Weaning caused imbalanced T lymphocytes distribution and impaired intestinal immune barrier function in piglets

Weaning caused imbalanced T lymphocytes distribution and impaired intestinal immune barrier function in piglets | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Weaning caused imbalanced T lymphocytes distribution and impaired intestinal immune barrier function in piglets li huai YU, li Dong, Meng xuan Wang, Zhong Peng, Hongrong Wang, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2368056/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract A total of 40 piglets with similar body weights were selected in pairs at 21 days old and divided into the suckling group (SG: breastfed by their mothers) and weaning group (WG: weaned at 21 days old). Eight piglets from each group were randomly selected and sacrificed at 24 days (SG3 and WG3) and 28 days of age (SG7 and WG7). The growth performance, T lymphocyte subpopulations, the concentration of cytokines and immunoglobulins, and the expression of Notch2 signaling proteins were determined. The weaning caused a decrease in body weight ( P < 0.01) and the ratio of CD3 + CD4 + /CD3 + CD8 + T cells in thymus ( P < 0.05). Compared to SG3, the concentration of secretory immunoglobulin A (sIgA) in jejunum was decreased, and that of interleukin 2 (IL-2) in serum and ileum, IL-1β and IL-2 in jejunum were upregulated ( P < 0.01), while IL-10 in the small intestine was downregulated ( P < 0.05) in WG3. Weaning downregulated gene expression of IL-4 and upregulated gene expression of IL-1β, IL-12, and interferon γ (IFN-γ) in small intestine ( P < 0.05). Further, weaning downregulated protein expression of Notch2 and Hes1 but upregulated Jagged1 expression in small intestine of piglets ( P < 0.05). In summary, weaning caused an imbalance in T lymphocytes distribution, thus impairing the intestinal immune function of piglets, which might be associated with the Notch2 signaling. Furthermore, the impairment of intestinal immune barrier function was more severe at 3 days post-weaning than that at the 7 days post-weaning in piglets. weaning intestine immunity pigs Notch2 T lymphocytes cytokines Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction The pressure of weaning is a severe challenge for the growth of piglets. Sudden changes in psychology, the environment, and feeding habits expose piglets to large immunological stress[ 1 ]. Due to this stress, the intestinal immunity of piglets is affected, making them more susceptible to the invasion of pathogenic microorganisms [ 2 ]. However, the underlying mechanisms of impaired intestinal immunity are not clear at present. We hypothesized that the decreased growth of weaning piglets might be associated with the impaired intestinal immune barrier function mediated by T lymphocytes and Notch2 signaling. Weaning may adversely affect the intestinal immune system of piglets, thereby leading to intestinal inflammation and damage to the mucosal barrier functions [ 3 ]. T lymphocytes play a vital role in the regulation of the immune function of piglets. The decreased ratio of CD4 + /CD8 + lymphocytes is an important indicator of immune deficiency [ 4 ]. The Notch2 signaling is critical for the control and development of T lymphocytes and blocking the Notch2 signaling pathway decreases T cell proliferation [ 5 ]. This study was conducted to investigate the effects of weaning on the growth performance, T lymphocyte subpopulations, concentrations of cytokines and immunoglobulins, and the expression of Notch2 signaling in the small intestine of piglets. Jejunum and ileum are the main parts of the small intestine, which play a key role in the digestion and absorption of nutrients [ 6 ] [ 7 ]. Weaning causes shorter villi and higher crypt depth in jejunum and ileum thus resulting in impaired digestion and absorption capacity in piglets and may eventually cause diarrhea [ 8 ]. Therefore, special attention should be paid to the jejunum and ileum of weaning piglets, and was, therefore, studied to observe the different effects of weaning. Different weaning times have different effects on the intestinal immunity of piglets. Early weaning during production results in a shorter reproductive cycle and higher annual productivity for sows [ 9 ]. Late weaning can improve the growth performance of piglets and reduce the occurrence of gastrointestinal diseases [ 10 ]. Colostrum contains more immunomodulatory substances than late breast milk, which may have a significant impact on the development of the immune system of piglets. However, breast milk cannot provide enough nutrients to meet the needs of the growing piglets [ 11 ]. The European Union (EU) banned the use of antibiotics as growth promoters in pigs and livestock production from 1 January 2006, which encouraged pig farms to delay weaning and reduce the stress of weaning for better health of piglets [ 12 ]. Weaning at 21 days of age was generally chosen in commercial pig production and in this study too, we have chosen to wean the piglets in the weaning group at 21 days. Many researchers are also interested in the study of the recovery time of the piglets after weaning. A few studies have suggested that piglets recovered after 9 days, while some others reported that the piglets recovered at 20 days post-weaning [ 13 ] [ 14 ]. However, most of the studies suggested severe immune stress after weaning during the first week. Hence, we observed the changes in the body weight and the intestinal immune barrier function of piglets 3 days and 7 days post-weaning. The results of this study may guide the pig farming industry, especially for the management of piglets shortly after weaning. Materials And Methods Ethical Approval The ethics committee of Yangzhou University has approved all animal experimentation procedures (SXXY 2015-0054). Animal and experimental design The feeding experiment was carried out at Yangzhou Susheng Ecological Agriculture Development Co., Ltd. in January 2017. A total of 20 pairs of healthy (Duroc×(Landrace×Yorkshire)) 21-day-old piglets with similar body weight were chosen from 8 sows. These sows were of similar body weight and similar parity (3-4 parities, half male and half female). Two piglets (one pair) from the same mother were divided into the suckling group and weaning group (WG), respectively. The piglets were reared in one confined house with controlled temperature and light. The piglets in the WG were randomly divided into two pens while the suckling piglets still lived with their mothers. The piglets in the WG had free access to feed and water, while the piglets in the SG had free access to water and the breast of their mothers. All the piglets were vaccinated according to the farm routine before the experiment, and no vaccine was administered during the experiment. The daily management, disinfection, and epidemic prevention measures were performed according to the routine procedures of the pig farm. The feed for the weaning piglets was an in-house prepared meal with no zinc oxide or antimicrobial feed additives that may reduce the weaning stress. The nutrient contents of the diet (Table 1) for the weaning piglets were decided according to NRC (2012) [15]. The formula of the sow diet is given in Supplementary Table S1. Sample collection and preparation Eight piglets from each group were randomly selected and sacrificed at 24 and 28 days of age, respectively. Before sacrificing, each piglet was weighed, and the blood was collected from the posterior jugular vein. The blood samples were centrifuged at 3000 g for 10 minutes to extract serum, and the serum samples were aliquoted and kept at -80 °C until further analysis. The piglets were sacrificed and dissected after administering an intramuscular injection of sodium pentobarbital (50 mg/kg body weight) 2 hours after their final feeding. The intestines were separated, washed with PBS, and the intestinal segments were then cut open. After drying the water and other impurities on the surface with an absorbent paper, the intestinal mucosa was scraped with slides and placed in a 2 mL cryostorage tube before storing at -80℃ for further analysis [16] [17]. Body weight and organ indexes All piglets were weighed at the beginning of experiment and on 3 days and 7 days post weaning (24th day and 28th day). The spleen and thymus of the piglets were separated and weighed. The organ index was determined by using the following formula: organ index = organ weight/body weight (g/kg). Analysis of the activity of LDH Serum samples stored at -80 °C were equilibrated to room temperature and the supernatant was collected after centrifugation at 3000 × g for 10 minutes. The mucosa samples from the jejunum and ileum were homogenized in normal saline in an ice-water bath at a 1:9 (w/v) ratio. The homogenate was centrifuged (3000× g for 10 minutes), and the supernatant was collected for lactate dehydrogenase (LDH) determination (A020-2, Nanjing Jiancheng Institute of Bioengineering, www.njjcbio.com) using a kit according to the manufacturer's instructions (Jiancheng Bioengineering Institute of Nanjing, Jiangsu, China). Analysis of T lumphocyte hy flow cytometry The porcine peripheral blood lymphocyte separator kit (P8770, Beijing Solebold Technology Co., Ltd, Beijing, China, https://www.solarbio.com/) was used to extract lymphocytes from 2.0 ml of fresh heparin sodium anticoagulant blood. To obtain a cell suspension, the particular operation stages were carried out in accordance with the manufacturer's instructions. FITC-CD3 (NO 559582), Alexa 647-CD4 (NO 561472) and PE-CD8 (NO 559584) antibodies (3 μl; 0.2 μg/μl) were added (Biosciences Company, USA, https://www.bdbiosciences.com), and the samples were kept at 4 °C in the dark overnight. On the second day, a FACSAria SORP flow cytometer was used to detect the number of T lymphocyte subsets in the blood (Beckman company, USA). The spleen and thymus tissues were chopped into small pieces and put on a 300-mesh nylon net before being mashed with the core of a disposable syringe and 2-3 mL of saline added. The liquid under the net was collected in a sterilized dish, and the porcine Tissue Lymph Cell Separation Solution Kit (P6020, Beijing Soleibao Technology Co., Ltd., Beijing, China) was then used to extract the lymphocyte suspension. Next, FITC-conjugated anti-CD3, Alexa 647-conjugated anti-CD4 and PE-conjugated anti-CD8 antibodies (3 μl; 0.2 μg/μl) were added to the lymphocyte suspension and incubated overnight in the dark at 4 °C. On the second day, the numbers of T lymphocyte subsets in the spleen and thymus were evaluated. Analysis of the content of cytokines and immunoglobulins by ELISA An ELISA (Enzyme Linked Immunesorbent Assay) kit was used to measure the concentrations of immunoglobulin A (IgA, NO H108), immunoglobulin G (IgG, NO H106), interleukin-1 beta (IL-1β, NO H002), interleukin-2 (IL-2, NO H003), interleukin10 (IL-10, NO H009), interleukin-12 (IL-12, NO H010), Interferon-γ (IFN-γ, NO H025), tumour necrosis factor-alpha (TNF-α, NO H05 (Nanjing JianCheng Bioengineering Institute, Jiangsu, China) in the serum, jejunum and ileum according to the manufacturer's instructions (Nanjing JianCheng Bioengineering Institute, Jiangsu, China). Quantitative real-time PCR analysis of relative mRNA expression TRIzol was used to extract total RNA from mucosa of jejunum and ileum (Invitrogen, Shanghai, China). Following the manufacturer's instructions, RNA was utilized to generate complementary DNA (cDNA) using PrimeScript TM RT reagent Kit with gDNA Eraser (TaKaRa Biotechnology Co. Ltd., Dalian, China). qRT-PCR was performed on cDNA using an Applied Biosystems 7500 Real-Time PCR System (Life Technologies, USA). To quantitatively analyze the target gene, the primers were diluted to 10 μM and β-actin was utilized as an internal reference. Primer-BLAST (http://www.ncbi.nlm.nih.gov) was used to create gene-specific primers. Suzhou Jinweizhi Biotechnology Co., Ltd. produced the primer sequences, which are presented in Table 2. (Jiangsu, China). The relative expression of the target gene was calculated using the comparative 2 -ΔΔCT approach [18]. Western blot analysis of relative protein expression Protein was extracted from intestinal mucosal tissue using a total protein extraction kit (SunShinebio, Nanjing, China) as directed by the manufacturer. Protein concentrations were determined using the BCA technique (Thermo Scientific, Shanghai, China). Using % SDS–PAGE (SDS–polyacrylamide gel electrophoresis), equal quantities of protein were separated and transferred to polyvinylidene fluoride (PVDF) membranes. After blocking for 1 h at room temperature [19], the membranes were incubated overnight with the following primary antibodies: anti-NOTCH2 (1:500, BioByt, Cambridge, UK), anti-DLL1 (1:500, BioByt, Cambridge, UK), anti-Jagged1 (1:800, Abcam, Cambridge, UK), anti-HES1 (1:500, LSBio, WA, USA), and anti-GAPDH (1:500, LSBio, WA, USA) (1:2000, Cell Signalling, MA, USA). After being thoroughly washed to remove nonspecific binding, the membranes were incubated for 1 hour at room temperature with a horseradish peroxidase-conjugated secondary antibody (goat anti-rabbit IgG) (Boster Biological Technology Co., Ltd., USA). The immunoreactive bands were washed before being detected using an ECL western blotting detection method. For densitometric detection of band intensity, ImageJ software (Wayne Rasband, MD, USA) was utilized. The band density of each blot was standardized using the density of a reference sample and the GAPDH content. Statistical analysis Experimental data were analyzed by SPSS 23.0. Growth performance and organ weight data were analyzed by an independent t test. Other data were analyzed by two-factors analysis of variance with two fixed factors of time (T) and group (G). Independent t test was further conducted to investigated the difference between the SG and the WG on different time point post weaning. P values between 0.05 and 0.10 were identified as with a trend, and differences were identified as significant when P < 0.05. All data are shown as the mean ± standard error. Results Growth performance and immune organ index The results indicated that the body weight of piglets in the WG was lower than that in the SG at 3 days post-weaning and 7 days post-weaning ( P 0.05) (Figure 1B). Lactate dehydrogenase (LDH) in the serum and small intestine The concentration of LDH in the serum from the WG was increased as compared to SG, especially 3 days after weaning ( P < 0.05) (Figure 2A). The levels of LDH in the jejunum and ileum were further upregulated at 7 days post-weaning ( P < 0.05) (Figures 2B and 2C). Number of T lymphocytes in the blood, thymus, and spleen The number of CD3 + T cells in the blood was lower in the WG ( P < 0.05) as compared to the SG, whereas those in the thymus and spleen were higher in the WG ( P < 0.05). Furthermore, the number of CD3 + CD4 + T