Molecular approach for identification of Pangasianodon hypophthalmus based on Mitochondrial Cytochrome b Oxidase Subunit I (COI) gene from Pakistan | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular approach for identification of Pangasianodon hypophthalmus based on Mitochondrial Cytochrome b Oxidase Subunit I (COI) gene from Pakistan TAYYABA MALIK, MUHAMMAD NAEEM This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2330857/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The aquaculture industry is dependent on rich fish resources in water bodies. Human activities have led to a rapid decline of fish species. In Asia, the Pangasiidae family is highly valued for its potential for survival and its fillet meat. DNA barcoding is a taxonomic method using genetic markers in organisms mitochondrial DNA (mt DNA) for identification. The phylogeny and identification of Pangasianodon hypophthalmus in the subcontinent is of great concern. For species identification, a precise and rapid technique is DNA barcoding. This method is strongly effective for analyzing the divergence among species. DNA barcoding is more reliable as compared to external morphology. To avoid mislabeling and conservation of species, it is equally useful in juveniles as well as adult stages of fishes. As DNA bar-coding is a taxonomic method that uses small genetic markers in organisms’ mitochondrial DNA (mt DNA) for identification of particular species. In recent study MAGA X and Kimura 2 Parameter was used to evaluate genetic distance and neighbor joining tree was constructed. BOLD and GenBank reveals the nearest identity matches. As mitochondrial cyt-b gene region was successfully used for identifying species and accepted as a standard region for DNA barcoding. DNA barcoding P. hypophthalmus Mitochondrial cyt-b Pakistan Figures Figure 1 Figure 2 Figure 3 Introduction Globally, fish account for more than half of all vertebrates, with more than 30,000 species. Additionally, fish provide humans with animal protein and are an important component of biodiversity. Classification and identification of fish are essential to fishery investigations, nature reserve assessments, and food and drug identification (Bingpeng et al., 2018 ). In order to study the huge variety of fish species, a proper taxonomical key is important and its molecular basis should be known (Vartak et al., 2015 ). Ontogenetic metamorphosis occurs in most fishes, resulting in a diverse range of morphological characteristics. On the path to ontogenetic development, many morphometric features changes. Species identification by Morphological characters poses great challenge and controversy to taxonomy as convergent or divergent evolution could cause changes in morphological characters (Bingpeng et al., 2018 ). DNA barcoding is a tools that helps to identify the closely related species in diverse fish fauna that is based upon the isolation of DNA segments, as early studies have already recognized that sequence diversity in a 650-bp fragment of the mitochondrial-DNA, CO1 provides solid species level resolution for large variety of animal groups (Ramadan and Baeshen, 2012 ; Takahara et al., 2013 ). DNA barcoding technique is based upon the molecular approach of DNA isolation and tag them for a single species and stores them, later this data is used for identification purposes (Hebert and Gregory, 2005 ). From ovum to adult, barcoding eliminates the difficulties taxonomists face in identifying organisms (Ayesha et al., 2019 ). The extraction of biomolecules, DNA, RNA, and protein, is of utmost importance in early days of experimental biology and for monitoring biological assaults (Wink, 2006 ; Armstrong and Ball, 2005 ). In contemporary biological sciences the isolation of DNA is a key step in many diagnostic kits for various diseases, DNA molecules can be extracted from various sample of dead tissues, bones, virus sample or dead organic matter for the purpose of study (Wink, 2006 ). DNA isolation is achieved by complete splintering of tissues that release cells and underlying organelles, denaturation of protein complexes, and activation of nucleases that release the DNA molecules (Doyle, 1996 ). Closely related intermixing of fish fauna is an important problem to solve, one species may evolve to many other species levels, and this requires a cheap and rapid method in a mass production environment (Darling and Blum, 2007 ). DNA is relatively stable molecule at high temperature and usually provides far better hereditary (Pardo and Perez-Villarreal, 2004 ) and molecular identification of closely related species, that provides insight into diverse fish fauna, to keep a check on invasive and key varieties (Darling and Blum, 2007 ). It can be analyzed with a single piece of isolated gene to identify it again (Ram, et al. 1996 ). However, genetic information for less than 10% of the total species is yet documented (Bernardi et al., 2010 ). PCR (polymerase chain reaction ) is an advance method of amplification of target sequence of gene and make copies for the desired DNA sequence, it is also noted that this process is very quick and specific but also very sensitive (Lockley and Bardsley, 2000 ). The history of Lessepsian incursions demonstrates those species that becomes problematic to categorize commonly remain unrecognized or misidentified (Azzurro et al., 2015 ). In recent years the documentation of fish species has gained consideration due to the cumulative cases of deception in the fish processing industry (Espineira et al., 2009 ). DNA barcoding aims to provide a competent method for species-level identifications using a range of species-specific molecular tags derived from the five regions of the mitochondrial cytochrome c oxidase I (COI) gene (Hubert et al., 2008 ). As a result, scientists worldwide have established mitochondrial DNA databases and repositories for all animals, including fish (Ayesha et al., 2019 ). Striped catfish ( Pangasianodon hypophthalmus ) is presently the principal freshwater aquaculture species, more than 90% of it is marketed as fillet (Tung et al., 2001 ), out of which most is exported to over 127 countries worldwide and is often being mislabeled (Dung, 2008 ). Materials And Methods In recent work, for identification through DNA barcoding specimens of P. hypophthalmus were obtained from Tawakkal Fish Hatchery near Muzaffargarh, Punjab, Pakistan. As the standard taxonomic key was utilized to recognize the fish at morphological basis. Phenol Chloroform extraction method was executed for isolation of DNA from fish tissues. The weight of tissues was approximately 50mg, they were grinded by adding extraction buffer. 