Under pathological conditions, thrombin levels are usually elevated. Alternatively, thrombin may abnormally infiltrate neuronal tissue. Thrombin activates protease-activated receptors (PARs), leading to tau aggregation and hippocampal degeneration [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. These findings pathogenetically link thrombin to neuroinflammation, including brain tauopathies, associated with cerebrovascular damage, and suggest that thrombin can be employed in \u003cem\u003ein vitro\u003c/em\u003e cell models to investigate these tauopathies.\u003c/p\u003e \u003cp\u003eAutophagy is a lysosome-dependent, evolutionarily conserved cellular process in eukaryotes. This process has been closely associated with the regulation of protein metabolism considering that it enables the degradation and recycling of damaged organelles and misfolded proteins to maintain protein homeostasis. Increasing evidence suggests that autophagy is involved in the regulation of AD pathogenesis [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. A reduction in autophagy can cause neurodegeneration, whereas its stimulation can protect against some proteinopathies. Silva \u003cem\u003eet al.\u003c/em\u003e (2020) used neurons from patients with AD to demonstrate that tau reduction in these cells requires autophagy through the sequestration of the cells into phagolysosomes [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Notably, tau clearance in neurons was predominantly achieved through the inhibition of mammalian target of rapamycin (mTOR) and mammalian target of rapamycin complex 1 (mTORC1). This is induced by mTOR inhibitors that promote autophagy-mediated tau clearance [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Therefore, in AD, especially with tau pathology, autophagy evidently serves as an essential defense of brain cells through its degradation of NFTs formed by hyperphosphorylated tau protein. Studies have also highlighted the importance of activating autophagy in a neuroinflammatory environment [\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eApolipoprotein E (APOE) plays a crucial role in the pathogenesis of AD. Notably, three predominant APOE variants exist in humans, namely ε2, ε3, and ε4 [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Among these variants, APOE ε4 has been strongly associated with an increased risk of AD. Reports have also shown that polymorphisms in the APOE promoter were correlated with increased AD susceptibility. Aside from humans, mouse models of APOE expression have long been used to study the mechanisms underlying the pathogenesis of AD [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In the context of AD pathogenesis, Sohn \u003cem\u003eet al.\u003c/em\u003e (2021) demonstrated that APOE variants increase the accumulation of hyperphosphorylated tau by impairing autophagy through the repression of forkhead box O3A (FOXO3A) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], a transcription factor that plays a crucial role in regulating various cellular processes, particularly autophagy. More specifically, FOXO3A activates autophagy by upregulating the expression of autophagy-related genes [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Numerous studies suggest that the activation of FOXO3A and subsequent enhancement of autophagy may serve as a neuroprotective mechanism against the accumulation of hyperphosphorylated tau and other toxic proteins associated with AD [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDense granule protein 16 (GRA16), which is secreted by the parasitic protozoan \u003cem\u003eToxoplasma gondii (T. gondii)\u003c/em\u003e, has been found to play an important role in modulating the host cell environment to favor \u003cem\u003eT. gondii\u003c/em\u003e survival and replication [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Once secreted, GRA16 is transported across the parasitophorous vacuole into the cytoplasm and nucleus of the host cell [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. GRA16 directly interacts with B55 regulatory subunit of protein phosphatase 2A (PP2A-B55) and ubiquitin-specific protease 7 (USP7) or indirectly with phosphatase and tensin homolog (PTEN) within host cells to regulate key signaling pathways associated with the cell cycle, apoptosis, and immune responses [\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. By leveraging the functional properties of GRA16, our previous studies demonstrated that GRA16 upregulates the critical tumor suppressors PP2A-B55 and PTEN in cancer cells located in the liver, lungs, and colon and downregulates nuclear factor kappa B (NF-κB), a transcriptional factor that promotes cell cycle progression, proliferation, invasion, and metastasis of cancer cells [\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWith this background, the current study aimed to investigate the following. First, AD was associated with hyperphosphorylated tau, which directly promotes the progression of neuroinflammation. Second, autophagy functions as an essential defense mechanism for degrading NFTs formed by hyperphosphorylated tau in brain cells. Third, during the pathogenesis of AD, the upregulated APOE suppresses FOXO3A, a key regulator of the transcriptional expression of autophagy-related genes, thereby constraining autophagy activation. Therefore, we investigated whether GRA16 reduces the hyperphosphorylation and aggregation of tau protein and promotes autophagy by upregulating FOXO3A through the suppression of APOE in thrombin-induced neuroinflammatory hippocampal neuronal cells.\u003c/p\u003e \u003cp\u003eImportantly, this study might foster a more profound understanding of the molecular processes involved in tau hyperphosphorylation and aggregation that drive neuroinflammation, as well as the autophagy mechanisms that counteract them. Furthermore, our results potentially provide a conceptual foundation for developing new therapeutic approaches that utilize GRA16 as a novel tauopathy downregulator and autophagy enhancer.\u003c/p\u003e"},{"header":"2. Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Cell culture\u003c/h2\u003e \u003cp\u003eMouse hippocampal neuronal cell line (HT-22) was obtained from the Korean Cell Line Bank (Seoul, Korea). The retroviral packaging cell line (Platinum-A) was purchased from Cell Biolabs (San Diego, CA, USA). HT-22 and Platinum-A cells were maintained in Dulbecco\u0026rsquo;s Modified Eagle Medium (DMEM) (Welgene, Gyeongsan, Korea) supplemented with 10% fetal bovine serum (FBS) (Welgene) and 1% antibiotic\u0026ndash;antimycotic (AA) (Welgene). HT-22 cells were differentiated in neurobasal medium (Thermo Fisher Scientific, Waltham, MA, USA) containing 2 mM L-glutamine (Thermo Fisher Scientific) and 1 \u0026times; N-2 supplement (Thermo Fisher Scientific) for 24 h prior to use.