Preliminary study of the mechanism underlying how Jianshen Granules ameliorate renal failure in 5/6 nephrectomy model rats

preprint OA: closed
Full text JSON View at publisher

Abstract

Background: Chronic renal failure (CRF) is a worldwide public health concern, and at present, there are limited treatment options available. Jianshen Granules, a traditional Chinese herbal medicine, have been used clinically in the treatment of renal diseases for a large number of years in the Air Force Medical Center of the Chinese People's Liberation Army (PLA), and have shown great efficacy. In the present study, both the effectiveness and the mechanism of action of Jianshen Granules to treat CRF were investigated. Methods: : A rat model of CRF was established by 5/6 nephrectomy. Rats were administered with distilled water, Uremic Clearance Granules (UCGs), or Jianshen Granules. During the administration period, the physiological state of the rats was observed, and the biochemical parameters of interest were measured. The pathology of the kidney tissues were assessed using hematoxylin and eosin (H.E.), and Masson’s staining. In addition, the expression level of transforming growth factor‑β1 (TGF‑β1) was detected. Human kidney cells (HKC cells) were used to investigate the effects of Jianshen Granules on apoptosis induced by hydrogen peroxide (H 2 O 2 ), whereas cell viability was assessed by Cell Counting Kit‑8 (CCK‑8) assay. The level of apoptosis, the mitochondrial membrane potential (MMP), and reactive oxygen species (ROS) and Ca 2 + levels were measured using a flow cytometry. Results: : The results revealed that Jianshen Granules could reduce the levels of serum creatinine, blood urea nitrogen, alanine aminotransferase and aspartate aminotransferase, and the volume of urine in CRF rats. Renal histopathological examinations revealed that Jianshen Granules had an ameliorative effect on renal injury. In addition, Jianshen Granules led to a marked decrease in TGF‑β1 levels in CRF rats. Following treatment with Jianshen Granules, cell viability and the level of the MMP increased, whereas the levels of ROS and Ca 2+ were reduced significantly. The increased level of TGF‑β1 was detected in the H 2 O 2 ‑treated group, although this increase was attenuated by treatment with Jianshen Granules. Conclusion: Taken together, the results of the present study have shown that Jianshen Granules are able to ameliorate renal failure in CRF rats, and to inhibit apoptosis of HKC cells induced by H 2 O 2 via downregulation of TGF‑β1.
Full text 136,533 characters · extracted from preprint-html · click to expand
Preliminary study of the mechanism underlying how Jianshen Granules ameliorate renal failure in 5/6 nephrectomy model rats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research article Preliminary study of the mechanism underlying how Jianshen Granules ameliorate renal failure in 5/6 nephrectomy model rats Yan Wu, Xianxie Zhang, Jian Kong, Haiying Qiu, Hongjie Lu, Lina Du, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-18615/v2 This work is licensed under a CC BY 4.0 License Status: Posted Version 2 posted You are reading this latest preprint version Show more versions Abstract Background : Chronic renal failure (CRF) is a worldwide public health concern, and at present, there are limited treatment options available. Jianshen Granules, a traditional Chinese herbal medicine, have been used clinically in the treatment of renal diseases for a large number of years in the Air Force Medical Center of the Chinese People's Liberation Army (PLA), and have shown great efficacy. In the present study, both the effectiveness and the mechanism of action of Jianshen Granules to treat CRF were investigated. Methods: A rat model of CRF was established by 5/6 nephrectomy. Rats were administered with distilled water, Uremic Clearance Granules (UCGs), or Jianshen Granules. During the administration period, the physiological state of the rats was observed, and the biochemical parameters of interest were measured. The pathology of the kidney tissues were assessed using hematoxylin and eosin (H.E.), and Masson’s staining. In addition, the expression level