12µl Proteinase-K was added and incubated at 37°C and 55°C for 60mins respectively. Then centrifuged at 5000rpm for 10mins. The supernatant was collected; Phenol, Chloroform and Isoamyl alcohol were added in 25:24:1 ratio and centrifuge at 12000rpm for 10min. Top aqueous layer was collected; Chloroform and Isoamyl alcohol in the ratio 24:1 were added, after gently mixing again centrifuge at 12000rpm for 10min. 0.1 volume of 3M sodium acetate and equal volume of ice cold ethanol(100%) was added to the supernatant and mixed thoroughly until DNA pallet was obtained. After incubation at -20°C for 1hr it was again centrifuged at 1000rpm for 10min and decant the supernatant. After washing with 70% ethanol air dry DNA pellets were suspended in 100µl of distilled water and stored at -20°C for further study. Finally sample was electrophoresed on 0.7% agarose gel at 80volt for 30mins. DNA concentration and purity was evaluated by Thermo-Scientific Nanodrops. DNA sequence was amplified from region of mitochondrial cytochrome b oxidase I (COI) gene using the primers pair as follows: Cyt-b Forward primer: 5’AGCCTACGAAAAACCCACCC 3’ Cyt-b Reverse primer: 5’AAACTGCAGCCCCTCAGAATGATATTTGTCCTC 3’ SensQuest Labcycler was used for PCR amplification. For this processes 25µl of reaction mixture was used in PCR, containing distilled water 11.3µl, master mix 12.5µl, forward primer 0.1µl, reverse primer 0.1µl and DNA template sample 1µl. The PCR thermal cycling conditions includes an initial denaturation of 95°C (5 min), followed by denaturation at 95°C (30 sec; 40 cycles), annealing at 55°C (30 sec) and extension at 72°C (30 sec), with final extension at 72°C (7 min). After amplification, PCR products were run on 1.5% agarose gel for 50 min and then visualized using UV transilluminator to assess the quality of the amplified product. The most clarified samples were selected for the sequencing purpose. Results The purified PCR products was for sequencing. Blast results by NCBI helps to determine the best match homology. The barcode was deposited to GenBank under Accession number MT441543.1( Pangasianodon hypophthalmus ) with 364bp and BLAST results in table.1.1 and pairwise genetic distance in table.1.2. A distinctive electropherogram was formed after DNA sequencing to show nucleotides in colorful peaks(Fig. 1.1 ). By means of MEGA X software; genetic distances and phylogenetic relationship was analyzed as NJ trees and K2P genetics were produced Evolutionary analyses of the aligned sequences were conducted by program MEGA X (Fig. 1.3 ). The phylogenetic tree (Fig. 1.2 ) was rooted among P hypophthalmus Accession No: MT441543.1 and closely related KY586022.1, KY586028.1, KY5860251, KY586008.1. The relationship was analyzed as NJ tree and K2P genetics were rooted among above (Fig. 1.2 and 1.3) Table.1.1:Accession No. and BLAST results analysis of Pangasianodon hypopthalmus Query ID NCBI: taxonomy ID Sequence Length Accession No. Percentage similarity E Value Max Score Total Score Accession No. of best match & % match 43205 310915 364 MT441543.1 100% 0.0 673 673 KY586022.1 (100%) KY586028.1 (99.73%) KY586025.1 (99.73%) KY586008.1 (100%) Table.1.2: Pairwise Genetic Divergence between Species of Pangasianodon hypophthalmus MT441543.1 P.hypophthalmus KY586022.1 P.hypophthalmus KY586028.1 P.hypophthalmus KY586025.1 P.hypophthalmus KY586008.1 P.hypophthalmus MT441543.1 P.hypophthalmus KY586022.1 P.hypophthalmus 0.0000 KY586028.1 P.hypophthalmus 0.0028 0.0049 KY586025.1 P.hypophthalmus 0.0028 0.0026 0.0000 KY586008.1 P.hypophthalmus 0.0055 0.0099 0.0099 0.0077 Discussion For inferring fish phylogenetic relationships and understanding speciation, only morphometric characteristics were used before because Pangasiidae species are highly similar, it is difficult to distinguish them (Ahmed et al., 2018 ). Molecular analysis based on sequence of mitochondrial-DNA for is helpful in accurate recognition of unknown species (Dawnay et al., 2007 and Kerr et al., 2009 ). Cyt-b(cytochrome) gene sequence of 650 base pair are usually used in study for species identification (Lohman et al. 2009 ) and sequence of 649bp was used for identification of Labeo bata from Pakistan (Naeem and Hassan, 2019 ). Present study on Pangasianodon hypophthalmus was conducted to examine the species by DNA barcoding. Amplified PCR product was sequenced, and complete barcode’s fragments of 364 base pairs of P. hypophthalmus (Accession No: MT441543.1) were obtained. Earlier Gianmarco et al. ( 2009 ) reports fragments of base pairs extending 157 to 541 bp in humans, which lies close to recently identified base pairs(364bp). The most appropriate way of distinguishing the DNA depend diversity of intra and interspecific is barcode analysis used to distinguish diverse species, which correspond with neighbor joining tree. Besides that many standardized methods are still used for classification and distance measurement (Bhattacharjee et al. 2012 ). Comparison of quality and quantity of DNA were accessed by Nanodrop and absorbance were noted for 1.6 to 2 for purified DNA product after extraction (Cawthorn et al. 2011 ) as the value of absorbance were found 1.6–1.76 (Naeem and Hassan, 2019 ) study revealed that present extraction quantification were in general agreement. Study of molecular biology by Cytochrome b also useful for molecular taxonomy of fish species (Luo et al., 2011 ). Identification sequence as Cytochrome b gene is significantly used for identification of animals and plants diversity (Khaliq, 2012 ). So the present study used Cytochrome b for the identification of fish species. DNA barcoding marked as very useful for evolutionist, taxonomist and phylogenetic study. Previous studies were in debate about the importance of these studies for taxonomists in DNA barcoding processes to identifying species and its bio-diversity (Hebert et al., 2003 ). Cyt b oxidase was successfully used for DNA barcoding of fishes, as it effectively mark the differences among specific species (Al-Zafiri et al., 2018 ). The barcoding could be useful in a taxonomic study but not as a whole; as it provides additional information to make the research significant (Ebach and Carvalho, 2010 ). Species identification was accessed by using by BOLD and NCBI database for this study (Ha et al. ,2018). Sometimes the results from Barcode of life database (NCBI and BOLD) had significant differences in identification percentage and phylogenetics. This database may also have some unknown species absent in record like P. tenuispinis . Recent results reveal that DNA barcoding is more specifically accessing fishes on basis of diversity (Takahara et al., 2013 ). Phylogenetic differences and species identification were noticeably explained on basis of cytochrome b genes, considered as the preeminent identification tool. The genetic divergence was found in their sequences due to variations. Those variation percentages are measured on the basis of knowing species similarity index (Falade et al., 2016 ). Alignment of nitrogenous bases in present study was close to Pouyaud et al. ( 2009 ). Several countries require that species be identified when fish are supplied to souks without proper labeling (Marko et al. ,2004). DNA-barcoding can be used for confirmation results of fish species that were under consideration, as previously studied by Panprommin et al. ( 2019 ). As these DNA bands clearly indicates the size of sequence that were under consideration for study. In many species of the catfish the specimen were mislabeled reasoned lacking in proper DNA based identification (Ha et al., 2018 ). Species were observed to be interconnected, such analysis of closeness were assessed by measuring of distance by neighbor joining tree, as identical relationship was marked in present study where closely related species were grouped together to formulate a tree (Iyiola et al. ,2018). As the general reference sequence, BOLD and NCBI are operative, and data-base helps in explaining sequences (Wong et al. ,2011). As this study also mentioned it. Conclusion Identification of fishes on molecular bases, in Pakistan is not being considered an accustomed exercise. Numerous techniques practiced, for classifying documentation of fish species traditionally; are less authenticated in contrast to approach of techniques aligned at molecular roots. Recent study was an attempt to provoke the future of these modern approaches. Prior techniques utilized for eras were confined; as they do not show effective outcomes for mislabeling of fish-fillet and fish species, besides spoiled specimens. Substantiations among nucleic divergences amongst species; genera and family could be examined with molecular approaches. Declarations Disclosure statement No potential conflict of interest was reported by the authors. Prof. Dr. Muhammad Naeem designed and invigilate the work. Tayyaba Malik performs and analyzed work and write the manuscript. References Ahmed, S. M., Dina, R. S., Nahari, L., Islam, N. N., and