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Cell transduction\u003c/h2\u003e \u003cp\u003eTo produce HT-22 cells stably expressing the GRA16 protein, we prepared a retrovirus transfer plasmid (\u003cem\u003epBABE-HAII-GRA16\u003c/em\u003e) containing the \u003cem\u003egra16\u003c/em\u003e gene constructed in a previous study [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Platinum-A cells were seeded into 6-well plates at 5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells per well 24 h before transfection. Thereafter, 2.5 \u0026micro;g of DNA constructs were transfected into each well using Lipofectamine 3000 kit (Thermo Fisher Scientific) and Opti-Minimal Essential Medium (Opti-MEM) (Thermo Fisher Scientific). Afterward, 1.5 \u0026micro;g of \u003cem\u003epBABE-HAII-GRA16\u003c/em\u003e, 0.75 \u0026micro;g of \u003cem\u003epCMV-Gag-Pol\u003c/em\u003e (Retrovirus packaging plasmid), and 0.25 \u0026micro;g of \u003cem\u003epMD2.G\u003c/em\u003e (Retrovirus envelop plasmid) were mixed with 5 \u0026micro;L of P3000 reagent and 5 \u0026micro;L of Lipofectamine 3000 reagent in 250 \u0026micro;L of Opti-MEM (Thermo Fisher Scientific). After 15 min of incubation at room temperature, the mixture was added to the Platinum-A cells. After 48 h of transfection, the cell culture medium was harvested, centrifuged for 5 min with 1,000 \u0026times; \u003cem\u003eg\u003c/em\u003e and filtered using a 0.45-\u0026micro;m filter. The supernatant was frozen using liquid nitrogen and stored at \u0026minus;\u0026thinsp;80\u0026deg;C before using. For viral transduction, HT-22 cells were seeded into 6-well plates at 5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells per well. After 24 h, the viral supernatant was distributed to each well with 8 \u0026micro;g of polybrene (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and incubated for 48 h. GRA16 protein-expressing HT-22 cells were selected using a fresh DMEM medium supplemented with 10% FBS and 1% AA with 2 \u0026micro;g/mL of puromycin (Santa Cruz Biotechnology).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. RNA extraction and real-time quantitative polymerase chain reaction (qPCR)\u003c/h2\u003e \u003cp\u003eTotal RNA from the cells was extracted using the HiGene\u0026trade; Total RNA Prep Kit (BioFact, Daejeon, Korea). Using a Reverse-Transcription Premix (Elpis Biotech, Daejeon, Korea), 1 \u0026micro;g of the RNA was incubated at 70\u0026deg;C for 5 min and reverse transcribed to cDNA using the following conditions: 42\u0026deg;C for 1 h, then 94\u0026deg;C for 5 min, in a 20 \u0026micro;L of reaction volume. Subsequently, real-time qPCR was performed using 20 \u0026micro;L of reaction mixture comprising 1 \u0026micro;L of cDNA, 10 pmol of primers, and 10 \u0026micro;L of TOPreal\u0026trade; qPCR 2X PreMIX (SYBR Green with low ROX) (Enzynomics, Daejeon, Korea). Amplification reactions were performed at 95\u0026deg;C for 15 min, followed by 40 cycles of 95\u0026deg;C for 20 s, 59\u0026deg;C for 20 s, and 72\u0026deg;C for 30 s. SYBR Green fluorescent signals were assessed using iQ\u0026trade;5 optical system software (Bio-Rad Laboratories, Hercules, CA, USA). The relative expression of the target gene was compared to that of the control group after normalizing it to the Ct value of \u003cem\u003eGAPDH\u003c/em\u003e. The primer sequences of the target genes were obtained from OriGene\u0026trade; Technologies (Rockville, MD, USA). All primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences used in real-time quantitative polymerase chain reaction\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCDK5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTACTCCACGTCCATCGACATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCATTGTTCCTCAGTCGGTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAAGGCTGTAGGAGACACTCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAAGGGGCAAAGGACTGATTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBNIP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTCCAAGAGTTCTCACTGTGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTTTTTCTCGCCAAAGCTGTGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLC3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGCCTGTCCTGGATAAGACCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGGTTGACCAGCAGGAAGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBECN1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGCCTCTGAAACTGGACACGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCTCCTGAGTTAGCCTCTTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSQSTM1/p62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTCTTCGGAAGTCAGCAAACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAGTTTCCCGACTCCATCTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePINK1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGACAACATCCTTGTGGAGTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCATTGCCACCACGCTCTACACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOPTN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGTGGAGAGACTTGAAGTCGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCTCGCTGTCTGCTTCTCAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCGCTGTCTTGCACTCTGGTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAATCTGCGCTTGGAGTGATAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATCACTGCCACCCAGAAGACTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGCCAGTGAGCTTCCCGTTCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003eATG12, autophagy-related gene 12; BECN1, Beclin 1; BNIP3, BCL2 interacting protein 3; CDK5, cyclin-dependent kinase 5; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LC3, microtubule-associated protein light chain 3; OPTN, optineurin; PINK1, PTEN-induced kinase 1; SQSTM1/p62, sequestosome 1\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Western blot analysis\u003c/h2\u003e \u003cp\u003eTotal proteins from HT-22 cells were extracted using M-PER\u0026trade; Mammalian Protein Extraction Reagent (Thermo Fisher Scientific). Proteins were quantified using Pierce\u0026trade; BCA Protein Assay Kit (Thermo Fisher Scientific). A total of 30 \u0026micro;g of proteins per mini-gel well was separated using 12% SDS-PAGE and transferred onto polyvinylidene fluoride membranes at 100 V for 1 h at 4\u0026deg;C using the Mini Trans-Blot\u0026reg; Electrophoretic Transfer Cell (Bio-Rad Laboratories) instrument. The transferred membranes were blocked in 5% bovine serum albumin (BSA) in TBS-T (TBS with 0.1% Tween-20) for 1.5 h at room temperature. The blocked membranes were incubated with primary antibodies for 16 h at 4\u0026deg;C. Thereafter, the membranes were washed three times with TBS-T and incubated with horseradish peroxidase-conjugated secondary antibodies for 1 h at room temperature. Target proteins on the membrane were visualized using Pierce\u0026trade; ECL western Blotting Substrate (Thermo Fisher Scientific). Images were captured using Amersham Imager 680 (GE healthcare, Chicago, IL, USA), and the signal intensities were calculated using ImageJ (free software provided by the National Institutes of Health). The relative expression of the target protein was normalized to the density value of β-actin and compared to that in the control group. All antibodies are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAntibodies used in immunofluorescence and western blot analysis\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimary antibody\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAntibody dilution\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSource\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCat. no.