TIP3;2 is a Tonoplast Transporter Contributed to Nickel Detoxification in Arabidopsis thaliana

TIP3;2 is a Tonoplast Transporter Contributed to Nickel Detoxification in Arabidopsis thaliana | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article TIP3;2 is a Tonoplast Transporter Contributed to Nickel Detoxification in Arabidopsis thaliana Yimeng Feng, Weiyin Zhang, Wenjian Zhao, Mingyu Wu, Bixia Liang, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9077910/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 10 You are reading this latest preprint version Abstract Nickel (Ni) is a necessary trace element for plants, but excessive amounts can be harmful. To mitigate Ni toxicity, plants have evolved distinct mechanism, such as storing Ni in the vacuole or confining it to less sensitive root tissues to prevent its translocation to the vulnerable shoot tissues. Despite this, the exact mechanism of Ni immobilization remains unclear. In Arabidopsis, sequestration of excess Ni into root vacuoles is crucial for Ni immobilization, facilitated by distinct tonoplast-localized transporters. As some members of the aquaporin superfamily have been implicated in transporting both metal ions and polar, non-charged small molecules, we explored whether Arabidopsis thaliana tonoplast intrinsic proteins (TIPs) are involved in Ni immobilization and tolerance. We found that TIP3;2 helps retain excess Ni in the root, restricts its translocation to the shoot, and facilitates its accumulation in the leaf trichome. Furthermore, when TIP3;2 was expressed in yeast, its enhanced Ni resistance, suggesting that TIP3;2 plays a vital role in Ni detoxification. In addition, partial expression of TIP3;2 at yeast plasma membrane demonstrated its capability to facilitate the uptake of Ni-PC complexes into yeast cells. The results reveal a dual function for TIP3;2 in Ni detoxification and underscore the expand substrate specificity of aquaporins to include heavy-metal complexes, uncovering a new aspect of plant adaptive responses to metal stress. Aquaporin Heavy metal toxicity Tonoplast intrinsic protein Ni detoxification Ni immobilization Ni toxicity Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Nickel (Ni) is an essential trace element for plant growth and development at low concentrations. Ni deficiency can inhibit plant growth, disrupt nitrogen and iron uptake, and lead to chlorosis and plant senescence [1, 2]. On the other hand, Ni is harmful at high concentrations [3] . Excess Ni results in decreased germination, cell division, biomass accumulation, nutrients absorption, and metabolic disorders [4-6]. As a result, all adverse effects of Ni toxicity reduce crop production and quality [7-9] . Ni is also toxic to humans, which is associated with lung cancer, kidney ailments and cardiovascular problems [10, 11]. With the increasing industrialization and urbanization, heavy metal pollution in soil, including Ni, become a worldwide environmental issue [12]. Plants are more frequently exposed to Ni toxicity than Ni deficit [13]. Some hyperaccumulator plants can thrive on Ni contaminated soils, and accumulate more Ni in their tissues, especially in leaves, without no toxic effects [14, 15]. This ability highlights the existence of specialized Ni transport and detoxification system in plants. Phytoremediation using hyperaccumulators represents an eco-friendly strategy for soil decontamination [16-18]. However, most known hyperaccumulators are photosynthesis C3 plants, which typically produce lower biomass than C4 species [19, 20]. This limitation extends the time required for effective phytoextraction [21]. Identifying key heavy metal transporters and leveraging molecular biology tools [22, 23] could enable the development of engineered “super plants” with desirable traits such as deep roots, fast growth, high biomass, and efficient metal translocation and accumulation. Such advancements would make phytoremediation a more viable and faster solution to the growing challenge of heavy metal pollution. Plant aquaporins (AQPs) are integral membrane proteins that form a large gene family [24, 25]. They are characterized by two conserved asparagine-proline-alanine (Asn-Pro-Ala, NPA) motifs embedded in the plasma membrane and correlate with substrate selectivity [26, 27]. Another conserved structural feature of AQP family is the aromatic/arginine (ar/R) constriction site, which contains highly conserved aromatic and arginine residues that acts as a selectivity filter [26, 27]. While traditionally known to transport polar and non-charged small solutes and metalloids across cellular membranes [25, 28], recent evidence indicates that some AQPs can also facilitate the transport of metal ions [29]. For example, our recent studies suggest that Arabidopsis AtNIP1;2 transports aluminum-malate (Al-Mal) complexes, thereby alleviating Al toxicity by removing Al 3+ from the root cell wall – the primary site of Al damage [30-35].Similarly, the tonoplast-localized AtTIP2;2 plays an important role in Zn immobilization and sequestration into the root vacuole in Arabidopsis , enhancing Zn tolerance [36]. In rice, a coordinated system involving plasma-localized OsNIP1;2 and tonoplast-localized OsTIP2;1 facilitates the removal of cell wall Al and its vacuolar sequestration, improving Al detoxification [37, 38]. Building on this foundation, we further investigated the potential role of the tonoplast intrinsic protein TIP3;2 (NCBI accession number: NP_173223.1, https://www.ncbi.nlm.nih.gov/datasets/gene/838359/#transcripts-and-proteins) in Ni detoxification and resistance in Arabidopsis . We report that tip3;2 mutants are sensitive to Ni stress, and that TIP3;2 facilitates sequestration of excess Ni into vacuole in roots and is crucial for conferring Ni resistance. Our findings establish TIP3;2 as a key component of the Ni detoxification machinery in Arabidopsis . Materials and Methods Plant Material and Growth Conditions. The Arabidopsis thaliana T-DNA insertion mutants tip3;2 -1 (At1g17810, SALK_091612) and tip3;2 -2 (At1g17810, SALK_125353) were acquired from the Arabidopsis Biological Resource Center (ABRC) (https://abrc.osu.edu/). Wild-type (Col-0), and mutant seeds were surface-sterilized, cold stratified and sown on 250 μm polypropylene meshes floating on hydroponic solutions, at pH6.5, supplemented without or with Ni or other metal ions in Magenta boxes. The components of the hydroponic solution are described in reference [32]. Relative root growth (RRG %) was calculated as the percentage of root growth of individual plants under toxic Ni treatment over the average root growth under the control (0.5 µM Ni) condition. Three biological replicates (Magenta boxes) were conducted for each treatment. For testing the sensitivity to other metals, WT and two tip3;2 SALK lines were treated with hydroponic solutions (pH 6.5) containing (in μM) 50, ZnSO 4 ; 6, CdCl 2 ; 200, MnCl 2 ; 20, AlCl 3 ; or 5, CuSO 4 for 7 days and the primary root length was measured. GUS Staining Assays and Localization of GUS Expression . A 1.9 kb TIP3;2 promoter (ATG as +1) was PCR-amplified from Arabidopsis genomic DNAs with primers 5’-GGTT AAGCTT TACGACTCGATGCCTTCTC-3’ and 5′-AGCA CCATGG CTCTCCCGAATCCATATGC-3′ (the underlined sequences are restriction enzyme sites for Hind III: and Nco I, respectively), and then cloned into the pCAMBIA1305.2 vector. The resulting TIP3;2 promoter::β-glucuronidase (GUS) construct was transformed into the WT (Col-0) genome through Agrobacterium tumefaciens (strain GV3101)-mediated transformation. GUS staining were processed according to the methodology outlined in a previous paper [36]. Subcellular Localization of TIP3;2. The coding sequence of TIP3;2, excluding the stop codon, was amplified from the TIP3;2 cDNA using the primers 5′- TCGC GGATCC AAAATGGCTACATCTGCTAGAAG -3′ and 5′- ATGG CTCGAG GTAATCTTCCGGAGCCAAT -3′ (the underlined sequences are restriction enzyme sites for BamH I and Xho I, respectively), and then cloned in frame with the 5’ end of the GFP coding region in the pGPTV.GFP.Bar vector. The resulting TIP3;2-GFP construct was then transformed into Agrobacterium tumefaciens strain GV3101, followed by transiently transformed into the tobacco leaves by infiltration. The vacuolar membrane marker 35S::TIP1;1-RFP (vac-rk-CD3-975) was as described in Nelson et al. [39]. GFP signals were observed with a Leica SP5 confocal laser microscope. RNA Isolation and Quantitative Real-time RT-qPCR . Total RNAs were extracted from Arabidopsis root, stem, shoot or seed using the RNeasy Mini Kit (Qiagen) following the manufacturer’s instruction and according to previously described [32]. The relative expression levels of the target genes were referred to an endogenous calibrator gene, 18S rRNA, for each RT-qPCR experiment. The sequences of real-time primers for TIP2;2 are: 5’-AGTACATGATCATCCCCAG-3’ and 5’-CATAGGAAATGGCAGGAAAAC-3’. Root and Shoot Ni Content Measurement . Seven-day-old seedlings of the indicated lines were cultured in a hydroponic solution (pH 6.5) with or without the supplement of 0.5 or 50 μM NiCl2 for 24h. Plant samples were harvested and processed according to previous paper [36]. Elements of each sample were analyzed with ICP-MS (inductively coupled plasma mass spectrometry). Three biological replicates for each treatment were made. Cell Sap and Cell Wall Preparation and Ni Content Determination . Following a 24-h treatment with 0.5 or 50 μM NiCl 2 (pH 6.5), roots or shoots were excised. The collection and analysis procedures were detailed by Wang et al [36]. Nickel contents in the samples were analyzed by ICP-MS. Collection and Analysis of Xylem Sap . Six weeks old seedlings were subjected to 0.5 or 50 μM NiCl 2 treatment for 24h. Xylem sap collection followed the previous procedures [36]. ICP-MS was used to determine the Ni and K concentrations. Trichome Isolation Trichomes were collected and processed according to the methodology outlined in a previous paper [36]. Ni content in the trichomes were analyzed by ICP-MS. Yeast Ni Sensitivity Analysis. The coding sequence of TIP3;2 was amplified with the primers：5’-TCGC GGATCC AAAATGGCTACATCTGCTAGAAG-3’ and 5’- ATCC GCGGCCGC GTAATCTTCCGGAGCCAAT-3’ (the underlined sequences are restriction enzyme sites for BamH I and Not I, respectively). The PCR fragments were ligated to the corresponding restriction sites of the pYES2-GFP vector [37]. Yeast cells expressing the pYES2-TIP3;2-GFP construct were observed under a Leica SP5 confocal laser microscope. For Ni sensitivity evaluation, the TIP3;2 CDS fragment was obtained through PCR with primers: 5’-TCGC GGATCC AAAATGGCTACATCTGCTAGAAG-3’ and 5’- ATCC GCGGCCGC CTAGTAATCTTCCGGAGCCAAT-3’, and subcloned into the pYES2 vector at BamH I and Not I sites. The pYES2-TIP3;2 plasmid was transformed into yeast BY4741 cells. Three independent yeast BY4741 lines, containing the pYES2 empty vector, or pYES2-TIP3;2 plasmid, were selected and cultivated overnight in an SD-Ura medium (+2% glucose). Then, the cultures were centrifuged for 5 min (at 5000 g), and resuspended in the SD-Ura medium with 2% galactose and cultured overnight. After sequential 10-fold dilutions, 10 μl of cell suspensions were spotted on SD-Ura plates with different Ni concentration, and incubated at 30 ℃ for 3 days. Creation of NIP1;2 1-30 ::TIP3;2 31-268 fusion protein and uptake assays in yeast. To create NIP1;2 1-30 ::TIP3;2 31-268 fusion protein, the 1-150 nucleotide from ATG of TIP3;2 gene was replaced by NIP1;2 gene’s 1-150 nucleotide with infusion PCR, the first PCR primer pairs are (1) 5’-CTACggatccAAAATGGCGGAGATCTCGGGAAA-3’ and 5’-GTGAGCCGCCGTGTCCCAATAGAAAGGGACAGAGATAGAGAG-3’ and (2) 5’-TATTGGGACACGGCGGCTCAC-3’ and 5’-ATCCgcggccgcGTAATCTTCCGGAGCCAAT-3’ , using plasmid as template which contains NIP1;2 or TIP3;2 CDS respectively. The second PCR was performed with primer pair: 5’-CTAC GGATCC AAAATGGCGGAGATCTCGGGAAA-3’ and 5’-ATCC GCGGCCGC GTAATCTTCCGGAGCCAAT-3’, (the underlined sequences are restriction enzyme sites for BamH I and Not I, respectively), the first PCR products are as template. Then, the individual PCR fragments were sub-cloned into the BamH I and the Not I restriction sites in frame with the 5’ end of the GFP coding region in the pYES2-GFP construct. The resulting pYES2- NIP1;2 1-30 ::TIP3;2 31-268 -GFP construct was transformed into yeast strain BY4741, and observed with a Leica SP5 confocal laser microscope. The yeast lines with pYES2-GFP and pYES2- NIP1;2 1-30 ::TIP3;2 31-268 -GFP were inoculated in an SC-Ura medium containing 2% galactose and grown at 30 ℃ to a mid-exponential phase. Then, the precultured yeast cells were resuspended at OD600 = 3.0 in the uptake medium, i.e., the SC-Ura medium supplemented with different possible transport substrates at final concentrations of 0 or 20 µM NiCl 2 : 40 µM ligands. The Ni-ligands tested included Ni-Citrate, Ni-Malate, Ni-Nicotinamide, Ni-glutathione, Ni-phytochelatin, Ni- metallothionein. After incubation in the uptake media for 4 h, yeast cells were harvested and washed three times with deionized water and dried in a 55℃oven for 2 days.. The Ni concentrations were determined by ICP-MS. Three biological replicates for each line and each treatment were conducted. Results tip3;2 Mutants Are Sensitive Specifically to Ni Stress. Given the reported involvement of aquaporins in the transport of B, As, Sb, and Al, we investigated a potential role in Ni tolerance. We screened T-DNA insertion mutant lines for nine Arabidopsis TIP genes under Ni stress, obtained from the Arabidopsis Biological Resource Center (ABRC). Two independent TIP3;2 (At1g17810) T-DNA lines, tip3;2 -1 (SALK_091612, intronic insertion) and tip3;2 -2 (SALK_125353, exonic insertion), exhibited significantly reduced TIP3;2 transcript levels by real-time quantitative RT-PCR (qRT-PCR) (Figure 1D), and showed