Al-Reza, H. (2018). Molecular characterization of Channa species from Bangladesh based on Cytochrome c Oxidase Subunit I (COI) gene. FishTaxa, 3(4): 87–93. Al-Zafiri, B., Magdy, M., Ali, R. A. M. and Rashed, M. A. S. 2018. DNA Barcoding of Common Commercial Sea Catfish (Genus: Plicofollis) from Kuwait. Ameri J. of Mol Bio., 8(02), 102. Ardura, A., Planes, S., Garcia, V. E. 2013. Applications of DNA barcoding to fish landings: authentication and diversity assessment. Zookeys., (365):49–65. Armstrong, K. F. and Ball, S. L. 2005. DNA barcodes for biosecurity: invasive species identification. Philosophical Transactions of the Royal Society B: Biological Sciences, 360, 1813–1823. Avise, J. C., Arnold, J., Ball, R. M., Bermingham, E. and Lamb, T. 1987. Intraspecific phylogeography: The mitochondrial bridge between population genetics and systematics. Annu Rev Ecol Syst., 18: 489–522. Ayesha, UR., Shafi, N., Akhtar, T., Zareen, A., and Ayub, H. (2019). DNA barcoding of cyprinids ( Labeo rohita, Catla catla and Cirrhinus mrigala ), mitochondrial CO1-based study, Mitochondrial DNA Part B, 4:1, 405–407. Azzurro, E., Goren, M., Diamant, A., Galil, B. and Bernardi, G. 2015. Establishing the identity and assessing the dynamics of invasion in the Mediterranean Sea by the dusky sweeper, Pempheris rhomboidea Kossmann & Rauber, 1877. Biological Invasions, 17, 815–826. Bernardi, G., Golani, D. and Azzurro, E. 2010. The genetics of Lessepsian bioinvasions. Fish invasions of the Mediterranean Sea: change and renewal (ed. by D. Golani and B. Applebaum-Golani), pp. 71–84. Pensoft Publishers , Sofia- Moscow, Russia. Bhattacharjee, M. J., Laskar, B. A. and Dhar, B. 2012. Identification and Re-Evaluation of Freshwater Catfishes through DNA Barcoding. PloS One, 7(11). Bingpeng X, Heshan L, Zhilan Z, Chunguang W, Yanguo W, Jianjun W (2018) DNA barcoding for identification of fish species in the Taiwan Strait. PLoS ONE 13(6): e0198109 Cawthorn, D. M., Steinman, H. A. and Witthuhn, R. C. 2011. Comparative study of different methods for extraction of DNA from fish species commercially available in South Africa. Food Control, 22:231–244. Darling, J. A. and Blum, M. J. 2007. DNA-based methods for monitoring invasive species: a review and prospectus. Biological Invasions, 9, 751–765. Dawnay, N., Ogden, R., and McEwing, R. 2007. Validation of the barcoding gene COI for use in forensic genetic species identification. Forensic Sci Int.,173:1–6. Doyle, K. 1996. The Source of Discovery: Protocols and Applications Guide, PROMEGA, Madison,Wis., USA. Dung, N. H. 2008. Vietnam Pangasius and world market. International Symposium on Catfish Farming in Asia, Viet Nam, 5–7 December 2008. Presentation, 50 pp. Ebach, M. C. and Carvalho, M. R. 2010. Anti-intellectualism in the DNA barcoding enterprise. Zoologia., 27:165–178. Espineira, M., Gonzalez-Lavín, N., Vieites, J. M. and Santaclara, F. J. 2009. Development of a Method for the Identification of Scombroid and Common Substitute Species in Seafood Products by FINS. Food Chemistry, 117 : 698–704. Falade, M. O., Opeme, A. J. and Benson, O. 2016. DNA barcoding of Clarias gariepinus, Coptodon zillii and Sarotherodon melanotheron from Southwestern Nigeria [version 1; referees: 1 approved]. F1000 Res; 5: 1268. FAO, Fisheries and Aquaculture. 2009. Review of the state of the World Fishery Resources, Circular No. 942, Rev.2 FIRF/C942, Rev. 2 (En), pp.110. Gianmarco, F., Milena, A., Beatrice, C., Manuela, L., and Giovanni, B. (2009). Species Identification Through DNA Barcodes. GTMB,13(3):1–6. Ha, T. T., Huong, N. T., Hung, N. P. and Guiguen, Y. 2018. Species Identification Using DNA Barcoding on Processed Panga Catfish Products in Viet Nam Revealed Important Mislabeling. Turkish J. of Fish and Aqua Sci., 18: 457–462. Hebert, P. D., Cywinska, A., Ball, S.L. and DeWaard, J. R. 2003. Biological identifications through DNA barcodes. Proceedings Biological sciences, 270(1512):313–21. Hebert, P. D. N. and Gregory, T. R. 2005. The promise of DNA barcoding for taxonomy. Systematic Biology, 54, 852–859. Hogan, Z., Baird, I. G., Radtke, R. and Vander Zanden, J. 2007. Long distance migration and marine habitation in the Asian catfish Pangasius krempfi. J. of Fish Biol ., 71: 818–832. IUCN. 2011. IUCN Red List of Threatened Species (ver. 2011.1). Hubert N, Hanner R, Holm E, Mandrak NE, Taylor E, Burridge M, Watkinson D, et al. (2008). Identifying Canadian freshwater fishes through DNA barcodes. PLoS One 3:2490. Iyiola, O. A., Nneji, L. M. and Mustapha, M. K. 2018. DNA barcoding of economically important freshwater fish species from north-central Nigeria uncovers cryptic diversity. Ecol Evol., 8:6932–6951. Kerr, K. C., Lijtmaer, D. O. A., Barreira, A. S., Hebert, P. D., Tubaro, P. L. 2009. Probing evolutionary patterns through DNA barcodes. PLoS One, 4:4379. Khaliq, F. 2012. Isolation and sequencing of cytochrome oxidase C sub- unit 1 (COI) gene of Tor putitora [Thesis]. Pakistan: University of Sargodha. Ko, H. L., Wang, Y. T., Chiu, T. S., Lee, M. A., Leu, M. Y., Chang, K. Z., Chen, W. Y. and Shao, K. T. 2013. Evaluating the Accuracy of Morphological identification of larval fishes by applying DNA barcoding. PLoS ONE, 8: e53451. Lenormand, S. 1996. Les Pangasiidae du delta du Mekong (Viet Nam): description preliminaire des pecheries, elements de biologie, et perspectives pour une diversification des elevages. Memoire de Fin D'etudes, Ecole Nationale Superieure Agronomie de Rennes. Lockley, A. K. and Bardsley, R. G. 2000. DNA-based methods for food authentication.Trends in Food Science and Technology, 11: 67–77. Lohman, D.J., Prawiradilaga, D.M. and Meier, R. 2009. Improved COI barcoding primers for Southeast Asian perching. Mol Ecol Resour., 9:37–40. Luo, A., Zhang, A., Ho, S.Y., Xu, W., Zhang, Y., Shi, W., Cameron, S.L. and Zhu, C. 2011. Potential efficiency of mitochondrial genes for animal DNA barcoding: a case study using eutherian mammals. BMC Genomics,12:84. Marko, P. B., Lee, S. C. and Rice, A. M. 2004. Fisheries: mislabeling of a depleted reef fish. Nature, 430 (6997), 309–310. Naeem, M. and Hassan, S. 2019. Molecular approach for identification of Labeo bata based on COI gene sequence from Pakistan, Mitochondrial DNA PartB, 4:1, 244–246. Nwani, C. D., Becker, S., Braid, H. E., Ude, E. F., Okogwu, O.I. and Hanner, R. 2011. DNA barcoding discriminates freshwater fishes from Southeastern Nigeria and provides river system-level phylogeographic resolution within some species. Mitochondrial DNA, 22:43–51. Panprommin, D., Soontornprasit, K., Tuncharoen, S., Pithakpol, S. and Keereelang, J. 2019. DNA barcodes for the identification of species diversity in fish from Kwan Phayao, Thailand. J. of Asia-Pacific Biodiv., 12: 382–389. Pardo, M. A. and Perez-Villarreal, B. 2004. Identification of commercial canned tuna species by restriction site analysis of mitochondrial DNA products obtained by nested primer PCR. Food Chemistry, 86, 143–150. Pouyaud, L., Sudarto and Paradis, E. 2009. The phylogenetic structure of habitat shift and morphological convergence in Asian Clarias (Teleostei, Siluriformes: Clariidae). J. of Zool Syst and Evol Res., 47, 344–356. Ram, J. L., Ram, M. L. and Baidoun, F. F. 1996. Authentication of Canned Tuna and Bonito by Sequence and Restriction Site Analysis of Polymerase Chain Reaction Products of Mitochondrial DNA. J. of Agri and Food Chem., 44 : 2460–2467. Ramadan, H. A. and Baeshen, N. A. 2012. Biological Identifications through DNA barcodes. In: Lameed GA, editor. Biodiversity conservation and utilization in a diverse world, 1st ed. Croatia: InTech ., p.109–28. Rasmussen, R. S., Morrissey, M. T. and Hebert, P. D. N. 2009. DNA barcoding of commercially important salmon and trout species ( oncorhynchus and salmo ) from North America. J, of Agri and Food Chem., vol.57,no.18: pp.8379–8385. Takahara, T., Minamoto, T. and