\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhospho-tau (Ser202, Thr205) (AT8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eInvitrogen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMN1020\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhospho-tau (Ser422)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eInvitrogen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e44-764G\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTau\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eInvitrogen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePA5-29610\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhospho-NF-κB p65 (Ser536)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eABclonal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePA1294\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNF-κB p65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8242\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHA tag (For GRA16)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3724\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePP2A-B55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSanta Cruz Biotechnology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003esc-365282\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhospho-PTEN (Ser380)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSanta Cruz Biotechnology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003esc-377573\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePTEN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSanta Cruz Biotechnology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003esc-7974\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhospho-GSK3β (Ser389)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProteintech\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14850-1-AP\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGSK3β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9315\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAPOE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSanta Cruz Biotechnology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003esc-390925\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFOXO3A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSanta Cruz Biotechnology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003esc-48348\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCaspase 3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSanta Cruz Biotechnology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003esc-56053\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSanta Cruz Biotechnology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003esc-47778\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSecondary antibody\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eAntibody dilution\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eSource\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eCat. no.\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003em-IgG\u003csub\u003eK\u003c/sub\u003e BP-HRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:2,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSanta Cruz Biotechnology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003esc-516102\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGoat antirabbit IgG (H\u0026thinsp;+\u0026thinsp;L)-HRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:4,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eInvitrogen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e32460\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDonkey antimouse IgG (H\u0026thinsp;+\u0026thinsp;L)-Alexa Fluor 594\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:2,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eInvitrogen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA-21203\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Immunofluorescence\u003c/h2\u003e \u003cp\u003eHT-22 cells were fixed with 4% paraformaldehyde solution for 10 min at room temperature. After washing with PBS (pH 7.5), the cells were treated for 15 min at room temperature with a permeabilization solution (PBS with 0.2% Triton X-100), incubated with a blocking buffer (PBS with 0.1% Tween-20 containing 1% BSA and 22.52 mg/mL glycine) for 1 h at room temperature, washed with PBS-T (TBS with 0.1% Tween-20) buffer, and then stained with antiphospho-Tau antibody (Ser202/Thr205, AT8) (Invitrogen) for 16 h at 4\u0026deg;C. After washing with PBS-T, the cells were stained with donkey antimouse IgG (H\u0026thinsp;+\u0026thinsp;L)-Alexa Fluor 594 antibody (Invitrogen) as a secondary antibody for 1 h at room temperature in the dark. Thereafter, the cells were washed with PBS-T and stained with Hoechst33342 (Sigma\u0026ndash;Aldrich, St. Louis, MO, USA) diluted in PBS (5 \u0026micro;g/mL) for 5 min at room temperature in the dark. After another wash with PBS-T, the cell samples were visualized under a DE/DMI6000B inverted fluorescence microscope (Leica, Wetzlar, HE, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Autophagy assay\u003c/h2\u003e \u003cp\u003eHT-22 cells were seeded into 96-well plates at 4 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells/well and incubated for 24 h at 37\u0026deg;C before the autophagy assay. The cells were treated with 100 nM thrombin for 24 h at 37\u0026deg;C. As a positive control, the cells were treated with 500 nM rapamycin, an autophagy inducer, for 24 h at 37\u0026deg;C, washed with 1 \u0026times; assay buffer, dispensed in the Microscopy Dual Detection Reagent, and then incubated for 30 min at 37\u0026deg;C away from light. Thereafter, the cells were washed with 1 \u0026times; assay buffer and stained with 5 \u0026micro;g/mL of Hoechst33342 (Sigma\u0026ndash;Aldrich) for 5 min at room temperature in the dark. After another round of washing with 1 \u0026times; assay buffer, 100 \u0026micro;L of 1 \u0026times; assay buffer was added to the cells in each well. Autophagic fluorescence intensity was measured at a wavelength of 480 nm using Infinite\u0026reg; 200 PRO fluorescence microplate reader (Tecan). In addition, the fluorescence autophagic flux was visualized under a DE/DMI6000B inverted fluorescence microscope (Leica).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Cell proliferation assay\u003c/h2\u003e \u003cp\u003eHT-22 cells were seeded into 96-well plates at 2.5 \u0026times; 10\u003csup\u003e3\u003c/sup\u003e cells/well and incubated for 24 h at 37\u0026deg;C before treatment with thrombin. Thereafter, the cells were exposed to 100 nM of thrombin and incubated for 0, 24, 48, 72, and 96 h. At each time point, the cells were treated with CCK-8 reagent and incubated for 1.5 h at 37\u0026deg;C. Finally, the optical density was determined at a wavelength of 450 nm using the Infinite\u0026reg; 200 PRO microplate reader (Tecan, M\u0026auml;nnedorf, Switzerland).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Statistical analysis\u003c/h2\u003e \u003cp\u003eAll statistical analyses were conducted using GraphPad Prism 5 (GraphPad, La Jolla, CA, USA). Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). A t-test was implemented for comparisons between two groups. One-way analysis of variance (ANOVA) followed by a Bonferroni post-hoc comparison test was applied for comparisons between three groups. Two-way ANOVAs followed by Bonferroni post-hoc comparison tests were used to compare cell viability data. Statistical significance (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) was designated as follows: * indicates a difference between the control group and the control\u0026thinsp;+\u0026thinsp;thrombin-group, \u0026dagger; indicates a difference between the control group and the GRA16 group, and \u0026Dagger; indicates a difference between the vector group and the GRA16 group.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cp\u003e \u003cb\u003e3.1. Thrombin induces tau hyperphosphorylation and APOE expression, which are pathologically relevant targets of AD, and partially attenuates the expression of autophagy-related factors regulated by FOXO3A\u003c/b\u003e \u003c/p\u003e \u003cp\u003eImmunofluorescence staining and western blotting were performed to determine whether thrombin treatment induces tau protein hyperphosphorylation in hippocampal neuronal cells (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA\u0026ndash;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). During immunofluorescence staining, thrombin treatment induced a significant increase in the fluorescence expression of hyperphosphorylated tau protein (Ser202/Thr205, AT8) in HT-22 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). We evaluated changes in p-tau (Ser202/Thr205, AT8) protein expression by measuring fluorescence intensity (as arbitrary units [AU]). The results showed p-tau (S202/T205, AT8) levels to be significantly elevated in thrombin-treated HT-22 cells (46.1 AU) compared with untreated HT-22 cells (4.63 AU) (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Using western blotting, we analyzed the total amounts of tau protein, as well as p-tau (Ser202/Thr205 and Ser422) levels. Notably, thrombin treatment increased in total tau protein and enhanced tau phosphorylation (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Thereafter, to investigate the activation of NF-κB, which is known to be a major cause of tau hyperphosphorylation and tangling of hippocampal neuronal cells, NF-κB protein expression in thrombin-treated HT-22 cells was analyzed. Our results showed a significant increase in the phosphorylation of NF-κB (Ser536) (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). Meanwhile, NF-κB is a well-known inflammatory transcription factor that regulates neurodegeneration in the context of common neurodegenerative diseases. NF-κB activation increases neuroinflammation and triggers an increase in the APOE promoter function associated with AD development [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. APOE attenuates autophagy, causing phosphorylated tau accumulation by repressing FOXO3A in the pathogenesis of AD [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The results of thrombin treatment, which activated NF-κB, demonstrated increased APOE protein expression and decreased FOXO3A protein expression (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). Under thrombin-induced tau hyperphosphorylation conditions, these results were characterized by a decrease in the expression of direct downstream targets of FOXO3A, such as autophagy-related gene/protein 12 (ATG12), BCL2 interacting protein 3 (BNIP3), and microtubule-associated protein light chain 3 (LC3), along with only a limited increase in certain autophagy-related genes (Beclin 1 [BECN1], sequestosome 1 [SQSTM1/p62], PTEN-induced kinase 1 [PINK1], and optineurin [OPTN]). Meanwhile, the expression of cyclin-dependent kinase 5 (CDK5), known to inhibit autophagy and induce tau hyperphosphorylation, did not show any significant difference (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). Next, to investigate the effect of thrombin on cell growth, a cell proliferation assay was analyzed over time following thrombin treatment. Reportedly, thrombin treatment reduced the rate of cell proliferation (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH). In addition, the expression of caspase-3, a key mediator of apoptosis in neuronal cells, was increased in thrombin-treated HT-22 cells (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eI).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.2. GRA16 affects upstream signaling pathways that modulate the inhibition and activation of tau hyperphosphorylation\u003c/h2\u003e \u003cp\u003eTo investigate how \u003cem\u003eT. gondii-\u003c/em\u003ederived GRA16 affects tau hyperphosphorylation induced by thrombin through the regulation of PP2A and PTEN in hippocampal neuronal cells, GRA16-expressing HT-22 cells were generated using retroviral transfection. Following thrombin treatment, continuous GRA16 protein expression was confirmed by western blotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Upon thrombin treatment, a specific increase in the expression of PP2A-B55, which dephosphorylates tau protein, was observed exclusively in GRA16-expressing HT-22 cells, accompanied by increased PTEN protein levels and enhanced dephosphorylation (Ser380) of PTEN to its active form (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Meanwhile, GSK3β, which acts antagonistically to PP2A and PTEN during tau phosphorylation and directly induces tau hyperphosphorylation, is a key protein involved in neurodegenerative diseases and aging. Notably, Ser389 phosphorylation indicates the inactive form of GSK3β [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Therefore, we also analyzed the expression of GSK3β. Notably, we found that GRA16 decreased GSK3β expression and relatively inactivated GSK3β through phosphorylation at Ser389 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, GRA16 upregulates PP2A and PTEN, enzymes responsible for directly dephosphorylating p-tau proteins, and inhibits GSK3β, which promotes tau phosphorylation under thrombin-induced pathological neuroinflammation conditions.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.3. NF-κB inhibition by GRA16 suppresses APOE and upregulates autophagy-related factors via FOXO3A increase in thrombin-induced HT-22 cells\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe subsequently investigated whether GRA16 could suppress thrombin-induced activation of NF-κB/APOE signaling and enhance autophagy-related factors via FOXO3A (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Notably, we found that GRA16 inhibited the phosphorylation of NF-κB (Ser536) in HT-22 cells at the basal state before thrombin treatment (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Additionally, we observed a decrease in APOE protein expression and an increase in FOXO3A protein expression (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). However, no significant difference in the expression of autophagy-related genes was noted, except for PINK1 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). In the case of PINK1, an autophagy-inducing gene activated by PTEN, evidence suggests that the activation of PTEN by GRA16 influenced the expression of PINK1 [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Meanwhile, in the thrombin-induced intracellular