cells in the thymus and the ratio of CD3 + CD4 + /CD3 + CD8 + T cells in the thymus and spleen of WG were lower than that in the SG ( P < 0.05), especially 3 days post-weaning (Figures 3A-D). Level of immunoglobulins and cytokines in the serum and intestine There was no significant difference in the IgA and IgG concentrations in the serum between the SG and WG ( P > 0.05) (Figure 4A). The sIgA concentration in the jejunum of WG3 was lower than that in the SG3 ( P < 0.05) (Figure 4B). The concentrations of interleukin 2 (IL-2) in the serum and ileum, and that of IL-1β and IL-2 in the jejunum of WG3 were higher than that in SG3 ( P < 0.01). Further, the concentration of IL-2 in the jejunum of WG7 was higher than that in SG7 ( P < 0.01). In addition, the IL-10 concentrations in the small intestine of WG3 and jejunum of WG7 were lower than that in SG3 and SG7, respectively ( P < 0.05) (Figures 4C-E). Gene expression of cytokines in the small intestine The gene expression of IL4 was downregulated in the jejunum, while that of IL-12 ( P < 0.05) and interferon γ (IFN-γ) ( P < 0.01) in the jejunum, and IL-1β in the ileum were upregulated in the WG in comparison with SG ( P < 0.05). Further, the gene expression of IL-2 and IL-4 in the ileum of WG3 was higher than that in SG3 ( P < 0.05). Considering the WG7 group, the gene expression of IL-4 was decreased, while that of IL-12 and IFN-γ in the jejunum and IL-1β, IL-2, and IFN-γ in the ileum were upregulated as compared to SG7 ( P < 0.05) (Figures 5A and 5B). Gene and protein expression of Notch2 signaling in the small intestine The gene expression of Jagged1 in the ileum of WG3 was lower than that in SG3 ( P < 0.01). Similarly, the gene expression of Notch2 and Jagged1 in the jejunum and Delta-like 1 (DLL1) in the ileum were downregulated ( P < 0.05) (Figures 6A and 6B). Further, the protein expression of Hes1 and Notch2 in the jejunum was downregulated, while Jagged1 in the ileum was upregulated in WG when compared with SG ( P < 0.05) (Figures 6C-F). Discussion The immune system of piglets is not fully developed at weaning time. The immature adaptive immune system along with the change in the feed types and the living conditions make the piglets susceptible to the invasion of pathogenic microorganisms, and result in diarrhea and decreased growth [20]. However, the underlying mechanisms of these observations were not elucidated yet. We hypothesized that the diarrhea and decreased growth of weaning piglets might be associated with the T lymphocytes and Notch2 signaling caused impaired intestinal immune function. This study was conducted to investigate the effects of weaning on the growth performance and intestinal immune function of piglets. The results of this study may guide the pig raising industry, especially for the management of piglets shortly after weaning. In this study, weaning caused a decrease in the body weight of piglets 3 days and 7 days post-weaning, which might be associated with the transition from breast milk to a solid diet and weaning stress. Previous studies also suggested that the piglets had a significant weight loss after weaning [6] [21] [22]. In addition, the body weight of the piglets was severely affected 3 days post-weaning, while it was better 7 days post-weaning. The piglets gradually adapted to the changes in the environment and diet 7 days after weaning, and the gastrointestinal digestive function gradually became matured driven by the adaptive immune system. A previous study had reported a similar trend wherein severe body weight loss was observed on day 3 after weaning and the piglets gradually regained weight 9 days after weaning [23]. Thus, these results indicated that the piglets experienced severe stress 3 days post-weaning, but the stress response was relieved 7 days post-weaning. LDH catalyzes the mutual conversion of pyruvate and lactic acid and participates in the catabolism and anabolism of carbohydrates. During anaerobic glycolysis, ATP is produced when pyruvate is converted to lactic acid by LDH [24]. LDH is present in various tissues of animals and is an important indicator of the stress state [25]. Weaning causes stress reactions in piglets, including diarrhea, decreased feed intake, and increased LDH activity [6] [25]. The reduced feed intake of weaned pigs causes an increased LDH concentration in the serum [26]. In this study, weaning caused an increased content of LDH in the serum, especially 3 days after weaning. The stress state was severe up to 3 days of weaning while the level of LDH at 7 days post-weaning was alleviated, thereby confirming that the weaning stress may have a greater impact on young piglets on the first few days after weaning. T lymphocytes play a vital role in the regulation of the immune function of piglets. Herein, we focused on the number of CD3 + T lymphocytes and its two major subsets, CD3 + CD4 + and CD3 + CD8 + T lymphocytes. CD3 + T lymphocytes accounted for 30% ~ 70% of T lymphocytes. The other T lymphocytes, including CD4 + CD45RA + , CD28 + , CD38 + , and CD95 + T lymphocytes, were not detected in the study [27]. The CD2 + , CD3 + , CD4 + , CD8 + , and other molecules on the surface of T lymphocytes are closely related to T lymphocyte recognition, antigen presentation, and immune function [28]. CD3 + T cells represent mature T lymphocytes and are associated with T cell receptor expression and signaling [29]. CD4 + T cells assist B cells to secrete antibodies and their activation can enhance the binding of TCR-CD3 complexes to MHC class II antigens and induce macrophages to produce a strong bactericidal effect [30]. CD8 + is the receptor of MHC class I molecules and an important marker of cytotoxic T cells. Its activation helps the cytotoxic T cells mediate the damage of target antigens by releasing perforin and granulation enzymes [31]. The major cause of illness in pigs is a decline in the number and function of CD4 + T cells among the T cell subsets [32]. In this study, weaning caused a reduction in CD3 + CD4 + T cells in the thymus of piglets, especially 3 days post-weaning, which might explain the decreased ratio of CD4 + /CD8 + lymphocytes to some extent. The decreased ratio of CD4 + /CD8 + lymphocytes is an important indicator of immune deficiency and suggests that the piglets may be infected by pathogens [4]. The ratio of CD3 + CD4 + /CD3 + CD8 + T cells in the thymus and spleen of WG3 was lower than that in the SG3, which suggested an immune deficiency in weaning piglets 3 days post-weaning, thereby emphasizing a need for strengthening the daily management during this period. The intestine is the main point for the entry of pathogens. sIgA is the most abundant antibody in the intestine that defends the intestinal epithelium against harmful bacteria, modulates antigen capture, and aids in the immunological protection of the intestinal mucosa [33] [34] [35]. Breastfeeding has a long-term impact on future health and is an important physiological factor that affects the development of intestinal function and the immune system [36]. Many studies have shown that colostrum and breast milk contain high concentrations of sIgA, and its synthesis in animals after weaning mainly depends on their adaptive immune system [37]. The adaptive immune system of piglets is not fully developed at weaning time, and the level of sIgA in the small intestine decreases after weaning. The results of our study were in accordance with the previous studies [12] [13], where weaning caused a decreased concentration of sIgA in the small intestine 3 days post-weaning. The reason for the decreased IgA concentration in the intestine after weaning could be attributed to the reduced availability of the resources of IgA, colostrum and breast milk after weaning when the synthesis of sIgA mainly depends on the still weak adaptive immune system of animals. In addition, our study also showed that the concentration of sIgA in WG returned to the level of lactation 7 days after weaning, which may be due to the maturation of the immune system of piglets stimulated by weaning stress, which can promote the synthesis of intestinal sIgA in piglets. However, a previous study suggested that the concentration of IgA increased in the intestine 20 days after weaning [2]. The different results between the two studies may be due to the choice of different time points. The time points chosen in the earlier study were 4-, 20- and 40-days post-weaning and the IgA levels were not tested between 4 and 20 days post-weaning [2]. Thus, our results suggested that the intestinal immune barrier function of piglets was impaired after weaning, but after a period of adaptation, the synthesis of sIgA in the intestinal mucosa increased to a level like that of suckling piglets, which indicated that the immune barrier function of the intestine was recovered. Cytokines play a key role in the regulation of intestinal immune function [34] [35]. Tumor necrosis factor alpha (TNF-α), IL-1β, and IFN-γ are proinflammatory cytokines that may impair intestinal epithelial barrier function and tight junction formation [38] [39]. However, some anti-inflammatory cytokines, such as IL-10, may downregulate the expression of pro-inflammatory cytokines (such as IL-6, TNF-α, and IL-1β), thus maintaining intestinal immune homeostasis [40] [41] [42]. IL-4 is a key regulator of the antibody-mediated immune response, influencing B cell proliferation, T cell growth and function, and immunoglobulin conversion [43]. Some studies have shown that weaning increases pro-inflammatory cytokines in the intestines of piglets, and the mRNA expression of IL-1β, IL-6, and TNF-α rises dramatically, which is connected to early inflammation and various intestinal disorders in piglets [44]. Furthermore, there are earlier reports demonstrating that the gene expression of TNF-α and IL-6 rises at 3 and 7 days after weaning and recovers to pre-weaning levels after 14 days. However, within 2 weeks after weaning at 21 days of age, no significant changes in the mRNA expression of inflammatory cytokines (TGF-β and IL-10) are observed in piglets [45]. In our study, weaning caused an increase in the level of IL-1β in the jejunum while decreasing the concentration of IL-10 in the jejunum and ileum. The increased concentration of pro-inflammatory cytokines and decreased concentration of anti-inflammatory cytokines suggested an impaired intestinal barrier function. In addition, 7 days after weaning, the gene expression of IL-4 in the jejunum was decreased. Our results were in accordance with a previous study, which also demonstrated a marked decrease in levels of IL-4 in mice lacking enteral feeding [46]. Further, the gene expression of IL-4 in the ileum was also upregulated, especially 3 days after weaning. In addition, the gene expression of IFN-γ in jejunum and IL-1β and IFN-γ in ileum were also upregulated at 7 days after weaning. Our results are consistent with a previous study, which demonstrated that the gene expression of cytokine increases sharply in the early acute weaning stage and the inflammatory response is obvious, while in the adaptation stage of weaning defense, the intestinal mucosal immune function recovers, and the gene expression of cytokines returns to the pre-weaning level [13]. IL-2 can induce T lymphocyte proliferation and differentiation, and its concentration directly reflects immune function [47]. Studies have shown that IL-2 can induce the pathologic opening of the intestinal tight junction barrier and increase intestinal epithelial permeability [48] [49]. In this study, the concentrations of IL-2 were upregulated in the serum and small intestine and the gene expression of IL-2 was also significantly increased in the ileum of weaned piglets, indicating a weaker intestinal barrier function in weaning piglets. In addition, both the anti-inflammatory and pro-inflammatory cytokines are secreted by Th1 cells and Th2 cells [50]. In the immune response system, the Th1/Th2 dynamic balance is an important factor in maintaining immune stability [51]. Once the balance is disturbed, changes in Th1 or Th2 cells can cause diseases. Hence, weaning causes an imbalance between anti-inflammatory and pro-inflammatory cytokines that may lead to impaired immune barrier function and destruction of the immune response dominated by the Th1/Th2 balance. However, in this study, the concentration of some cytokines in the intestine was not completely consistent with the gene expression of these cytokines. The reasons might be that the mRNA expression could not accurately reflect the quality and quantity of protein expression due to several processes involved before the mRNA is translated to the protein, including storage, transport, degradation, translation regulation, and post-translational processing [52]. The Notch2 signaling pathway affects the function of the intestinal immune system and plays a key role in the maintenance of intestinal immunological homeostasis [18]. The Notch2 signaling is critical for the control and development of T lymphocytes and blocking the Notch2 signaling pathway decreases T cell proliferation [5]. DLL1 mainly induces hematopoietic stem cells and thymic lymphocytes to differentiate into T cells and promotes the development of precursor T cells [53]. Jagged1 also promotes T cell development and activates the T cell response [54]. In this study, weaning caused the inhibition of the gene expression of Notch2, Jagged1, and DLL1 and the downregulation of the protein expression of Notch2 and Hes1 in the small intestine of piglets, which might explain the imbalanced T lymphocytes distribution and the variations in the concentration of cytokines in our previous results. However, the protein expression of Jagged1 in the ileum of weaning piglets was upregulated in this study, which is in line with the observation in a previous study where Jagged1 expression was upregulated in the intestine of mice with intestinal inflammatory injury [55]. The reason for the upregulated protein expression of Jagged1 in weaning piglets is not understood yet and needs further research. Nevertheless, our results suggest that the impaired immune barrier function in the intestine of weaning piglets might be associated with Notch2 signaling. Conclusion In conclusion, weaning caused decreased body weight, imbalanced T lymphocytes distribution, lowered concentration of sIgA and anti-inflammatory cytokines, and increased concentration of pro-inflammatory cytokines in piglets. The impairment of intestinal immune barrier function, which might be associated with the Notch2 signaling was more severe 3 days post-weaning than that at 7 days post-weaning in piglets. Declarations Authors contribution L.D., L.H.Y, and H. R. W. designed the research; L.D., L.H.Y, M.X.W., H.M.L., .Z.P., T.Q., Y.Y.Y., and H.R.W.. made the investigation; L.D., and M.X.W., made formal analysis and data curation; L.D., and M.X.W. wrote