Doi, H. 2013. Using environmental DNA to estimate the distribution of an invasive fish species in ponds. PLoS ONE , 8(2). Tung, N. T., Tuan, N., Tuan, T. T. and Hoa, N. D. 2001. Development situation of two fish species of Pangasiidae cultured in the Mekong delta of Viet Nam ( Pangasianodon hypophthalmus and Pangasius bocourti ). Assessment of Mekong Fisheries Project. Unpublished document. Mekong River Commission, Phnom Penh, 21 pp. Vartak, V. R., Narasimmalu, R., Annam, P. K., Singh, D. P. and Lakra, W. S. 2015. DNA barcoding detected improper labelling and supersession of crab food served by restaurants in India. J. of the Sci of Food and Agri., 95(2):359–66. Victor, B. C., Hanner, R., Shivji, M., Hyde, J. and Caldow, C. 2009. Identification of the larval and juvenile stages of the Cubera Snapper, Lutjanus cyanoptems , usingDNA barcoding. Zootaxa, no. 2215, pp. 24–36. Ward, R. D., Zemlak, S. T., Innes, B. H., Last, P.R. and Hebert, P. D. N. 2005. DNA barcoding Australia´s fish species. Philos. T. Roy. Soc, B 360:1847–1857. Wink, M. 2006. An Introduction to Molecular Biotechnology: Molecular Fundamentals, Methods and Application in Modern Biotechnology, Wiley-VCH, Weinheim, Germany. Wong, L. L., Peatman, E., Lu, J., Kucuktas, H., He, S. and Zhou, C. 2011. DNA Barcoding of Catfish: Species Authentication and Phylogenetic Assessment. PLoS ONE, 6(3):e17812. Zhang, J. and Hanner, R. 2012. Molecular approach to the identification of fish in the South China Sea. PLoS ONE, 7:e30621. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2330857","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":156572670,"identity":"1de7328e-0b30-4695-b5ae-11d732ab79f7","order_by":0,"name":"TAYYABA MALIK","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABC0lEQVRIiWNgGAWjYLACxgYIdQBIyDEw8OBXzYOkhQGkxZh0LYkNhLTYs58xk/i5w45Bvr35wIEPvw6nbzh+9uCDDwx2croNOGzhyTGT7D2TzMDYcyzh4My+w7kbzuQlG85gSDY2O4DLYTlmErxtzAzMEjkGh3l7gFoO5JhJ8zAcSNyGSwv/GzPJv231DGxQLekG598Q0CIBNJO37TCIYXCY58fhBIMbhGy58azYWvbMcQYJHpBfGtINZ954Y2w4wwC3X9j7kzfefLujGhRiwID6Yy3Pdz7H8MGHCjs5XFoYGDhMJIBkfQOIzdjWzKAAVmmASznYnscfEJw/dQzyDfhUj4JRMApGwUgEAGOjYmgAI2jPAAAAAElFTkSuQmCC","orcid":"","institution":"Bahauddin Zakariya University","correspondingAuthor":true,"prefix":"","firstName":"TAYYABA","middleName":"","lastName":"MALIK","suffix":""},{"id":156572673,"identity":"be51ad6b-badf-4ade-a2d6-b1af4c10b1c5","order_by":1,"name":"MUHAMMAD NAEEM","email":"","orcid":"","institution":"Bahauddin Zakariya University","correspondingAuthor":false,"prefix":"","firstName":"MUHAMMAD","middleName":"","lastName":"NAEEM","suffix":""}],"badges":[],"createdAt":"2022-11-30 18:29:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2330857/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2330857/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":29786479,"identity":"8405f580-1a8a-4424-b347-a85da59bf7d5","added_by":"auto","created_at":"2022-12-01 18:14:40","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":151671,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e1.1. Results of Electropherogram showing Peaks of nucleotides\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2330857/v1/4cb145298a46b5e46d098811.jpg"},{"id":29786157,"identity":"9c668e5a-b6d7-4b41-a0fe-e3f3bf3c537d","added_by":"auto","created_at":"2022-12-01 18:06:40","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":48087,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e1.2. Phylogenetic distances\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2330857/v1/fad903562efacdfab84cc6ce.jpg"},{"id":29786156,"identity":"3d424201-50db-4b1f-8056-5fd0b7ae357c","added_by":"auto","created_at":"2022-12-01 18:06:40","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":51537,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e1.3. BLAST Neighbor joining tree by blast inquiry with Distance Evaluating of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eP. hypophthalmus\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"1.3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2330857/v1/c35a44fd6216844025cac7e2.jpg"},{"id":30129229,"identity":"beb18579-77f6-4831-b17b-e03bc594aa97","added_by":"auto","created_at":"2022-12-09 16:44:17","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":500070,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2330857/v1/1705d16e-9cd0-4665-8305-64068deab136.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Molecular approach for identification of Pangasianodon hypophthalmus based on Mitochondrial Cytochrome b Oxidase Subunit I (COI) gene from Pakistan","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGlobally, fish account for more than half of all vertebrates, with more than 30,000 species. Additionally, fish provide humans with animal protein and are an important component of biodiversity. Classification and identification of fish are essential to fishery investigations, nature reserve assessments, and food and drug identification (Bingpeng et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In order to study the huge variety of fish species, a proper taxonomical key is important and its molecular basis should be known (Vartak et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Ontogenetic metamorphosis occurs in most fishes, resulting in a diverse range of morphological characteristics. On the path to ontogenetic development, many morphometric features changes. Species identification by Morphological characters poses great challenge and controversy to taxonomy as convergent or divergent evolution could cause changes in morphological characters (Bingpeng et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDNA barcoding is a tools that helps to identify the closely related species in diverse fish fauna that is based upon the isolation of DNA segments, as early studies have already recognized that sequence diversity in a 650-bp fragment of the mitochondrial-DNA, CO1 provides solid species level resolution for large variety of animal groups (Ramadan and Baeshen, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Takahara et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). DNA barcoding technique is based upon the molecular approach of DNA isolation and tag them for a single species and stores them, later this data is used for identification purposes (Hebert and Gregory, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). From ovum to adult, barcoding eliminates the difficulties taxonomists face in identifying organisms (Ayesha et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe extraction of biomolecules, DNA, RNA, and protein, is of utmost importance in early days of experimental biology and for monitoring biological assaults (Wink, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Armstrong and Ball, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). In contemporary biological sciences the isolation of DNA is a key step in many diagnostic kits for various diseases, DNA molecules can be extracted from various sample of dead tissues, bones, virus sample or dead organic matter for the purpose of study (Wink, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). DNA isolation is achieved by complete splintering of tissues that release cells and underlying organelles, denaturation of protein complexes, and activation of nucleases that release the DNA molecules (Doyle, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). Closely related intermixing of fish fauna is an important problem to solve, one species may evolve to many other species levels, and this requires a cheap and rapid method in a mass production environment (Darling and Blum, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2007\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDNA is relatively stable molecule at high temperature and usually