neuroinflammatory environment, dephosphorylation of NF-κB (Ser536) continued to occur in GRA16-expressing HT-22 cells (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Simultaneously, the decrease in APOE protein and increase in FOXO3A protein were significantly more pronounced in the thrombin-induced neuroinflammatory state than in the basal state (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Notably, we found a marked increase in FOXO3A protein, highlighting the substantial impact of the thrombin-induced neuroinflammatory environment in GRA16-expressing HT-22 cells. These findings also had a positive effect on autophagy-related factors. In thrombin-treated HT-22 cells expressing GRA16, all autophagy-related genes (BECN1, SQSTM1/p62, PINK1, OPTN) except CDK5, including ATG12, BNIP3, and LC3, which are directly regulated by FOXO3A, showed a more pronounced increase (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). These results confirmed that GRA16 can suppress NF-κB/APOE signaling and promote the upregulation of autophagy-related factors centered on FOXO3A under thrombin-induced neuroinflammatory conditions in HT-22 cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.4. GRA16 blocks tau hyperphosphorylation by further enhancing the thrombin-induced autophagic flux\u003c/h2\u003e \u003cp\u003eBased on our results regarding the expression of autophagy-related signaling pathway factors regulated by GRA16, we analyzed whether GRA16 could further enhance the intracellular autophagic flux under thrombin-induced neuroinflammatory conditions and whether this could inhibit tau hyperphosphorylations in HT-22 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Using an autophagy assay, we examined autophagic fluorescence and quantified the corresponding fluorescence intensity in HT-22 cells following thrombin treatment and observed changes in autophagic flux induced by GRA16 (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Rapamycin, a well-known autophagy inducer, served as a positive control and significantly increased autophagic fluorescence (23,138 AU) (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Under basal conditions (i.e., nontreated HT-22 cells), there were no significant differences in autophagic fluorescence among the control (9,883 AU), vector (10,005 AU), and GRA16 (11,090 AU) groups (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). In contrast, following thrombin treatment, autophagic fluorescence increased in all experimental groups, with GRA16-expressing HT-22 cells displaying the highest fluorescence levels (27,273 AU) compared with the control (17,175 AU) and vector (16,769 AU) groups (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Next, we used fluorescence microscopy to analyze the fluorescence intensity of hyperphosphorylated tau proteins after thrombin treatment. Under basal conditions (i.e., nontreated HT-22 cells), we found no significant differences in the fluorescence intensity of phosphorylated tau (Ser202/Thr205, AT8) between the control (7.19 AU), vector (6.71 AU), and GRA16 (5.92 AU) groups (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). In contrast, following thrombin treatment, phosphorylated tau (Ser202/Thr205, AT8) levels were markedly lower in GRA16-expressing cells (17.06 AU) compared with those in the control (50.2 AU) and vector (53.51 AU) groups (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). We conducted a western blot analysis to assess the phosphorylation of tau proteins at two sites (Ser202/Thr205 and Ser422). Under basal conditions (i.e., nontreated HT-22 cells), there were no significant differences in phosphorylated tau (Ser202/Thr205 and Ser422) relative to total tau between any of the experimental groups (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). Conversely, following thrombin treatment, GRA16-expressing cells exhibited a significantly greater reduction in phosphorylation at both sites (Ser202/Thr205 and Ser422) compared with the control and vector groups \u003cem\u003e(P\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ). Next, we analyzed cell growth based on changes in autophagy under thrombin-mediated cellular tau aggregates conditions. Following thrombin treatment, GRA16-expressing HT-22 cells exhibited relatively low proliferation (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eK), similar to that observed in control HT-22 cells treated with rapamycin. However, cell proliferation tended to gradually increase over time across all HT-22 cell groups (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eK). We analyzed the effects of suppression of cell proliferation due to increased autophagy on cell apoptosis and cell-cycle arrest. Caspase-3 protein, a marker of cell apoptosis, including its active form did not differ significantly, either generally or in its active form (cleaved caspase-3), between the experimental groups with nontreated or thrombin-treated HT-22 cells (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eL and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eM). Conversely, we found significantly elevated levels of cell-cycle arrest marker p21 in nontreated and thrombin-treated GRA16-expressing HT-22 cells (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eO and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eP). Reportedly, under thrombin-induced neuroinflammatory conditions, GRA16 enhances intracellular autophagic flux, effectively reducing the accumulation of tau and concurrently slowing cell proliferation by modulating the cell-cycle to promote autophagy.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe current study investigated the interplay between \u003cem\u003eT. gondii\u003c/em\u003e GRA16, tau hyperphosphorylation and aggregation, and autophagy in hippocampal neurons experimentally induced with neurofibrillary degeneration at the cellular level. For this purpose, HT-22 cells, a murine hippocampal neuronal cell line, were treated with thrombin to induce tau hyperphosphorylation, after which the mechanisms regulating tau phosphorylation and autophagy following GRA16 transduction were analyzed.\u003c/p\u003e \u003cp\u003eThrombin induces hyperphosphorylation of tau. In so doing, it can contribute to tauopathy, a condition associated with AD [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Tau hyperphosphorylation occurs at multiple sites along the tau protein, including Thr181 (AT270), Ser202/Thr205 (AT8), Ser214/Thr212 (AT100), Ser396/Ser404 (PHF1), and Ser422 (AP422) [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Herein, we selected the p-taus Ser202/Thr205 and Ser422 as marker proteins for tau hyperphosphorylation and thrombin-induced tau aggregation [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. These two phosphorylation sites are help form NFTs in HT-22 cells following thrombin treatment. They have previously been employed in neuroinflammation research as markers in cellular models, including AD [\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Meanwhile, Neddens \u003cem\u003eet al.