hypersensitivity to a range of Ni concentrations (Figure 1 A–C). These results suggest that TIP3;2 contributes to Ni tolerance in Arabidopsis . To assess specificity, we compared the sensitivity of wild-type and tip3;2 mutants to other toxic metals, including Cd, Al, Zn, Cu and Mn. No difference in sensitivity were observed for Cd (6 µM), Al (20 µM), Zn (60 µM), Cu (5 µM) or Mn (200 µM) between WT and mutants (Supplemental Figure 1). These results indicate that the mutant phenotype is specific to Ni stress. TIP3;2 Expression is Induced by Ni . Specificity of TIP3;2 expression was examined via TIP3;2 promoter β-glucuronidase (GUS) analysis in transgenic Arabidopsis plants. GUS activity was consistently observed in roots, trichomes of the leaf and stem, and hydathode (Figure 2A-E). qRT-PCR analyses found TIP3;2 expression mainly in the root, stem, shoot, but barely in the seed (Figure 3A). Time-course qRT-PCR analyses indicated that TIP3;2 expression in the root was up-regulated rapidly and peaked with a 3.8-fold increase after 6 h of Ni treatment (Figure 3B). After 6 h treatments with different Ni concentrations, TIP3;2 expression showed a concentration-dependent pattern (Figure 3C). In addition, TIP3;2 expression was explicitly induced by Ni stress, but not by other toxic metal ions, including Cd 2+ , Al 3+ , Zn 2+ , Cu 2+ and Mn 2 + (Figure 3D). TIP3;2 is Localized to the Tonoplast To determine subcellular localization, the TIP3;2 cDNA was fused with the GFP gene and the TIP3;2::GFP protein was transiently express in in Nicotiana benthamiana epidermal cells. Fluorescence was consistently observed on the inner side of the chloroplast autofluorescence, and associated with transvacuolar strands (indicated by the blue arrows in Figure 4), which are cytoplasmic tunnels bounded by the tonoplast [40, 41], suggesting that TIP3;2 was confined to the vacuolar membrane. The tonoplast localization was confirmed by co-expression of the TIP3;2::GFP fusion protein in N. benthamiana with a vacuolar membrane marker protein, TIP1;1-RFP (vac-rk-CD3-975) [42]. The vac-rk protein was tagged with the mCherry fluorophore, which allows signals from both fluorophores to be detected in the same cell. Fluorescence from the vac-rk control was detected at the tonoplast of N. benthamiana cells and overlapped with signals from TIP3;2::GFP (Figure 4). TIP3;2 Affects Ni Homoeostasis in Arabidopsis Ni accumulation in WT and tip3;2 mutants was examined by inductively coupled plasma mass spectrometry (ICP-MS). When plants were grown in control medium (containing 0.5 μM Ni), no difference in Ni content was observed between tip3;2 mutants and wild type. However, under 50 μM Ni stress, while the root cell wall Ni content was similar between genotypes (Figure 5A), the Ni concentrations in the root cell sap (primarily vacuolar contents [43]) was significantly lower in the mutants (Figure 5B). Given the tonoplast localization of TIP3;2, these results suggest its involvement in sequestration Ni from cytoplasm inti the vacuole. Given the loss of TIP3;2 function, Ni in root is less sequestered in the vacuole and may be translocated to the shoot via transpiration flow. We further tested the Ni concentration in xylem sap, roots and shoots. The results suggested that TIP3;2 knockout increased Ni concentration in the xylem sap (Figure 5E), and mutant lines contained more Ni in shoots (Figure 5D), and less Ni in roots (Figure 5C) than WT. There are no differences in Fe, Mn, Cu, and Zn content between WT and mutant lines (Supplemental Figure 2). It is well known that the trichomes play an important role in plant ion and metal homeostasis, one of the important functions is sequestration and compartmentalization of heavy metals. As TIP3;2 is also expressed in trichome and hydathodes, the tip3;2 mutants contained obviously less Ni in trichomes under excess Ni condition than that in WT (Figure 5F). Collectively, these results indicate that TIP3;2 functions to sequester Ni into root vacuoles, limiting its translocation to shoots, and may also facilitate Ni sequestration into trichomes or its secretion via hydathodes for detoxification. Heterologous Expression of TIP3;2 enhanced Yeast Ni tolerance When expressed in yeast, a TIP3;2::GFP fusion protein was localized to the vacuolar membrane, as observed under a confocal microscope (Figure 6A). To test the function of TIP3;2 to Ni tolerance, we transferred pYES2 empty vector and pYES2-TIP3;2 to wild type (BY4741) yeast strains. We then compared the Ni stress tolerance of the transformed yeast lines using a drop assay. In the absence of Ni, the growth of yeast cells expressing TIP3;2 was similar to that of the vector control (Figure 6B). However, in the presence of Ni, growth of both the vector control and TIP3;2-expressing yeast cells was inhibited, with the vector control showing greater inhibition than the TIP3;2-expressing yeast cells, across all tested Ni concentration (Figure 6B). These results suggest that TIP3;2 functions to sequester Ni into the vacuoles, thereby enhancing Ni tolerance in yeast. TIP3;2 Facilitates the Uptake of Nickel-Phytochelatin Complexes In the cytosol (pH 7.0–7.5), ionic metal is mostly chelated by ligands such as malate, citrate, GSH, MT, etc. [44]. Therefore, TIP3;2 might transport Ni in complexed form from the cytosol to the vacuole. However, since TIP3;2 is not localized to the plasma membrane in the yeast expression system, determining its transport form is challenging. To address this ,we engineered an NIP1;2 1-30 ::TIP3;2 31-268 fusion protein by replacing the first 30 amino acids of TIP3;2 with those of NIP1;2, which is known to be localized to the plasma membrane[30]. The initial 30 amino acids may contain the signal peptide to the plasma membrane and lack the key NPA and ar/R motifs of aquaporin. When such a fusion protein was expressed in yeast cells, the GFP signal partially colocalized with red CellMask PM Staining (Thermo Fisher Scientific) at the plasma membrane (Figure 7A), allowing us to determine the transport form of TIP3;2. We conducted a short-term (4 h) Ni uptake assay on yeast lines (BY4741) carrying the pYES2-GFP or pYES2-NIP1;2 1-30 ::TIP3;2 31-268 -GFP construct in the presence of Ni 2+ or Ni 2+ conjugated with different cellular ligands, such as citrate (Cit), malate (Mal), nicotinamide (NA), glutathione (GSH), phytochelatin (PC), and metallothionein (MT) (Figure 7B). Compared with the control line ( pYES2-GFP ), the pYES2-NIP1;2 1-30 ::TIP3;2 31-268 -GFP line showed significantly enhanced Ni uptake activities in the presence of the Ni-PC conjugated complex, but not with other Ni-ligands (Figure 7B). This result suggests that the Ni-PC complex could be a transport substrate for TIP3;2. Discussion TIP3;2 is Probably a Nickel Transporter Aquaporins have evolved beyond their canonical role in water transport to facilitate the movement of various small, neutral solutes and, as increasingly evidenced, charged metal complexes, such as B, As, glycerol, Al-malate complexes, and Zn complexes [29, 30, 36, 45]. Our study adds significant weight to this paradigm shift by implicating TIP3;2, a member of the tonoplast intrinsic protein (TIP) subfamily [46], in Ni transport. The hypersensitivity of two independent tip3;2 mutants to Ni stress (Figure 1A–C), coupled with the specific Ni-induced upregulation of TIP3;2 expression (Figure 3B, D), provides strong genetic evidence for its dedicated role in Ni detoxification, distinct from responses to other heavy metals like Cd, Al, or Zn. The tonoplast localization of TIP3;2 (Figure 4) directs its function to a critical cellular compartment for metal homeostasis. The central vacuole, occupying 30–90% of a plant cell’s volume [47], serves as a primary storage and detoxification site, sequestering excess heavy metals, including Ni, to protect the cytosolic machinery [48]. Our physiological data align perfectly with this model: tip3;2 mutants exhibit reduced Ni accumulation in root cell sap (vacuolar content) but increased Ni in the xylem and shoots (Figure 5B-E). Supporting this hypothesis, heterologous expression of TIP3;2 in yeast resulted in enhanced Ni resistance (Figure 6B), with the protein correctly localizing to the tonoplast (Figure 6A). This phenotype mirrors that of other tonoplast metal transporters, such as AtTIP2;2 for Zn [36], suggesting a conserved functional logic within the TIP subfamily for vacuolar metal sequestration. Crucially, our heterologous expression studies in yeast provide direct functional support. The enhanced Ni tolerance conferred by TIP3;2 (Figure 6B) confirms its capacity to mediate cellular detoxification. Furthermore, the innovative plasma membrane-targeting strategy via the NIP1;2 1-30 ::TIP3;2 31-268 fusion was instrumental in identifying the putative transport substrate. The specific enhancement of Ni uptake only in the presence of Ni-phytochelatin (Ni-PC) complexes (Figure 7B) suggests that TIP3;2 likely transports Ni in a chelated form. This result is physiologically highly plausible, as PCs are rapidly synthesized under heavy metal stress and are key ligands for vacuolar sequestration [49, 50]. This finding positions TIP3;2 as a potential missing link in the PC-dependent detoxification pathway, specifically responsible for the tonoplast transport step of the Ni-PC complex into the vacuole. The Integrated Role of TIP3;2 in Nickel Tolerance: from Root Sequestration to Shoot Detoxification Our results paint a comprehensive picture of how TIP3;2 orchestrates Ni tolerance at the whole-plant level. Its function begins in the root, where high expression in the elongation and hair zones (Figure 2) positions it to intercept Ni entering the symplast. By actively pumping Ni into root vacuoles, TIP3;2 performs a dual function: it directly protects root cell metabolism and acts as a “checkpoint” that limits the amount of Ni entering the xylem stream for shoot translocation. This strategy explains the classic tolerance mechanism of reduced translocation observed in many non-hyperaccumulators [51, 52]. However, TIP3;2's role extends beyond root containment. Its expression in leaf and stem trichomes (Figure 2B-D) and the concomitant reduction of Ni in tip3;2 mutant trichomes (Figure 5F) reveal a secondary, shoot-based detoxification layer. Trichomes function as external metabolic sinks, and their ability to sequester metals is a well-documented tolerance trait [53]. TIP3;2 may facilitate the loading of Ni (likely as a complex) into trichome vacuoles, providing a final line of defense by isolating the metal from mesophyll cells. This role is particularly significant, given that the mutants had higher total shoot Ni but lower trichome Ni, indicating that TIP3;2 is essential for redirecting and safely storing the Ni that does reach the shoot. The expression of TIP3;2 in hydathodes adds a fascinating potential third mechanism (Figure 2B-C). Guttation fluid can contain heavy metals, suggesting a secretory detoxification route. TIP3;2 could be involved in loading Ni into this fluid, effectively excreting it from the plant. This multi-compartmental strategy—root vacuole sequestration, trichome storage, and possible hydathode secretion—underscores the sophisticated, tiered adaptation plants employ against metal stress, with TIP3;2 emerging as a central player in this network. Broader Implications and Future Perspectives The identification of TIP3;2 has important implications. First, it challenges the strict definition of aquaporin substrates and encourages re-examination of other TIPs, and indeed NIPs, for roles in heavy metal transport. The mechanistic parallel with Al detoxification via AtNIP1;2 (Al-malate) and OsNIP1;2/OsTIP2;1 [30, 37, 38] suggests a potential common theme where aquaporins handle metal-ligand complexes. Second, from a phytoremediation perspective, our findings open new avenues. While hyperaccumulators like Alyssum species use specific ligands (e.g., histidine) and transporters (e.g., YSL families) for Ni xylem loading and shoot accumulation [52], our work identifies a key vacuolar transporter for Ni in a non-hyperaccumulator. Engineering or overexpressing TIP3;2 in high-biomass plants, perhaps in conjunction with enhanced PC synthesis, could improve root storage capacity, reducing food chain contamination. Conversely, silencing homologous genes in hyperaccumulators might alter their metal partitioning. Future work should focus on several key questions: (1) Directly confirming the Ni-PC transport activity of TIP3;2 in planta using tonoplast vesicle transport assays. (2) Identifying the protein interactors that might regulate TIP3;2 activity or target it to specific membrane microdomains. (3) Exploring whether TIP3;2 orthologs in crop species like rice or soybean share this function, which would be critical for breeding or engineering metal-tolerant cultivars. By elucidating the role of TIP3;2, this study not only advances our understanding of fundamental plant metal homeostasis but also provides a promising genetic tool for addressing agricultural and environmental challenges posed by nickel pollution. Conclusion This study establishes a critical role for the tonoplast-localized aquaporin TIP3;2 in nickel detoxification in Arabidopsis. We demonstrate that TIP3;2 expression is specifically induced by Ni stress. Functional loss in tip3;2 mutants results in hypersensitivity to Ni, disrupted root-to-shoot partitioning (with reduced root vacuolar sequestration and increased shoot accumulation), and impaired Ni deposition in leaf trichomes. The enhanced Ni tolerance conferred by heterologous TIP3;2 expression in yeast, coupled with evidence suggesting it transports Ni-phytochelatin complexes, reinforces its direct role in Ni transport. Overall, our findings identify TIP3;2 as a key component of the cellular machinery that regulates Ni homeostasis and tolerance in plants. Abbreviations Ni : Nickel ; TIP: Tonoplast Intrinsic Protein ; AQP : Aquaporin ; NPA : Asparagine-Proline-Alanine ; ar/R : Aromatic/arginine ; PC: Phytochelatin ; Cit : Citrate ; Mal : Malate; Nic: Nicotinamide; Glu: Glutathione ; MT : Metallothionein ; GFP: Green Fluorescent Protein; GUS: β‑Glucuronidase. Declarations Acknowledgments This work was supported by a grant from the National Natural Science Foundation of China (32572256, 32272023). Author’s contributions Y.W. conceived and supervised the research. Y.W. and K.X. designed the experiments. Y.