provides far better hereditary (Pardo and Perez-Villarreal, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2004\u003c/span\u003e) and molecular identification of closely related species, that provides insight into diverse fish fauna, to keep a check on invasive and key varieties (Darling and Blum, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). It can be analyzed with a single piece of isolated gene to identify it again (Ram, et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). However, genetic information for less than 10% of the total species is yet documented (Bernardi et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). PCR (polymerase chain reaction ) is an advance method of amplification of target sequence of gene and make copies for the desired DNA sequence, it is also noted that this process is very quick and specific but also very sensitive (Lockley and Bardsley, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2000\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe history of Lessepsian incursions demonstrates those species that becomes problematic to categorize commonly remain unrecognized or misidentified (Azzurro et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In recent years the documentation of fish species has gained consideration due to the cumulative cases of deception in the fish processing industry (Espineira et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). DNA barcoding aims to provide a competent method for species-level identifications using a range of species-specific molecular tags derived from the five regions of the mitochondrial cytochrome c oxidase I (COI) gene (Hubert et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). As a result, scientists worldwide have established mitochondrial DNA databases and repositories for all animals, including fish (Ayesha et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Striped catfish (\u003cem\u003ePangasianodon hypophthalmus\u003c/em\u003e) is presently the principal freshwater aquaculture species, more than 90% of it is marketed as fillet (Tung et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2001\u003c/span\u003e), out of which most is exported to over 127 countries worldwide and is often being mislabeled (Dung, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2008\u003c/span\u003e).\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003eIn recent work, for identification through DNA barcoding specimens of \u003cem\u003eP. hypophthalmus\u003c/em\u003e were obtained from Tawakkal Fish Hatchery near Muzaffargarh, Punjab, Pakistan. As the standard taxonomic key was utilized to recognize the fish at morphological basis.\u003c/p\u003e \u003cp\u003ePhenol Chloroform extraction method was executed for isolation of DNA from fish tissues. The weight of tissues was approximately 50mg, they were grinded by adding extraction buffer. 12\u0026micro;l Proteinase-K was added and incubated at 37\u0026deg;C and 55\u0026deg;C for 60mins respectively. Then centrifuged at 5000rpm for 10mins. The supernatant was collected; Phenol, Chloroform and Isoamyl alcohol were added in 25:24:1 ratio and centrifuge at 12000rpm for 10min. Top aqueous layer was collected; Chloroform and Isoamyl alcohol in the ratio 24:1 were added, after gently mixing again centrifuge at 12000rpm for 10min. 0.1 volume of 3M sodium acetate and equal volume of ice cold ethanol(100%) was added to the supernatant and mixed thoroughly until DNA pallet was obtained. After incubation at -20\u0026deg;C for 1hr it was again centrifuged at 1000rpm for 10min and decant the supernatant. After washing with 70% ethanol air dry DNA pellets were suspended in 100\u0026micro;l of distilled water and stored at -20\u0026deg;C for further study. Finally sample was electrophoresed on 0.7% agarose gel at 80volt for 30mins. DNA concentration and purity was evaluated by Thermo-Scientific Nanodrops. DNA sequence was amplified from region of mitochondrial cytochrome b oxidase I (COI) gene using the primers pair as follows:\u003c/p\u003e \u003cp\u003eCyt-b Forward primer: 5\u0026rsquo;AGCCTACGAAAAACCCACCC 3\u0026rsquo;\u003c/p\u003e \u003cp\u003eCyt-b Reverse primer: 5\u0026rsquo;AAACTGCAGCCCCTCAGAATGATATTTGTCCTC 3\u0026rsquo;\u003c/p\u003e \u003cp\u003eSensQuest Labcycler was used for PCR amplification. For this processes 25\u0026micro;l of reaction mixture was used in PCR, containing distilled water 11.3\u0026micro;l, master mix 12.5\u0026micro;l, forward primer 0.1\u0026micro;l, reverse primer 0.1\u0026micro;l and DNA template sample 1\u0026micro;l. The PCR thermal cycling conditions includes an initial denaturation of 95\u0026deg;C (5 min), followed by denaturation at 95\u0026deg;C (30 sec; 40 cycles), annealing at 55\u0026deg;C (30 sec) and extension at 72\u0026deg;C (30 sec), with final extension at 72\u0026deg;C (7 min). After amplification, PCR products were run on 1.5% agarose gel for 50 min and then visualized using UV transilluminator to assess the quality of the amplified product. The most clarified samples were selected for the sequencing purpose.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eThe purified PCR products was for sequencing. Blast results by NCBI helps to determine the best match homology. The barcode was deposited to GenBank under Accession number MT441543.1(\u003cem\u003ePangasianodon hypophthalmus\u003c/em\u003e) with 364bp and BLAST results in table.1.1 and pairwise genetic distance in table.1.2.\u003c/p\u003e\u003cp\u003eA distinctive electropherogram was formed after DNA sequencing to show nucleotides in colorful peaks(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1.1\u003c/span\u003e). By means of MEGA X software; genetic distances and phylogenetic relationship was analyzed as NJ trees and K2P genetics were produced Evolutionary analyses of the aligned sequences were conducted by program MEGA X (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1.3\u003c/span\u003e). The phylogenetic tree (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1.2\u003c/span\u003e) was rooted among \u003cem\u003eP hypophthalmus\u003c/em\u003e Accession No: MT441543.1 and closely related KY586022.1, KY586028.1, KY5860251, KY586008.1. The relationship was analyzed as NJ tree and K2P genetics were rooted among above (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1.2\u003c/span\u003e and 1.3)\u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eTable.1.1:Accession No. and BLAST results analysis of\u003c/span\u003e \u003cspan type=\"BoldItalicUnderline\" class=\"BoldItalicUnderline\" name=\"Emphasis\"\u003ePangasianodon hypopthalmus\u003c/span\u003e\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eQuery ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNCBI: taxonomy ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence Length\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAccession No.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePercentage similarity\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eE Value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eMax Score\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eTotal Score\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eAccession No. of best match \u0026amp; % match\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e43205\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e310915\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e364\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMT441543.