\u003c/em\u003e (2018) and Alonso et al. (2018) provided evidence to distinguish hyperphosphorylated tau (Ser202/Thr205 and Ser422) from regular p-tau, demonstrating that hyperphosphorylated tau exhibits a three- to four-fold increase in the number of phosphate moles per mole compared to regular p-tau [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Also, Elevated total tau (t-tau) levels in cerebrospinal fluid (CSF) are a hallmark of Alzheimer\u0026rsquo;s disease (AD) and are believed to reflect ongoing neurodegeneration [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Therefore, based on our western blot analysis, which revealed that the relative expression of p-tau (Ser202/Thr205) increased by 5.34-fold and that of p-tau (Ser422) increased by 3.7-fold following treatment with 100 nM thrombin in HT-22 cells, we can conclude that intracellular tau hyperphosphorylation and aggregation were induced.\u003c/p\u003e \u003cp\u003eNF-κB, a well-established inflammatory transcription factor that drives neurodegeneration, has emerged as a significant target in inflammatory disease research owing to its broad involvement in cellular inflammatory responses [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. APOE, which promotes neuroinflammation by reducing amyloid-β clearance and increasing phosphorylated tau accumulation in AD, is an NF-κB-dependent factor whose expression is elevated by activated NF-κB. The increase in NF-κB-dependent APOE promoter activity may attenuate autophagy by repressing FOXO3A in the pathogenesis of AD [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Notably, our results revealed that NF-κB and APOE were upregulated in thrombin-treated HT-22 cells, which consequently decreased FOXO3A through NF-κB-dependent APOE activation. In contrast, GRA16-expressing HT-22 cells showed an increase in PP2A-B55 expression despite thrombin treatment, whereas NF-κB and APOE levels significantly decreased. The inactivation of NF-κB-dependent APOE by GRA16 markedly increased FOXO3A expression.\u003c/p\u003e \u003cp\u003eFOXO3A has been associated with the transcriptional regulation of autophagy in neuronal cells. Mounting evidence indicates that FOXO3A directly activates the transcription of ATG12, BNIP3, and LC3, thereby protecting neuronal cells from the toxic effects of abnormal protein aggregation or misfolding [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Our results indicated that inhibiting FOXO3A in thrombin-treated HT-22 cells suppressed the expression of these genes, thereby restricting the autophagic flux. In contrast, GRA16-expressing HT-22 cells exhibited an increase in the expression of all autophagy-related genes, including FOXO3A downstream genes, thereby inducing a more pronounced induction of the autophagic flux. Meanwhile, CDK5, a serine/threonine kinase, induces tau hyperphosphorylation at multiple epitopes associated with AD [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Under pathological conditions such as the excessive stimulation of N-methyl-D-aspartate (NMDA) receptors, the calcium-dependent protease calpain is activated. This leads to the cleavage of p35, a CDK5 regulatory protein, and to the generation of a truncated fragment known as p25 [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The hyperactive CDK5/p25 complex aberrantly phosphorylates multiple residual serines and threonines on the tau protein [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Despite the occurrence of thrombin-induced tau hyperphosphorylation, we found no significant changes in CDK5 expression in the present study. This discrepancy may be because thrombin induces tau hyperphosphorylation by activating the GSK3β pathway, which is distinct from the CDK5-mediated mechanism. However, further investigation is required to confirm this hypothesis. Previous studies have shown that PP2A-B55 and PTEN act as upstream phosphatases in the tau dephosphorylation process [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] and are also tumor suppressors upregulated by GRA16 [\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. GSK3β is a direct tau-phosphorylating enzyme that is highly expressed in neurodegenerative diseases, with recent studies showing a correlation between GSK3β and activated NF-κB [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Our results have been the first to demonstrate that, in the context of thrombin-induced tau hyperphosphorylation and aggregation in hippocampal neuronal cells, GRA16 actively induces autophagy to facilitate the clearance of hyperphosphorylated and misfolded tau proteins and aggregates.\u003c/p\u003e \u003cp\u003eRapamycin inhibits cell proliferation and induces autophagy, a cellular process responsible for removing or recycling cellular components. It is also an inhibitor of the protein kinase, mammalian target of rapamycin (mTOR) [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Clinically, it is widely used as an immunosuppressant [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Herein, rapamycin treatment simultaneously enhances autophagic flux and inhibits cell proliferation in HT-22 cells. We found similar effects in thrombin-treated GRA16-expressing cells. To investigate possible causes of the observed suppression of cell proliferation, we compared the expression levels of the cell-cycle arrest factor p21 and caspase 3 and cleaved caspase 3, which are the markers of apoptosis [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. We found no significant differences between groups in the expression levels of caspase 3 and cleaved caspase 3, despite thrombin treatment. In contrast, we saw high levels of p21 expression in GRA16-expressing cells, with and without thrombin treatment. Notably, GRA16 induced high expression of PP2A-B55 and FOXO3A, which are involved in autophagy regulation and cell-cycle arrest. Therefore, GRA16 activates autophagy in response to thrombin-induced neuroinflammation. This causes the suppression of tau hyperphosphorylation and tau aggregate formation, and the attenuation of cell proliferation through the induction of cell-cycle arrest.\u003c/p\u003e \u003cp\u003e \u003cem\u003eT. gondii\u003c/em\u003e is an obligate intracellular protozoan capable of invading and replicating in the cells of warm-blooded animals [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. During host cell infection, \u003cem\u003eT. gondii\u003c/em\u003e induces immune evasion mechanisms that suppress innate and adaptive immunity by releasing several secretory proteins from three types of specialized secretory organelles: micronemes, rhoptries, and dense granules [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. This host signaling pathway is essential for \u003cem\u003eT. gondii\u003c/em\u003e fitness, enabling its survival and proliferation within host cells [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Conversely, this immune evasion mechanism could serve to protect the host brain cells in the context of neurodegenerative diseases. Our previous study demonstrated that enhancing the production of anti-inflammatory cytokines in disease-related inflammatory states suppresses neuroinflammation and restores homeostasis [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. These results therefore suggest the possibility that proteins secreted during \u003cem\u003eT. gondii\u003c/em\u003e infection, such as GRA16, may have a mitigating effect on diseases, including AD.