of transforming growth factor‑β1 (TGF‑β1) was detected. Human kidney cells (HKC cells) were used to investigate the effects of Jianshen Granules on apoptosis induced by hydrogen peroxide (H 2 O 2 ), whereas cell viability was assessed by Cell Counting Kit‑8 (CCK‑8) assay. The level of apoptosis, the mitochondrial membrane potential (MMP), and reactive oxygen species (ROS) and Ca 2 + levels were measured using a flow cytometry. Results: The results revealed that Jianshen Granules could reduce the levels of serum creatinine, blood urea nitrogen, alanine aminotransferase and aspartate aminotransferase, and the volume of urine in CRF rats. Renal histopathological examinations revealed that Jianshen Granules had an ameliorative effect on renal injury. In addition, Jianshen Granules led to a marked decrease in TGF‑β1 levels in CRF rats. Following treatment with Jianshen Granules, cell viability and the level of the MMP increased, whereas the levels of ROS and Ca 2+ were reduced significantly. The increased level of TGF‑β1 was detected in the H 2 O 2 ‑treated group, although this increase was attenuated by treatment with Jianshen Granules. Conclusion: Taken together, the results of the present study have shown that Jianshen Granules are able to ameliorate renal failure in CRF rats, and to inhibit apoptosis of HKC cells induced by H 2 O 2 via downregulation of TGF‑β1. Urology & Nephrology antioxidant 5/6 nephrectomy chronic renal failure transforming growth factor β1 Jianshen Granule Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Background Chronic renal failure (CRF) is a well‑recognized public health problem worldwide, characterized by evidence of renal damage or dysfunction[ 1 ]. CRF is characterized by the progressive loss of renal function, chronic inflammation, oxidative stress, vascular remodeling, and glomerular and tubulointerstitial scarring[ 2 ]. CRF has also been demonstrated to increase the risk of cardiovascular disease, diabetic nephropathy, and renal osteodystrophy[ 3 , 4 ]. At the moment, kidney transplantation surgery and hemodialysis therapy are increasingly applied in clinical treatment; however, these therapies are expensive and difficult to be applied widely[ 5 ]. Furthermore, these therapies may cause inflammatory reactions and oxidative stress during the course of treatment, thereby increasing the risk of complications. Therefore, it is important for clinical practice that effective and safe alternative therapies be sought after[ 6 , 7 ]. Traditional Chinese medicine (TCM) has abundant clinical applications and has demonstrable curative effects. Renal failure ensues largely as a consequence of endocrine disorders that lead to disturbance of the microcirculation. Based on TCM theory, renal failure is due to “deficient functioning of the spleen and kidney”, "interior accumulation of dampness and turbidity", and "accumulated poison gathered in the kidney". It is characterized as one of the “consumptive diseases”[ 8 ]. Jianshen Granules, a traditional Chinese herbal medicine designed by the renowned TCM physician Dr Zhan‑min Liu, working in Air Force Medical Center of PLA , has been used clinically in the treatment of renal diseases for a large number of years in the Air Force Medical Center of the Chinese People's Liberation Army (PLA). It was approved for the production of military preparations in 2006. Jianshen Granules are composed of Radix Rehmanniae , Cornus , Poria cocos , Astragali radix, Angelica sinensis , Salvia miltiorrhiza radix, Ligusticum chuanxiong Hort, lumbricus , Honeysuckle , Fried atractylodes and Rhubarb . A clinical study conducted by the Air Force Medical Center on 61 patients with CRF revealed that the overall response rate of Jianshen Granules was 85.24%. Jianshen Granules not only enhanced recovery of the spleen and kidney, but were also demonstrated to clear stasis, promote the excretion of toxins and metabolic wastes from the body, and restore renal functions [ 9 , 10 ]. Rodent models are commonly used in preclinical CRF studies[ 11 ]. The partially nephrectomized rat model has been used extensively to investigate archetypal pathological changes in CRF[ 12 ]. Residual kidneys