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e673\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e673\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eKY586022.1 (100%)\u003c/p\u003e \u003cp\u003eKY586028.1 (99.73%)\u003c/p\u003e \u003cp\u003eKY586025.1 (99.73%)\u003c/p\u003e \u003cp\u003eKY586008.1 (100%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eTable.1.2: Pairwise Genetic Divergence between Species of\u003c/span\u003e \u003cspan type=\"BoldItalicUnderline\" class=\"BoldItalicUnderline\" name=\"Emphasis\"\u003ePangasianodon hypophthalmus\u003c/span\u003e\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Tabb\" border=\"1\"\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMT441543.1\u003c/p\u003e \u003cp\u003eP.hypophthalmus\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eKY586022.1\u003c/p\u003e \u003cp\u003eP.hypophthalmus\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eKY586028.1 P.hypophthalmus\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eKY586025.1 P.hypophthalmus\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eKY586008.1\u003c/p\u003e \u003cp\u003eP.hypophthalmus\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMT441543.1\u003c/b\u003e\u003c/p\u003e \u003cp\u003eP.hypophthalmus\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eKY586022.1\u003c/b\u003e\u003c/p\u003e \u003cp\u003eP.hypophthalmus\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eKY586028.1\u003c/b\u003e P.hypophthalmus\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.0028\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.0049\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eKY586025.1\u003c/b\u003e P.hypophthalmus\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.0028\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.0026\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eKY586008.1\u003c/b\u003e P.hypophthalmus\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.0055\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.0099\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0099\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.0077\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eFor inferring fish phylogenetic relationships and understanding speciation, only morphometric characteristics were used before because \u003cem\u003ePangasiidae\u003c/em\u003e species are highly similar, it is difficult to distinguish them (Ahmed et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Molecular analysis based on sequence of mitochondrial-DNA for is helpful in accurate recognition of unknown species (Dawnay et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2007\u003c/span\u003e and Kerr et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Cyt-b(cytochrome) gene sequence of 650 base pair are usually used in study for species identification (Lohman et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) and sequence of 649bp was used for identification of \u003cem\u003eLabeo bata\u003c/em\u003e from Pakistan (Naeem and Hassan, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePresent study on \u003cem\u003ePangasianodon hypophthalmus\u003c/em\u003e was conducted to examine the species by DNA barcoding. Amplified PCR product was sequenced, and complete barcode\u0026rsquo;s fragments of 364 base pairs of \u003cem\u003eP. hypophthalmus\u003c/em\u003e (Accession No: MT441543.1) were obtained. Earlier Gianmarco et al. (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) reports fragments of base pairs extending 157 to 541 bp in humans, which lies close to recently identified base pairs(364bp). The most appropriate way of distinguishing the DNA depend diversity of intra and interspecific is barcode analysis used to distinguish diverse species, which correspond with neighbor joining tree. Besides that many standardized methods are still used for classification and distance measurement (Bhattacharjee et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Comparison of quality and quantity of DNA were accessed by Nanodrop and absorbance were noted for 1.6 to 2 for purified DNA product after extraction (Cawthorn et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) as the value of absorbance were found 1.6\u0026ndash;1.76 (Naeem and Hassan, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) study revealed that present extraction quantification were in general agreement.\u003c/p\u003e \u003cp\u003eStudy of molecular biology by Cytochrome b also useful for molecular taxonomy of fish species (Luo et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Identification sequence as Cytochrome b gene is significantly used for identification of animals and plants diversity (Khaliq, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). So the present study used Cytochrome b for the identification of fish species. DNA barcoding marked as very useful for evolutionist, taxonomist and phylogenetic study. Previous studies were in debate about the importance of these studies for taxonomists in DNA barcoding processes to identifying species and its bio-diversity (Hebert et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Cyt b oxidase was successfully used for DNA barcoding of fishes, as it effectively mark the differences among specific species (Al-Zafiri et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The barcoding could be useful in a taxonomic study but not as a whole; as it provides additional information to make the research significant (Ebach and Carvalho, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSpecies identification was accessed by using by BOLD and NCBI database for this study (Ha \u003cem\u003eet al.\u003c/em\u003e,2018). Sometimes the results from Barcode of life database (NCBI and BOLD) had significant differences in identification percentage and phylogenetics. This database may also have some unknown species absent in record like \u003cem\u003eP. tenuispinis\u003c/em\u003e. Recent results reveal that DNA barcoding is more specifically accessing fishes on basis of diversity (Takahara et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Phylogenetic differences and species identification were noticeably explained on basis of cytochrome b genes, considered as the preeminent identification tool. The genetic divergence was found in their sequences due to variations. Those variation percentages are measured on the basis of knowing species similarity index (Falade et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAlignment of nitrogenous bases in present study was close to Pouyaud et al. (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Several countries require that species be identified when fish are supplied to souks without proper labeling (Marko \u003cem\u003eet al.\u003c/em\u003e,2004). DNA-barcoding can be used for confirmation results of fish species that were under consideration, as previously studied by Panprommin et al. (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). As these DNA bands clearly indicates the size of sequence that were under consideration for study. In many species of the catfish the specimen were mislabeled reasoned lacking in proper DNA based identification (Ha et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSpecies were observed to be interconnected, such analysis of closeness were assessed by measuring of distance by neighbor joining tree, as identical relationship was marked in present study where closely related species were grouped together to formulate a tree (Iyiola \u003cem\u003eet al.\u003c/em\u003e,2018). As the general reference sequence, BOLD and NCBI are operative, and data-base helps in explaining sequences (Wong \u003cem\u003eet al.\u003c/em\u003e,2011). As this study also mentioned it.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIdentification of fishes on molecular bases, in Pakistan is not being considered an accustomed exercise. Numerous techniques practiced, for classifying documentation of fish species traditionally; are less authenticated in contrast to approach of techniques aligned at molecular roots. Recent study was an attempt to provoke the future of these modern approaches. Prior techniques utilized for eras were confined; as they do not show effective outcomes for mislabeling of fish-fillet and fish species, besides spoiled specimens. Substantiations among nucleic divergences amongst species; genera and family could be examined with molecular approaches.