-M.F., W.‑Y.Z., W.-J.Z., M.-Y.W., and B.-X.L. performed the experiments and analyzed the results. Y.W. and K.X. wrote the paper. All authors have read and approved the final manuscript. Funding This work was supported by a grant from the National Natural Science Foundation of China (32572256, 32272023) to Y.W. Availability of data and materials The datasets used and analyzed during the current study are included in this article and its supplementary files. The TIP3;2 (AT1G17810) DNA sequence data referenced in this study were available at the NCBI (National Center for Biotechnology Information) GenBank database, the Gene ID is 838359, Transcript accession number is NM_101644.3, and Protein accession number is NP_173223.1. Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. References Bai C, Reilly CC, Wood BW: Nickel Deficiency Disrupts Metabolism of Ureides, Amino Acids, and Organic Acids of Young Pecan Foliage . Plant Physiology 2006, 140 (2):433-443. Harish, Sundaramoorthy S, Kumar D, Vaijapurkar SG: A new chlorophycean nickel hyperaccumulator . Bioresour Technol 2008, 99 (9):3930-3934. Hassan MU, Chattha MU, Khan I, Chattha MB, Aamer M, Nawaz M, Ali A, Khan MAU, Khan TA: Nickel toxicity in plants: reasons, toxic effects, tolerance mechanisms, and remediation possibilities—a review . Environmental Science and Pollution Research 2019, 26 (13):12673-12688. Aqeel M, Khalid N, Tufail A, Ahmad RZ, Akhter MS, Luqman M, Javed MT, Irshad MK, Alamri S, Hashem M et al : Elucidating the distinct interactive impact of cadmium and nickel on growth, photosynthesis, metal-homeostasis, and yield responses of mung bean (Vigna radiata L.) varieties . Environmental Science and Pollution Research 2021, 28 (21):27376-27390. Kumar S, Wang M, Liu Y, Fahad S, Qayyum A, Jadoon SA, Chen Y, Zhu G: Nickel toxicity alters growth patterns and induces oxidative stress response in sweetpotato . Frontiers in Plant Science 2022, 13 . Labidi O, Kouki R, Hidouri S, Bouzahouane H, Caçador I, Pérez-Clemente RM, Sleimi N: Impact of Nickel Toxicity on Growth, Fruit Quality and Antioxidant Response in Zucchini Squash (Cucurbita pepo L.) . Plants 2024, 13 (17). Kumar A, Jigyasu DK, Kumar A, Subrahmanyam G, Mondal R, Shabnam AA, Cabral-Pinto MMS, Malyan SK, Chaturvedi AK, Gupta DK et al : Nickel in terrestrial biota: Comprehensive review on contamination, toxicity, tolerance and its remediation approaches . Chemosphere 2021, 275 . Rizwan M, Imtiaz M, Dai Z, Mehmood S, Adeel M, Liu J, Tu S: Nickel stressed responses of rice in Ni subcellular distribution, antioxidant production, and osmolyte accumulation . Environmental Science and Pollution Research 2017, 24 (25):20587-20598. Mustafa A, Zulfiqar U, Mumtaz MZ, Radziemska M, Haider FU, Holatko J, Hammershmiedt T, Naveed M, Ali H, Kintl A et al : Nickel (Ni) phytotoxicity and detoxification mechanisms: A review . Chemosphere 2023, 328 . Zambelli B, Uversky VN, Ciurli S: Nickel impact on human health: An intrinsic disorder perspective . Biochim Biophys Acta 2016, 1864 (12):1714-1731. Jose CC, Jagannathan L, Tanwar VS, Zhang X, Zang C, Cuddapah S: Nickel exposure induces persistent mesenchymal phenotype in human lung epithelial cells through epigenetic activation of ZEB1 . Mol Carcinog 2018, 57 (6):794-806. Shahzad B, Tanveer M, Rehman A, Cheema SA, Fahad S, Rehman S, Sharma A: Nickel; whether toxic or essential for plants and environment - A review . Plant Physiology and Biochemistry 2018, 132 :641-651. Mustafiz A, Ghosh A, Tripathi AK, Kaur C, Ganguly AK, Bhavesh NS, Tripathi JK, Pareek A, Sopory SK, Singla‐Pareek SL: A unique Ni2+ ‐dependent and methylglyoxal‐inducible rice glyoxalase I possesses a single active site and functions in abiotic stress response . The Plant Journal 2014, 78 (6):951-963. Chamba-Eras I, Griffith DM, Kalinhoff C, Ramírez J, Gázquez MJ: Native Hyperaccumulator Plants with Differential Phytoremediation Potential in an Artisanal Gold Mine of the Ecuadorian Amazon . Plants 2022, 11 (9). Zhang L, Zhang P, Yoza B, Liu W, Liang H: Phytoremediation of metal-contaminated rare-earth mining sites using Paspalum conjugatum . Chemosphere 2020, 259 . Guo K, Yan L, He Y, Li H, Lam SS, Peng W, Sonne C: Phytoremediation as a potential technique for vehicle hazardous pollutants around highways . Environmental Pollution 2023, 322 . Antonkiewicz J, Kowalewska A, Mikołajczak S, Kołodziej B, Bryk M, Spychaj-Fabisiak E, Koliopoulos T, Babula J: Phytoextraction of heavy metals after application of bottom ash and municipal sewage sludge considering the risk of environmental pollution . Journal of Environmental Management 2022, 306 . Lima LHV, Ly SN, Araújo RSRd, Nascimento JdS, Biondi CM, Pérez CA, Rabelo RS, Echevarria G, van der Ent A, Nascimento CWAd: Testing the Feasibility of Citric Acid-Assisted Nickel Agromining with Tropical and Temperate Hyperaccumulator Plants . ACS Omega 2025, 10 (21):22018-22027. Pan P, Lei M, Qiao P, Zhou G, Wan X, Chen T: Potential of indigenous plant species for phytoremediation of metal(loid)-contaminated soil in the Baoshan mining area, China . Environmental Science and Pollution Research 2019, 26 (23):23583-23592. Razmi B, Ghasemi-Fasaei R, Ronaghi A, Mostowfizadeh-Ghalamfarsa R: Investigation of factors affecting phytoremediation of multi-elements polluted calcareous soil using Taguchi optimization . Ecotoxicology and Environmental Safety 2021, 207 . Egendorf SP, Groffman P, Moore G, Cheng Z: The limits of lead (Pb) phytoextraction and possibilities of phytostabilization in contaminated soil: a critical review . Int J Phytoremediation 2020, 22 (9):916-930. Acharya A, Bellaloui N, Pilipovic A, Perez E, Maddox-Mandolini M, Fuente HDL: Current Assessment and Future Perspectives on Phytoremediation of Heavy Metals . Plants 2025, 14 (18). Vats S, Sudhakaran S, Bhardwaj A, Mandlik R, Sharma Y, Kumar S, Tripathi DK, Sonah H, Sharma TR, Deshmukh R: Targeting aquaporins to alleviate hazardous metal(loid)s imposed stress in plants . Journal of Hazardous Materials 2021, 408 . Bezerra-Neto JP, de Araújo FC, Ferreira-Neto JRC, da Silva MD, Pandolfi V, Aburjaile FF, Sakamoto T, de Oliveira Silva RL, Kido EA, Barbosa Amorim LL et al : Plant Aquaporins: Diversity, Evolution and Biotechnological Applications . Curr Protein Peptide Sci 2019, 20 (4):368-395. Maurel C, Verdoucq L, Luu D-T, Santoni V: Plant Aquaporins: Membrane Channels with Multiple Integrated Functions . Annual Review of Plant Biology 2008, 59 (1):595-624. Verdoucq L, Maurel C: Plant Aquaporins . In: Membrane Transport in Plants. 2018: 25-56. Maurel C, Boursiac Y, Luu D-T, Santoni V, Shahzad Z, Verdoucq L: Aquaporins in Plants . Physiological Reviews 2015, 95 (4):1321-1358. Maurel C: Plant aquaporins: Novel functions and regulation properties . FEBS Letters 2007, 581 (12):2227-2236. Tyerman SD, McGaughey SA, Qiu J, Yool AJ, Byrt CS: Adaptable and Multifunctional Ion-Conducting Aquaporins . Annual Review of Plant Biology 2021, 72 (1):703-736. Wang Y, Li R, Li D, Jia X, Zhou D, Li J, Lyi SM, Hou S, Huang Y, Kochian LV et al : NIP1;2 is a plasma membrane-localized transporter mediating aluminum uptake, translocation, and tolerance in Arabidopsis . Proceedings of the National Academy of Sciences 2017, 114 (19):5047-5052. Wang Y, Cai Y, Cao Y, Liu J: Aluminum-activated root malate and citrate exudation is independent of NIP1;2-facilitated root-cell-wall aluminum removal in Arabidopsis . Plant Signaling & Behavior 2018, 13 (1). Wang Y, Yu W, Cao Y, Cai Y, Lyi SM, Wu W, Kang Y, Liang C, Liu J: An exclusion mechanism is epistatic to an internal detoxification mechanism in aluminum resistance in Arabidopsis . BMC Plant Biology 2020, 20 (1):122. Sivaguru M, Liu J, Kochian LV: Targeted expression of SbMATE in the root distal transition zone is responsible for sorghum aluminum resistance . The Plant Journal 2013, 76 (2):297-307. Yang JL, Zhu XF, Peng YX, Zheng C, Li GX, Liu Y, Shi YZ, Zheng SJ: Cell Wall Hemicellulose Contributes Significantly to Aluminum Adsorption and Root Growth in Arabidopsis . Plant Physiology 2011, 155 (4):1885-1892. Zhou D, Yang Y, Zhang J, Jiang F, Craft E, Thannhauser TW, Kochian LV, Liu J: Quantitative iTRAQ Proteomics Revealed Possible Roles for Antioxidant Proteins in Sorghum Aluminum Tolerance . Frontiers in Plant Science 2017, 7 . Wang Y, Kang Y, Yu W, Lyi SM, Choi HW, Xiao E, Li L, Klessig DF, Liu J: AtTIP2;2 facilitates resistance to zinc toxicity via promoting zinc immobilization in the root and limiting root-to-shoot zinc translocation in Arabidopsis thaliana . Ecotoxicology and Environmental Safety 2022, 233 . Wang Y, Yang S, Li C, Hu T, Hou S, Bai Q, Ji X, Xu F, Guo C, Huang M et al : The plasma membrane-localized OsNIP1;2 mediates internal aluminum detoxification in rice . Frontiers in Plant Science 2022, 13 :970270. Zhang W, Yang S, Feng Y, Liang B, Li C, Li Q, Zeng Z, Ji X, Liu J, Wang Y: The tonoplast-localized OsTIP2;1 is involved in aluminum detoxification in rice . Plant Physiology and Biochemistry 2024, 215 . Nelson BK, Cai X, Nebenfuhr A: A multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis and other plants . Plant J 2007, 51 (6):1126-1136. Higaki T, Kutsuna N, Okubo E, Sano T, Hasezawa S: Actin Microfilaments Regulate Vacuolar Structures and Dynamics: Dual Observation of Actin Microfilaments and Vacuolar Membrane in Living Tobacco BY-2 Cells . Plant and Cell Physiology 2006, 47 (7):839-852. Ruthardt N, Gulde N, Spiegel H, Fischer R, Emans N: Four-dimensional imaging of transvacuolar strand dynamics in tobacco BY-2 cells . Protoplasma 2005, 225 (3-4):205-215. Nelson BK, Cai X, Nebenführ A: A multicolored set of in vivo organelle markers for co ‐localization studies in Arabidopsis and other plants . The Plant Journal 2007, 51 (6):1126-1136. Xia J, Yamaji N, Kasai T, Ma JF: Plasma membrane-localized transporter for aluminum in rice . Proceedings of the National Academy of Sciences 2010, 107 (43):18381-18385. Ma JF: Role of Organic Acids in Detoxification of Aluminum in Higher Plants . Plant and Cell Physiology 2000, 41 (4):383-390. Singh R, Deshmukh R, Muthamilarasan M, Rani R, Prasad M: Versatile roles of aquaporin in physiological processes and stress tolerance in plants.pdf . Plant Physiol Biochem 2020, 149: :178-189. Bansal A, Sankararamakrishnan R: Homology modeling of major intrinsic proteins in rice, maize and Arabidopsis: comparative analysis of transmembrane helix association and aromatic/arginine selectivity filters . BMC Structural Biology 2007, 7 (1):27. Shimada T, Takagi J, Ichino T, Shirakawa M, Hara-Nishimura I: Plant Vacuoles . Annual Review of Plant Biology 2018, 69 (1):123-145. Noor I, Sohail H, Sun J, Nawaz MA, Li G, Hasanuzzaman M, Liu J: Heavy metal and metalloid toxicity in horticultural plants: Tolerance mechanism and remediation strategies . Chemosphere 2022, 303 . Clemens S, Kim EJ, Neumann D, JI. S: Tolerance to toxic metals by a gene family of phytochelatin synthases from plants and yeast.pdf . EMBO J 1999, 18 (12):3325-3333. Luo Y, Zhang Y, Xiong Z, Chen X, Sha A, Xiao W, Peng L, Zou L, Han J, Li Q: Peptides Used for Heavy Metal Remediation: A Promising Approach . International Journal of Molecular Sciences 2024, 25 (12). Krämer U, Talke IN, Hanikenne M: Transition metal transport . FEBS Letters 2007, 581 (12):2263-2272. Krämer U: Metal hyperaccumulation in plants . Annual Review of Plant Biology Annual 2010, 61 :517–534. Sarret Gr, Harada E, Choi Y-E, Isaure M-P, Geoffroy N, Fakra S, Marcus MA, Birschwilks M, Clemens S, Manceau A: Trichomes of Tobacco Excrete Zinc as Zinc-Substituted Calcium Carbonate and Other Zinc-Containing Compounds . Plant Physiology 2006, 141 (3):1021-1034. Additional Declarations No competing interests reported. Supplementary Files 2026SupplementalFigures.pptx Supplemental Figure 1. The tip3;2 mutants are specifically hypersensitive to Ni but not to other metal ions. Seeds of WT, and tip3;2 -1 and tip3;2 -2 were germinated in hydroponic solution containing 8 μM NiCl 2 , 6 μM CdCl 2 ; 20μM AlCl 3 ; 50 μM ZnSO 4 ; 5 μM CuSO 4 or 200 μM MnCl 2 . Root length was measured at 8d after germination (N = 20). CK, the control hydroponic solution. Asterisks indicate significant differences (**, p<0.01) between WT and individual tip3;2 lines under indicated treatment conditions. Supplemental Figure 2. Other metals concentration in root or shoot. The Fe, Zn, Cu, Mn concentration in the root or shoot, Fe (A), Zn (B), Cu (C), Mn (D), and K in xylem sap (E). Plants were hydroponically grown in nutrient solution for 7 days and treated with 0.5 or 50 μM NiCl 2 for 24 h, and metals concentrations were measured using ICP-MS. Data are mean ± SD of three biological replicates. **P < 0.01 between WT and individual tip3;2 lines under the indicated treatment conditions. DW, dry weight. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 30 Mar, 2026 Reviews received at journal 29 Mar, 2026 Reviews received at journal 23 Mar, 2026 Reviewers agreed at journal 21 Mar, 2026 Reviewers agreed at journal 20 Mar, 2026 Reviewers invited by journal 18 Mar, 2026 Editor assigned by journal 18 Mar, 2026 Editor invited by journal 18 Mar, 2026 Submission checks completed at journal 18 Mar, 2026 First submitted to journal 12 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9077910","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":609915198,"identity":"9259762b-e8eb-497b-a06d-8e2234874049","order_by":0,"name":"Yimeng Feng","email":"","orcid":"","institution":"Guangzhou University","correspondingAuthor":false,"prefix":"","firstName":"Yimeng","middleName":"","lastName":"Feng","suffix":""},{"id":609915208,"identity":"69c99b8e-dca7-495e-b511-4ab5437c6d4d","order_by":1,"name":"Weiyin Zhang","email":"","orcid":"","institution":"Guangzhou University","correspondingAuthor":false,"prefix":"","firstName":"Weiyin","middleName":"","lastName":"Zhang","suffix":""},{"id":609915209,"identity":"41aa9189-e765-4dad-bcb1-27bf9df4a380","order_by":2,"name":"Wenjian Zhao","email":"","orcid":"","institution":"Guangzhou University","correspondingAuthor":false,"prefix":"","firstName":"Wenjian","middleName":"","lastName":"Zhao","suffix":""},{"id":609915211,"identity":"4f238d4b-1598-4f0e-b74f-5411070def60","order_by":3,"name":"Mingyu Wu","email":"","orcid":"","institution":"Guangzhou University","correspondingAuthor":false,"prefix":"","firstName":"Mingyu","middleName":"","lastName":"Wu","suffix":""},{"id":609915212,"identity":"61ab6fe5-8a97-4efc-afda-f22001271267","order_by":4,"name":"Bixia Liang","email":"","orcid":"","institution":"Guangzhou University","correspondingAuthor":false,"prefix":"","firstName":"Bixia","middleName":"","lastName":"Liang","suffix":""},{"id":609915213,"identity":"b071d773-4229-4af5-b2f7-0f581f2664af","order_by":5,"name":"Kuaifei Xia","email":"","orcid":"","institution":"South China Botanical Garden","correspondingAuthor":false,"prefix":"","firstName":"Kuaifei","middleName":"","lastName":"Xia","suffix":""},{"id":609915214,"identity":"3b1ec35a-134a-44fc-aede-67e439536603","order_by":6,"name":"Yuqi Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0klEQVRIiWNgGAWjYPACGwYGCRDNRryWNNK1HCZBi8HxHMPPBb/O282f3WPA8KHsMAP/7AYCWs68MZae2Xc7uXHOGQPGGecOM0jcOUBAy43cDdK8PbeTmSVyDJh52w4zGEgkENSy+Tdvz7lkNpCWv0Rq2SbN8+OAHQ9ICyMxWiTPvP9mzduQnCAhkVZwsOdcOo/EDQJa+I6nJd/m+WNnLz8jeeODH2XWcvwzCGhROABUwNjGkNgA5BwAYh786oFAvgFk5h8Ge4IqR8EoGAWjYOQCAB4aRVsMcctKAAAAAElFTkSuQmCC","orcid":"","institution":"Guangzhou University","correspondingAuthor":true,"prefix":"","firstName":"Yuqi","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2026-03-10 01:54:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9077910/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9077910/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105216303,"identity":"eb0882f3-5fb0-4fdc-bc49-ed5ca6c6a175","added_by":"auto","created_at":"2026-03-23 14:44:17","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":308240,"visible":true,"origin":"","legend":"\u003cp\u003eTIP3;2 mutations sensitize mutant plants to Ni stress. (A) Ni sensitivity of WT and two \u003cem\u003etip3;2\u003c/em\u003e T-DNA lines. Seedlings were grown in hydroponic solution containing 0 or 7 μM NiCl\u003csub\u003e2\u003c/sub\u003e for 7 days. (B) Gene structure of \u003cem\u003eTIP3;2\u003c/em\u003e. Boxes, exons; horizontal lines, introns; closed boxes, the coding sequences; triangles, T-DNA insertions. (C) Relative root growth (RRG%) of WT and \u003cem\u003etip3;2\u003c/em\u003e mutants under Ni stress. (D) Real-time RT-qPCR analyses of \u003cem\u003eTIP3;2\u003c/em\u003e expression in roots. Data in C and D are means ± SD of three biological replicates.\u003c/p\u003e","description":"","filename":"2026FinalFigures1.png","url":"https://assets-eu.researchsquare.com/files/rs-9077910/v1/166d54d3fc214c2b0931d81c.png"},{"id":105216304,"identity":"f0297cfc-9de9-474d-9c3a-d84eba4e3d99","added_by":"auto","created_at":"2026-03-23 14:44:17","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":37596,"visible":true,"origin":"","legend":"\u003cp\u003eTissue-specific expression of \u003cem\u003eTIP3;2\u003c/em\u003e. GUS activity driven by the \u003cem\u003eTIP3;2\u003c/em\u003epromoter in the whole seedling (A) Leaf (B) partial magnified leaf (C) Stem (D) and Root tip (E). Scale bars: 1mm in A, B, D; 100 μm in C, E.\u003c/p\u003e","description":"","filename":"2026FinalFigures3.png","url":"https://assets-eu.researchsquare.com/files/rs-9077910/v1/a383cca4716dc466b84a0b53.png"},{"id":105216306,"identity":"823a6500-22a1-4139-aff8-44268964d932","added_by":"auto","created_at":"2026-03-23 14:44:17","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1159286,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eTIP3;2 \u003c/em\u003eexpression patterns. (A) Detection of \u003cem\u003eTIP3;2\u003c/em\u003e expression in seed, root, stem and shoot of 7-d-old WT(Col-0) by qRT-PCR analysis. (B)Time course qRT-PCR analysis of \u003cem\u003eTIP3;2\u003c/em\u003e. gene expression in WT roots treated with 8 μM NiCl\u003csub\u003e2\u003c/sub\u003e. (C) Concentration-dependent expression of \u003cem\u003eTIP3;2\u003c/em\u003e in WT root treated with different Ni concentration. (D) qRT-PCR analysis of \u003cem\u003eTIP3;2\u003c/em\u003e expression in WT roots in response to different metal ions. Here 7-d-old WT plants were treated with 6 μM CdCl\u003csub\u003e2\u003c/sub\u003e, 20 μM AlCl\u003csub\u003e3\u003c/sub\u003e, 8 μM NiCl\u003csub\u003e2\u003c/sub\u003e, 50 μM ZnSO4, 5 μM CuSO\u003csub\u003e4\u003c/sub\u003e, or 200 μM MnCl\u003csub\u003e2\u003c/sub\u003e for 6 h. Asterisks indicate significant differences between 0 and 8 μM NiCl\u003csub\u003e2 \u003c/sub\u003etreatments (**P \u0026lt; 0.01).\u003c/p\u003e","description":"","filename":"2026FinalFigures2.png","url":"https://assets-eu.researchsquare.com/files/rs-9077910/v1/144ecabca2ab58b9456ba76f.png"},{"id":105564118,"identity":"90159b4e-817f-45be-a664-abc95a39a60d","added_by":"auto","created_at":"2026-03-27 12:48:46","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1416451,"visible":true,"origin":"","legend":"\u003cp\u003eSubcellular localization of TIP3;2 in \u003cem\u003eNicotiana benthamiana\u003c/em\u003e epidermal cells. Coexpression of TIP3;2-GFP (green) and the vacuolar membrane marker TIP1;1-RFP (vac-rk-CD3-975) (red) in a tobacco epidermal cell, the overlapped signal (yellow) is on the inside facing side of the chloroplast auto-fluorescent signals (blue), and contained typical transvacuolar strands (indicated by the purple arrows). Boxed area is magnified. Scale bar: 10 μm.\u003c/p\u003e","description":"","filename":"2026FinalFigures4.png","url":"https://assets-eu.researchsquare.com/files/rs-9077910/v1/e82f57df309ddf6147c52226.png"},{"id":105216311,"identity":"66936349-cfe3-4cea-b08a-11d0eca11520","added_by":"auto","created_at":"2026-03-23 14:44:17","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":135586,"visible":true,"origin":"","legend":"\u003cp\u003eNi Homoeostasis in Arabidopsis.\u003c/p\u003e\n\u003cp\u003eThe Ni concentration in the root cell wall (A), root cell sap (B), roots (C), shoots (D), xylem sap (E), trichome (F), shoot cell wall (G), shoot cell sap (H). Plants were hydroponically grown in nutrient solution for 7 days and treated with 0.5 or 50 μM NiCl\u003csub\u003e2\u003c/sub\u003e for 24 h, and Ni concentrations were measured using ICP-MS. Data are mean ± SD of three biological replicates. **P \u0026lt; 0.01 between WT and individual \u003cem\u003etip3;2\u003c/em\u003e lines under the indicated treatment conditions. DW, dry weight.\u003c/p\u003e","description":"","filename":"2026FinalFigures6.png","url":"https://assets-eu.researchsquare.com/files/rs-9077910/v1/6edee86f6f15ffa08e98c84d.png"},{"id":105216305,"identity":"c1f4fca0-cbb0-49d6-b2e0-ab65983fae38","added_by":"auto","created_at":"2026-03-23 14:44:17","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":244426,"visible":true,"origin":"","legend":"\u003cp\u003eFunctional analysis of TIP3;2 in yeast. (A) Subcellular localization of TIP3;2 in yeast. TIP3;2-GFP (green) mainly localized to the tonoplast in a yeast cell carrying pYES2-TIP3;2::GFP. (Scale bar: 1 μm.) Arrows points to the vacuolar membrane. (B) Expression of TIP3;2 in yeast enhances Ni tolerance. Overnight yeast cell suspension of BY4741 or \u003cem\u003ecot1\u003c/em\u003etransformed with empty vector pYES2 or TIP3;2 were serially diluted (1:10) and spotted on the media without (Control) or with indicated Ni concentration. Pictures were taken after 3 days growth at 30 ℃.\u003c/p\u003e","description":"","filename":"2026FinalFigures5.png","url":"https://assets-eu.researchsquare.com/files/rs-9077910/v1/f09f2f6e9375d7bdda552a0f.png"},{"id":105564122,"identity":"05ff67bd-11b7-4c8a-bfea-5a61641ab955","added_by":"auto","created_at":"2026-03-27 12:48:47","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":443678,"visible":true,"origin":"","legend":"\u003cp\u003eNIP1;2\u003csup\u003e1-30\u003c/sup\u003e::TIP3;2\u003csup\u003e31-268\u003c/sup\u003e\u003cstrong\u003e \u003c/strong\u003e\u0026nbsp;fusion protein facilitates uptake of Ni-PC, but not other Al-ligands, in yeast. (A) Subcellular localization of NIP1;2\u003csup\u003e1-30\u003c/sup\u003e::TIP3;2\u003csup\u003e31-268\u003c/sup\u003e\u003cstrong\u003e \u003c/strong\u003ein yeast. NIP1;2\u003csup\u003e1-30\u003c/sup\u003e::TIP3;2\u003csup\u003e31-268\u003c/sup\u003e\u003cstrong\u003e \u003c/strong\u003e-GFP (green) was partially colocalized with red CellMask PM Staining (Thermo Fisher Scientific) to the plasma in a yeast cell carrying pYES2- NIP1;2\u003csup\u003e1-30\u003c/sup\u003e::TIP3;2\u003csup\u003e31-268\u003c/sup\u003e-GFP. (Scale bar: 1 μm).\u0026nbsp; (B) Uptake of Ni\u003csup\u003e2+\u003c/sup\u003e and different Ni-ligands by NIP1;2\u003csup\u003e1-30\u003c/sup\u003e::TIP3;2\u003csup\u003e31-268\u003c/sup\u003e\u003cstrong\u003e \u003c/strong\u003e\u0026nbsp;fusion protein. Yeast cells carrying pYES2-GFP or pYES2- NIP1;2\u003csup\u003e1-30\u003c/sup\u003e::TIP3;2\u003csup\u003e31-268\u003c/sup\u003e\u003cstrong\u003e \u003c/strong\u003e-GFP were exposed to the SC-Ura medium containing NiCl2 (20 µM), or individual Ni-ligands (20 µM NiCl2 + 40 µM ligand) for 4 h. The ligands used are citrate (Cit), malate (Mal), nicotinamide (NA), histidine (His), glutathione (GSH), phytochelatin (PC) or metallothionein (MT). Then, Ni concentrations of the yeast cells were determined by ICP-MS. Data are means ± SD of three biological replicates from three independent transformation events. *, significant differences (p\u0026lt;0.05) between two yeast lines under indicated treatment.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e","description":"","filename":"2026FinalFigures7.png","url":"https://assets-eu.researchsquare.com/files/rs-9077910/v1/d242648003e6b764814c214d.png"},{"id":105216308,"identity":"bc5c5abc-c44c-4b3c-9198-99049d37406a","added_by":"auto","created_at":"2026-03-23 14:44:17","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":301533,"visible":true,"origin":"","legend":"\u003cp\u003eProposed model of TIP3;2-mediated Ni transportation and detoxification in Arabidopsis. TIP3;2 is involved in retaining excess Ni in the root, limiting its translocation to the shoot, facilitating its accumulation in vacuole and trichome, and loading Ni to guttation fluid, and plays a crucial role in resistance to Ni toxicity in Arabidopsis.\u003c/p\u003e","description":"","filename":"2026FinalFigures8.png","url":"https://assets-eu.researchsquare.com/files/rs-9077910/v1/4ae18cfbb75da18861c19352.png"},{"id":105569004,"identity":"212dd61d-8afc-4c94-bfac-1ae16f50768e","added_by":"auto","created_at":"2026-03-27 13:11:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8460029,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9077910/v1/230ee09e-bc71-457f-8a92-7ff209ad74cf.pdf"},{"id":105564227,"identity":"590e0dbb-4dac-4579-a254-cbbed6244e9d","added_by":"auto","created_at":"2026-03-27 12:49:04","extension":"pptx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":67973,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental Figure 1\u003c/strong\u003e. The \u003cem\u003etip3;2\u003c/em\u003e mutants are specifically hypersensitive to Ni but not to other metal ions. Seeds of WT, and \u003cem\u003etip3;2\u003c/em\u003e -1 and \u003cem\u003etip3;2\u003c/em\u003e -2 were germinated in hydroponic solution containing 8 μM NiCl\u003csub\u003e2\u003c/sub\u003e, 6 μM CdCl\u003csub\u003e2\u003c/sub\u003e; 20μM AlCl\u003csub\u003e3\u003c/sub\u003e; 50 μM ZnSO\u003csub\u003e4\u003c/sub\u003e; 5 μM CuSO\u003csub\u003e4\u003c/sub\u003e or 200 μM MnCl\u003csub\u003e2\u003c/sub\u003e. Root length was measured at 8d after germination (N = 20). CK, the control hydroponic solution. Asterisks indicate significant differences (**, p\u0026lt;0.01) between WT and individual \u003cem\u003etip3;2\u003c/em\u003e lines under indicated treatment conditions.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplemental Figure 2. \u003c/strong\u003eOther metals concentration in root or shoot.\u003c/p\u003e\n\u003cp\u003eThe Fe, Zn, Cu, Mn concentration in the root or shoot, Fe (A), Zn (B), Cu (C), Mn (D), and K in xylem sap (E). Plants were hydroponically grown in nutrient solution for 7 days and treated with 0.5 or 50 μM NiCl\u003csub\u003e2\u003c/sub\u003e for 24 h, and metals concentrations were measured using ICP-MS. Data are mean ± SD of three biological replicates. **P \u0026lt; 0.01 between WT and individual \u003cem\u003etip3;2\u003c/em\u003e lines under the indicated treatment conditions. DW, dry weight.