the original draft and had the funding acquisition; L.D., L.H.Y, and H. R.W., reviewed and edited the paper, and L.H.Y, had primary responsibility for the final manuscript. All authors read and approved the final manuscript. Conflict of interest There are no conflicts of interest to declare. Funding This work was supported by grants from the Special project of Science and Technology of North Jiangsu Province (grant numbers SZ-YC202101) and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). Availability of data and materials The datasets analyzed in the present study are available from the corresponding author on reasonable request. References Pluske JR, Turpin DL, Kim J-C: Gastrointestinal tract (gut) health in the young pig . Animal Nutrition 2018, 4 (2):187-196. García GR, Dogi CA, Ashworth GE, Berardo D, Godoy G, Cavaglieri LR, de Moreno de LeBlanc A, Greco CR: Effect of breast feeding time on physiological, immunological and microbial parameters of weaned piglets in an intensive breeding farm . Veterinary Immunology and Immunopathology 2016, 176 :44-49. !!! INVALID CITATION !!! (Spreeuwenberg, Verdonk et al. 2001, Brown, Maxwell et al. 2006). Hussain T, Kulshreshtha KK, Yadav VS, Katoch K: CD4+, CD8+, CD3+ cell counts and CD4+/CD8+ ratio among patients with mycobacterial diseases (leprosy, tuberculosis), HIV infections, and normal healthy adults: a comparative analysis of studies in different regions of India . J Immunoassay Immunochem 2015, 36 (4):420-443. Yang L, Zhao K-L, Qin L, Ji D-X, Zhang B, Zheng P-F, Qin Y-M: Notch signaling pathway regulates CD4+ CD25+ CD127dim/− regulatory T cells and T helper 17 cells function in gastric cancer patients . Bioscience Reports 2019, 39 (5). Tang M, Laarveld B, Van Kessel A, Hamilton D, Estrada A, Patience J: Effect of segregated early weaning on postweaning small intestinal development in pigs . Journal of animal science 1999, 77 (12):3191-3200. Mosenthin R: Physiology of small and large intestine of swine-Review . Asian-Australasian Journal of Animal Sciences 1998, 11 (5):608-619. Campbell JM, Crenshaw JD, Polo J: The biological stress of early weaned piglets . Journal of animal science and biotechnology 2013, 4 (1):1-4. Koketsu Y, Tani S, Iida R: Factors for improving reproductive performance of sows and herd productivity in commercial breeding herds . Porcine health management 2017, 3 (1):1-10. Blecha F, Pollman D, Nichols D: Weaning pigs at an early age decreases cellular immunity . Journal of Animal Science 1983, 56 (2):396-400. Gu Y, Li M, Wang T, Liang Y, Zhong Z, Wang X, Zhou Q, Chen L, Lang Q, He Z: Lactation-related microRNA expression profiles of porcine breast milk exosomes . 2012. Heo JM, Opapeju F, Pluske J, Kim J, Hampson D, Nyachoti CM: Gastrointestinal health and function in weaned pigs: a review of feeding strategies to control post ‐weaning diarrhoea without using in ‐feed antimicrobial compounds . Journal of animal physiology and animal nutrition 2013, 97 (2):207-237. de Groot N, Fariñas F, Cabrera-Gómez CG, Pallares FJ, Ramis G: Weaning causes a prolonged but transient change in immune gene expression in the intestine of piglets . Journal of Animal Science 2021, 99 (4):skab065. Colson V, Orgeur P, Foury A, Mormède P: Consequences of weaning piglets at 21 and 28 days on growth, behaviour and hormonal responses . Applied Animal Behaviour Science 2006, 98 (1-2):70-88. Council NR: Nutrient requirements of swine . Natl Acad Press, Washington, DC 2012. Zmudzki J, Osek J, Stankevicius A, Pejsak Z: Rapid detection of Brachyspira hyodysenteriae and Lawsonia intracellularis in swine faecal and mucosal specimens by multiplex PCR . Bulletin of the Veterinary Institute in Puławy 2004, 48 (3). Donowitz M, Wicks J, Battisti L, Pike G, DeLellis R: Effect of Senokot on rat intestinal electrolyte transport: evidence of Ca++ dependence . Gastroenterology 1984, 87 (3):503-512. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method . methods 2001, 25 (4):402-408. Abbasalipourkabir R, Moradi H, Zarei S, Asadi S, Salehzadeh A, Ghafourikhosroshahi A, Mortazavi M, Ziamajidi N: Toxicity of zinc oxide nanoparticles on adult male Wistar rats . Food and chemical toxicology 2015, 84 :154-160. Mathern D, Laitman L, Hovhannisyan Z, Dunkin D, Farsio S, Malik T, Roda G, Chitre A, Iuga A, Yeretssian G: Mouse and human Notch-1 regulate mucosal immune responses . Mucosal immunology 2014, 7 (4):995-1005. Callesen J, Halas D, Thorup F, Knudsen KB, Kim J, Mullan B, Hampson D, Wilson R, Pluske J: The effects of weaning age, diet composition, and categorisation of creep feed intake by piglets on diarrhoea and performance after weaning . Livestock Science 2007, 108 (1-3):120-123. Landrain B, Hemard M, Caugant A, Desprez F: Etude des consequences sur les performances de croissance et d'abattage d'un sevrage a 21 jours comparativement a un sevrage a 28 jours . Journées de la Recherche Porcine en France 1997, 29 :129-134. Hedemann MS, Højsgaard S, Jensen BB: Small intestinal morphology and activity of intestinal peptidases in piglets around weaning . Journal of Animal Physiology and Animal Nutrition 2003, 87 (1‐2):32-41. Powers DA, Lauerman T, Crawford D, Dimichele L: Genetic Mechanisms for Adapting to a Changing Environment . Annual Review of Genetics 1991, 25 (1):629-659. Malyar RM, Li H, Liu D, Abdulrahim Y, Farid RA, Gan F, Ali W, Enayatullah H, Banuree SAH, Huang K: Selenium/Zinc-Enriched probiotics improve serum enzyme activity, antioxidant ability, inflammatory factors and related gene expression of Wistar rats inflated under heat stress . Life sciences 2020, 248 :117464. Funderburke DW, Seerley RW: The effects of postweaning stressors on pig weight change, blood, liver and digestive tract characteristics . J Anim Sci 1990, 68 (1):155-162. Mechanisms Involved in the Low-Level Regeneration of CD4+ Cells in HIV-1--Infected Patients Receiving Highly Active Antiretroviral Therapy Who Have Prolonged Undetectable Plasma Viral Loads . Journal of Infectious Diseases 2005, 191 (10):1670-1679. Fabbri M, Smart C, Pardi R: T lymphocytes . The international journal of biochemistry & cell biology 2003, 35 (7):1004-1008. Shiheido H, Chen C, Hikida M, Watanabe T, Shimizu J: Modulation of the human T cell response by a novel non-mitogenic anti-CD3 antibody . PloS one 2014, 9 (4):e94324. Zhu J, Paul WE: CD4 T cells: fates, functions, and faults . Blood, The Journal of the American Society of Hematology 2008, 112 (5):1557-1569. Arlehamn CSL, Lewinsohn D, Sette A, Lewinsohn D: Antigens for CD4 and CD8 T cells in tuberculosis . Cold Spring Harbor perspectives in medicine 2014, 4 (7):a018465. Tian ZL-hGY, Feng-zheng X-sZ: Effect of CpG DNA on CD4~+ and CD8~+ T Lymphocyte Subpopulations in Blood of Newborn Piglets [J] . Journal of South China University of Technology (Natural Science Edition) 2006, 5 . Cerutti A, Chen K, Chorny A: Immunoglobulin Responses at the Mucosal Interface . Annual Review of Immunology 2011, 29 (1):273-293. Gommerman JL, Rojas OL, Fritz JH: Re-thinking the functions of IgA+ plasma cells . Gut microbes 2014, 5 (5):652-662. Corthésy B: Roundtrip ticket for secretory IgA: role in mucosal homeostasis? The Journal of Immunology 2007, 178 (1):27-32. Cabrera RA, Boyd RD, Jungst SB, Wilson ER, Johnston ME, Vignes JL, Odle J: Impact of lactation length and piglet weaning weight on long-term growth and viability of progeny . Journal of Animal Science 2010, 88 (7):2265. Wagstrom EA, Yoon KJ, Zimmerman JJ: Immune components in porcine mammary secretions . Viral Immunol 2000, 13 (3):383-397. Ye D, Ma I, Ma TY: Molecular mechanism of tumor necrosis factor-α modulation of intestinal epithelial tight junction barrier . American Journal of Physiology-Gastrointestinal and Liver Physiology 2006, 290 (3):G496-G504. Al-Sadi RM, Ma TY: IL-1β Causes an Increase in Intestinal Epithelial Tight Junction Permeability . The Journal of Immunology 2007, 178 (7):4641-4649. Moore KW, O'garra A, de Waal Malefyt R, Vieira P, Mosmann TR: Interleukin-10 . Annual review of immunology 1993, 11 :165-190. Madsen KL, Lewis SA, Tavernini MM, Hibbard J, Fedorak RN: Interleukin 10 prevents cytokine-induced disruption of T84 monolayer barrier integrity and limits chloride secretion . Gastroenterology 1997, 113 (1):151-159. Barada KA, Mourad FH, Sawah SI, Khoury C, Safieh-Garabedian B, Nassar CF, Tawil A, Jurjus A, Saadé NE: Up-regulation of nerve growth factor and interleukin-10 in inflamed and non-inflamed intestinal segments in rats with experimental colitis . Cytokine 2007, 37 (3):236-245. Kampen CV, Gauldie J, Collins SM: Proinflammatory properties of IL-4 in the intestinal microenvironment . American Journal of Physiology Gastrointestinal & Liver Physiology 2005, 288 (1):G111. Pié S, Lalles JP, Blazy F, Laffitte J, Sève B, Oswald IP: Weaning is associated with an upregulation of expression of inflammatory cytokines in the intestine of piglets . The Journal of nutrition 2004, 134 (3):641-647. Hu C, Xiao K, Luan Z, Song J: Early weaning increases intestinal permeability, alters expression of cytokine and tight junction proteins, and activates mitogen-activated protein kinases in pigs . Journal of animal science 2013, 91 (3):1094-1101. Wu Y, Kudsk KA, DeWitt RC, Tolley EA, Li J: Route and type of nutrition influence IgA-mediating intestinal cytokines . Annals of surgery 1999, 229 (5):662. Arenas-Ramirez N, Woytschak J, Boyman O: Interleukin-2: biology, design and application . Trends in immunology 2015, 36 (12):763-777. Zhang H, Li J, Cao C, Zhang B, Yang W, Shi B, Shan A: Pyrroloquinoline quinone inhibits the production of inflammatory cytokines via the SIRT1/NF-κB signal pathway in weaned piglet jejunum . Food & function 2020, 11 (3):2137-2153. Al-Sadi R, Boivin M, Ma T: Mechanism of cytokine modulation of epithelial tight junction barrier . Frontiers in bioscience: a journal and virtual library 2009, 14 :2765. Santos F, Rao V: Antiinflammatory and antinociceptive effects of 1, 8 ‐cineole a terpenoid oxide present in many plant essential oils . Phytotherapy Research: An International Journal Devoted to Pharmacological and Toxicological Evaluation of Natural Product Derivatives 2000, 14 (4):240-244. Behfarjam F, Sanati MH, Nasseri Moghaddam S, Ataei M, Nikfam S, Jadali Z: Role of Th1/Th2 cells and related cytokines in autoimmune hepatitis . Turk J Gastroenterol 2017, 28 (2):110-114. Buccitelli C, Selbach M: mRNAs, proteins and the emerging principles of gene expression control . Nature Reviews Genetics 2020, 21 (10):630-644. Tchekneva EE, Goruganthu MU, Uzhachenko RV, Thomas PL, Antonucci A, Chekneva I, Koenig M, Piao L, Akhter A, de Aquino MTP: Determinant roles of dendritic cell-expressed Notch Delta-like and Jagged ligands on anti-tumor T cell immunity . Journal for immunotherapy of cancer 2019, 7 (1):1-17. Kijima M, Iwata A, Maekawa Y, Uehara H, Izumi K, Kitamura A, Yagita H, Chiba S, Shiota H, Yasutomo K: Jagged1 suppresses collagen-induced arthritis by indirectly providing a negative signal in CD8+ T cells . The Journal of Immunology 2009, 182 (6):3566-3572. Robinson SC, Klobucar K, Pierre CC, Ansari A, Zhenilo S, Prokhortchouk E, Daniel JM: Kaiso differentially regulates components of the Notch signaling pathway in intestinal cells . Cell Communication and Signaling 2017, 15 (1):1-13. Tables Table 1 Composition and nutrient levels of basal diets (air-dry basis) (%） Ingredient Content Nutrition levels 1 Content Corn 60.50 DE（MJ/kg） 14.11 Fish meal 5.00 CP 20.21 Corn gluten meal 5.00 Ca 0.76 Soybean oil 1.00 AP 0.45 Soybean meal 24.00 Lys 1.25 Limestone 1.18 Met 0.43 CaHPO 4 1.30 Thr 0.71 L -Lys 0.60 Trp 0.16 Met 0.13 Thr 0.17 Ser 0.02 Choline chloride 0.10 NaCl 0.40 Premix 2 0.60 Total 100.00 1 Nutrient levels were calculated values. 2 The premix provided the following per kilogram of the diet: VA 6 000 IU, VD 3 400 IU, VE 30 mg, VK 3 2 mg, VB 1 3.5mg, VB 2 5.5 mg, VB 6 3.5 mg, VB 12 25.0μg, biotin 0.05 mg, folic acid 0.3 mg, D -pAntothenic acid 20 mg, niacin 20 mg, choline chloride 500 mg, Fe (as ferrous sulfate) 110 mg, Zn (as zinc sulfate) 100 mg, Cu (as copper sulfate) 20 mg, Mn (as manganese sulfate) 40 mg, Se (as sodium selenite) 0.30 mg, I (as potassium iodide) 0.40 mg. Table 2 Primer parameters used in quantitative real-time PCR 1 Gene Accession No. Primer sequence（5’to 3’） Amplicon size, bp Β-Actin DQ845171.1 F AGGCCAACCGTGAGAAGATG 122 R CATGACAATGCCAGTGGTGC IL-1β NM_001302388 F GTGGCAGGACCTACACTCTTC 115 R TTCCTTCAGAATGCCGTCCTC IL-2 FJ543109.1 F GGAGCCATTGCTGCTGGAT 116 R ATTCTGTAGCCTGCTTGGGC IL-10 NM_214041 F GTGGCAGCCAGCATTAAGTC 103 R AACTCTTCACTGGGCCGAAG IL-12 NM_214097.2 F CTCCCCCAAATCACATCCAATA 110 R ATTCCCTCTCATTTCCTTGGGG TNF-α NM_214022 F GCCCTTCCACCAACGTTTTC 97 R CAAGGGCTCTTGATGGCAGA IFN-γ NM_213948 F GGCCATTCAAAGGAGCATGGA 144 R TCACTGATGGCTTTGCGCT Notch2 XM_021090690 F GCCCGGCAGGATGAATGATTAG 99 R CCCGACATTGCAGTGCTTCT DLL1 XM_005659096 F ATCGCCACCGAGGTGTAAAG 103 R CCTCTCTCAGCAGCATTCGT JAG1 XM_005672699 F TTTCAGGGCGACCTTGCATC 121 R CCACACCACACCTTCGAGC Hes1 NM_001195231 F GTGAGTGCATGAACGAGGTG 118 R GTCATGGCGTTGATCTGGGT 1 IL-1β: interleukin 1β; IL-2: interleukin 2; IL-10: interleukin 10; IL-12: interleukin 12; TNF-α: tumor necrosis factor α; IFN-γ: interferon-γ; Notch2: DLL1: Delta-like; JAG1: Jagge Additional Declarations No competing interests reported. Supplementary Files Supplementary.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2368056","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":159371850,"identity":"432f48ac-32b4-4b30-bb28-4d9e6e95d598","order_by":0,"name":"li huai YU","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAr0lEQVRIiWNgGAWjYBACPgkg8QHCNiBOCxtQC+MMkrUw85CmRbrHTNq2rS6xgb15mwRDzR0itMicMZPObWNLbOA5VibBcOwZMQ7LAWnhSWwAMiQYGw4TqcWyTSKxQf4NKVoY2wyAtvAQrSWt2LLnXIJxG09asUXCMSK08Eskb7zxo6xOtp/98MYbH2qI0MLAwGHAwMgGtA7ETiBGAwMD+wMGhj/EKR0Fo2AUjIIRCgDDCi8I3k68wgAAAABJRU5ErkJggg==","orcid":"","institution":"Yangzhou University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"li","middleName":"huai","lastName":"YU","suffix":""},{"id":159371851,"identity":"84d14e87-6189-4939-8ce4-247cc9192a60","order_by":1,"name":"li Dong","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"li","middleName":"","lastName":"Dong","suffix":""},{"id":159371852,"identity":"e8392fcb-da2c-430c-a25e-39e7187b8f55","order_by":2,"name":"Meng xuan Wang","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Meng","middleName":"xuan","lastName":"Wang","suffix":""},{"id":159371853,"identity":"9f5be865-f24d-4b6c-84a6-1a64852d1a91","order_by":3,"name":"Zhong Peng","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhong","middleName":"","lastName":"Peng","suffix":""},{"id":159371854,"identity":"1db506c9-15d8-4b80-bc03-9c3bf6e06457","order_by":4,"name":"Hongrong Wang","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hongrong","middleName":"","lastName":"Wang","suffix":""},{"id":159371855,"identity":"11e8bd0b-7bb0-4888-ba3a-32b6939ce1af","order_by":5,"name":"Hongmin li","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hongmin","middleName":"","lastName":"li","suffix":""},{"id":159371856,"identity":"82654452-f6e0-4922-af0b-235e32e1d383","order_by":6,"name":"Tao Qin","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tao","middleName":"","lastName":"Qin","suffix":""},{"id":159371857,"identity":"5942db50-a4f0-48af-90e7-ea43e22b0735","order_by":7,"name":"Yinyan Yin","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yinyan","middleName":"","lastName":"Yin","suffix":""}],"badges":[],"createdAt":"2022-12-12 02:59:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2368056/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2368056/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":30326396,"identity":"fab62218-c2f8-4f80-bb2b-cf7df9ceb833","added_by":"auto","created_at":"2022-12-14 15:48:34","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":128899,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of weaning on body weight and immune organ index of piglets. Suckling group [23], Weaning group (WG). Values are means±SEM, Unit definition of y axis: fig1A (kg), fig 1B (g/kg), n=8 per group. The differences between groups at the same time,*p\u0026lt;0.05, the difference was significant at 0.05 level. **p\u0026lt;0.01, the difference was significant at 0.01 level.