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eDisclosure statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo potential conflict of interest was reported by the authors.\u003c/p\u003e\n\u003cp\u003eProf. Dr. Muhammad Naeem designed and invigilate the work.\u003c/p\u003e\n\u003cp\u003eTayyaba Malik performs and analyzed work and write the manuscript.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAhmed, S. M., Dina, R. S., Nahari, L., Islam, N. N., and Al-Reza, H. (2018). Molecular characterization of \u003cem\u003eChanna\u003c/em\u003e species from Bangladesh based on Cytochrome c Oxidase Subunit I (COI) gene. FishTaxa, 3(4): 87\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAl-Zafiri, B., Magdy, M., Ali, R. A. M. and Rashed, M. A. S. 2018. DNA Barcoding of Common Commercial Sea Catfish (Genus: Plicofollis) from Kuwait. Ameri J. of Mol Bio., 8(02), 102.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArdura, A., Planes, S., Garcia, V. E. 2013. Applications of DNA barcoding to fish landings: authentication and diversity assessment. Zookeys., (365):49\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArmstrong, K. F. and Ball, S. L. 2005. DNA barcodes for biosecurity: invasive species identification. Philosophical Transactions of the Royal Society B: Biological Sciences, 360, 1813\u0026ndash;1823.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAvise, J. C., Arnold, J., Ball, R. M., Bermingham, E. and Lamb, T. 1987. Intraspecific phylogeography: The mitochondrial bridge between population genetics and systematics. Annu Rev Ecol Syst., 18: 489\u0026ndash;522.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAyesha, UR., Shafi, N., Akhtar, T., Zareen, A., and Ayub, H. (2019). DNA barcoding of cyprinids (\u003cem\u003eLabeo rohita, Catla catla and Cirrhinus mrigala\u003c/em\u003e), mitochondrial CO1-based study, Mitochondrial DNA Part B, 4:1, 405\u0026ndash;407.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAzzurro, E., Goren, M., Diamant, A., Galil, B. and Bernardi, G. 2015. Establishing the identity and assessing the dynamics of invasion in the Mediterranean Sea by the dusky sweeper, Pempheris rhomboidea Kossmann \u0026amp; Rauber, 1877. Biological Invasions, 17, 815\u0026ndash;826.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBernardi, G., Golani, D. and Azzurro, E. 2010. The genetics of Lessepsian bioinvasions. Fish invasions of the Mediterranean Sea: change and renewal (ed. by D. Golani and B. Applebaum-Golani), pp.\u0026nbsp;71\u0026ndash;84. \u003cem\u003ePensoft Publishers\u003c/em\u003e, Sofia- Moscow, Russia.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhattacharjee, M. J., Laskar, B. A. and Dhar, B. 2012. Identification and Re-Evaluation of Freshwater Catfishes through DNA Barcoding. PloS One, 7(11).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBingpeng X, Heshan L, Zhilan Z, Chunguang W, Yanguo W, Jianjun W (2018) DNA barcoding for identification of fish species in the Taiwan Strait. PLoS ONE 13(6): e0198109\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCawthorn, D. M., Steinman, H. A. and Witthuhn, R. C. 2011. Comparative study of different methods for extraction of DNA from fish species commercially available in South Africa. Food Control, 22:231\u0026ndash;244.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDarling, J. A. and Blum, M. J. 2007. DNA-based methods for monitoring invasive species: a review and prospectus. Biological Invasions, 9, 751\u0026ndash;765.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDawnay, N., Ogden, R., and McEwing, R. 2007. Validation of the barcoding gene COI for use in forensic genetic species identification. Forensic Sci Int.,173:1\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDoyle, K. 1996. The Source of Discovery: Protocols and Applications Guide, PROMEGA, Madison,Wis., USA.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDung, N. H. 2008. Vietnam Pangasius and world market. International Symposium on Catfish Farming in Asia, Viet Nam, 5\u0026ndash;7 December 2008. Presentation, 50 pp.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEbach, M. C. and Carvalho, M. R. 2010. Anti-intellectualism in the DNA barcoding enterprise. Zoologia., 27:165\u0026ndash;178.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEspineira, M., Gonzalez-Lav\u0026iacute;n, N., Vieites, J. M. and Santaclara, F. J. 2009. Development of a Method for the Identification of Scombroid and Common Substitute Species in Seafood Products by FINS. Food Chemistry,\u003cem\u003e117\u003c/em\u003e: 698\u0026ndash;704.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFalade, M. O., Opeme, A. J. and Benson, O. 2016. DNA barcoding of Clarias gariepinus, Coptodon zillii and Sarotherodon melanotheron from Southwestern Nigeria [version 1; referees: 1 approved]. F1000 Res; 5: 1268.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFAO, Fisheries and Aquaculture. 2009. Review of the state of the World Fishery Resources, Circular No. 942, Rev.2 FIRF/C942, Rev. 2 (En), pp.110.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGianmarco, F., Milena, A., Beatrice, C., Manuela, L., and Giovanni, B. (2009). Species Identification Through DNA Barcodes. GTMB,13(3):1\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHa, T. T., Huong, N. T., Hung, N. P. and Guiguen, Y. 2018. Species Identification Using DNA Barcoding on Processed Panga Catfish Products in Viet Nam Revealed Important Mislabeling. Turkish J. of Fish and Aqua Sci., 18: 457\u0026ndash;462.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHebert, P. D., Cywinska, A., Ball, S.L. and DeWaard, J. R. 2003. Biological identifications through DNA barcodes. Proceedings Biological sciences, 270(1512):313\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHebert, P. D. N. and Gregory, T. R. 2005. The promise of DNA barcoding for taxonomy. Systematic Biology, 54, 852\u0026ndash;859.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHogan, Z., Baird, I. G., Radtke, R. and Vander Zanden, J. 2007. Long distance migration and marine habitation in the Asian catfish Pangasius krempfi. \u003cem\u003eJ. of Fish Biol\u003c/em\u003e., 71: 818\u0026ndash;832. IUCN. 2011. IUCN Red List of Threatened Species (ver. 2011.1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHubert N, Hanner R, Holm E, Mandrak NE, Taylor E, Burridge M, Watkinson D, et al. (2008). Identifying Canadian freshwater fishes through DNA barcodes. PLoS One 3:2490.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIyiola, O. A., Nneji, L. M. and Mustapha, M. K. 2018. DNA barcoding of economically important freshwater fish species from north-central Nigeria uncovers cryptic diversity. Ecol Evol., 8:6932\u0026ndash;6951.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKerr, K. C., Lijtmaer, D. O. A., Barreira, A. S., Hebert, P. D., Tubaro, P. L. 2009. Probing evolutionary patterns through DNA barcodes. PLoS One, 4:4379.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhaliq, F. 2012. Isolation and sequencing of cytochrome oxidase C sub- unit 1 (COI) gene of Tor putitora [Thesis]. Pakistan: University of Sargodha.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKo, H. L., Wang, Y. T., Chiu, T. S., Lee, M. A., Leu, M. Y., Chang, K. Z., Chen, W. Y. and Shao, K. T. 2013. Evaluating the Accuracy of Morphological identification of larval fishes by applying DNA barcoding. PLoS ONE, 8: e53451.