of nephrectomized rats often show adaptive and compensatory growth following injury, which is similar to the development of human diseases. The present study aimed to confirm the therapeutic effects, and delineate the underlying mechanism of action of, Jianshen Granules on kidney injury induced by 5/6 nephrectomy in rats, as well as effects on the damage caused to HKC cells. Methods Animals . Sprague‑Dawley ( SD) male rats, aged 8 weeks with a body weight of 180‑240 g were held at the National Beijing Center for Drug Safety Evaluation and Research. In accordance with the guidelines of the Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA), the rats were maintained under conditions of controlling temperature (<30℃), humidity (<70%), and circadian circulation for 12 h. Each rat was individually housed in a plastic cage with free access to high pressure‑treated tap‑water and standard rat food. The certificate number for the animals in these experiments was SCXK‑2012‑0004. Following the operation (see below), the activity levels of the rats and the healing of their surgical wounds were monitored daily. All experimental procedures involving the animals were performed according to the protocols approved by National Beijing Center for Drug Safety Evaluation and Research, the approval number is IACUC-2018-035. Animals groups and drug administration Animals were randomized according to their body weight and divided into 2 groups prior to surgery: Animals with sham surgery, and animals with 5/6 nephrectomy. The levels of serum creatinine (Scr) and blood urea nitrogen (BUN) were determined 2 weeks after the operation to establish whether or not the model had been successful. After confirming the model had been established successfully, the experimental rats were divided into the respective model groups: The uremic clearance granules(Cunsun Co., LTD., NeiMenggu, China ) group (UCG), Jianshen granule (produced by Youcare Pharmaceutical Group Co., LTD., Beijing, China) low‑dose group (JS‑L), Jianshen granule middle‑dose group (JS‑M), Jianshen granule high‑dose group (JS‑H), and sham operation group, with 8 rats in each group. The UCG group was given a gavage of 3.6 mg/g/day premixing solution. The dose of UCG was obtained by converting the dose of UCG in the instructions according to the dose‑ratio table of human and animal body surface area ratio in "Pharmacological Experimental Methodology". The JS‑L, JS‑M, and JS‑H groups were administered a gavage of 0.96, 1.92, and 3.84 mg/g/day premixing solution, respectively. The dose of Jianshen Granules was calculated according to clinical dose. The sham and model groups were provided with an equal volume of distilled water. Medicine was administered twice daily, and all groups received the medicine continuously over a period of 8 weeks. Induction of renal failure: subtotal nephrectomy Subtotal nephrectomy (5/6 nephrectomy) was performed in order to induce CRF. Rats were anesthetized with pentobarbital injection (i.p.), the dose of pentobarbital was 40mg/kg, and a dorsoventral incision parallel to spinal cord was made to expose the left kidney, which was then freed of connective tissue. The renal artery was ligated, and the upper and lower poles of the left kidney were cut out (2/3 nephrectomy). The cavity was closed by double sutures of muscle and skin using a non‑absorbable surgical suture once the bleeding had ceased. One week after the 2/3 nephrectomy, the right kidney was exposed and removed (i.e., 5/6 nephrectomy). In each case, benzyl penicillin was applied on sutures to prevent infections immediately following the surgery, Animals in the sham group underwent the same surgical procedure as above, except that the kidneys were not removed or cut: The kidneys were merely touched with forceps and threads. Similar post‑operative care was also administered. After the operation, rats were placed individually in cages and were granted free access to food and water. Biological detection During the administration period, the physiological state of the rats was observed, and their body weight was recorded every week. In addition, the behavior, mental state, hair, and other physiological