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-2368056/v1/5f232c40ca9bbd7aeb216d23.png"},{"id":30326397,"identity":"b65b2763-f082-4c1c-ad70-9ffec183b95f","added_by":"auto","created_at":"2022-12-14 15:48:34","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":186622,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of weaning on LDH Contents in Serum and intestine Mucosa of Piglets. suckling group 3 days (SG3), Weaning group 3 days (WG3), suckling group 7 days (SG7), Weaning group 7 days (WG7). Values are means±SEM, Unit definition of y axis: fig 2A (U/L), fig 2B,C (U/gprot), n=8 per group. The direct difference between SG and WG at the same time is expressed as, *p\u0026lt;0.05, the difference was significant at 0.05 level. **p\u0026lt;0.01, the difference was significant at 0.01 level. Differences at different times, differences in different groups (SG vs. WG, D3 vs. D7) are expressed as: #p\u0026lt;0.05, the difference was significant at 0.05 level. ##p\u0026lt;0.01, the difference was significant at 0.01 level.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-2368056/v1/2d7a861c52738616f98506e5.png"},{"id":30326395,"identity":"b3f5b7f3-8153-4997-a8c2-641757e325e0","added_by":"auto","created_at":"2022-12-14 15:48:34","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":217620,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of weaning on the number of T lymphocyte subsets in the blood，thymus and spleen of piglets. suckling group 3 days (SG3), Weaning group 3 days (WG3), suckling group 7 days (SG7), Weaning group 7 days (WG7), Values are means ± SEM, Unit definition of y axis: fig 3A,B,C (%), n=8 per group. The direct difference between SG and WG at the same time is expressed as, *p\u0026lt;0.05, the difference was significant at 0.05 level. **p\u0026lt;0.01, the difference was significant at 0.01 level. Differences at different times, differences in different groups (SG vs. WG, D3 vs. D7) are expressed as: \u003csup\u003e#\u003c/sup\u003ep\u0026lt;0.05, the difference was significant at 0.05 level. \u003csup\u003e##\u003c/sup\u003ep\u0026lt;0.01, the difference was significant at 0.01 level.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-2368056/v1/734aef38ea3b970cc440b95b.png"},{"id":30326398,"identity":"db74d96d-37e2-44c3-a7dd-1ad82a28ddd4","added_by":"auto","created_at":"2022-12-14 15:48:34","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":627496,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of weaning on serum and intestinal immunoglobulin levels, the content of cytokines in piglets. suckling group 3 days (SG3), Weaning group 3 days (WG3), suckling group 7 days (SG7), Weaning group 7 days (WG7). Values are means±SEM, Unit definition of y axis: fig 4A (mg/ml), fig 4B (mg/gprot), fig 4C (ng/L), fig 4D,E (ng/gprot), n=8 per group. The direct difference between SG and WG at the same time is expressed as, *p\u0026lt;0.05, the difference was significant at 0.05 level. **p\u0026lt;0.01, the difference was significant at 0.01 level. Differences at different times, differences in different groups (SG vs. WG, D3 vs. D7) are expressed as: #p\u0026lt;0.05, the difference was significant at 0.05 level. ##p\u0026lt;0.01, the difference was significant at 0.01 level.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-2368056/v1/404aa63c264a3331dabc6e14.png"},{"id":30326400,"identity":"ce839ca2-6682-4ff2-8785-365523fe42a6","added_by":"auto","created_at":"2022-12-14 15:48:34","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":562242,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of weaning on the gene expression of cytokines in the intestinal of piglets. suckling group 3 days (SG3), Weaning group 3 days (WG3), suckling group 7 days (SG7), Weaning group 7 days (WG7). Values are means±SEM, n=8 per group. The direct difference between SG and WG at the same time is expressed as, *p\u0026lt;0.05, the difference was significant at 0.05 level. **p\u0026lt;0.01, the difference was significant at 0.01 level. Differences at different times, differences in different groups (SG vs. WG, D3 vs. D7) are expressed as: #p\u0026lt;0.05, the difference was significant at 0.05 level. ##p\u0026lt;0.01, the difference was significant at 0.01 level.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-2368056/v1/ed76a4891390d8097728d800.png"},{"id":30326401,"identity":"a9118fe2-cc96-4ac7-b4fa-a1e5e6a09d55","added_by":"auto","created_at":"2022-12-14 15:48:34","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":936876,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of weaning on the gene and protein expression of the Notch2 signaling pathway in the intestinal mucosa of piglets.Jejunum (A), (C), (D), Ileum (B), (E), (F), suckling group 3 days (SG3), Weaning group 3 days (WG3), suckling group 7 days (SG7), Weaning group 7 days (WG7). Values are means±SEM, n=8 per group. The direct difference between SG and WG at the same time is expressed as, *p\u0026lt;0.05, the difference was significant at 0.05 level. **p\u0026lt;0.01, the difference was significant at 0.01 level. Differences at different times, differences in different groups (SG vs. WG, D3 vs. D7) are expressed as: #p\u0026lt;0.05, the difference was significant at 0.05 level. ##p\u0026lt;0.01, the difference was significant at 0.01 level.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-2368056/v1/06bd3f40139753cf3cab41bf.png"},{"id":30502357,"identity":"23a9fc47-5c5a-4b0e-9622-b01335b3e855","added_by":"auto","created_at":"2022-12-19 07:29:39","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2972675,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2368056/v1/05e41a5a-c764-4289-827c-3f8990f991b1.pdf"},{"id":30327436,"identity":"4f075d24-2c92-4281-808a-11eb81798ea0","added_by":"auto","created_at":"2022-12-14 15:56:34","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":17217,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementary.docx","url":"https://assets-eu.researchsquare.com/files/rs-2368056/v1/d3fc36885a3330dbb234cc69.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Weaning caused imbalanced T lymphocytes distribution and impaired intestinal immune barrier function in piglets","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe pressure of weaning is a severe challenge for the growth of piglets. Sudden changes in psychology, the environment, and feeding habits expose piglets to large immunological stress[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Due to this stress, the intestinal immunity of piglets is affected, making them more susceptible to the invasion of pathogenic microorganisms [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. However, the underlying mechanisms of impaired intestinal immunity are not clear at present. We hypothesized that the decreased growth of weaning piglets might be associated with the impaired intestinal immune barrier function mediated by T lymphocytes and Notch2 signaling.\u003c/p\u003e \u003cp\u003eWeaning may adversely affect the intestinal immune system of piglets, thereby leading to intestinal inflammation and damage to the mucosal barrier functions [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. T lymphocytes play a vital role in the regulation of the immune function of piglets. The decreased ratio of CD4\u003csup\u003e+\u003c/sup\u003e/CD8\u003csup\u003e+\u003c/sup\u003e lymphocytes is an important indicator of immune deficiency [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The Notch2 signaling is critical for the control and development of T lymphocytes and blocking the Notch2 signaling pathway decreases T cell proliferation [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. This study was conducted to investigate the effects of weaning on the growth performance, T lymphocyte subpopulations, concentrations of cytokines and immunoglobulins, and the expression of Notch2 signaling in the small intestine of piglets.\u003c/p\u003e \u003cp\u003eJejunum and ileum are the main parts of the small intestine, which play a key role in the digestion and absorption of nutrients [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Weaning causes shorter villi and higher crypt depth in jejunum and ileum thus resulting in impaired digestion and absorption capacity in piglets and may eventually cause diarrhea [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Therefore, special attention should be paid to the jejunum and ileum of weaning piglets, and was, therefore, studied to observe the different effects of weaning.\u003c/p\u003e \u003cp\u003eDifferent weaning times have different effects on the intestinal immunity of piglets. Early weaning during production results in a shorter reproductive cycle and higher annual productivity for sows [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Late weaning can improve the growth performance of piglets and reduce the occurrence of gastrointestinal diseases [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Colostrum contains more immunomodulatory substances than late breast milk, which may have a significant impact on the development of the immune system of piglets. However, breast milk cannot provide enough nutrients to meet the needs of the growing piglets [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The European Union (EU) banned the use of antibiotics as growth promoters in pigs and livestock production from 1 January 2006, which encouraged pig farms to delay weaning and reduce the stress of weaning for better health of piglets [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Weaning at 21 days of age was generally chosen in commercial pig production and in this study too, we have chosen to wean the piglets in the weaning group at 21 days.\u003c/p\u003e \u003cp\u003eMany researchers are also interested in the study of the recovery time of the piglets after weaning. A few studies have suggested that piglets recovered after 9 days, while some others reported that the piglets recovered at 20 days post-weaning [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. However, most of the studies suggested severe immune stress after weaning during the first week. Hence, we observed the changes in the body weight and the intestinal immune barrier function of piglets 3 days and 7 days post-weaning. The results of this study may guide the pig farming industry, especially for the management of piglets shortly after weaning.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe ethics committee of Yangzhou University has approved all animal experimentation procedures (SXXY 2015-0054).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimal and experimental design\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe feeding experiment was carried out at Yangzhou Susheng Ecological Agriculture Development Co., Ltd. in January 2017. A total of 20 pairs of healthy (Duroc\u0026times;(Landrace\u0026times;Yorkshire)) 21-day-old piglets with similar body weight were chosen from 8 sows. These sows were of similar body weight and similar parity (3-4 parities, half male and half female). Two piglets (one pair) from the same mother were divided into the suckling group and weaning group (WG), respectively. The piglets were reared in one confined house with controlled temperature and light. The piglets in the WG were randomly divided into two pens while the suckling piglets still lived with their mothers. The piglets in the WG had free access to feed and water, while the piglets in the SG had free access to water and the breast of their mothers.\u003c/p\u003e\n\u003cp\u003eAll the piglets were vaccinated according to the farm routine before the experiment, and no vaccine was administered during the experiment. The daily management, disinfection, and epidemic prevention measures were performed according to the routine procedures of the pig farm. The feed for the weaning piglets was an in-house prepared meal with no zinc oxide or antimicrobial feed additives that may reduce the weaning stress. The nutrient contents of the diet (Table 1) for the weaning piglets were decided according to NRC (2012) [15]. The formula of the sow diet is given in Supplementary Table S1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSample collection and preparation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEight piglets from each group were randomly selected and sacrificed at 24 and 28 days of age, respectively. Before sacrificing, each piglet was weighed, and the blood was collected from the posterior jugular vein. The blood samples were centrifuged at 3000 g for 10 minutes to extract serum, and the serum samples were aliquoted and kept at -80 \u0026deg;C until further analysis. The piglets were sacrificed and dissected after administering an intramuscular injection of sodium pentobarbital (50 mg/kg body weight) 2 hours after their final feeding. The intestines were separated, washed with PBS, and the intestinal segments were then cut open. After drying the water and other impurities on the surface with an absorbent paper, the intestinal mucosa was scraped with slides and placed in a 2 mL cryostorage tube before storing at -80℃ for\u0026nbsp;further analysis [16] [17].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBody weight and organ indexes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll piglets were weighed at the beginning of experiment and on 3 days and 7 days post weaning (24th day and 28th day). The spleen and thymus of the piglets were separated and weighed. The organ index was determined by using the following formula: organ index = organ weight/body weight (g/kg).