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLenormand, S. 1996. Les Pangasiidae du delta du Mekong (Viet Nam): description preliminaire des pecheries, elements de biologie, et perspectives pour une diversification des elevages. Memoire de Fin D'etudes, Ecole Nationale Superieure Agronomie de Rennes.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLockley, A. K. and Bardsley, R. G. 2000. DNA-based methods for food authentication.Trends in Food Science and Technology, 11: 67\u0026ndash;77.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLohman, D.J., Prawiradilaga, D.M. and Meier, R. 2009. Improved COI barcoding primers for Southeast Asian perching. Mol Ecol Resour., 9:37\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo, A., Zhang, A., Ho, S.Y., Xu, W., Zhang, Y., Shi, W., Cameron, S.L. and Zhu, C. 2011. Potential efficiency of mitochondrial genes for animal DNA barcoding: a case study using eutherian mammals. BMC Genomics,12:84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarko, P. B., Lee, S. C. and Rice, A. M. 2004. Fisheries: mislabeling of a depleted reef fish. Nature,\u003cem\u003e430\u003c/em\u003e(6997), 309\u0026ndash;310.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNaeem, M. and Hassan, S. 2019. Molecular approach for identification of \u003cem\u003eLabeo bata\u003c/em\u003e based on COI gene sequence from Pakistan, Mitochondrial DNA PartB, 4:1, 244\u0026ndash;246.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNwani, C. D., Becker, S., Braid, H. E., Ude, E. F., Okogwu, O.I. and Hanner, R. 2011. DNA barcoding discriminates freshwater fishes from Southeastern Nigeria and provides river system-level phylogeographic resolution within some species. Mitochondrial DNA, 22:43\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePanprommin, D., Soontornprasit, K., Tuncharoen, S., Pithakpol, S. and Keereelang, J. 2019. DNA barcodes for the identification of species diversity in fish from Kwan Phayao, Thailand. J. of Asia-Pacific Biodiv., 12: 382\u0026ndash;389.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePardo, M. A. and Perez-Villarreal, B. 2004. Identification of commercial canned tuna species by restriction site analysis of mitochondrial DNA products obtained by nested primer PCR. Food Chemistry, 86, 143\u0026ndash;150.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePouyaud, L., Sudarto and Paradis, E. 2009. The phylogenetic structure of habitat shift and morphological convergence in Asian Clarias (Teleostei, Siluriformes: Clariidae). J. of Zool Syst and Evol Res., 47, 344\u0026ndash;356.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRam, J. L., Ram, M. L. and Baidoun, F. F. 1996. Authentication of Canned Tuna and Bonito by Sequence and Restriction Site Analysis of Polymerase Chain Reaction Products of Mitochondrial DNA. J. of Agri and Food Chem., \u003cem\u003e44\u003c/em\u003e: 2460\u0026ndash;2467.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamadan, H. A. and Baeshen, N. A. 2012. Biological Identifications through DNA barcodes. In: Lameed GA, editor. Biodiversity conservation and utilization in a diverse world, 1st ed. Croatia: \u003cem\u003eInTech\u003c/em\u003e., p.109\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRasmussen, R. S., Morrissey, M. T. and Hebert, P. D. N. 2009. DNA barcoding of commercially important salmon and trout species (\u003cem\u003eoncorhynchus and salmo\u003c/em\u003e ) from North America. J, of Agri and Food Chem., vol.57,no.18: pp.8379\u0026ndash;8385.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakahara, T., Minamoto, T. and Doi, H. 2013. Using environmental DNA to estimate the distribution of an invasive fish species in ponds. \u003cem\u003ePLoS ONE\u003c/em\u003e, 8(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTung, N. T., Tuan, N., Tuan, T. T. and Hoa, N. D. 2001. Development situation of two fish species of Pangasiidae cultured in the Mekong delta of Viet Nam (\u003cem\u003ePangasianodon hypophthalmus\u003c/em\u003e and \u003cem\u003ePangasius bocourti\u003c/em\u003e). Assessment of Mekong Fisheries Project. Unpublished document. Mekong River Commission, Phnom Penh, 21 pp.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVartak, V. R., Narasimmalu, R., Annam, P. K., Singh, D. P. and Lakra, W. S. 2015. DNA barcoding detected improper labelling and supersession of crab food served by restaurants in India. J. of the Sci of Food and Agri., 95(2):359\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVictor, B. C., Hanner, R., Shivji, M., Hyde, J. and Caldow, C. 2009. Identification of the larval and juvenile stages of the Cubera Snapper, \u003cem\u003eLutjanus cyanoptems\u003c/em\u003e, usingDNA barcoding. Zootaxa, no. 2215, pp.\u0026nbsp;24\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWard, R. D., Zemlak, S. T., Innes, B. H., Last, P.R. and Hebert, P. D. N. 2005. DNA barcoding Australia\u0026acute;s fish species. Philos. T. Roy. Soc, B 360:1847\u0026ndash;1857.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWink, M. 2006. An Introduction to Molecular Biotechnology: Molecular Fundamentals, Methods and Application in Modern Biotechnology, Wiley-VCH, Weinheim, Germany.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWong, L. L., Peatman, E., Lu, J., Kucuktas, H., He, S. and Zhou, C. 2011. DNA Barcoding of Catfish: Species Authentication and Phylogenetic Assessment. PLoS ONE, 6(3):e17812.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, J. and Hanner, R. 2012. Molecular approach to the identification of fish in the South China Sea. PLoS ONE, 7:e30621.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"DNA barcoding, P. hypophthalmus, Mitochondrial cyt-b, Pakistan","lastPublishedDoi":"10.21203/rs.3.rs-2330857/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2330857/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"The aquaculture industry is dependent on rich fish resources in water bodies. Human activities have led to a rapid decline of fish species. In Asia, the Pangasiidae family is highly valued for its potential for survival and its fillet meat. DNA barcoding is a taxonomic method using genetic markers in organisms mitochondrial DNA (mt DNA) for identification. The phylogeny and identification of Pangasianodon hypophthalmus in the subcontinent is of great concern. For species identification, a precise and rapid technique is DNA barcoding. This method is strongly effective for analyzing the divergence among species. DNA barcoding is more reliable as compared to external morphology. To avoid mislabeling and conservation of species, it is equally useful in juveniles as well as adult stages of fishes. As DNA bar-coding is a taxonomic method that uses small genetic markers in organisms’ mitochondrial DNA (mt DNA) for identification of particular species. In recent study MAGA X and Kimura 2 Parameter was used to evaluate genetic distance and neighbor joining tree was constructed. BOLD and GenBank reveals the nearest identity matches. As mitochondrial cyt-b gene region was successfully used for identifying species and accepted as a standard region for DNA barcoding.","manuscriptTitle":"Molecular approach for identification of Pangasianodon hypophthalmus based on Mitochondrial Cytochrome b Oxidase Subunit I (COI) gene from Pakistan","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-12-01 18:06:35","doi":"10.21203/rs.3.rs-2330857/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"fa48c12f-ee7d-48bd-b8d3-ed0babe2a646","owner":[],"postedDate":"December 1st, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-12-09T16:44:10+00:00","versionOfRecord":[],"versionCreatedAt":"2022-12-01 18:06:35","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2330857","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2330857","identity":"rs-2330857","version":["v1"]},"buildId":"J0_U0BvcaRcwD8yVFaRlm","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.