parameters of the rats were also monitored. Serum was collected from the fundus vein every 2 weeks, heparin was used as anticoagulant, and the plasma was subsequently separated by centrifugation at 13,000 g for 10 min at 4°C. Plasma was collected and used for estimation of the sought‑after biochemical parameters, including Scr, BUN, super oxide dismutase (SOD), alanine aminotransferase (ALT) and aspartate aminotransferase (AST). The plasma biochemical index was measured using a kinetic color test (i.e., the Jaffe method using an Olympus AU400 ® clinical chemistry analyzer). Immediately before and after the 4th, the 6th and the 8th week post‑surgery, 2 ml urine sample was collected from all the groups for analysis of the level of urine protein (UPr). Subsequently, the urine volume was measured during the last week of medicine administration. A serum TGF‑β1 ELISA kit for rats (Shanghai Westang Bio‑Tech Co., Ltd; Shanghai, China) was used to determine the TGF‑β1 level in the rat serum. In a glass tissue grinder, the rat kidneys were homogenized for 30 sec in prechilled methanol. The homogenate was centrifuged at 4°C for 20 min at 13,000 g , and the supernatant was retained. All the rats were euthanized with pentobarbital injection (i.p.), the dose of pentobarbital was 130mg/kg. Then, the kidney remnants were taken out, weighed, teared off of the envelope, flushed with PBS, and fixed in 10% buffered formalin. Kidneys were then processed in paraffin. The pathologist, who was blinded to the treatment, duration, and genotype of the samples, examined the representative kidney sections of 3 rats from every group. Sections (5 μm‑thick) of tissue, following Masson and hematoxylin and eosin (H&E) staining, were evaluated according to a standard staining protocol. At high magnification (x 200), 6 complete glomeruli were randomly selected, histology scores were assessed according to morphological criteria, and the ratio of the proportion of the kidney affected by individual changes to the total area of the kidney sectioned was determined. To calculate the glomerular sclerosis index (GSI), histological scores were presented on an ordinal scale of 1‑4. According to the lesion degree of renal tubules and glomerulus, the higher the score, the more serious the lesion. Cell culture and treatment HKC cells (a proximal tubule epithelial cell line) were grown in DMEM (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum. Cells were maintained at 37°C in an incubator under a saturated humid atmosphere containing 95% air and 5% CO 2 . Cells were passaged once every 3 days. The cells were purchased from National Infrastructure of Cell Resource (Beijing, China), and all experiments were performed on cells between passages 10‑20. The HKC cells were pretreated with H 2 O 2 (0.6 mM) for 4 h, and then co‑treated with Jianshen Granule solution (at concentrations of 0.5, 1, 2 mg/ml) or UCG solution (1 mg/ml) for 24 h. Cell viability analysis Cytotoxicity was assayed in HKC cells grown in 96‑well plates. Cells (1.5x10 5 cells/ml; 0.1 ml per well) were seeded into plates and allowed to grow overnight before replacement of the medium with serum‑free medium supplemented with H 2 O 2 for 4 h, and then co‑treated with Jianshen Granule solution (0.5, 1, 2 mg/ml) or UCG solution (1 mg/ml) for 24 h. Subsequently, 10 μl Cell Counting Kit‑8 (CCK‑8) (Sigma‑Aldrich, Darmstadt, Germany) was added into each well and incubated for 1‑4 h. The absorbance was read at 450 nm with a PerkinElmer Victor X Microplate Reader (PerkinElmer, Inc., Waltham, MA, USA). Reductions in optical density (OD) due to drug treatment were used to assess cell viability and normalized against control incubated in medium (100% viability). Measurement of the mitochondrial membrane potential (MMP) MMP was measured using flow cytometry, and the mitochondrial‑specific cationic dye, JC‑1. HKC cells (1.5x10 5 cells/ml) were plated in 12‑well plates with H 2 O 2 for 4 h, and then co‑treated with Jianshen Granule solution (0.5, 1, 2 mg/ml) or UCG solution (1 mg/ml) for 24 h. Cells were harvested, washed twice with PBS, and incubated with 0.5 mL JC‑1 (25 μM) for 20 min at 37°C. MMP was assayed, and green (JC‑1 monomer) and red (JC‑1 aggregate) fluorescence were monitored at emission wavelengths of 525 and 595 nm, respectively. Changes in the ratio between measurements were indicative of changes in the MMP. Measurements of intracellular ROS and Ca 2+ HKC cells (1.5x10 5 cells/ml) were plated in 12‑well plates with the indicated concentrations of H 2 O 2 for 4 h, and subsequently co‑treated with Jianshen Granule solution (0.5, 1, 2 mg/ml) or UCG solution (1 mg/ml) for 24 h. Intracellular ROS and cytosolic Ca 2+ were measured using the fluorescent probes Dichlorofluorescein diacetate (DCFH DA) (Sigma‑Aldrich, Darmstadt, Germany) and fluo‑3‑acetoxymethyl ester (Fluo‑3‑AM) (Biosea Biotechnology, Beijing, China), respectively, and a fluorescence‑activated cell sorter. DCFH‑DA is converted into a fluorescent compound in the presence of ROS. Fluo‑3‑AM was added to treated cells to measure Ca 2+ . After treatment with the indicated drugs, cells were incubated with DCFH‑DA (10 μM) for 20 min at 37°C in the dark (for the ROS assay) or Fluo‑3/AM (5 μmol/l) for 30 min at 37°C (the Ca 2+ assay), and the cells were then harvested and suspended in 500 μl HBSS. Intracellular ROS and Ca 2+ were measured using a flow cytometer (excitation wavelength, 488 nm; emission wavelength, 535 nm). Cell apoptosis Apoptosis was also measured using Annexin V‑fluorescein isothiocyanate (FITC)‑propidium iodide (PI) double‑stained apoptosis detection kit (Biosea Biotechnology ,Beijing, China). HKC cells were plated (1.5x10 5 cells/ml; 0.1 ml) in 12‑well plates with the indicated concentrations of H 2 O 2 for 4 h, and then co‑treated with Jianshen Granule solution (0.5, 1, 2 mg/ml) or UCG solution (1 mg/ml) for 24 h. Cells were harvested, washed twice with ice‑cold PBS, and then suspended in 200 μl ice‑cold binding buffer. Subsequently, 10 μl HRP FITC‑labeled annexin V and 5 μL PI were added to the cells. The cell suspension was gently mixed, and incubated for 15 min at room temperature in the dark. Apoptosis was monitored using flow cytometry (488 nm excitation wavelength), and the fluorescence intensity was measured at 530 nm (emission wavelength). Annexin V + /PI ‑ was used to document early apoptosis, whereas AnnexinV + /PI + was used to assess the late apoptotic stages or necrotic cells. RT‑qPCR assay HKC cells were treated with different concentrations of Jianshen Granule solution for the indicated times. Total RNA was extracted from kidney tissue and HKC cells using Invitrogen ® TRIzol reagent (Thermo Fisher Scientific, Inc.), and cDNA was made by random hexamers. Quantitative PCR was monitored in a Real‑Time PCR detection system (Gene Amp 2400 ® ; PerkinElmer, Inc.) with SYBR Green Supermix (Bio‑Rad Laboratories, Inc., Hercules, CA, USA) and relevant primers. The primer sequences are shown in Tables 1 and 2. The percentages of the above molecules were quantified using StepOne Plus TM Real Time PCR (Applied Biosystems; StepOne Plus TM 272006169). Table 1 Primers of renal tissue Renal tissue Primers TGF-β1 F GAAGGACCTGGGTTGGAAG TGF-β1 R CGGGTTGTGTTGGTTGTAG β-actin F GGGAAATCGTGCGTGACATT β-actin R GCGGCAGTGGCCATCTC Table 2 Primers of HKC cells HKC cells Primers TGF-β1 F GGAAATTGAGGGCTTTCGCC TGF-β1 R CCGGTAGTGAACCCGTTGAT β-actin F CGGCGCCCTATAAAACCCA β-actin R TCATCATCCATGGTGAGCTGG Western blot assay Proteins from kidney tissues and HKC cells were acquired and sonicated in RIPA lysis buffer. Aliquots (40 µg) of proteins were subjected to SDS‑PAGE (10% gels), and electro‑transferred to PVDF membranes. The protein‑containing PVDF membrane was blocked in blocking buffer (5% non‑fat dry milk in Tris‑buffered saline containing 0.1% Tween‑20; TBST) for 2 h, incubated with the primary antibody (see above) for 3 h, and subsequently incubated at 4°C overnight. The membranes were incubated with secondary antibody (HRP‑conjugated IgG for 1 h) and the protein bands were quantified using a luminescent image analyzer (GE Healthcare Bio‑Sciences AB; Image Quant LAS 500; Sweden). The protein expression levels were normalized against GAPDH. Statistical analysis The data are expressed as the mean ± SEM. P <0.05 was considered to indicate a statistically significant value. All