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e","description":"","filename":"2026SupplementalFigures.pptx","url":"https://assets-eu.researchsquare.com/files/rs-9077910/v1/5746e8fa20d8dab381a5b4e1.pptx"}],"financialInterests":"No competing interests reported.","formattedTitle":"TIP3;2 is a Tonoplast Transporter Contributed to Nickel Detoxification in Arabidopsis thaliana","fulltext":[{"header":"Introduction","content":"\u003cp\u003eNickel (Ni) is an essential trace element for plant growth and development at low concentrations. Ni deficiency can inhibit plant growth, disrupt \u0026nbsp;nitrogen and iron uptake, and lead to chlorosis and plant senescence [1, 2]. On the other hand, Ni is harmful at high concentrations [3] . Excess Ni results in decreased germination, cell division, biomass accumulation, nutrients absorption, and metabolic disorders [4-6]. As a result, all adverse effects of Ni toxicity reduce crop production and quality [7-9] . Ni is also toxic to humans, which is associated with lung cancer, kidney ailments and cardiovascular problems [10, 11]. With the increasing industrialization and urbanization, heavy metal pollution in soil, including Ni, become a worldwide environmental issue [12]. Plants are more frequently exposed to Ni toxicity than Ni deficit [13].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSome hyperaccumulator plants can thrive on Ni contaminated soils, and accumulate more Ni in their tissues, especially in leaves, without no toxic effects [14, 15]. This ability highlights the existence of specialized Ni transport and detoxification system in plants. Phytoremediation using hyperaccumulators represents an eco-friendly strategy for soil decontamination [16-18]. However, most known hyperaccumulators are photosynthesis C3 plants, which typically produce lower biomass than C4 species [19, 20]. This limitation extends the time required for effective phytoextraction [21]. Identifying key heavy metal transporters and leveraging molecular biology tools [22, 23] could enable the development of engineered \u0026ldquo;super plants\u0026rdquo; with desirable traits such as deep roots, fast growth, high biomass, and efficient metal translocation and accumulation. Such advancements would make phytoremediation a more viable and faster solution to the growing challenge of heavy metal pollution.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePlant aquaporins (AQPs) are integral membrane proteins that form a large gene family [24, 25]. They are characterized by two conserved asparagine-proline-alanine (Asn-Pro-Ala, NPA) motifs embedded in the plasma membrane and correlate with substrate selectivity [26, 27]. Another conserved structural feature of AQP family is the aromatic/arginine (ar/R) constriction site, which contains highly conserved aromatic and arginine residues that acts as a selectivity filter [26, 27]. While traditionally known to transport polar and non-charged small solutes and metalloids across cellular membranes [25, 28], recent evidence indicates that some AQPs can also facilitate the transport of metal ions [29]. For example, our recent studies suggest that Arabidopsis AtNIP1;2 transports aluminum-malate (Al-Mal) complexes, thereby alleviating Al toxicity by removing Al\u003csup\u003e3+\u003c/sup\u003e from the root cell wall \u0026ndash; the primary site of Al damage [30-35].Similarly, the tonoplast-localized AtTIP2;2 plays an important role in Zn immobilization and sequestration into the root vacuole in \u003cem\u003eArabidopsis\u003c/em\u003e, enhancing Zn tolerance [36]. In rice, a coordinated system involving plasma-localized OsNIP1;2 and tonoplast-localized OsTIP2;1 facilitates the removal of cell wall Al and its vacuolar sequestration, improving Al detoxification [37, 38].\u003c/p\u003e\n\u003cp\u003eBuilding on this foundation, we further investigated the potential role of the tonoplast intrinsic protein TIP3;2 (NCBI accession number: NP_173223.1, https://www.ncbi.nlm.nih.gov/datasets/gene/838359/#transcripts-and-proteins) in Ni detoxification and resistance in \u003cem\u003eArabidopsis\u003c/em\u003e. We report that \u003cem\u003etip3;2\u003c/em\u003e mutants are sensitive to Ni stress, and that TIP3;2 facilitates sequestration of excess Ni into vacuole in roots and is crucial for conferring Ni resistance. Our findings establish TIP3;2 as a key component of the Ni detoxification machinery in\u003cem\u003e\u0026nbsp;Arabidopsis\u003c/em\u003e.\u003c/p\u003e"},{"header":"Materials and Methods ","content":"\u003cp\u003e\u003cstrong\u003ePlant Material and Growth Conditions.\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe Arabidopsis thaliana T-DNA insertion mutants \u003cem\u003etip3;2\u003c/em\u003e-1 (At1g17810, SALK_091612) and \u003cem\u003etip3;2\u003c/em\u003e-2 (At1g17810, SALK_125353) were acquired from the Arabidopsis Biological Resource Center (ABRC) (https://abrc.osu.edu/). Wild-type (Col-0), and mutant seeds were surface-sterilized, cold stratified and sown on 250 \u0026mu;m polypropylene meshes floating on hydroponic solutions, at pH6.5, supplemented without or with Ni or other metal ions in Magenta boxes. The components of the hydroponic solution are described in reference [32].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eRelative root growth (RRG %) was calculated as the percentage of root growth of individual plants under toxic Ni treatment over the average root growth under the control (0.5 \u0026micro;M Ni) condition. Three biological replicates (Magenta boxes) were conducted for each treatment.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor testing the sensitivity to other metals, WT and two \u003cem\u003etip3;2\u003c/em\u003e SALK lines were treated with hydroponic solutions (pH 6.5) containing (in \u0026mu;M) 50, ZnSO\u003csub\u003e4\u003c/sub\u003e; 6, CdCl\u003csub\u003e2\u003c/sub\u003e; 200, MnCl\u003csub\u003e2\u003c/sub\u003e; 20, AlCl\u003csub\u003e3\u003c/sub\u003e; or 5, CuSO\u003csub\u003e4\u003c/sub\u003e for 7 days and the primary root length was measured. \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGUS Staining Assays and Localization of GUS Expression\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eA 1.9 kb TIP3;2 promoter (ATG as +1) was PCR-amplified from Arabidopsis genomic DNAs with primers 5\u0026rsquo;-GGTT\u003cu\u003eAAGCTT\u003c/u\u003eTACGACTCGATGCCTTCTC-3\u0026rsquo; and 5\u0026prime;-AGCA\u003cu\u003eCCATGG\u003c/u\u003eCTCTCCCGAATCCATATGC-3\u0026prime; (the underlined sequences are restriction enzyme sites for \u003cem\u003eHind\u0026nbsp;\u003c/em\u003eIII: \u0026nbsp;and \u003cem\u003eNco\u0026nbsp;\u003c/em\u003eI, respectively), and then cloned into the pCAMBIA1305.2 vector. The resulting TIP3;2 promoter::\u0026beta;-glucuronidase (GUS) construct was transformed into the WT (Col-0) genome through Agrobacterium tumefaciens (strain GV3101)-mediated transformation. GUS staining were processed according to the methodology outlined in a previous paper [36]. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSubcellular Localization of TIP3;2.\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe coding sequence of TIP3;2, excluding the stop codon, was amplified from the TIP3;2 cDNA using the primers 5\u0026prime;- TCGC\u003cu\u003eGGATCC\u003c/u\u003eAAAATGGCTACATCTGCTAGAAG -3\u0026prime; and 5\u0026prime;- ATGG\u003cu\u003eCTCGAG\u003c/u\u003eGTAATCTTCCGGAGCCAAT -3\u0026prime; (the underlined sequences are restriction enzyme sites for \u003cem\u003eBamH\u003c/em\u003eI and \u003cem\u003eXho\u003c/em\u003eI, respectively), and then cloned in frame with the 5\u0026rsquo; end of the GFP coding region in the pGPTV.GFP.Bar vector. The resulting TIP3;2-GFP construct was then transformed into \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e strain GV3101, followed by transiently transformed into the tobacco leaves by infiltration. The vacuolar membrane marker 35S::TIP1;1-RFP (vac-rk-CD3-975) was as described in Nelson et al. [39]. GFP signals were observed with a Leica SP5 confocal laser microscope.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA Isolation and Quantitative Real-time RT-qPCR\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTotal RNAs were extracted from Arabidopsis root, stem, shoot or seed using the RNeasy Mini Kit (Qiagen) following the manufacturer\u0026rsquo;s instruction and according to previously described [32]. The relative expression levels of the target genes were referred to an endogenous calibrator gene, 18S rRNA, for each RT-qPCR experiment. The sequences of real-time primers for \u003cem\u003eTIP2;2\u003c/em\u003e are: 5\u0026rsquo;-AGTACATGATCATCCCCAG-3\u0026rsquo; and 5\u0026rsquo;-CATAGGAAATGGCAGGAAAAC-3\u0026rsquo;.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRoot and Shoot Ni Content Measurement\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSeven-day-old seedlings of the indicated lines were cultured in a hydroponic\u0026nbsp;solution (pH 6.5) with or without the supplement of 0.5 or 50 \u0026mu;M NiCl2 for 24h. Plant samples were harvested and processed according to previous paper [36]. Elements of each sample were analyzed with ICP-MS (inductively coupled plasma mass spectrometry). Three biological replicates for each treatment were made.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Sap and Cell Wall Preparation and Ni Content Determination\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFollowing a 24-h treatment with 0.5 or 50 \u0026mu;M NiCl\u003csub\u003e2\u003c/sub\u003e (pH 6.5), roots or shoots were excised. The collection and analysis procedures were detailed by Wang et al [36]. Nickel contents in the samples were analyzed by ICP-MS.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCollection and Analysis of Xylem Sap\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSix weeks old seedlings were subjected to 0.5 or 50 \u0026mu;M NiCl\u003csub\u003e2\u003c/sub\u003e treatment for 24h. Xylem sap collection followed the previous procedures [36]. ICP-MS was used to determine the Ni and K concentrations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTrichome Isolation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTrichomes were collected and processed according to the methodology outlined in a previous paper [36]. Ni content in the trichomes were analyzed by ICP-MS.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eYeast Ni Sensitivity Analysis.\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe coding sequence of TIP3;2 was amplified with the primers：5\u0026rsquo;-TCGC\u003cu\u003eGGATCC\u003c/u\u003eAAAATGGCTACATCTGCTAGAAG-3\u0026rsquo; and 5\u0026rsquo;-\u0026nbsp;ATCC\u003cu\u003eGCGGCCGC\u003c/u\u003eGTAATCTTCCGGAGCCAAT-3\u0026rsquo; (the underlined sequences are restriction enzyme sites for \u003cem\u003eBamH\u003c/em\u003e I and \u003cem\u003eNot\u0026nbsp;\u003c/em\u003eI, respectively). The PCR fragments were ligated to the corresponding restriction sites of the pYES2-GFP vector [37]. Yeast cells expressing the pYES2-TIP3;2-GFP construct were observed under a Leica SP5 confocal laser microscope.\u003c/p\u003e\n\u003cp\u003eFor Ni sensitivity evaluation, the TIP3;2 CDS fragment was obtained through PCR with primers: 5\u0026rsquo;-TCGC\u003cu\u003eGGATCC\u003c/u\u003eAAAATGGCTACATCTGCTAGAAG-3\u0026rsquo; and 5\u0026rsquo;-\u0026nbsp;ATCC\u003cu\u003eGCGGCCGC\u003c/u\u003eCTAGTAATCTTCCGGAGCCAAT-3\u0026rsquo;, and subcloned into the pYES2 vector at \u003cem\u003eBamH\u003c/em\u003e I and \u003cem\u003eNot\u003c/em\u003e I sites. The pYES2-TIP3;2 plasmid was transformed into yeast BY4741 cells. Three independent yeast BY4741 lines, containing the pYES2 empty vector, or pYES2-TIP3;2 plasmid, were selected and cultivated overnight in an SD-Ura medium (+2% glucose). Then, the cultures were centrifuged for 5 min (at 5000 g), and resuspended in the SD-Ura medium with 2% galactose and cultured overnight. After sequential 10-fold dilutions, 10 \u0026mu;l of cell suspensions were spotted on SD-Ura plates with different Ni concentration, and incubated at 30 ℃ for 3 days.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCreation of NIP1;2\u003csup\u003e1-30\u003c/sup\u003e::TIP3;2\u003csup\u003e31-268\u003c/sup\u003e fusion protein and uptake assays in yeast.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo create NIP1;2\u003csup\u003e1-30\u003c/sup\u003e::TIP3;2\u003csup\u003e31-268\u003c/sup\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e fusion protein, the 1-150 nucleotide from ATG of TIP3;2 gene was replaced by NIP1;2 gene\u0026rsquo;s 1-150 nucleotide with infusion PCR, the first PCR primer pairs are (1) 5\u0026rsquo;-CTACggatccAAAATGGCGGAGATCTCGGGAAA-3\u0026rsquo; \u0026nbsp;and 5\u0026rsquo;-GTGAGCCGCCGTGTCCCAATAGAAAGGGACAGAGATAGAGAG-3\u0026rsquo; and (2) 5\u0026rsquo;-TATTGGGACACGGCGGCTCAC-3\u0026rsquo; and 5\u0026rsquo;-ATCCgcggccgcGTAATCTTCCGGAGCCAAT-3\u0026rsquo; , using plasmid as template which contains NIP1;2 or TIP3;2 CDS respectively. The second PCR was performed with primer pair: 5\u0026rsquo;-CTAC\u003cu\u003eGGATCC\u003c/u\u003eAAAATGGCGGAGATCTCGGGAAA-3\u0026rsquo; and 5\u0026rsquo;-ATCC\u003cu\u003eGCGGCCGC\u003c/u\u003eGTAATCTTCCGGAGCCAAT-3\u0026rsquo;, (the underlined sequences are restriction enzyme sites for \u003cem\u003eBamH\u003c/em\u003e I and\u003cem\u003e\u0026nbsp;Not\u003c/em\u003e I, respectively), the first PCR products are as template. Then, the individual PCR fragments were sub-cloned into the \u003cem\u003eBamH\u003c/em\u003e I and the \u003cem\u003eNot\u003c/em\u003e I restriction sites in frame with the 5\u0026rsquo; end of the GFP coding region in the pYES2-GFP construct. The resulting pYES2- NIP1;2\u003csup\u003e1-30\u003c/sup\u003e::TIP3;2\u003csup\u003e31-268\u003c/sup\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e-GFP construct was transformed into yeast strain BY4741, and observed with a Leica SP5 confocal laser microscope.\u003c/p\u003e\n\u003cp\u003eThe yeast lines with \u003cem\u003epYES2-GFP\u003c/em\u003e and \u003cem\u003epYES2- NIP1;2\u003csup\u003e1-30\u003c/sup\u003e::TIP3;2\u003csup\u003e31-268\u003c/sup\u003e\u003c/em\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cem\u003e-GFP\u003c/em\u003e were inoculated in an SC-Ura medium\u0026nbsp;containing 2% galactose and grown at 30 ℃ to a mid-exponential phase. Then, the precultured yeast cells were resuspended at OD600 = 3.0 in the uptake medium, i.e., the SC-Ura medium supplemented with different possible transport substrates at final concentrations of 0 or 20 \u0026micro;M NiCl\u003csub\u003e2\u003c/sub\u003e: 40 \u0026micro;M ligands. The Ni-ligands tested included Ni-Citrate, Ni-Malate, Ni-Nicotinamide, Ni-glutathione, Ni-phytochelatin, Ni- metallothionein.