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnalysis of the activity of LDH\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSerum samples stored at -80 \u0026deg;C were equilibrated to room temperature and the supernatant was collected after centrifugation at 3000 \u0026times; g for 10 minutes. The mucosa samples from the jejunum and ileum were homogenized in normal saline in an ice-water bath at a 1:9 (w/v) ratio. The homogenate was centrifuged (3000\u0026times; g for 10 minutes), and the supernatant was collected for lactate dehydrogenase (LDH) determination (A020-2, Nanjing Jiancheng Institute of Bioengineering, www.njjcbio.com) using a kit according to the manufacturer\u0026apos;s instructions (Jiancheng Bioengineering Institute of Nanjing, Jiangsu, China).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnalysis of T lumphocyte hy flow cytometry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe porcine peripheral blood lymphocyte separator kit (P8770, Beijing Solebold Technology Co., Ltd, Beijing, China, https://www.solarbio.com/) was used to extract lymphocytes from 2.0 ml of fresh heparin sodium anticoagulant blood. To obtain a cell suspension, the particular operation stages were carried out in accordance with the manufacturer\u0026apos;s instructions. FITC-CD3 (NO 559582), Alexa 647-CD4 (NO 561472) and PE-CD8 (NO 559584) antibodies (3 \u0026mu;l; 0.2 \u0026mu;g/\u0026mu;l) were added (Biosciences Company, USA, https://www.bdbiosciences.com), and the samples were kept at 4 \u0026deg;C in the dark overnight. On the second day, a FACSAria SORP flow cytometer was used to detect the number of T lymphocyte subsets in the blood (Beckman company, USA).\u003c/p\u003e\n\u003cp\u003eThe spleen and thymus tissues were chopped into small pieces and put on a 300-mesh nylon net before being mashed with the core of a disposable syringe and 2-3 mL of saline added. The liquid under the net was collected in a sterilized dish, and the porcine Tissue Lymph Cell Separation Solution Kit (P6020, Beijing Soleibao Technology Co., Ltd., Beijing, China) was then used to extract the lymphocyte suspension. Next, FITC-conjugated anti-CD3, Alexa 647-conjugated anti-CD4 and PE-conjugated anti-CD8 antibodies (3 \u0026mu;l; 0.2 \u0026mu;g/\u0026mu;l) were added to the lymphocyte suspension and incubated overnight in the dark at 4 \u0026deg;C. On the second day, the numbers of T lymphocyte subsets in the spleen and thymus were evaluated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnalysis of the content of cytokines and immunoglobulins by ELISA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAn ELISA (Enzyme Linked Immunesorbent Assay) kit was used to measure the concentrations\u0026nbsp;of immunoglobulin A (IgA, NO H108), immunoglobulin G (IgG, NO H106), interleukin-1 beta (IL-1\u0026beta;, NO H002), interleukin-2 (IL-2, NO H003), interleukin10 (IL-10, NO H009), interleukin-12 (IL-12, NO H010), Interferon-\u0026gamma;\u0026nbsp;(IFN-\u0026gamma;, NO H025), tumour necrosis factor-alpha (TNF-\u0026alpha;, NO H05 (Nanjing JianCheng Bioengineering Institute, Jiangsu, China) in the serum, jejunum and ileum according to the manufacturer\u0026apos;s instructions (Nanjing JianCheng Bioengineering Institute, Jiangsu, China).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative real-time PCR analysis of relative mRNA expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTRIzol was used to extract total RNA from mucosa of jejunum and ileum (Invitrogen, Shanghai, China). Following the manufacturer\u0026apos;s instructions, RNA was utilized to generate complementary DNA (cDNA) using PrimeScript\u003csup\u003eTM\u003c/sup\u003eRT reagent Kit with gDNA Eraser (TaKaRa Biotechnology Co. Ltd., Dalian, China). qRT-PCR was performed on cDNA using an Applied Biosystems 7500 Real-Time PCR System (Life Technologies, USA). To quantitatively analyze the target gene, the primers were diluted to 10 \u0026mu;M and \u0026beta;-actin was utilized as an internal reference. Primer-BLAST (http://www.ncbi.nlm.nih.gov) was used to create gene-specific primers. Suzhou Jinweizhi Biotechnology Co., Ltd. produced the primer sequences, which are presented in Table 2. (Jiangsu, China). The relative expression of the target gene was calculated using the comparative 2\u003csup\u003e-\u0026Delta;\u0026Delta;CT\u003c/sup\u003e approach [18].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot analysis of relative protein expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eProtein was extracted from intestinal mucosal tissue using a total protein extraction kit (SunShinebio, Nanjing, China) as directed by the manufacturer. Protein concentrations were determined using the BCA technique (Thermo Scientific, Shanghai, China). Using % SDS\u0026ndash;PAGE (SDS\u0026ndash;polyacrylamide gel electrophoresis), equal quantities of protein were separated and transferred to polyvinylidene fluoride (PVDF) membranes. After blocking for 1 h at room temperature [19], the membranes were incubated overnight with the following primary antibodies: anti-NOTCH2 (1:500, BioByt, Cambridge, UK), anti-DLL1 (1:500, BioByt, Cambridge, UK), anti-Jagged1 (1:800, Abcam, Cambridge, UK), anti-HES1 (1:500, LSBio, WA, USA), and anti-GAPDH (1:500, LSBio, WA, USA) (1:2000, Cell Signalling, MA, USA). After being thoroughly washed to remove nonspecific binding, the membranes were incubated for 1 hour at room temperature with a horseradish peroxidase-conjugated secondary antibody (goat anti-rabbit IgG) (Boster Biological Technology Co., Ltd., USA). The immunoreactive bands were washed before being detected using an ECL western blotting detection method. For densitometric detection of band intensity, ImageJ software (Wayne Rasband, MD, USA) was utilized. The band density of each blot was standardized using the density of a reference sample and the GAPDH content.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExperimental data were analyzed by SPSS 23.0. Growth performance and organ weight data were analyzed by an independent \u003cem\u003et\u003c/em\u003e test. Other data were analyzed by two-factors analysis of variance with two fixed factors of time (T) and group (G). Independent\u003cem\u003e\u0026nbsp;t\u003c/em\u003e test was further conducted to investigated the difference between the SG and the WG on different time point post weaning.\u003cem\u003e\u0026nbsp;P\u003c/em\u003e values between 0.05 and 0.10 were identified as with a trend, and differences were identified as significant when \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05. All data are shown as the mean \u0026plusmn; standard error.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eGrowth performance and immune organ index\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results indicated that the body weight of piglets in the WG was lower than that in the SG at 3 days post-weaning and 7 days post-weaning (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01) (Figure 1A). There was no significant difference in the organ index of the spleen and thymus obtained from WG and SG (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026gt; 0.05) (Figure 1B).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLactate dehydrogenase\u0026nbsp;(LDH) in the serum and small intestine\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe concentration of LDH in the serum from the WG was increased as compared to SG, especially 3 days after weaning (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05) (Figure 2A). The levels of LDH in the jejunum and ileum were further upregulated at 7 days post-weaning (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05) (Figures 2B and 2C).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNumber of T lymphocytes in the blood, thymus, and spleen\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe number of CD3\u003csup\u003e+\u003c/sup\u003e T cells in the blood was lower in the WG (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05) as compared to the SG, whereas those in the thymus and spleen were higher in the WG (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05). Furthermore, the number of CD3\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003e T cells in the thymus and the ratio of CD3\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003e/CD3\u003csup\u003e+\u003c/sup\u003eCD8\u003csup\u003e+\u003c/sup\u003eT cells in the thymus and spleen of WG were lower than that in the SG (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05), especially 3 days post-weaning (Figures 3A-D).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLevel of immunoglobulins and cytokines in the serum and intestine\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere was no significant difference in the IgA and IgG concentrations in the serum between the SG and WG (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026gt; 0.05) (Figure 4A). The sIgA concentration in the jejunum of WG3 was lower than that in the SG3 (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05) (Figure 4B). The concentrations of interleukin 2 (IL-2) in the serum and ileum, and that of IL-1\u0026beta; and IL-2 in the jejunum of WG3 were higher than that in SG3 (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01). Further, the concentration of IL-2 in the jejunum of WG7 was higher than that in SG7 (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01). In addition, the IL-10 concentrations in the small intestine of WG3 and jejunum of WG7 were lower than that in SG3 and SG7, respectively (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05) (Figures 4C-E).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGene expression of cytokines in the small intestine\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe gene expression of IL4 was downregulated in the jejunum, while that of IL-12 (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05) and interferon \u0026gamma; (IFN-\u0026gamma;) (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01) in the jejunum, and IL-1\u0026beta; in the ileum were upregulated in the WG in comparison with SG (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05). Further, the gene expression of IL-2 and IL-4 in the ileum of WG3 was higher than that in SG3 (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05). Considering the WG7 group, the gene expression of IL-4 was decreased, while that of IL-12 and IFN-\u0026gamma; in the jejunum and IL-1\u0026beta;, IL-2, and IFN-\u0026gamma; in the ileum were upregulated as compared to SG7 (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05) (Figures 5A and 5B).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGene and protein expression of Notch2 signaling in the small intestine\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe gene expression of Jagged1 in the ileum of WG3 was lower than that in SG3 (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01). Similarly, the gene expression of Notch2 and Jagged1 in the jejunum and Delta-like 1 (DLL1) in the ileum were downregulated (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05) (Figures 6A and 6B). Further, the protein expression of Hes1 and Notch2 in the jejunum was downregulated, while Jagged1 in the ileum was upregulated in WG when compared with SG (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05) (Figures 6C-F).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe immune system of piglets is not fully developed at weaning time. The immature adaptive immune system along with the change in the feed types and the living conditions make the piglets susceptible to the\u0026nbsp;invasion of pathogenic microorganisms, and result in diarrhea and decreased growth [20]. However, the underlying mechanisms of these observations were not elucidated yet. We hypothesized that the diarrhea and decreased growth of weaning piglets might be associated with the T lymphocytes and Notch2 signaling caused impaired intestinal immune function. This study was conducted to investigate the effects of weaning on the growth performance and intestinal immune function of piglets. The results of this study may guide the pig raising industry, especially for the management of piglets shortly after weaning.\u003c/p\u003e\n\u003cp\u003eIn this study, weaning caused a decrease in the body weight of piglets 3 days and 7 days post-weaning, which might be associated with the transition from breast milk to a solid diet and weaning stress. Previous studies\u0026nbsp;also suggested that the piglets had a significant weight loss after weaning [6] [21] [22]. In addition, the body weight of the piglets was severely affected 3 days post-weaning, while it was better 7 days post-weaning. The piglets gradually adapted to the changes in the environment and diet 7 days after weaning, and the gastrointestinal digestive function gradually became matured driven by the adaptive immune system.\u0026nbsp;A previous study had reported a similar trend wherein severe body weight loss was observed on day 3 after weaning and the piglets gradually regained weight 9 days after weaning [23]. Thus,\u0026nbsp;these results indicated that the piglets experienced severe stress 3 days post-weaning, but the stress response was relieved 7 days post-weaning.\u003c/p\u003e\n\u003cp\u003eLDH catalyzes the mutual conversion of pyruvate and lactic acid and participates in the catabolism and anabolism of carbohydrates. During anaerobic glycolysis, ATP is produced when pyruvate is converted to lactic acid by LDH [24]. LDH is present in various tissues of animals and is an important indicator of the stress state [25]. Weaning causes stress reactions in piglets, including diarrhea, decreased feed intake, and increased LDH activity [6] [25]. The reduced feed intake of weaned pigs causes an increased LDH concentration in the serum [26]. In this study, weaning caused an increased content of LDH in the serum, especially 3 days after weaning. The stress state was severe up to 3 days of weaning while the level of LDH at 7 days post-weaning was alleviated, thereby confirming that the weaning stress may have a greater impact on young piglets on the first few days after weaning.