the statistical calculations were performed using Prism software package (GraphPad Prism, version 5) with unpaired or paired t‑test, depending on the type of comparison being made. Results Animal model of nephrectomy The rat CRF model was established by 5/6 nephrectomy. The levesl of Scr and BUN in rat serum of the model group were found to be significantly higher than those of the sham group ( P <0.05). This suggested that the model had been built successfully (Fig. 1). Fig 1 Pharmacodynamic evaluation During the drug administration, the rats of the sham group were noted to be livelier and more energetic, with bright hair color and normal gains of weight. By contrast, the 5/6 nephrectomy model rats were mentally depressed, with slightly protruding eyeballs, dark hair color and a lower consumption of food. However, upon treatment of Jianshen granule and UCG, the mental state of the rats was gradually restored, which became similar to that of the sham operation group. No significant differences in the weight of the rats before or after the nephrectomy were observed. However, the body weight of the rats in the nephrectomy group were found to be lower than those of the sham group 2 weeks after surgery ( P <0.05). By the end of the treatment cycle, the body weights of the rats in the JS‑L and JS‑M groups were significantly higher compared with that of the model group ( P <0.05). The boy weights in the JS‑H group were lower compared with that of the model group, until after 7 or 8 weeks. Taken together, these results suggested that low or medium doses of Jianshen Granules enabled the CRF rats to retain their weights, whereas a high dose of Jianshen Granules had no effect (Fig. 2). Fig 2 Changes in renal function can be assessed according to the levels of Scr and BUN. In the present study, the Scr and BUN levels were significantly increased in the model group compared with the sham group ( P <0.05). However, treatment with Jianshen Granules did lead to a significant reduction in the increases of Scr and BUN levels that were observed in CRF rats ( P <0.05), signifying that residual renal functions were protected, and renal failure symptoms were relieved (Fig. 3A and B). Furthermore, no differences were observed between the Jianshen group and the UCG group. Changes in the levels of ALT and AST can be used to characterize the degree of damage of liver function. In these experiments, no significant differences were observed between the sham group and the other groups attributable to fluctuations in the ALT and AST values in each group, indicating that Jianshen Granules caused no damage to the liver function of CRF rats (Fig. 3C and D). Compared with the model group, the level of SOD in each treatment group increased, but there was no statistical difference among the three groups (Fig. 3E). This shows that Jianshen granule can reduce oxidative stress in vivo. Fig 3 In terms of the analysis of the level of UPr, the UPr level of the model group was shown to increase rapidly, and the UPr level in the JS group was significantly lower compared with that in the model group ( P <0.05). The UPr content was lowest in the JS‑M group. Furthermore, the UPr level in the JS groups were lower compared with that in the UCG group (Fig. 4A). The volume of urine in the JS groups were also lower compared with that in the model group, while the JS‑M group had the lowest levels of all JS groups, also lower than the UCG group. These results suggested that Jianshen Granules may lead to an improvement in reabsorption of the renal tubules, and the effect was observed to be the best in the JS‑M group (Fig. 4B). Fig 4 Histological analysis The sham group appeared to have no obvious renal lesions, whereas the other groups exhibited different degrees of lesions, including renal membrane fibrosis, renal interstitium (i.e. interstitial fibrosis and chronic inflammation), and renal parenchyma lesions (i.e. renal tubule dilatation, protein tube type, peripheral glomerular fibrosis, glomerular mesangial hyperplasia and glomerular cysts deposition). Although the Jianshen Granule group also had similar pathological changes, these were significantly less severe compared