\u003c/p\u003e \u003cp\u003eIn conclusion, the current study confirmed that GRA16 enhances tau dephosphorylation in tauopathies driven by tau hyperphosphorylation and promotes the clearance of tau aggregates through autophagy. Our results uncover a unique regulatory mechanism of GRA16 at the cellular level of the AD environment, with intracellular NFTs being a pathological feature, and suggest that GRA16 could be a novel therapeutic strategy for targeting tau and autophagy.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003e6. Author\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eContributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to this study. Conceptualization was performed by S.H.S. and E.H.S. Material preparation and methodology were performed by S.H.S. and J.E.L. Data collection and analysis were performed by S.H.S, D.W.H, and J.E.L. Project administration and supervision were performed by E.H.S. The first draft of the manuscript was written by S.H.S. and E.H.S. and all authors commented on previous versions of the manuscript. All authors have read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e7.\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;Data availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e8. Additional information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e8\u003c/strong\u003e\u003cstrong\u003e.1. Funding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIT) (No. NRF-2022R1A2C1009234) and by grant no. 14-2023-0005 from the Seoul National University Bundang Hospital (SNUBH) Research Fund.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e8\u003c/strong\u003e\u003cstrong\u003e.2. Competing Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eCiurea, V. A. et al. Alzheimer\u0026apos;s disease: 120 years of research and progress. \u003cem\u003eJ. Med. Life\u003c/em\u003e 16, 173\u0026ndash;177 (2023).\u003c/li\u003e\n\u003cli\u003eDeture, M. A. et al. The neuropathological diagnosis of Alzheimer\u0026rsquo;s disease. \u003cem\u003eMol. Neurodegener.\u003c/em\u003e 14, 32 (2019).\u003c/li\u003e\n\u003cli\u003eChen, Y. et al. Tau and neuroinflammation in Alzheimer\u0026rsquo;s disease: Interplay mechanisms and clinical translation. \u003cem\u003eJ. Neuroinflammation\u003c/em\u003e 20, 165 (2023).\u003c/li\u003e\n\u003cli\u003eMoore, K. B. E. et al. Hyperphosphorylated tau (p-tau) and drug discovery in the context of Alzheimer\u0026apos;s disease and related tauopathies. \u003cem\u003eDrug Discov. Today\u003c/em\u003e 28, 103487 (2023).\u003c/li\u003e\n\u003cli\u003eLaurent, C. et al. Tau and neuroinflammation: What impact for Alzheimer\u0026apos;s disease and tauopathies? \u003cem\u003eBiomed. J.\u003c/em\u003e 41, 21\u0026ndash;33 (2018).\u003c/li\u003e\n\u003cli\u003eNoble, W. et al. The importance of Tau phosphorylation for neurodegenerative diseases. \u003cem\u003eFront. Neurol.\u003c/em\u003e 4, 83 (2013).\u003c/li\u003e\n\u003cli\u003eSuo, Z. et al. Rapid Tau aggregation and delayed hippocampal neuronal death induced by persistent thrombin signaling. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e 278, 37681\u0026ndash;37689 (2003).\u003c/li\u003e\n\u003cli\u003eIannucci, J. et al. Thrombin, a key driver of pathological inflammation in the brain. \u003cem\u003eCells\u003c/em\u003e 12, 1222 (2023).\u003c/li\u003e\n\u003cli\u003eBihaqi, S. W. et al. Dabigatran reduces thrombin-induced neuroinflammation and AD markers in vitro: Therapeutic relevance for Alzheimer\u0026apos;s disease. \u003cem\u003eCereb. Circ. - Cogn. Behav.\u003c/em\u003e 2, 100014 (2021).\u003c/li\u003e\n\u003cli\u003eZhang, Z. et al. Autophagy in Alzheimer\u0026rsquo;s disease pathogenesis: Therapeutic potential and future perspectives. \u003cem\u003eAgeing Res. Rev.\u003c/em\u003e 72, 101464 (2021).\u003c/li\u003e\n\u003cli\u003eSilva, M. C. et al. Prolonged tau clearance and stress vulnerability rescue by pharmacological activation of autophagy in tauopathy neurons. \u003cem\u003eNat. Commun.\u003c/em\u003e 11, 3258 (2020).\u003c/li\u003e\n\u003cli\u003eLiu, X. et al. The emerging role of autophagy and mitophagy in tauopathies: From pathogenesis to translational implications in Alzheimer\u0026rsquo;s disease. \u003cem\u003eFront. Aging Neurosci.\u003c/em\u003e 14, 1022821 (2022).\u003c/li\u003e\n\u003cli\u003eBai, I. et al. Epigenetic regulation of autophagy in neuroinflammation and synaptic plasticity. \u003cem\u003eFront. Immunol.\u003c/em\u003e 15, 1322842 (2024).\u003c/li\u003e\n\u003cli\u003eWilliams, T. et al. Therapeutic approaches targeting Apolipoprotein E function in Alzheimer\u0026rsquo;s disease. \u003cem\u003eMol. Neurodegener.\u003c/em\u003e 15, 1\u0026ndash;19 (2020).\u003c/li\u003e\n\u003cli\u003eMaloney, B. et al. Important differences between human and mouse APOE gene promoters: limitation of mouse APOE model in studying Alzheimer\u0026rsquo;s disease. \u003cem\u003eJ. Neurochem.\u003c/em\u003e 103, 1237\u0026ndash;1257 (2007).\u003c/li\u003e\n\u003cli\u003eSohn, H. Y. et al. ApoE4 attenuates autophagy via FoxO3a repression in the brain. \u003cem\u003eSci. Rep.\u003c/em\u003e 11, 17604 (2021).\u003c/li\u003e\n\u003cli\u003eLiu, Q. Q. et al. The role of Foxo3a in neuron-mediated cognitive impairment. \u003cem\u003eFront. Mol. Neurosci.\u003c/em\u003e 17 (2024).\u003c/li\u003e\n\u003cli\u003eBougdour, A. et al. Host cell subversion by toxoplasma gra16, an exported dense granule protein that targets the host cell nucleus and alters gene expression. \u003cem\u003eCell Host \u0026amp; Microbe\u003c/em\u003e 13, 489\u0026ndash;500 (2013).\u003c/li\u003e\n\u003cli\u003eLu, X. X. et al. \u003cem\u003ePTEN \u003c/em\u003einhibits cell proliferation, promotes cell apoptosis, and induces cell cycle arrest via downregulating the PI3K/AKT/\u003cem\u003ehTERT\u003c/em\u003ePathway in lung adenocarcinoma A549 cells. \u003cem\u003eBioMed Res. Int.\u003c/em\u003e 2016, 2476842 (2016).\u003c/li\u003e\n\u003cli\u003ePan, J. et al. Targeting protein phosphatases for the treatment of inflammation-related diseases: From signaling to therapy. \u003cem\u003eSignal Transduct. Target. Ther.\u003c/em\u003e 7, 177 (2022).\u003c/li\u003e\n\u003cli\u003eKim, S. G. et al. Increase in the nuclear localization of PTEN by the \u003cem\u003eToxoplasma\u003c/em\u003e GRA16 protein and subsequent induction of p53‐dependent apoptosis and anticancer effect. \u003cem\u003eJ. Cell. Mol. Med.\u003c/em\u003e 23, 3234\u0026ndash;3245 (2019).\u003c/li\u003e\n\u003cli\u003eSeo, S. H. et al. \u003cem\u003eToxoplasma \u003c/em\u003eGRA16 Inhibits NF-\u0026kappa;B Activation through PP2A-B55 Upregulation in Non-Small-Cell Lung Carcinoma Cells. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e 21, 6642 (2020).\u003c/li\u003e\n\u003cli\u003eSeo, S. H. et al. PTEN/AKT signaling pathway related to hTERT downregulation and telomere shortening induced in \u003cem\u003eToxoplasma\u003c/em\u003e GRA16-expressing colorectal cancer cells. \u003cem\u003eBiomed. Pharmacother. \u003c/em\u003e153, 113366 (2022).\u003c/li\u003e\n\u003cli\u003eSun, E. et al. The Pivotal Role of NF-kB in the Pathogenesis and Therapeutics of Alzheimer\u0026rsquo;s Disease. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e 23, 8972 (2022).