\u003c/p\u003e\n\u003cp\u003eT lymphocytes play a vital role in the regulation of the immune function of piglets. Herein, we focused on the number of CD3\u003csup\u003e+\u003c/sup\u003e T lymphocytes and its two major subsets, CD3\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003e and CD3\u003csup\u003e+\u003c/sup\u003eCD8\u003csup\u003e+\u003c/sup\u003e T lymphocytes. CD3\u003csup\u003e+\u003c/sup\u003e T lymphocytes accounted for 30% ~ 70% of T lymphocytes. The other T lymphocytes, including CD4\u003csup\u003e+\u003c/sup\u003eCD45RA\u003csup\u003e+\u003c/sup\u003e, CD28\u003csup\u003e+\u003c/sup\u003e, CD38\u003csup\u003e+\u003c/sup\u003e,\u0026nbsp;and\u0026nbsp;CD95\u003csup\u003e+\u003c/sup\u003e T lymphocytes, were not detected in the study [27]. The CD2\u003csup\u003e+\u003c/sup\u003e, CD3\u003csup\u003e+\u003c/sup\u003e, CD4\u003csup\u003e+\u003c/sup\u003e, CD8\u003csup\u003e+\u003c/sup\u003e, and other molecules on the surface of T lymphocytes are closely related to T lymphocyte recognition, antigen presentation, and immune function [28]. CD3\u003csup\u003e+\u003c/sup\u003e T cells represent mature T lymphocytes and are associated with T cell receptor expression and signaling [29]. CD4\u003csup\u003e+\u003c/sup\u003e T cells assist B cells to secrete antibodies and their activation can enhance the binding of TCR-CD3 complexes to MHC class II antigens and induce macrophages to produce a strong bactericidal effect [30]. CD8\u003csup\u003e+\u003c/sup\u003e is the receptor of MHC class I molecules and an important marker of cytotoxic T cells. Its activation helps the cytotoxic T cells mediate the damage of target antigens by releasing perforin and granulation enzymes [31]. The major cause of illness in pigs is a decline in the number and function of CD4\u003csup\u003e+\u003c/sup\u003e T cells among the T cell subsets [32]. In this study, weaning caused a reduction in CD3\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003e T cells in the thymus of piglets, especially 3 days post-weaning, which might explain the decreased ratio of CD4\u003csup\u003e+\u003c/sup\u003e/CD8\u003csup\u003e+\u003c/sup\u003e lymphocytes to some extent. The decreased ratio of CD4\u003csup\u003e+\u003c/sup\u003e/CD8\u003csup\u003e+\u003c/sup\u003e lymphocytes is an important indicator of immune deficiency and suggests that the piglets may be infected by pathogens [4]. The ratio of CD3\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003e/CD3\u003csup\u003e+\u003c/sup\u003eCD8\u003csup\u003e+\u003c/sup\u003e T cells in the thymus and spleen of WG3 was lower than that in the SG3, which suggested an immune deficiency in weaning piglets 3 days post-weaning, thereby emphasizing a need for strengthening the daily management during this period.\u003c/p\u003e\n\u003cp\u003eThe intestine is the main point for the entry of pathogens. sIgA is the most abundant antibody in the intestine that defends the intestinal epithelium against harmful bacteria, modulates antigen capture, and aids in the immunological protection of the intestinal mucosa [33] [34] [35]. Breastfeeding has a long-term impact on future health and is an important physiological factor that affects the development of intestinal function and the immune system [36]. Many studies have shown that colostrum and breast milk contain high concentrations of sIgA, and its synthesis in animals after weaning mainly depends on their adaptive immune system [37]. The adaptive immune system of piglets is not fully developed at weaning time, and the level of sIgA in the small intestine decreases after weaning. The results of our study were in accordance with the previous studies [12] [13], where weaning caused a decreased concentration of sIgA in the small intestine 3 days post-weaning. The reason for the decreased IgA concentration in the intestine after weaning could be attributed to the reduced availability of the resources of IgA, colostrum and breast milk after weaning when the synthesis of sIgA mainly depends on the still weak adaptive immune system of animals. In addition, our study also showed that the concentration of sIgA in WG returned to the level of lactation 7 days after weaning, which may be due to the maturation of the immune system of piglets stimulated by weaning stress, which can promote the synthesis of intestinal sIgA in piglets. However, a previous study suggested that the concentration of IgA increased in the intestine 20 days after weaning [2]. The different results between the two studies may be due to the choice of different time points. The time points chosen in the earlier study were 4-, 20- and 40-days post-weaning and the IgA levels were not tested between 4 and 20 days post-weaning [2]. Thus, our results suggested that the intestinal immune barrier function of piglets was impaired after weaning, but after a period of adaptation, the synthesis of sIgA in the intestinal mucosa increased to a level like that of suckling piglets, which indicated that the immune barrier function of the intestine was recovered.\u003c/p\u003e\n\u003cp\u003eCytokines play a key role in the regulation of intestinal immune function [34] [35]. Tumor necrosis factor alpha (TNF-\u0026alpha;), IL-1\u0026beta;, and IFN-\u0026gamma; are proinflammatory cytokines that may impair intestinal epithelial barrier function and tight junction formation [38] [39]. However, some anti-inflammatory cytokines, such as IL-10, may downregulate the expression of pro-inflammatory cytokines (such as IL-6, TNF-\u0026alpha;, and IL-1\u0026beta;), thus maintaining intestinal immune homeostasis [40] [41] [42]. IL-4 is a key regulator of the antibody-mediated immune response, influencing B cell proliferation, T cell growth and function, and immunoglobulin conversion [43]. Some studies have shown that weaning increases pro-inflammatory cytokines in the intestines of piglets, and the mRNA expression of IL-1\u0026beta;, IL-6, and TNF-\u0026alpha; rises dramatically, which is connected to early inflammation and various intestinal disorders in piglets [44]. Furthermore, there are earlier reports demonstrating that the gene expression of TNF-\u0026alpha; and IL-6 rises at 3 and 7 days after weaning and recovers to pre-weaning levels after 14 days. However, within 2 weeks after weaning at 21 days of age, no significant changes in the mRNA expression of inflammatory cytokines (TGF-\u0026beta; and IL-10) are observed in piglets [45]. In our study, weaning caused an increase in the level of IL-1\u0026beta; in the jejunum while decreasing the concentration of IL-10 in the jejunum and ileum. The increased concentration of pro-inflammatory cytokines and decreased concentration of anti-inflammatory cytokines suggested an impaired intestinal barrier function. In addition, 7 days after weaning, the gene expression of IL-4 in the jejunum was decreased.\u0026nbsp;Our results were in accordance with a previous study, which also demonstrated a marked decrease in levels of IL-4 in mice lacking enteral feeding [46]. Further, the gene expression of IL-4 in the ileum was also upregulated, especially 3 days after weaning. In addition, the gene expression of IFN-\u0026gamma; in jejunum and IL-1\u0026beta; and IFN-\u0026gamma; in ileum were also upregulated at 7 days after weaning. Our results are consistent with a previous study, which demonstrated that the gene expression of cytokine increases sharply in the early acute weaning stage and the inflammatory response is obvious, while in the adaptation stage of weaning defense, the intestinal mucosal immune function recovers, and the gene expression of cytokines returns to the pre-weaning level [13]. IL-2 can induce T lymphocyte proliferation and differentiation, and its concentration directly reflects immune function [47]. Studies have shown that IL-2 can induce the pathologic opening of the intestinal tight junction barrier and increase intestinal epithelial permeability [48] [49]. In this study, the concentrations of IL-2 were upregulated in the serum and small intestine and the gene expression of IL-2 was also significantly increased in the ileum of weaned piglets, indicating a weaker intestinal barrier function in weaning piglets. In addition, both the anti-inflammatory and pro-inflammatory cytokines are secreted by Th1 cells and Th2 cells [50]. In the immune response system, the Th1/Th2 dynamic balance is an important factor in maintaining immune stability [51]. Once the balance is disturbed, changes in Th1 or Th2 cells can cause diseases. Hence, weaning causes an imbalance between anti-inflammatory and pro-inflammatory cytokines that may lead to impaired immune barrier function and destruction of the immune response dominated by the Th1/Th2 balance. However, in this study, the concentration of some cytokines in the intestine was not completely consistent with the gene expression of these cytokines. The reasons might be that the mRNA expression could not accurately reflect the quality and quantity of protein expression due to several processes involved before the mRNA is translated to the protein, including storage, transport, degradation, translation regulation, and post-translational processing [52].\u003c/p\u003e\n\u003cp\u003eThe Notch2 signaling pathway affects the function of the intestinal immune system and plays a key role in the maintenance of intestinal immunological homeostasis [18]. The Notch2 signaling is critical for the control and development of T lymphocytes and blocking the Notch2 signaling pathway decreases T cell proliferation [5]. DLL1 mainly induces hematopoietic stem cells and thymic lymphocytes to differentiate into T cells and promotes the development of precursor T cells [53]. Jagged1 also promotes T cell development and activates the T cell response [54]. In this study, weaning caused the inhibition of the gene expression of Notch2, Jagged1, and DLL1 and the downregulation of the protein expression of Notch2 and Hes1 in the small intestine of piglets, which might explain the imbalanced T lymphocytes distribution and the variations in the concentration of cytokines in our previous results. However, the protein expression of Jagged1 in the ileum of weaning piglets was upregulated in this study, which is in line with the observation in a previous study where Jagged1 expression was upregulated in the intestine of mice with intestinal inflammatory injury [55]. The reason for the upregulated protein expression of Jagged1 in weaning piglets is not understood yet and needs further research. Nevertheless, our results suggest that the impaired immune barrier function in the intestine of weaning piglets might be associated with Notch2 signaling.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, weaning caused decreased body weight, imbalanced T lymphocytes distribution, lowered concentration of sIgA and anti-inflammatory cytokines, and increased concentration of pro-inflammatory cytokines in piglets. The impairment of intestinal immune barrier function, which might be associated with the Notch2 signaling was more severe 3 days post-weaning than that at 7 days post-weaning in piglets. \u003c/p\u003e\n"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eL.D., L.H.Y, and H. R. W. designed the research; L.D., L.H.Y, M.X.W., H.M.L., .Z.P., T.Q., Y.Y.Y., and H.R.W.. made the investigation; L.D., and M.X.W., made formal analysis and data curation; L.D., and M.X.W. wrote the original draft and had the funding acquisition; L.D., L.H.Y, and H. R.W., reviewed and edited the paper, and L.H.Y, had primary responsibility for the final manuscript. All authors read and approved the final manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere are no conflicts of interest to declare.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants from the Special project of Science and Technology of North Jiangsu Province (grant numbers SZ-YC202101) and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets analyzed in the present study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003ePluske JR, Turpin DL, Kim J-C: \u003cstrong\u003eGastrointestinal tract (gut) health in the young pig\u003c/strong\u003e. \u003cem\u003eAnimal Nutrition \u003c/em\u003e2018, \u003cstrong\u003e4\u003c/strong\u003e(2):187-196.\u003c/li\u003e\n\u003cli\u003eGarc\u0026iacute;a GR, Dogi CA, Ashworth GE, Berardo D, Godoy G, Cavaglieri LR, de Moreno de LeBlanc A, Greco CR: \u003cstrong\u003eEffect of breast feeding time on physiological, immunological and microbial parameters of weaned piglets in an intensive breeding farm\u003c/strong\u003e. \u003cem\u003eVeterinary Immunology and Immunopathology \u003c/em\u003e2016, \u003cstrong\u003e176\u003c/strong\u003e:44-49.\u003c/li\u003e\n\u003cli\u003e!!! INVALID CITATION !!! (Spreeuwenberg, Verdonk et al. 2001, Brown, Maxwell et al. 2006).\u003c/li\u003e\n\u003cli\u003eHussain T, Kulshreshtha KK, Yadav VS, Katoch K: \u003cstrong\u003eCD4+, CD8+, CD3+ cell counts and CD4+/CD8+ ratio among patients with mycobacterial diseases (leprosy, tuberculosis), HIV infections, and normal healthy adults: a comparative analysis of studies in different regions of India\u003c/strong\u003e. \u003cem\u003eJ Immunoassay Immunochem \u003c/em\u003e2015, \u003cstrong\u003e36\u003c/strong\u003e(4):420-443.\u003c/li\u003e\n\u003cli\u003eYang L, Zhao K-L, Qin L, Ji D-X, Zhang B, Zheng P-F, Qin Y-M: \u003cstrong\u003eNotch signaling pathway regulates CD4+ CD25+ CD127dim/\u0026minus; regulatory T cells and T helper 17 cells function in gastric cancer patients\u003c/strong\u003e. \u003cem\u003eBioscience Reports \u003c/em\u003e2019, \u003cstrong\u003e39\u003c/strong\u003e(5).\u003c/li\u003e\n\u003cli\u003eTang M, Laarveld B, Van Kessel A, Hamilton D, Estrada A, Patience J: \u003cstrong\u003eEffect of segregated early weaning on postweaning small intestinal development in pigs\u003c/strong\u003e. \u003cem\u003eJournal of animal science \u003c/em\u003e1999, \u003cstrong\u003e77\u003c/strong\u003e(12):3191-3200.\u003c/li\u003e\n\u003cli\u003eMosenthin R: \u003cstrong\u003ePhysiology of small and large intestine of swine-Review\u003c/strong\u003e. \u003cem\u003eAsian-Australasian Journal of Animal Sciences \u003c/em\u003e1998, \u003cstrong\u003e11\u003c/strong\u003e(5):608-619.\u003c/li\u003e\n\u003cli\u003eCampbell JM, Crenshaw JD, Polo J: \u003cstrong\u003eThe biological stress of early weaned piglets\u003c/strong\u003e. \u003cem\u003eJournal of animal science and biotechnology \u003c/em\u003e2013, \u003cstrong\u003e4\u003c/strong\u003e(1):1-4.\u003c/li\u003e\n\u003cli\u003eKoketsu Y, Tani S, Iida R: \u003cstrong\u003eFactors for improving reproductive performance of sows and herd productivity in commercial breeding herds\u003c/strong\u003e. \u003cem\u003ePorcine health management \u003c/em\u003e2017, \u003cstrong\u003e3\u003c/strong\u003e(1):1-10.\u003c/li\u003e\n\u003cli\u003eBlecha F, Pollman D, Nichols D: \u003cstrong\u003eWeaning pigs at an early age decreases cellular immunity\u003c/strong\u003e. \u003cem\u003eJournal of Animal Science \u003c/em\u003e1983, \u003cstrong\u003e56\u003c/strong\u003e(2):396-400.\u003c/li\u003e\n\u003cli\u003eGu Y, Li M, Wang T, Liang Y, Zhong Z, Wang X, Zhou Q, Chen L, Lang Q, He Z: \u003cstrong\u003eLactation-related microRNA expression profiles of porcine breast milk exosomes\u003c/strong\u003e. 2012.\u003c/li\u003e\n\u003cli\u003eHeo JM, Opapeju F, Pluske J, Kim J, Hampson D, Nyachoti CM: \u003cstrong\u003eGastrointestinal health and function in weaned pigs: a review of feeding strategies to control post\u003c/strong\u003e\u003cstrong\u003e‐weaning diarrhoea without using in\u003c/strong\u003e\u003cstrong\u003e‐feed antimicrobial compounds\u003c/strong\u003e. \u003cem\u003eJournal of animal physiology and animal nutrition \u003c/em\u003e2013, \u003cstrong\u003e97\u003c/strong\u003e(2):207-237.