\u003c/p\u003e\n\u003cp\u003eAfter incubation in the uptake media for 4 h, yeast cells were harvested and washed three times with deionized water and dried in a 55℃oven for 2 days.. The Ni concentrations were determined by ICP-MS. Three biological replicates for each line and each treatment were conducted.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003etip3;2\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;Mutants\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eAre Sensitive Specifically to Ni Stress.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGiven the reported involvement of aquaporins in the transport of B, As, Sb, and Al, we investigated a potential role in Ni tolerance. We screened T-DNA insertion mutant lines for nine Arabidopsis \u003cem\u003eTIP\u003c/em\u003e genes under Ni stress, obtained from the Arabidopsis Biological Resource Center (ABRC). Two independent \u003cem\u003eTIP3;2\u003c/em\u003e (At1g17810) T-DNA lines, \u003cem\u003etip3;2\u003c/em\u003e-1 (SALK_091612, intronic insertion) and \u003cem\u003etip3;2\u003c/em\u003e-2 (SALK_125353, exonic insertion), exhibited significantly reduced \u003cem\u003eTIP3;2\u003c/em\u003e transcript levels by real-time quantitative RT-PCR (qRT-PCR) (Figure 1D), and showed hypersensitivity to a range of Ni concentrations (Figure 1 A\u0026ndash;C). These results suggest that \u003cem\u003eTIP3;2\u003c/em\u003e contributes to Ni tolerance in \u003cem\u003eArabidopsis\u003c/em\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo assess specificity, we compared the sensitivity of wild-type and tip3;2 mutants to other toxic metals, including Cd, Al, Zn, Cu and Mn. No difference in sensitivity were observed for Cd (6 \u0026micro;M), Al (20\u0026nbsp;\u0026micro;M), Zn (60\u0026nbsp;\u0026micro;M), Cu (5\u0026nbsp;\u0026micro;M) or Mn (200 \u0026micro;M) between WT and mutants (Supplemental Figure 1). These results indicate that the mutant phenotype is specific to Ni stress.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eTIP3;2\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;Expression is Induced by Ni\u003c/strong\u003e\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSpecificity of \u003cem\u003eTIP3;2\u003c/em\u003e expression was examined via \u003cem\u003eTIP3;2\u003c/em\u003e promoter \u0026beta;-glucuronidase (GUS) analysis in transgenic Arabidopsis plants. GUS activity was consistently observed in roots, trichomes of the leaf and stem, and hydathode (Figure 2A-E). qRT-PCR analyses found \u003cem\u003eTIP3;2\u003c/em\u003e expression mainly in the root, stem, shoot, but barely in the seed (Figure 3A). Time-course qRT-PCR analyses indicated that \u003cem\u003eTIP3;2\u003c/em\u003e expression in the root was up-regulated rapidly and peaked with a 3.8-fold increase after 6 h of Ni treatment (Figure 3B). After 6 h treatments with different Ni concentrations, \u003cem\u003eTIP3;2\u003c/em\u003e expression showed a concentration-dependent pattern (Figure 3C). In addition, \u003cem\u003eTIP3;2\u003c/em\u003e expression was explicitly induced by Ni stress, but not by other toxic metal ions, including Cd\u003csup\u003e2+\u003c/sup\u003e, Al\u003csup\u003e3+\u003c/sup\u003e, Zn\u003csup\u003e2+\u003c/sup\u003e, Cu\u003csup\u003e2+\u003c/sup\u003e and Mn\u003csup\u003e2\u003c/sup\u003e\u003csup\u003e+\u003c/sup\u003e (Figure 3D).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTIP3;2\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eis Localized to the Tonoplast\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo determine subcellular localization, the \u003cem\u003eTIP3;2\u003c/em\u003e cDNA was fused with the GFP gene and the TIP3;2::GFP protein was transiently express in in \u003cem\u003eNicotiana benthamiana\u003c/em\u003e epidermal cells. Fluorescence was consistently observed on the inner side of the chloroplast autofluorescence, and associated with transvacuolar strands (indicated by the blue arrows in Figure 4), which are cytoplasmic tunnels bounded by the tonoplast [40, 41], suggesting that TIP3;2 was confined to the vacuolar membrane. The tonoplast localization was confirmed by co-expression of the TIP3;2::GFP fusion protein in \u003cem\u003eN. benthamiana\u003c/em\u003e with a vacuolar membrane marker protein, TIP1;1-RFP (vac-rk-CD3-975) [42]. The vac-rk protein was tagged with the mCherry fluorophore, which allows signals from both fluorophores to be detected in the same cell. Fluorescence from the vac-rk control was detected at the tonoplast of \u003cem\u003eN. benthamiana\u003c/em\u003e cells and overlapped with signals from TIP3;2::GFP (Figure 4).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTIP3;2 Affects Ni Homoeostasis in Arabidopsis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNi accumulation in WT and \u003cem\u003etip3;2\u003c/em\u003e mutants was examined by inductively coupled plasma mass spectrometry (ICP-MS). When plants were grown in control medium (containing 0.5 \u0026mu;M Ni), no difference in Ni content was observed between \u003cem\u003etip3;2\u003c/em\u003e mutants and wild type. However, under 50 \u0026mu;M Ni stress, while the root cell wall Ni content was similar between genotypes (Figure 5A), the Ni concentrations in the root cell sap (primarily vacuolar contents [43]) was significantly lower in the mutants (Figure 5B). Given the tonoplast localization of TIP3;2, these results suggest its involvement in sequestration Ni from cytoplasm inti the vacuole.\u003c/p\u003e\n\u003cp\u003eGiven the loss of TIP3;2 function, Ni in root is less sequestered in the vacuole and may be translocated to the shoot via transpiration flow. We further tested the Ni concentration in xylem sap, roots and shoots. The results suggested that TIP3;2 knockout increased Ni concentration in the xylem sap (Figure 5E), and mutant lines contained more Ni in shoots (Figure 5D), and less Ni in roots (Figure 5C) than WT. There are no differences in Fe, Mn, Cu, and Zn content between WT and mutant lines (Supplemental Figure 2).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIt is well known that the trichomes play an important role in plant ion and metal homeostasis, one of the important functions is sequestration and compartmentalization of heavy metals. As \u003cem\u003eTIP3;2\u003c/em\u003e is also expressed in trichome and hydathodes, the \u003cem\u003etip3;2\u003c/em\u003e mutants contained obviously less Ni in trichomes under excess Ni condition than that in WT (Figure 5F). Collectively, these results indicate that TIP3;2 functions to sequester Ni into root vacuoles, limiting its translocation to shoots, and may also facilitate Ni sequestration into trichomes or its secretion via hydathodes for detoxification.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHeterologous Expression of TIP3;2 enhanced Yeast Ni tolerance\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWhen expressed in yeast, a TIP3;2::GFP fusion protein was localized to the vacuolar membrane, as observed under a confocal microscope (Figure 6A). To test the function of TIP3;2 to Ni tolerance, we transferred \u003cem\u003epYES2\u003c/em\u003e empty vector and \u003cem\u003epYES2-TIP3;2\u003c/em\u003e to wild type (BY4741) yeast strains. We then compared the Ni stress tolerance of the transformed yeast lines using a drop assay. In the absence of Ni, the growth of yeast cells expressing TIP3;2 was similar to that of the vector control (Figure 6B). However, in the presence of Ni, growth of both the vector control and TIP3;2-expressing yeast cells\u0026nbsp;was inhibited, with the vector control showing greater inhibition than the TIP3;2-expressing yeast cells, across all tested Ni concentration (Figure 6B). These results suggest that TIP3;2 functions to sequester Ni into the vacuoles, thereby enhancing Ni tolerance in yeast.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTIP3;2 Facilitates the Uptake of Nickel-Phytochelatin Complexes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the cytosol (pH 7.0\u0026ndash;7.5), ionic metal is mostly chelated by ligands such as malate, citrate, GSH, MT, etc. [44]. Therefore, TIP3;2 might transport Ni in complexed form from the cytosol to the vacuole. However, since TIP3;2 is not localized to the plasma membrane in the yeast expression system, determining its transport form is challenging. To address this ,we engineered an NIP1;2\u003csup\u003e1-30\u003c/sup\u003e::TIP3;2\u003csup\u003e31-268\u003c/sup\u003e fusion protein by replacing the first 30 amino acids of TIP3;2 with those of NIP1;2, which is known to be localized to the plasma membrane[30]. The initial 30 amino acids may contain the signal peptide to the plasma membrane and lack the key NPA and ar/R motifs of aquaporin. When such a fusion protein was expressed in yeast cells, the GFP signal partially colocalized with red CellMask PM Staining (Thermo Fisher Scientific) at the plasma membrane (Figure 7A), allowing us to determine the transport form of TIP3;2.\u003c/p\u003e\n\u003cp\u003eWe conducted a short-term (4 h) Ni uptake assay on yeast lines (BY4741) carrying the \u003cem\u003epYES2-GFP\u003c/em\u003e or \u003cem\u003epYES2-NIP1;2\u003csup\u003e1-30\u003c/sup\u003e::TIP3;2\u003csup\u003e31-268\u003c/sup\u003e-GFP\u003c/em\u003e construct in the presence of Ni\u003csup\u003e2+\u003c/sup\u003e or Ni\u003csup\u003e2+\u003c/sup\u003e conjugated with different cellular ligands, such as citrate (Cit), malate (Mal), nicotinamide (NA), glutathione (GSH), phytochelatin (PC), and metallothionein (MT) (Figure 7B). Compared with the control line (\u003cem\u003epYES2-GFP\u003c/em\u003e), the \u003cem\u003epYES2-NIP1;2\u003csup\u003e1-30\u003c/sup\u003e::TIP3;2\u003csup\u003e31-268\u003c/sup\u003e-GFP\u003c/em\u003e line showed significantly enhanced Ni uptake activities in the presence of the Ni-PC conjugated complex, but not with other Ni-ligands (Figure 7B). This result suggests that the Ni-PC complex could be a transport substrate for TIP3;2.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e\u003cstrong\u003eTIP3;2 is Probably a Nickel Transporter\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAquaporins have evolved beyond their canonical role in water transport to facilitate the movement of various small, neutral solutes and, as increasingly evidenced, charged metal complexes, such as B, As, glycerol, Al-malate complexes, and Zn complexes [29, 30, 36, 45]. Our study adds significant weight to this paradigm shift by implicating TIP3;2, a member of the tonoplast intrinsic protein (TIP) subfamily [46], in Ni transport. The hypersensitivity of two independent tip3;2 mutants to Ni stress (Figure 1A\u0026ndash;C), coupled with the specific Ni-induced upregulation of TIP3;2 expression (Figure 3B, D), provides strong genetic evidence for its dedicated role in Ni detoxification, distinct from responses to other heavy metals like Cd, Al, or Zn.\u003c/p\u003e\n\u003cp\u003eThe tonoplast localization of TIP3;2 (Figure 4) directs its function to a critical cellular compartment for metal homeostasis. The central vacuole, occupying 30\u0026ndash;90% of a plant cell\u0026rsquo;s volume [47], serves as a primary storage and detoxification site, sequestering excess heavy metals, including Ni, to protect the cytosolic machinery [48]. Our physiological data align perfectly with this model: \u003cem\u003etip3;2\u003c/em\u003e mutants exhibit reduced Ni accumulation in root cell sap (vacuolar content) but increased Ni in the xylem and shoots (Figure 5B-E). Supporting this hypothesis, heterologous expression of TIP3;2 in yeast resulted in enhanced Ni resistance (Figure 6B), with the protein correctly localizing to the tonoplast (Figure 6A). This phenotype mirrors that of other tonoplast metal transporters, such as AtTIP2;2 for Zn [36], suggesting a conserved functional logic within the TIP subfamily for vacuolar metal sequestration.\u003c/p\u003e\n\u003cp\u003eCrucially, our heterologous expression studies in yeast provide direct functional support. The enhanced Ni tolerance conferred by TIP3;2 (Figure 6B) confirms its capacity to mediate cellular detoxification. Furthermore, the innovative plasma membrane-targeting strategy via the NIP1;2\u003csup\u003e1-30\u003c/sup\u003e::TIP3;2\u003csup\u003e31-268\u003c/sup\u003e fusion was instrumental in identifying the putative transport substrate. The specific enhancement of Ni uptake only in the presence of Ni-phytochelatin (Ni-PC) complexes (Figure 7B) suggests that TIP3;2 likely transports Ni in a chelated form. This result is physiologically highly plausible, as PCs are rapidly synthesized under heavy metal stress and are key ligands for vacuolar sequestration [49, 50]. This finding positions TIP3;2 as a potential missing link in the PC-dependent detoxification pathway, specifically responsible for the tonoplast transport step of the Ni-PC complex into the vacuole.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe Integrated Role of TIP3;2 in Nickel Tolerance: from Root Sequestration to Shoot Detoxification\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur results paint a comprehensive picture of how TIP3;2 orchestrates Ni tolerance at the whole-plant level. Its function begins in the root, where high expression in the elongation and hair zones (Figure 2) positions it to intercept Ni entering the symplast. By actively pumping Ni into root vacuoles, TIP3;2 performs a dual function: it directly protects root cell metabolism and acts as a \u0026ldquo;checkpoint\u0026rdquo; that limits the amount of Ni entering the xylem stream for shoot translocation. This strategy explains the classic tolerance mechanism of reduced translocation observed in many non-hyperaccumulators [51, 52]. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHowever, TIP3;2\u0026apos;s role extends beyond root containment. Its expression in leaf and stem trichomes (Figure 2B-D) and the concomitant reduction of Ni in \u003cem\u003etip3;2\u003c/em\u003e mutant trichomes (Figure 5F) reveal a secondary, shoot-based detoxification layer. Trichomes function as external metabolic sinks, and their ability to sequester metals is a well-documented tolerance trait [53]. TIP3;2 may facilitate the loading of Ni (likely as a complex) into trichome vacuoles, providing a final line of defense by isolating the metal from mesophyll cells. This role is particularly significant, given that the mutants had higher total shoot Ni but lower trichome Ni, indicating that TIP3;2 is essential for redirecting and safely storing the Ni that does reach the shoot.\u003c/p\u003e\n\u003cp\u003eThe expression of \u003cem\u003eTIP3;2\u003c/em\u003e in hydathodes adds a fascinating potential third mechanism (Figure 2B-C). Guttation fluid can contain heavy metals, suggesting a secretory detoxification route. TIP3;2 could be involved in loading Ni into this fluid, effectively excreting it from the plant. This multi-compartmental strategy\u0026mdash;root vacuole sequestration, trichome storage, and possible hydathode secretion\u0026mdash;underscores the sophisticated, tiered adaptation plants employ against metal stress, with TIP3;2 emerging as a central player in this network.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBroader Implications and Future Perspectives\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe identification of TIP3;2 has important implications. First, it challenges the strict definition of aquaporin substrates and encourages re-examination of other TIPs, and indeed NIPs, for roles in heavy metal transport. The mechanistic parallel with Al detoxification via AtNIP1;2 (Al-malate) and OsNIP1;2/OsTIP2;1 [30, 37, 38] suggests a potential common theme where aquaporins handle metal-ligand complexes.\u003c/p\u003e\n\u003cp\u003eSecond, from a phytoremediation perspective, our findings open new avenues. While hyperaccumulators like \u003cem\u003eAlyssum\u003c/em\u003e species use specific ligands (e.g., histidine) and transporters (e.g., YSL families) for Ni xylem loading and shoot accumulation [52], our work identifies a key vacuolar transporter for Ni in a non-hyperaccumulator. Engineering or overexpressing \u003cem\u003eTIP3;2\u003c/em\u003e in high-biomass plants, perhaps in conjunction with enhanced PC synthesis, could improve root storage capacity, reducing food chain contamination. Conversely, silencing homologous genes in hyperaccumulators might alter their metal partitioning.\u003c/p\u003e\n\u003cp\u003eFuture work should focus on several key questions: (1) Directly confirming the Ni-PC transport activity of TIP3;2 in planta using tonoplast vesicle transport assays. (2) Identifying the protein interactors that might regulate TIP3;2 activity or target it to specific membrane microdomains. (3) Exploring whether TIP3;2 orthologs in crop species like rice or soybean share this function, which would be critical for breeding or engineering metal-tolerant cultivars. By elucidating the role of TIP3;2, this study not only advances our understanding of fundamental plant metal homeostasis but also provides a promising genetic tool for addressing agricultural and environmental challenges posed by nickel pollution.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study establishes a critical role for the tonoplast-localized aquaporin TIP3;2 in nickel detoxification in Arabidopsis. We demonstrate that TIP3;2 expression is specifically induced by Ni stress. Functional loss in \u003cem\u003etip3;2\u003c/em\u003e mutants results in hypersensitivity to Ni, disrupted root-to-shoot partitioning (with reduced root vacuolar sequestration and increased shoot accumulation), and impaired Ni deposition in leaf trichomes. The enhanced Ni tolerance conferred by heterologous TIP3;2 expression in yeast, coupled with evidence suggesting it transports Ni-phytochelatin complexes, reinforces its direct role in Ni transport. Overall, our findings identify TIP3;2 as a key component of the cellular machinery that regulates Ni homeostasis and tolerance in plants.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eNi : Nickel ; TIP: Tonoplast Intrinsic Protein ; AQP : Aquaporin ; NPA : Asparagine-Proline-Alanine ; ar/R : Aromatic/arginine ; PC: Phytochelatin ; Cit : Citrate ; Mal : Malate; Nic: Nicotinamide; Glu: Glutathione ; MT : Metallothionein ; GFP: Green Fluorescent Protein; GUS: \u0026beta;‑Glucuronidase.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by a grant from the National Natural Science Foundation of China (32572256, 32272023).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor\u0026rsquo;s contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eY.W. conceived and supervised the research. Y.W. and K.X. designed the experiments. Y.-M.F., W.‑Y.Z., W.-J.Z., M.-Y.W., and B.-X.L. performed the experiments and analyzed the results. Y.W. and K.X. wrote the paper. All authors have read and approved the final manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by a grant from the National Natural Science Foundation of China (32572256, 32272023) to Y.W.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and analyzed during the current study are included in this article and its supplementary files. The TIP3;2 (AT1G17810) DNA sequence data referenced in this study were available at the NCBI (National Center for Biotechnology Information) GenBank database, the Gene ID is 838359, Transcript accession number is NM_101644.3, and Protein accession number is NP_173223.1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBai C, Reilly CC, Wood BW: \u003cstrong\u003eNickel Deficiency Disrupts Metabolism of Ureides, Amino Acids, and Organic Acids of Young Pecan Foliage\u003c/strong\u003e. \u003cem\u003ePlant Physiology \u003c/em\u003e2006, \u003cstrong\u003e140\u003c/strong\u003e(2):433-443.\u003c/li\u003e\n\u003cli\u003eHarish, Sundaramoorthy S, Kumar D, Vaijapurkar SG: \u003cstrong\u003eA new chlorophycean nickel hyperaccumulator\u003c/strong\u003e. \u003cem\u003eBioresour Technol \u003c/em\u003e2008, \u003cstrong\u003e99\u003c/strong\u003e(9):3930-3934.\u003c/li\u003e\n\u003cli\u003eHassan MU, Chattha MU, Khan I, Chattha MB, Aamer M, Nawaz M, Ali A, Khan MAU, Khan TA: \u003cstrong\u003eNickel toxicity in plants: reasons, toxic effects, tolerance mechanisms, and remediation possibilities\u0026mdash;a review\u003c/strong\u003e. \u003cem\u003eEnvironmental Science and Pollution Research \u003c/em\u003e2019, \u003cstrong\u003e26\u003c/strong\u003e(13):12673-12688.\u003c/li\u003e\n\u003cli\u003eAqeel M, Khalid N, Tufail A, Ahmad RZ, Akhter MS, Luqman M, Javed MT, Irshad MK, Alamri S, Hashem M\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eElucidating the distinct interactive impact of cadmium and nickel on growth, photosynthesis, metal-homeostasis, and yield responses of mung bean (Vigna radiata L.) varieties\u003c/strong\u003e. \u003cem\u003eEnvironmental Science and Pollution Research \u003c/em\u003e2021, \u003cstrong\u003e28\u003c/strong\u003e(21):27376-27390.\u003c/li\u003e\n\u003cli\u003eKumar S, Wang M, Liu Y, Fahad S, Qayyum A, Jadoon SA, Chen Y, Zhu G: \u003cstrong\u003eNickel toxicity alters growth patterns and induces oxidative stress response in sweetpotato\u003c/strong\u003e. \u003cem\u003eFrontiers in Plant Science \u003c/em\u003e2022, \u003cstrong\u003e13\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eLabidi O, Kouki R, Hidouri S, Bouzahouane H, Ca\u0026ccedil;ador I, P\u0026eacute;rez-Clemente RM, Sleimi N: \u003cstrong\u003eImpact of Nickel Toxicity on Growth, Fruit Quality and Antioxidant Response in Zucchini Squash (Cucurbita pepo L.)\u003c/strong\u003e. \u003cem\u003ePlants \u003c/em\u003e2024, \u003cstrong\u003e13\u003c/strong\u003e(17).\u003c/li\u003e\n\u003cli\u003eKumar A, Jigyasu DK, Kumar A, Subrahmanyam G, Mondal R, Shabnam AA, Cabral-Pinto MMS, Malyan SK, Chaturvedi AK, Gupta DK\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eNickel in terrestrial biota: Comprehensive review on contamination, toxicity, tolerance and its remediation approaches\u003c/strong\u003e. \u003cem\u003eChemosphere \u003c/em\u003e2021, \u003cstrong\u003e275\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eRizwan M, Imtiaz M, Dai Z, Mehmood S, Adeel M, Liu J, Tu S: \u003cstrong\u003eNickel stressed responses of rice in Ni subcellular distribution, antioxidant production, and osmolyte accumulation\u003c/strong\u003e. \u003cem\u003eEnvironmental Science and Pollution Research \u003c/em\u003e2017, \u003cstrong\u003e24\u003c/strong\u003e(25):20587-20598.\u003c/li\u003e\n\u003cli\u003eMustafa A, Zulfiqar U, Mumtaz MZ, Radziemska M, Haider FU, Holatko J, Hammershmiedt T, Naveed M, Ali H, Kintl A\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eNickel (Ni) phytotoxicity and detoxification mechanisms: A review\u003c/strong\u003e. \u003cem\u003eChemosphere \u003c/em\u003e2023, \u003cstrong\u003e328\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eZambelli B, Uversky VN, Ciurli S: \u003cstrong\u003eNickel impact on human health: An intrinsic disorder perspective\u003c/strong\u003e. \u003cem\u003eBiochim Biophys Acta \u003c/em\u003e2016, \u003cstrong\u003e1864\u003c/strong\u003e(12):1714-1731.\u003c/li\u003e\n\u003cli\u003eJose CC, Jagannathan L, Tanwar VS, Zhang X, Zang C, Cuddapah S: \u003cstrong\u003eNickel exposure induces persistent mesenchymal phenotype in human lung epithelial cells through epigenetic activation of ZEB1\u003c/strong\u003e. \u003cem\u003eMol Carcinog \u003c/em\u003e2018, \u003cstrong\u003e57\u003c/strong\u003e(6):794-806.\u003c/li\u003e\n\u003cli\u003eShahzad B, Tanveer M, Rehman A, Cheema SA, Fahad S, Rehman S, Sharma A: \u003cstrong\u003eNickel; whether toxic or essential for plants and environment - A review\u003c/strong\u003e. \u003cem\u003ePlant Physiology and Biochemistry \u003c/em\u003e2018, \u003cstrong\u003e132\u003c/strong\u003e:641-651.\u003c/li\u003e\n\u003cli\u003eMustafiz A, Ghosh A, Tripathi AK, Kaur C, Ganguly AK, Bhavesh NS, Tripathi JK, Pareek A, Sopory SK, Singla‐Pareek SL: \u003cstrong\u003eA unique Ni2+ \u003c/strong\u003e\u003cstrong\u003e‐dependent and methylglyoxal‐inducible rice glyoxalase I possesses a single active site and functions in abiotic stress response\u003c/strong\u003e. \u003cem\u003eThe Plant Journal \u003c/em\u003e2014, \u003cstrong\u003e78\u003c/strong\u003e(6):951-963.\u003c/li\u003e\n\u003cli\u003eChamba-Eras I, Griffith DM, Kalinhoff C, Ram\u0026iacute;rez J, G\u0026aacute;zquez MJ: \u003cstrong\u003eNative Hyperaccumulator Plants with Differential Phytoremediation Potential in an Artisanal Gold Mine of the Ecuadorian Amazon\u003c/strong\u003e. \u003cem\u003ePlants \u003c/em\u003e2022, \u003cstrong\u003e11\u003c/strong\u003e(9).\u003c/li\u003e\n\u003cli\u003eZhang L, Zhang P, Yoza B, Liu W, Liang H: \u003cstrong\u003ePhytoremediation of metal-contaminated rare-earth mining sites using Paspalum conjugatum\u003c/strong\u003e. \u003cem\u003eChemosphere \u003c/em\u003e2020, \u003cstrong\u003e259\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eGuo K, Yan L, He Y, Li H, Lam SS, Peng W, Sonne C: \u003cstrong\u003ePhytoremediation as a potential technique for vehicle hazardous pollutants around highways\u003c/strong\u003e. \u003cem\u003eEnvironmental Pollution \u003c/em\u003e2023, \u003cstrong\u003e322\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eAntonkiewicz J, Kowalewska A, Mikołajczak S, Kołodziej B, Bryk M, Spychaj-Fabisiak E, Koliopoulos T, Babula J: \u003cstrong\u003ePhytoextraction of heavy metals after application of bottom ash and municipal sewage sludge considering the risk of environmental pollution\u003c/strong\u003e. \u003cem\u003eJournal of Environmental Management \u003c/em\u003e2022, \u003cstrong\u003e306\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eLima LHV, Ly SN, Ara\u0026uacute;jo RSRd, Nascimento JdS, Biondi CM, P\u0026eacute;rez CA, Rabelo RS, Echevarria G, van der Ent A, Nascimento CWAd: \u003cstrong\u003eTesting the Feasibility of Citric Acid-Assisted Nickel Agromining with Tropical and Temperate Hyperaccumulator Plants\u003c/strong\u003e. \u003cem\u003eACS Omega \u003c/em\u003e2025, \u003cstrong\u003e10\u003c/strong\u003e(21):22018-22027.\u003c/li\u003e\n\u003cli\u003ePan P, Lei M, Qiao P, Zhou G, Wan X, Chen T: \u003cstrong\u003ePotential of indigenous plant species for phytoremediation of metal(loid)-contaminated soil in the Baoshan mining area, China\u003c/strong\u003e. \u003cem\u003eEnvironmental Science and Pollution Research \u003c/em\u003e2019, \u003cstrong\u003e26\u003c/strong\u003e(23):23583-23592.\u003c/li\u003e\n\u003cli\u003eRazmi B, Ghasemi-Fasaei R, Ronaghi A, Mostowfizadeh-Ghalamfarsa R: \u003cstrong\u003eInvestigation of factors affecting phytoremediation of multi-elements polluted calcareous soil using Taguchi optimization\u003c/strong\u003e. \u003cem\u003eEcotoxicology and Environmental Safety \u003c/em\u003e2021, \u003cstrong\u003e207\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eEgendorf SP, Groffman P, Moore G, Cheng Z: \u003cstrong\u003eThe limits of lead (Pb) phytoextraction and possibilities of phytostabilization in contaminated soil: a critical review\u003c/strong\u003e. \u003cem\u003eInt J Phytoremediation \u003c/em\u003e2020, \u003cstrong\u003e22\u003c/strong\u003e(9):916-930.\u003c/li\u003e\n\u003cli\u003eAcharya A, Bellaloui N, Pilipovic A, Perez E, Maddox-Mandolini M, Fuente HDL: \u003cstrong\u003eCurrent Assessment and Future Perspectives on Phytoremediation of Heavy Metals\u003c/strong\u003e. \u003cem\u003ePlants \u003c/em\u003e2025, \u003cstrong\u003e14\u003c/strong\u003e(18).