\u003c/li\u003e\n\u003cli\u003eCalvo, B. et al. GSK3\u0026beta; inhibition by phosphorylation at Ser389 controls neuroinflammation. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e 24, 337 (2022).\u003c/li\u003e\n\u003cli\u003eHan, Y. et al. Roles of PINK1 in regulation of systemic growth inhibition induced by mutations of PTEN in Drosophila. \u003cem\u003eCell Rep.\u003c/em\u003e 34, 108875 (2021).\u003c/li\u003e\n\u003cli\u003eToral-Rios, D. et al. GSK3\u0026beta; and tau protein in Alzheimer\u0026rsquo;s disease and epilepsy. \u003cem\u003eFront. Cell. Neurosci.\u003c/em\u003e 14, 19 (2020).\u003c/li\u003e\n\u003cli\u003eNeddens, J. et al. Phosphorylation of different tau sites during progression of Alzheimer\u0026rsquo;s disease. \u003cem\u003eActa Neuropathol. Commun.\u003c/em\u003e 6, 52 (2018).\u003c/li\u003e\n\u003cli\u003eAlonso, A. D. et al. Hyperphosphorylation of Tau associates with changes in its function beyond microtubule stability. \u003cem\u003eFront. Cell. Neurosci.\u003c/em\u003e 12, 338 (2018).\u003c/li\u003e\n\u003cli\u003eVisser, P. J. et al. Cerebrospinal fluid tau levels are associated with abnormal neuronal plasticity markers in Alzheimer\u0026rsquo;s disease. \u003cem\u003eMol. Neurodegener.\u003c/em\u003e 17, 27 (2022).\u003c/li\u003e\n\u003cli\u003ePao, P. C. et al. Three decades of Cdk5. \u003cem\u003eJ. Biomed. Sci.\u003c/em\u003e 28, 79 (2021).\u003c/li\u003e\n\u003cli\u003eXu, Y. et al. Structure of a protein phosphatase 2A holoenzyme: Insights into B55-mediated tau dephosphorylation. \u003cem\u003eMol. Cell\u003c/em\u003e 31, 873\u0026ndash;885 (2008).\u003c/li\u003e\n\u003cli\u003eZhang, X. et al. Tumor suppressor PTEN affects tau phosphorylation, aggregation, and binding to microtubules. \u003cem\u003eFASEB J.\u003c/em\u003e 20, 1272\u0026ndash;1274 (2006).\u003c/li\u003e\n\u003cli\u003eLin, X. et al. Rapamycin inhibits proliferation and induces autophagy in human neuroblastoma cells. \u003cem\u003eBiosci. Rep. \u003c/em\u003e38, BSR20181822 (2018).\u003c/li\u003e\n\u003cli\u003eD\u0026rsquo;Amelio, M. et al. Caspase-3 in the central nervous system: beyond apoptosis. \u003cem\u003eTrends Neurosci.\u003c/em\u003e 35, 700-709 (2012).\u003c/li\u003e\n\u003cli\u003eEngeland, K. Cell cycle regulation: p53-p21-RB signaling. \u003cem\u003eCell Death Differ.\u003c/em\u003e 29, 946-960 (2022).\u003c/li\u003e\n\u003cli\u003eSeo, S. H. et al. \u003cem\u003eToxoplasma gondii\u003c/em\u003e IST suppresses inflammatory and apoptotic responses by inhibiting STAT1-mediated signaling in IFN-\u0026gamma;/TNF-\u0026alpha;-stimulated hepatocytes. \u003cem\u003eParasites Hosts Dis.\u003c/em\u003e 62, 30\u0026ndash;41 (2024).\u003c/li\u003e\n\u003cli\u003eHam, D. W. et al. Chronic \u003cem\u003eToxoplasma\u003c/em\u003e\u003cem\u003e gondii\u003c/em\u003e infection alleviates experimental autoimmune encephalomyelitis by the immune regulation inducing reduction in IL-17A/Th17 via upregulation of SOCS3. \u003cem\u003eNeurother. \u003c/em\u003e18, 430\u0026ndash;447 (2021).\u003c/li\u003e\n\u003cli\u003eShin, J. H. et al. Reduction of amyloid burden by proliferated homeostatic microglia in \u003cem\u003eToxoplasma\u003c/em\u003e\u003cem\u003e gondii-\u003c/em\u003einfected Alzheimer\u0026rsquo;s disease model mice. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e 22, 2764 (2021).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Autophagy, Dense granule protein 16, Hippocampal neuronal cell, Hyperphosphorylated tau, Tauopathy, Toxoplasma gondii","lastPublishedDoi":"10.21203/rs.3.rs-5586914/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5586914/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis study investigated whether \u003cem\u003eToxoplasma gondii\u003c/em\u003e-derived dense granule protein 16 (GRA16) modulates tau protein to attenuate tau hyperphosphorylation and promotes autophagy to facilitate the removal of tau aggregates. HT-22 murine hippocampal neuronal cells were treated with thrombin to induce rapid hyperphosphorylations and tau aggregation. Thrombin increased hyperphosphorylated tau protein levels and activated NF-κB, contributing to tau pathology and neuroinflammation. NF-κB activation increased apolipoprotein E (APOE) expression and decreased forkhead box O3A (FOXO3A) expression, a factor involved in autophagy regulation, consequently limiting the expression of autophagy-related genes directly regulated by FOXO3A. Meanwhile, in GRA16-transfected HT-22 cells treated with thrombin, GRA16 upregulated proteins involved in tau dephosphorylation but downregulated protein involved in tau phosphorylation. Moreover, GRA16 inhibited thrombin-induced NF-κB activation and increased FOXO3A levels, thereby enhancing the expression of autophagy-related genes, including those directly regulated by FOXO3A. GRA16 enhanced intracellular autophagic flux and inhibited tau hyperphosphorylations in thrombin-treated HT-22 cells, as evidenced by increased autophagic fluorescence and significant reductions in phosphorylated tau protein levels and fluorescence intensity. These findings suggest that GRA16 possesses therapeutic potential in tauopathies by enhancing tau dephosphorylation and autophagy-mediated tau clearance, establishing a conceptual foundation for developing new therapeutic approaches targeting tau pathology.\u003c/p\u003e","manuscriptTitle":"Toxoplasma GRA16 attenuates tau hyperphosphorylation and enhances autophagy in thrombin-treated HT-22 hippocampal neuronal cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-03-27 08:57:03","doi":"10.21203/rs.3.rs-5586914/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Accepted","date":"2025-04-28T05:06:22+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-12T15:33:59+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"319264232833448318263073368690188663219","date":"2025-03-28T08:20:56+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-03-28T07:02:30+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"258195381827421371510218083356811226727","date":"2025-03-28T05:45:16+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-03-26T06:17:24+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-03-25T12:02:11+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-03-18T05:17:32+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6a69d7fa-e644-4429-b532-0317ddc31d6d","owner":[],"postedDate":"March 27th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":46223239,"name":"Biological sciences/Cell biology"},{"id":46223240,"name":"Biological sciences/Molecular biology"},{"id":46223241,"name":"Biological sciences/Neuroscience"}],"tags":[],"updatedAt":"2025-05-26T16:10:04+00:00","versionOfRecord":{"articleIdentity":"rs-5586914","link":"https://doi.org/10.1038/s41598-025-00271-4","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-05-20 15:58:08","publishedOnDateReadable":"May 20th, 2025"},"versionCreatedAt":"2025-03-27 08:57:03","video":"","vorDoi":"10.1038/s41598-025-00271-4","vorDoiUrl":"https://doi.org/10.1038/s41598-025-00271-4","workflowStages":[]},"version":"v1","identity":"rs-5586914","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5586914","identity":"rs-5586914","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00