\u003c/li\u003e\n\u003cli\u003ede Groot N, Fari\u0026ntilde;as F, Cabrera-G\u0026oacute;mez CG, Pallares FJ, Ramis G: \u003cstrong\u003eWeaning causes a prolonged but transient change in immune gene expression in the intestine of piglets\u003c/strong\u003e. \u003cem\u003eJournal of Animal Science \u003c/em\u003e2021, \u003cstrong\u003e99\u003c/strong\u003e(4):skab065.\u003c/li\u003e\n\u003cli\u003eColson V, Orgeur P, Foury A, Morm\u0026egrave;de P: \u003cstrong\u003eConsequences of weaning piglets at 21 and 28 days on growth, behaviour and hormonal responses\u003c/strong\u003e. \u003cem\u003eApplied Animal Behaviour Science \u003c/em\u003e2006, \u003cstrong\u003e98\u003c/strong\u003e(1-2):70-88.\u003c/li\u003e\n\u003cli\u003eCouncil NR: \u003cstrong\u003eNutrient requirements of swine\u003c/strong\u003e. \u003cem\u003eNatl Acad Press, Washington, DC \u003c/em\u003e2012.\u003c/li\u003e\n\u003cli\u003eZmudzki J, Osek J, Stankevicius A, Pejsak Z: \u003cstrong\u003eRapid detection of Brachyspira hyodysenteriae and Lawsonia intracellularis in swine faecal and mucosal specimens by multiplex PCR\u003c/strong\u003e. \u003cem\u003eBulletin of the Veterinary Institute in Puławy \u003c/em\u003e2004, \u003cstrong\u003e48\u003c/strong\u003e(3).\u003c/li\u003e\n\u003cli\u003eDonowitz M, Wicks J, Battisti L, Pike G, DeLellis R: \u003cstrong\u003eEffect of Senokot on rat intestinal electrolyte transport: evidence of Ca++ dependence\u003c/strong\u003e. \u003cem\u003eGastroenterology \u003c/em\u003e1984, \u003cstrong\u003e87\u003c/strong\u003e(3):503-512.\u003c/li\u003e\n\u003cli\u003eLivak KJ, Schmittgen TD: \u003cstrong\u003eAnalysis of relative gene expression data using real-time quantitative PCR and the 2\u0026minus; \u0026Delta;\u0026Delta;CT method\u003c/strong\u003e. \u003cem\u003emethods \u003c/em\u003e2001, \u003cstrong\u003e25\u003c/strong\u003e(4):402-408.\u003c/li\u003e\n\u003cli\u003eAbbasalipourkabir R, Moradi H, Zarei S, Asadi S, Salehzadeh A, Ghafourikhosroshahi A, Mortazavi M, Ziamajidi N: \u003cstrong\u003eToxicity of zinc oxide nanoparticles on adult male Wistar rats\u003c/strong\u003e. \u003cem\u003eFood and chemical toxicology \u003c/em\u003e2015, \u003cstrong\u003e84\u003c/strong\u003e:154-160.\u003c/li\u003e\n\u003cli\u003eMathern D, Laitman L, Hovhannisyan Z, Dunkin D, Farsio S, Malik T, Roda G, Chitre A, Iuga A, Yeretssian G: \u003cstrong\u003eMouse and human Notch-1 regulate mucosal immune responses\u003c/strong\u003e. \u003cem\u003eMucosal immunology \u003c/em\u003e2014, \u003cstrong\u003e7\u003c/strong\u003e(4):995-1005.\u003c/li\u003e\n\u003cli\u003eCallesen J, Halas D, Thorup F, Knudsen KB, Kim J, Mullan B, Hampson D, Wilson R, Pluske J: \u003cstrong\u003eThe effects of weaning age, diet composition, and categorisation of creep feed intake by piglets on diarrhoea and performance after weaning\u003c/strong\u003e. \u003cem\u003eLivestock Science \u003c/em\u003e2007, \u003cstrong\u003e108\u003c/strong\u003e(1-3):120-123.\u003c/li\u003e\n\u003cli\u003eLandrain B, Hemard M, Caugant A, Desprez F: \u003cstrong\u003eEtude des consequences sur les performances de croissance et d\u0026apos;abattage d\u0026apos;un sevrage a 21 jours comparativement a un sevrage a 28 jours\u003c/strong\u003e. \u003cem\u003eJourn\u0026eacute;es de la Recherche Porcine en France \u003c/em\u003e1997, \u003cstrong\u003e29\u003c/strong\u003e:129-134.\u003c/li\u003e\n\u003cli\u003eHedemann MS, H\u0026oslash;jsgaard S, Jensen BB: \u003cstrong\u003eSmall intestinal morphology and activity of intestinal peptidases in piglets around weaning\u003c/strong\u003e. \u003cem\u003eJournal of Animal Physiology and Animal Nutrition \u003c/em\u003e2003, \u003cstrong\u003e87\u003c/strong\u003e(1‐2):32-41.\u003c/li\u003e\n\u003cli\u003ePowers DA, Lauerman T, Crawford D, Dimichele L: \u003cstrong\u003eGenetic Mechanisms for Adapting to a Changing Environment\u003c/strong\u003e. \u003cem\u003eAnnual Review of Genetics \u003c/em\u003e1991, \u003cstrong\u003e25\u003c/strong\u003e(1):629-659.\u003c/li\u003e\n\u003cli\u003eMalyar RM, Li H, Liu D, Abdulrahim Y, Farid RA, Gan F, Ali W, Enayatullah H, Banuree SAH, Huang K: \u003cstrong\u003eSelenium/Zinc-Enriched probiotics improve serum enzyme activity, antioxidant ability, inflammatory factors and related gene expression of Wistar rats inflated under heat stress\u003c/strong\u003e. \u003cem\u003eLife sciences \u003c/em\u003e2020, \u003cstrong\u003e248\u003c/strong\u003e:117464.\u003c/li\u003e\n\u003cli\u003eFunderburke DW, Seerley RW: \u003cstrong\u003eThe effects of postweaning stressors on pig weight change, blood, liver and digestive tract characteristics\u003c/strong\u003e. \u003cem\u003eJ Anim Sci \u003c/em\u003e1990, \u003cstrong\u003e68\u003c/strong\u003e(1):155-162.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eMechanisms Involved in the Low-Level Regeneration of CD4+ Cells in HIV-1--Infected Patients Receiving Highly Active Antiretroviral Therapy Who Have Prolonged Undetectable Plasma Viral Loads\u003c/strong\u003e. \u003cem\u003eJournal of Infectious Diseases \u003c/em\u003e2005, \u003cstrong\u003e191\u003c/strong\u003e(10):1670-1679.\u003c/li\u003e\n\u003cli\u003eFabbri M, Smart C, Pardi R: \u003cstrong\u003eT lymphocytes\u003c/strong\u003e. \u003cem\u003eThe international journal of biochemistry \u0026amp; cell biology \u003c/em\u003e2003, \u003cstrong\u003e35\u003c/strong\u003e(7):1004-1008.\u003c/li\u003e\n\u003cli\u003eShiheido H, Chen C, Hikida M, Watanabe T, Shimizu J: \u003cstrong\u003eModulation of the human T cell response by a novel non-mitogenic anti-CD3 antibody\u003c/strong\u003e. \u003cem\u003ePloS one \u003c/em\u003e2014, \u003cstrong\u003e9\u003c/strong\u003e(4):e94324.\u003c/li\u003e\n\u003cli\u003eZhu J, Paul WE: \u003cstrong\u003eCD4 T cells: fates, functions, and faults\u003c/strong\u003e. \u003cem\u003eBlood, The Journal of the American Society of Hematology \u003c/em\u003e2008, \u003cstrong\u003e112\u003c/strong\u003e(5):1557-1569.\u003c/li\u003e\n\u003cli\u003eArlehamn CSL, Lewinsohn D, Sette A, Lewinsohn D: \u003cstrong\u003eAntigens for CD4 and CD8 T cells in tuberculosis\u003c/strong\u003e. \u003cem\u003eCold Spring Harbor perspectives in medicine \u003c/em\u003e2014, \u003cstrong\u003e4\u003c/strong\u003e(7):a018465.\u003c/li\u003e\n\u003cli\u003eTian ZL-hGY, Feng-zheng X-sZ: \u003cstrong\u003eEffect of CpG DNA on CD4~+ and CD8~+ T Lymphocyte Subpopulations in Blood of Newborn Piglets [J]\u003c/strong\u003e. \u003cem\u003eJournal of South China University of Technology (Natural Science Edition) \u003c/em\u003e2006, \u003cstrong\u003e5\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eCerutti A, Chen K, Chorny A: \u003cstrong\u003eImmunoglobulin Responses at the Mucosal Interface\u003c/strong\u003e. \u003cem\u003eAnnual Review of Immunology \u003c/em\u003e2011, \u003cstrong\u003e29\u003c/strong\u003e(1):273-293.\u003c/li\u003e\n\u003cli\u003eGommerman JL, Rojas OL, Fritz JH: \u003cstrong\u003eRe-thinking the functions of IgA+ plasma cells\u003c/strong\u003e. \u003cem\u003eGut microbes \u003c/em\u003e2014, \u003cstrong\u003e5\u003c/strong\u003e(5):652-662.\u003c/li\u003e\n\u003cli\u003eCorth\u0026eacute;sy B: \u003cstrong\u003eRoundtrip ticket for secretory IgA: role in mucosal homeostasis?\u003c/strong\u003e \u003cem\u003eThe Journal of Immunology \u003c/em\u003e2007, \u003cstrong\u003e178\u003c/strong\u003e(1):27-32.\u003c/li\u003e\n\u003cli\u003eCabrera RA, Boyd RD, Jungst SB, Wilson ER, Johnston ME, Vignes JL, Odle J: \u003cstrong\u003eImpact of lactation length and piglet weaning weight on long-term growth and viability of progeny\u003c/strong\u003e. \u003cem\u003eJournal of Animal Science \u003c/em\u003e2010, \u003cstrong\u003e88\u003c/strong\u003e(7):2265.\u003c/li\u003e\n\u003cli\u003eWagstrom EA, Yoon KJ, Zimmerman JJ: \u003cstrong\u003eImmune components in porcine mammary secretions\u003c/strong\u003e. \u003cem\u003eViral Immunol \u003c/em\u003e2000, \u003cstrong\u003e13\u003c/strong\u003e(3):383-397.\u003c/li\u003e\n\u003cli\u003eYe D, Ma I, Ma TY: \u003cstrong\u003eMolecular mechanism of tumor necrosis factor-\u0026alpha; modulation of intestinal epithelial tight junction barrier\u003c/strong\u003e. \u003cem\u003eAmerican Journal of Physiology-Gastrointestinal and Liver Physiology \u003c/em\u003e2006, \u003cstrong\u003e290\u003c/strong\u003e(3):G496-G504.\u003c/li\u003e\n\u003cli\u003eAl-Sadi RM, Ma TY: \u003cstrong\u003eIL-1\u0026beta; Causes an Increase in Intestinal Epithelial Tight Junction Permeability\u003c/strong\u003e. \u003cem\u003eThe Journal of Immunology \u003c/em\u003e2007, \u003cstrong\u003e178\u003c/strong\u003e(7):4641-4649.\u003c/li\u003e\n\u003cli\u003eMoore KW, O\u0026apos;garra A, de Waal Malefyt R, Vieira P, Mosmann TR: \u003cstrong\u003eInterleukin-10\u003c/strong\u003e. \u003cem\u003eAnnual review of immunology \u003c/em\u003e1993, \u003cstrong\u003e11\u003c/strong\u003e:165-190.\u003c/li\u003e\n\u003cli\u003eMadsen KL, Lewis SA, Tavernini MM, Hibbard J, Fedorak RN: \u003cstrong\u003eInterleukin 10 prevents cytokine-induced disruption of T84 monolayer barrier integrity and limits chloride secretion\u003c/strong\u003e. \u003cem\u003eGastroenterology \u003c/em\u003e1997, \u003cstrong\u003e113\u003c/strong\u003e(1):151-159.\u003c/li\u003e\n\u003cli\u003eBarada KA, Mourad FH, Sawah SI, Khoury C, Safieh-Garabedian B, Nassar CF, Tawil A, Jurjus A, Saad\u0026eacute; NE: \u003cstrong\u003eUp-regulation of nerve growth factor and interleukin-10 in inflamed and non-inflamed intestinal segments in rats with experimental colitis\u003c/strong\u003e. \u003cem\u003eCytokine \u003c/em\u003e2007, \u003cstrong\u003e37\u003c/strong\u003e(3):236-245.\u003c/li\u003e\n\u003cli\u003eKampen CV, Gauldie J, Collins SM: \u003cstrong\u003eProinflammatory properties of IL-4 in the intestinal microenvironment\u003c/strong\u003e. \u003cem\u003eAmerican Journal of Physiology Gastrointestinal \u0026amp; Liver Physiology \u003c/em\u003e2005, \u003cstrong\u003e288\u003c/strong\u003e(1):G111.\u003c/li\u003e\n\u003cli\u003ePi\u0026eacute; S, Lalles JP, Blazy F, Laffitte J, S\u0026egrave;ve B, Oswald IP: \u003cstrong\u003eWeaning is associated with an upregulation of expression of inflammatory cytokines in the intestine of piglets\u003c/strong\u003e. \u003cem\u003eThe Journal of nutrition \u003c/em\u003e2004, \u003cstrong\u003e134\u003c/strong\u003e(3):641-647.\u003c/li\u003e\n\u003cli\u003eHu C, Xiao K, Luan Z, Song J: \u003cstrong\u003eEarly weaning increases intestinal permeability, alters expression of cytokine and tight junction proteins, and activates mitogen-activated protein kinases in pigs\u003c/strong\u003e. \u003cem\u003eJournal of animal science \u003c/em\u003e2013, \u003cstrong\u003e91\u003c/strong\u003e(3):1094-1101.\u003c/li\u003e\n\u003cli\u003eWu Y, Kudsk KA, DeWitt RC, Tolley EA, Li J: \u003cstrong\u003eRoute and type of nutrition influence IgA-mediating intestinal cytokines\u003c/strong\u003e. \u003cem\u003eAnnals of surgery \u003c/em\u003e1999, \u003cstrong\u003e229\u003c/strong\u003e(5):662.\u003c/li\u003e\n\u003cli\u003eArenas-Ramirez N, Woytschak J, Boyman O: \u003cstrong\u003eInterleukin-2: biology, design and application\u003c/strong\u003e. \u003cem\u003eTrends in immunology \u003c/em\u003e2015, \u003cstrong\u003e36\u003c/strong\u003e(12):763-777.\u003c/li\u003e\n\u003cli\u003eZhang H, Li J, Cao C, Zhang B, Yang W, Shi B, Shan A: \u003cstrong\u003ePyrroloquinoline quinone inhibits the production of inflammatory cytokines via the SIRT1/NF-\u0026kappa;B signal pathway in weaned piglet jejunum\u003c/strong\u003e. \u003cem\u003eFood \u0026amp; function \u003c/em\u003e2020, \u003cstrong\u003e11\u003c/strong\u003e(3):2137-2153.\u003c/li\u003e\n\u003cli\u003eAl-Sadi R, Boivin M, Ma T: \u003cstrong\u003eMechanism of cytokine modulation of epithelial tight junction barrier\u003c/strong\u003e. \u003cem\u003eFrontiers in bioscience: a journal and virtual library \u003c/em\u003e2009, \u003cstrong\u003e14\u003c/strong\u003e:2765.\u003c/li\u003e\n\u003cli\u003eSantos F, Rao V: \u003cstrong\u003eAntiinflammatory and antinociceptive effects of 1, 8\u003c/strong\u003e\u003cstrong\u003e‐cineole a terpenoid oxide present in many plant essential oils\u003c/strong\u003e. \u003cem\u003ePhytotherapy Research: An International Journal Devoted to Pharmacological and Toxicological Evaluation of Natural Product Derivatives \u003c/em\u003e2000, \u003cstrong\u003e14\u003c/strong\u003e(4):240-244.\u003c/li\u003e\n\u003cli\u003eBehfarjam F, Sanati MH, Nasseri Moghaddam S, Ataei M, Nikfam S, Jadali Z: \u003cstrong\u003eRole of Th1/Th2 cells and related cytokines in autoimmune hepatitis\u003c/strong\u003e. \u003cem\u003eTurk J Gastroenterol \u003c/em\u003e2017, \u003cstrong\u003e28\u003c/strong\u003e(2):110-114.\u003c/li\u003e\n\u003cli\u003eBuccitelli C, Selbach M: \u003cstrong\u003emRNAs, proteins and the emerging principles of gene expression control\u003c/strong\u003e. \u003cem\u003eNature Reviews Genetics \u003c/em\u003e2020, \u003cstrong\u003e21\u003c/strong\u003e(10):630-644.\u003c/li\u003e\n\u003cli\u003eTchekneva EE, Goruganthu MU, Uzhachenko RV, Thomas PL, Antonucci A, Chekneva I, Koenig M, Piao L, Akhter A, de Aquino MTP: \u003cstrong\u003eDeterminant roles of dendritic cell-expressed Notch Delta-like and Jagged ligands on anti-tumor T cell immunity\u003c/strong\u003e. \u003cem\u003eJournal for immunotherapy of cancer \u003c/em\u003e2019, \u003cstrong\u003e7\u003c/strong\u003e(1):1-17.\u003c/li\u003e\n\u003cli\u003eKijima M, Iwata A, Maekawa Y, Uehara H, Izumi K, Kitamura A, Yagita H, Chiba S, Shiota H, Yasutomo K: \u003cstrong\u003eJagged1 suppresses collagen-induced arthritis by indirectly providing a negative signal in CD8+ T cells\u003c/strong\u003e. \u003cem\u003eThe Journal of Immunology \u003c/em\u003e2009, \u003cstrong\u003e182\u003c/strong\u003e(6):3566-3572.\u003c/li\u003e\n\u003cli\u003eRobinson SC, Klobucar K, Pierre CC, Ansari A, Zhenilo S, Prokhortchouk E, Daniel JM: \u003cstrong\u003eKaiso differentially regulates components of the Notch signaling pathway in intestinal cells\u003c/strong\u003e. \u003cem\u003eCell Communication and Signaling \u003c/em\u003e2017, \u003cstrong\u003e15\u003c/strong\u003e(1):1-13.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1 Composition and nutrient levels of basal diets (air-dry basis) \u0026nbsp;(%）\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"553\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"37.545126353790614%\"\u003e\n \u003cp\u003eIngredient\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.342960288808664%\"\u003e\n \u003cp\u003eContent\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"29.061371841155236%\"\u003e\n \u003cp\u003eNutrition levels\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.050541516245488%\"\u003e\n \u003cp\u003eContent\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"37.545126353790614%\"\u003e\n \u003cp\u003eCorn\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.342960288808664%\"\u003e\n \u003cp\u003e60.