\u003c/li\u003e\n\u003cli\u003eVats S, Sudhakaran S, Bhardwaj A, Mandlik R, Sharma Y, Kumar S, Tripathi DK, Sonah H, Sharma TR, Deshmukh R: \u003cstrong\u003eTargeting aquaporins to alleviate hazardous metal(loid)s imposed stress in plants\u003c/strong\u003e. \u003cem\u003eJournal of Hazardous Materials \u003c/em\u003e2021, \u003cstrong\u003e408\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eBezerra-Neto JP, de Ara\u0026uacute;jo FC, Ferreira-Neto JRC, da Silva MD, Pandolfi V, Aburjaile FF, Sakamoto T, de Oliveira Silva RL, Kido EA, Barbosa Amorim LL\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003ePlant Aquaporins: Diversity, Evolution and Biotechnological Applications\u003c/strong\u003e. \u003cem\u003eCurr Protein Peptide Sci \u003c/em\u003e2019, \u003cstrong\u003e20\u003c/strong\u003e(4):368-395.\u003c/li\u003e\n\u003cli\u003eMaurel C, Verdoucq L, Luu D-T, Santoni V: \u003cstrong\u003ePlant Aquaporins: Membrane Channels with Multiple Integrated Functions\u003c/strong\u003e. \u003cem\u003eAnnual Review of Plant Biology \u003c/em\u003e2008, \u003cstrong\u003e59\u003c/strong\u003e(1):595-624.\u003c/li\u003e\n\u003cli\u003eVerdoucq L, Maurel C: \u003cstrong\u003ePlant Aquaporins\u003c/strong\u003e. In: \u003cem\u003eMembrane Transport in Plants.\u003c/em\u003e 2018: 25-56.\u003c/li\u003e\n\u003cli\u003eMaurel C, Boursiac Y, Luu D-T, Santoni V, Shahzad Z, Verdoucq L: \u003cstrong\u003eAquaporins in Plants\u003c/strong\u003e. \u003cem\u003ePhysiological Reviews \u003c/em\u003e2015, \u003cstrong\u003e95\u003c/strong\u003e(4):1321-1358.\u003c/li\u003e\n\u003cli\u003eMaurel C: \u003cstrong\u003ePlant aquaporins: Novel functions and regulation properties\u003c/strong\u003e. \u003cem\u003eFEBS Letters \u003c/em\u003e2007, \u003cstrong\u003e581\u003c/strong\u003e(12):2227-2236.\u003c/li\u003e\n\u003cli\u003eTyerman SD, McGaughey SA, Qiu J, Yool AJ, Byrt CS: \u003cstrong\u003eAdaptable and Multifunctional Ion-Conducting Aquaporins\u003c/strong\u003e. \u003cem\u003eAnnual Review of Plant Biology \u003c/em\u003e2021, \u003cstrong\u003e72\u003c/strong\u003e(1):703-736.\u003c/li\u003e\n\u003cli\u003eWang Y, Li R, Li D, Jia X, Zhou D, Li J, Lyi SM, Hou S, Huang Y, Kochian LV\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eNIP1;2 is a plasma membrane-localized transporter mediating aluminum uptake, translocation, and tolerance in Arabidopsis\u003c/strong\u003e. \u003cem\u003eProceedings of the National Academy of Sciences \u003c/em\u003e2017, \u003cstrong\u003e114\u003c/strong\u003e(19):5047-5052.\u003c/li\u003e\n\u003cli\u003eWang Y, Cai Y, Cao Y, Liu J: \u003cstrong\u003eAluminum-activated root malate and citrate exudation is independent of NIP1;2-facilitated root-cell-wall aluminum removal in Arabidopsis\u003c/strong\u003e. \u003cem\u003ePlant Signaling \u0026amp; Behavior \u003c/em\u003e2018, \u003cstrong\u003e13\u003c/strong\u003e(1).\u003c/li\u003e\n\u003cli\u003eWang Y, Yu W, Cao Y, Cai Y, Lyi SM, Wu W, Kang Y, Liang C, Liu J: \u003cstrong\u003eAn exclusion mechanism is epistatic to an internal detoxification mechanism in aluminum resistance in Arabidopsis\u003c/strong\u003e. \u003cem\u003eBMC Plant Biology \u003c/em\u003e2020, \u003cstrong\u003e20\u003c/strong\u003e(1):122.\u003c/li\u003e\n\u003cli\u003eSivaguru M, Liu J, Kochian LV: \u003cstrong\u003eTargeted expression of SbMATE in the root distal transition zone is responsible for sorghum aluminum resistance\u003c/strong\u003e. \u003cem\u003eThe Plant Journal \u003c/em\u003e2013, \u003cstrong\u003e76\u003c/strong\u003e(2):297-307.\u003c/li\u003e\n\u003cli\u003eYang JL, Zhu XF, Peng YX, Zheng C, Li GX, Liu Y, Shi YZ, Zheng SJ: \u003cstrong\u003eCell Wall Hemicellulose Contributes Significantly to Aluminum Adsorption and Root Growth in Arabidopsis\u003c/strong\u003e. \u003cem\u003ePlant Physiology \u003c/em\u003e2011, \u003cstrong\u003e155\u003c/strong\u003e(4):1885-1892.\u003c/li\u003e\n\u003cli\u003eZhou D, Yang Y, Zhang J, Jiang F, Craft E, Thannhauser TW, Kochian LV, Liu J: \u003cstrong\u003eQuantitative iTRAQ Proteomics Revealed Possible Roles for Antioxidant Proteins in Sorghum Aluminum Tolerance\u003c/strong\u003e. \u003cem\u003eFrontiers in Plant Science \u003c/em\u003e2017, \u003cstrong\u003e7\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eWang Y, Kang Y, Yu W, Lyi SM, Choi HW, Xiao E, Li L, Klessig DF, Liu J: \u003cstrong\u003eAtTIP2;2 facilitates resistance to zinc toxicity via promoting zinc immobilization in the root and limiting root-to-shoot zinc translocation in Arabidopsis thaliana\u003c/strong\u003e. \u003cem\u003eEcotoxicology and Environmental Safety \u003c/em\u003e2022, \u003cstrong\u003e233\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eWang Y, Yang S, Li C, Hu T, Hou S, Bai Q, Ji X, Xu F, Guo C, Huang M\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eThe plasma membrane-localized OsNIP1;2 mediates internal aluminum detoxification in rice\u003c/strong\u003e. \u003cem\u003eFrontiers in Plant Science \u003c/em\u003e2022, \u003cstrong\u003e13\u003c/strong\u003e:970270.\u003c/li\u003e\n\u003cli\u003eZhang W, Yang S, Feng Y, Liang B, Li C, Li Q, Zeng Z, Ji X, Liu J, Wang Y: \u003cstrong\u003eThe tonoplast-localized OsTIP2;1 is involved in aluminum detoxification in rice\u003c/strong\u003e. \u003cem\u003ePlant Physiology and Biochemistry \u003c/em\u003e2024, \u003cstrong\u003e215\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eNelson BK, Cai X, Nebenfuhr A: \u003cstrong\u003eA multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis and other plants\u003c/strong\u003e. \u003cem\u003ePlant J \u003c/em\u003e2007, \u003cstrong\u003e51\u003c/strong\u003e(6):1126-1136.\u003c/li\u003e\n\u003cli\u003eHigaki T, Kutsuna N, Okubo E, Sano T, Hasezawa S: \u003cstrong\u003eActin Microfilaments Regulate Vacuolar Structures and Dynamics: Dual Observation of Actin Microfilaments and Vacuolar Membrane in Living Tobacco BY-2 Cells\u003c/strong\u003e. \u003cem\u003ePlant and Cell Physiology \u003c/em\u003e2006, \u003cstrong\u003e47\u003c/strong\u003e(7):839-852.\u003c/li\u003e\n\u003cli\u003eRuthardt N, Gulde N, Spiegel H, Fischer R, Emans N: \u003cstrong\u003eFour-dimensional imaging of transvacuolar strand dynamics in tobacco BY-2 cells\u003c/strong\u003e. \u003cem\u003eProtoplasma \u003c/em\u003e2005, \u003cstrong\u003e225\u003c/strong\u003e(3-4):205-215.\u003c/li\u003e\n\u003cli\u003eNelson BK, Cai X, Nebenf\u0026uuml;hr A: \u003cstrong\u003eA multicolored set of in\u0026emsp;vivo organelle markers for co\u003c/strong\u003e\u003cstrong\u003e‐localization studies in Arabidopsis and other plants\u003c/strong\u003e. \u003cem\u003eThe Plant Journal \u003c/em\u003e2007, \u003cstrong\u003e51\u003c/strong\u003e(6):1126-1136.\u003c/li\u003e\n\u003cli\u003eXia J, Yamaji N, Kasai T, Ma JF: \u003cstrong\u003ePlasma membrane-localized transporter for aluminum in rice\u003c/strong\u003e. \u003cem\u003eProceedings of the National Academy of Sciences \u003c/em\u003e2010, \u003cstrong\u003e107\u003c/strong\u003e(43):18381-18385.\u003c/li\u003e\n\u003cli\u003eMa JF: \u003cstrong\u003eRole of Organic Acids in Detoxification of Aluminum in Higher Plants\u003c/strong\u003e. \u003cem\u003ePlant and Cell Physiology \u003c/em\u003e2000, \u003cstrong\u003e41\u003c/strong\u003e(4):383-390.\u003c/li\u003e\n\u003cli\u003eSingh R, Deshmukh R, Muthamilarasan M, Rani R, Prasad M: \u003cstrong\u003eVersatile roles of aquaporin in physiological processes and stress tolerance in plants.pdf\u003c/strong\u003e. \u003cem\u003ePlant Physiol Biochem \u003c/em\u003e2020, \u003cstrong\u003e149:\u003c/strong\u003e:178-189.\u003c/li\u003e\n\u003cli\u003eBansal A, Sankararamakrishnan R: \u003cstrong\u003eHomology modeling of major intrinsic proteins in rice, maize and Arabidopsis: comparative analysis of transmembrane helix association and aromatic/arginine selectivity filters\u003c/strong\u003e. \u003cem\u003eBMC Structural Biology \u003c/em\u003e2007, \u003cstrong\u003e7\u003c/strong\u003e(1):27.\u003c/li\u003e\n\u003cli\u003eShimada T, Takagi J, Ichino T, Shirakawa M, Hara-Nishimura I: \u003cstrong\u003ePlant Vacuoles\u003c/strong\u003e. \u003cem\u003eAnnual Review of Plant Biology \u003c/em\u003e2018, \u003cstrong\u003e69\u003c/strong\u003e(1):123-145.\u003c/li\u003e\n\u003cli\u003eNoor I, Sohail H, Sun J, Nawaz MA, Li G, Hasanuzzaman M, Liu J: \u003cstrong\u003eHeavy metal and metalloid toxicity in horticultural plants: Tolerance mechanism and remediation strategies\u003c/strong\u003e. \u003cem\u003eChemosphere \u003c/em\u003e2022, \u003cstrong\u003e303\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eClemens S, Kim EJ, Neumann D, JI. S: \u003cstrong\u003eTolerance to toxic metals by a gene family of phytochelatin synthases from plants and yeast.pdf\u003c/strong\u003e. \u003cem\u003eEMBO J \u003c/em\u003e1999, \u003cstrong\u003e18\u003c/strong\u003e(12):3325-3333.\u003c/li\u003e\n\u003cli\u003eLuo Y, Zhang Y, Xiong Z, Chen X, Sha A, Xiao W, Peng L, Zou L, Han J, Li Q: \u003cstrong\u003ePeptides Used for Heavy Metal Remediation: A Promising Approach\u003c/strong\u003e. \u003cem\u003eInternational Journal of Molecular Sciences \u003c/em\u003e2024, \u003cstrong\u003e25\u003c/strong\u003e(12).\u003c/li\u003e\n\u003cli\u003eKr\u0026auml;mer U, Talke IN, Hanikenne M: \u003cstrong\u003eTransition metal transport\u003c/strong\u003e. \u003cem\u003eFEBS Letters \u003c/em\u003e2007, \u003cstrong\u003e581\u003c/strong\u003e(12):2263-2272.\u003c/li\u003e\n\u003cli\u003eKr\u0026auml;mer U: \u003cstrong\u003eMetal hyperaccumulation in plants\u003c/strong\u003e. \u003cem\u003eAnnual Review of Plant Biology Annual \u003c/em\u003e2010,\u003cstrong\u003e 61\u003c/strong\u003e:517\u0026ndash;534.\u003c/li\u003e\n\u003cli\u003eSarret Gr, Harada E, Choi Y-E, Isaure M-P, Geoffroy N, Fakra S, Marcus MA, Birschwilks M, Clemens S, Manceau A: \u003cstrong\u003eTrichomes of Tobacco Excrete Zinc as Zinc-Substituted Calcium Carbonate and Other Zinc-Containing Compounds\u003c/strong\u003e. \u003cem\u003ePlant Physiology \u003c/em\u003e2006, \u003cstrong\u003e141\u003c/strong\u003e(3):1021-1034.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-plant-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pbio","sideBox":"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pbio/default.aspx","title":"BMC Plant Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Aquaporin, Heavy metal toxicity, Tonoplast intrinsic protein, Ni detoxification, Ni immobilization, Ni toxicity","lastPublishedDoi":"10.21203/rs.3.rs-9077910/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9077910/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eNickel (Ni) is a necessary trace element for plants, but excessive amounts can be harmful. To mitigate Ni toxicity, plants have evolved distinct mechanism, such as storing Ni in the vacuole or confining it to less sensitive root tissues to prevent its translocation to the vulnerable shoot tissues. Despite this, the exact mechanism of Ni immobilization remains unclear. In Arabidopsis, sequestration of excess Ni into root vacuoles is crucial for Ni immobilization, facilitated by distinct tonoplast-localized transporters. As some members of the aquaporin superfamily have been implicated in transporting both metal ions and polar, non-charged small molecules, we explored whether Arabidopsis thaliana tonoplast intrinsic proteins (TIPs) are involved in Ni immobilization and tolerance. We found that TIP3;2 helps retain excess Ni in the root, restricts its translocation to the shoot, and facilitates its accumulation in the leaf trichome. Furthermore, when TIP3;2 was expressed in yeast, its enhanced Ni resistance, suggesting that TIP3;2 plays a vital role in Ni detoxification. In addition, partial expression of TIP3;2 at yeast plasma membrane demonstrated its capability to facilitate the uptake of Ni-PC complexes into yeast cells. The results reveal a dual function for TIP3;2 in Ni detoxification and underscore the expand substrate specificity of aquaporins to include heavy-metal complexes, uncovering a new aspect of plant adaptive responses to metal stress.\u003c/p\u003e","manuscriptTitle":"TIP3;2 is a Tonoplast Transporter Contributed to Nickel Detoxification in Arabidopsis thaliana","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-23 14:43:59","doi":"10.21203/rs.3.rs-9077910/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-03-30T11:22:46+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-29T11:37:03+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-24T02:18:26+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"17230162833682278167856838916707575139","date":"2026-03-21T15:18:15+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"212792870123325157912511509985014393931","date":"2026-03-20T18:23:31+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-18T14:29:26+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-18T14:26:31+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-03-18T12:51:49+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-18T11:32:33+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Plant Biology","date":"2026-03-13T02:52:16+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-plant-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pbio","sideBox":"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pbio/default.aspx","title":"BMC Plant Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"79d14e37-7460-4db4-86fe-8300ac34c727","owner":[],"postedDate":"March 23rd, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-05T19:24:10+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-23 14:43:59","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9077910","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9077910","identity":"rs-9077910","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}