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.061371841155236%\"\u003e\n \u003cp\u003eDE（MJ/kg）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.050541516245488%\"\u003e\n \u003cp\u003e14.11\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.545126353790614%\"\u003e\n \u003cp\u003eFish meal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.342960288808664%\"\u003e\n \u003cp\u003e5.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.061371841155236%\"\u003e\n \u003cp\u003eCP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.050541516245488%\"\u003e\n \u003cp\u003e20.21\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.545126353790614%\"\u003e\n \u003cp\u003eCorn gluten meal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.342960288808664%\"\u003e\n \u003cp\u003e5.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.061371841155236%\"\u003e\n \u003cp\u003eCa\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.050541516245488%\"\u003e\n \u003cp\u003e0.76\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.545126353790614%\"\u003e\n \u003cp\u003eSoybean oil\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.342960288808664%\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.061371841155236%\"\u003e\n \u003cp\u003eAP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.050541516245488%\"\u003e\n \u003cp\u003e0.45\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.545126353790614%\"\u003e\n \u003cp\u003eSoybean meal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.342960288808664%\"\u003e\n \u003cp\u003e24.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.061371841155236%\"\u003e\n \u003cp\u003eLys\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.050541516245488%\"\u003e\n \u003cp\u003e1.25\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.545126353790614%\"\u003e\n \u003cp\u003eLimestone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.342960288808664%\"\u003e\n \u003cp\u003e1.18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.061371841155236%\"\u003e\n \u003cp\u003eMet\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.050541516245488%\"\u003e\n \u003cp\u003e0.43\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.545126353790614%\"\u003e\n \u003cp\u003eCaHPO\u003csub\u003e4\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.342960288808664%\"\u003e\n \u003cp\u003e1.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.061371841155236%\"\u003e\n \u003cp\u003eThr\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.050541516245488%\"\u003e\n \u003cp\u003e0.71\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.545126353790614%\"\u003e\n \u003cp\u003e\u003cem\u003eL\u003c/em\u003e-Lys\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.342960288808664%\"\u003e\n \u003cp\u003e0.60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"29.061371841155236%\"\u003e\n \u003cp\u003eTrp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.050541516245488%\"\u003e\n \u003cp\u003e0.16\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.545126353790614%\"\u003e\n \u003cp\u003eMet\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.342960288808664%\"\u003e\n \u003cp\u003e0.13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"29.061371841155236%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.050541516245488%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.545126353790614%\"\u003e\n \u003cp\u003eThr\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.342960288808664%\"\u003e\n \u003cp\u003e0.17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"29.061371841155236%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.050541516245488%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.545126353790614%\"\u003e\n \u003cp\u003eSer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.342960288808664%\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"29.061371841155236%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.050541516245488%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.545126353790614%\"\u003e\n \u003cp\u003eCholine chloride\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.342960288808664%\"\u003e\n \u003cp\u003e0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"29.061371841155236%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.050541516245488%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"37.545126353790614%\"\u003e\n \u003cp\u003eNaCl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.342960288808664%\"\u003e\n \u003cp\u003e0.40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"29.061371841155236%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.050541516245488%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"37.545126353790614%\"\u003e\n \u003cp\u003ePremix\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.342960288808664%\"\u003e\n \u003cp\u003e0.60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"29.061371841155236%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.050541516245488%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"37.545126353790614%\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.342960288808664%\"\u003e\n \u003cp\u003e100.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"29.061371841155236%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.050541516245488%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003csup\u003e1\u0026nbsp;\u003c/sup\u003eNutrient levels were calculated values.\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e2\u003c/sup\u003e The premix provided the following per kilogram of the diet: VA 6 000 IU, VD\u003csub\u003e3\u0026nbsp;\u003c/sub\u003e400 IU, VE 30 mg, VK\u003csub\u003e3\u0026nbsp;\u003c/sub\u003e2 mg, VB\u003csub\u003e1\u0026nbsp;\u003c/sub\u003e3.5mg, VB\u003csub\u003e2\u0026nbsp;\u003c/sub\u003e5.5 mg, VB\u003csub\u003e6\u0026nbsp;\u003c/sub\u003e3.5 mg, VB\u003csub\u003e12\u0026nbsp;\u003c/sub\u003e25.0\u0026mu;g, biotin 0.05 mg, folic acid 0.3 mg, \u003cem\u003eD\u003c/em\u003e-pAntothenic acid 20 mg, niacin 20 mg, choline chloride 500 mg, Fe (as ferrous sulfate) 110 mg, Zn (as zinc sulfate) 100 mg, Cu (as copper sulfate) 20 mg, Mn (as manganese sulfate) 40 mg, Se (as sodium selenite) 0.30 mg, I (as potassium iodide) 0.40 mg.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 2 Primer parameters used in quantitative real-time PCR\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"572\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" width=\"12.43432574430823%\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003eAccession No.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003ePrimer sequence（5\u0026rsquo;to 3\u0026rsquo;）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003eAmplicon size, bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"0.8756567425569177%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" width=\"11.558669001751314%\"\u003e\n \u003cp\u003e\u0026Beta;-Actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003eDQ845171.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eF \u0026nbsp; \u0026nbsp; AGGCCAACCGTGAGAAGATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e122\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eR \u0026nbsp; \u0026nbsp; CATGACAATGCCAGTGGTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003eIL-1\u0026beta;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003eNM_001302388\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eF \u0026nbsp; \u0026nbsp; GTGGCAGGACCTACACTCTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e115\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eR \u0026nbsp; \u0026nbsp; TTCCTTCAGAATGCCGTCCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003eIL-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003eFJ543109.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eF \u0026nbsp; \u0026nbsp; GGAGCCATTGCTGCTGGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e116\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eR \u0026nbsp; \u0026nbsp; ATTCTGTAGCCTGCTTGGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003eIL-10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003eNM_214041\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eF \u0026nbsp; \u0026nbsp; GTGGCAGCCAGCATTAAGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e103\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eR \u0026nbsp;AACTCTTCACTGGGCCGAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003eIL-12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003eNM_214097.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eF \u0026nbsp; \u0026nbsp; CTCCCCCAAATCACATCCAATA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e110\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eR \u0026nbsp; \u0026nbsp; ATTCCCTCTCATTTCCTTGGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003eTNF-\u0026alpha;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003eNM_214022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eF \u0026nbsp; \u0026nbsp; GCCCTTCCACCAACGTTTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e97\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eR \u0026nbsp; \u0026nbsp; CAAGGGCTCTTGATGGCAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003eIFN-\u0026gamma;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003eNM_213948\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eF \u0026nbsp; \u0026nbsp; GGCCATTCAAAGGAGCATGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e144\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eR \u0026nbsp; \u0026nbsp; TCACTGATGGCTTTGCGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003eNotch2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003eXM_021090690\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eF \u0026nbsp; \u0026nbsp; GCCCGGCAGGATGAATGATTAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e99\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eR \u0026nbsp; \u0026nbsp; CCCGACATTGCAGTGCTTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003eDLL1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003eXM_005659096\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eF \u0026nbsp; \u0026nbsp; ATCGCCACCGAGGTGTAAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e103\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eR \u0026nbsp; \u0026nbsp; CCTCTCTCAGCAGCATTCGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003eJAG1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003eXM_005672699 \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eF \u0026nbsp; \u0026nbsp; TTTCAGGGCGACCTTGCATC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e121\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eR \u0026nbsp; \u0026nbsp; CCACACCACACCTTCGAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003eHes1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003eNM_001195231\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eF \u0026nbsp; \u0026nbsp; GTGAGTGCATGAACGAGGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e118\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" width=\"1.7513134851138354%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.683012259194395%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.914185639229423%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.6584938704028%\"\u003e\n \u003cp\u003eR \u0026nbsp; \u0026nbsp; GTCATGGCGTTGATCTGGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.992994746059544%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003csup\u003e1\u0026nbsp;\u003c/sup\u003eIL-1\u0026beta;: interleukin 1\u0026beta;; IL-2: interleukin 2; IL-10: interleukin 10; IL-12: interleukin 12; TNF-\u0026alpha;: tumor necrosis factor \u0026alpha;; IFN-\u0026gamma;: interferon-\u0026gamma;; Notch2: DLL1: Delta-like; JAG1: Jagge\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"weaning, intestine, immunity, pigs, Notch2, T lymphocytes, cytokines","lastPublishedDoi":"10.21203/rs.3.rs-2368056/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2368056/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eA total of 40 piglets with similar body weights were selected in pairs at 21 days old and divided into the suckling group (SG: breastfed by their mothers) and weaning group (WG: weaned at 21 days old). Eight piglets from each group were randomly selected and sacrificed at 24 days (SG3 and WG3) and 28 days of age (SG7 and WG7). The growth performance, T lymphocyte subpopulations, the concentration of cytokines and immunoglobulins, and the expression of Notch2 signaling proteins were determined. The weaning caused a decrease in body weight (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and the ratio of CD3\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003e/CD3\u003csup\u003e+\u003c/sup\u003eCD8\u003csup\u003e+\u003c/sup\u003e T cells in thymus (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Compared to SG3, the concentration of secretory immunoglobulin A (sIgA) in jejunum was decreased, and that of interleukin 2 (IL-2) in serum and ileum, IL-1β and IL-2 in jejunum were upregulated (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), while IL-10 in the small intestine was downregulated (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in WG3. Weaning downregulated gene expression of IL-4 and upregulated gene expression of IL-1β, IL-12, and interferon γ (IFN-γ) in small intestine (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Further, weaning downregulated protein expression of Notch2 and Hes1 but upregulated Jagged1 expression in small intestine of piglets (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In summary, weaning caused an imbalance in T lymphocytes distribution, thus impairing the intestinal immune function of piglets, which might be associated with the Notch2 signaling. Furthermore, the impairment of intestinal immune barrier function was more severe at 3 days post-weaning than that at the 7 days post-weaning in piglets.\u003c/p\u003e","manuscriptTitle":"Weaning caused imbalanced T lymphocytes distribution and impaired intestinal immune barrier function in piglets","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-12-14 15:48:29","doi":"10.21203/rs.3.rs-2368056/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1e638109-e68d-4b21-b0c8-7f950768feb1","owner":[],"postedDate":"December 14th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-12-19T07:29:23+00:00","versionOfRecord":[],"versionCreatedAt":"2022-12-14 15:48:29","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2368056","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2368056","identity":"rs-2368056","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}