with the other groups (Fig. 5A and B). According to the GSI, histological scores were determined (Fig. 5C). The model group rats were observed to have significantly higher scores compared with sham group, which indicated that severe renal lesions existed in the model group. The scores of the Jianshen Granule groups and the UCG group were lower compared with that of model group; taken together, these results demonstrated that Jianshen Granule and UCG treatment was able to relieve the lesions, and the JS‑M group experienced the best effect. Fig 5 Previous research has shown that TGF‑β1 is a key pro‑fibrotic growth factor involved in renal fibrogenesis, and an important factor among cytokines due to its upregulation in patients with chronic renal failure. In the present study, the TGF‑β1 level was shown to be increased in the kidney tissues of 5/6 nephrectomy rats, whereas Jianshen Granule treatment led to a marked decrease in the level of TGF‑β1. These results were confirmed by western blot analysis of TGF‑β1 (Fig. 6A). Similar results were also obtained by ELISA (Fig.6C). In addition, the mRNA expression level of TGF‑β1 was markedly reduced upon treatment with Jianshen Granules (Fig. 6B). Fig 6 Cell function is influenced by Jianshen Granules Hydrogen peroxide (H 2 O 2 ) is able to cause oxidative damage to cells, leading to apoptosis. In order to evaluate the effects of Jianshen Granules on H 2 O 2 ‑induced cell death, the viability of the HKC cells by CCK‑8 assay was first investigated, and it was identified that Jianshen Granules led to a significant improvement in the HKC cells’ viability compared with H 2 O 2 group ( P <0.01) (Fig. 7). Fig 7 In addition, annexin‑V and PI staining were performed, and flow cytometry was used to distinguish living cells from apoptotic and necrotic cells. These experiments demonstrated that the number of apoptotic cells in the H 2 O 2 group was significantly higher compared with those in the control group ( P <0.01), whereas the extent of apoptosis of HKC cells in the JS‑M, JS‑H and UCG groups was significantly lower compared with that in the H 2 O 2 group ( P <0.01 or P <0.05). However, no significant differences were observed among the JS‑M, JS‑H and UCG groups. These results revealed that treatment with Jianshen Granules was able to protect the HKC cells from H 2 O 2 ‑induced apoptosis (Fig. 8A). As a marker of oxidative stress, ROS participate in renal injury through oxidative stress and inflammatory reactions, and the levels of ROS are increased markedly in both acute and chronic renal failure[ 13 ]. In the present study, the levels of intracellular ROS in the H 2 O 2 group were found to be significantly higher compared with those of the control group ( P <0.01) (Fig. 8B). In addition, the ROS level in the Jianshen Granule treatment group was also significantly lower compared with that in the H 2 O 2 group ( P <0.05). Therefore, ROS production was shown to be effectively inhibited by Jianshen Granules. When cells are stimulated by external stress, the mitochondrial function is compromised, with a decrease in the MMP, and an increase in the levels of ROS and the intracellular Ca 2+ concentration [ 14 ]. In the present study, after HKC cells were stimulated by H 2 O 2 , the intracellular Ca 2+ level increased significantly, whereas the MMP level decreased significantly ( P <0.01 and P <0.05, respectively). After administration of Jianshen Granules or UCG, the Ca 2+ concentration was reduced markedly, and the MMP level was elevated to an appreciable extent compared with that in the H 2 O 2 group ( P <0.01). The decreases in Ca 2+ and MMP caused by cell damage were also found to be alleviated following treatment with Jianshen Granules (Fig. 8C and D). Fig 8 To further investigate the correlation between TGF‑β1 and renal failure, the protein expression level of TGF‑β1 was analyzed by western blot analysis, and the mRNA expression level of TGF‑β1 was also assessed by RT‑qPCR in the HKC cells. In these experiments, the TGF‑β1 level was increased in the HKC cells induced by H 2 O 2 , whereas Jianshen Granules were able to significantly decrease the protein and mRNA expression of TGF‑β1 (Fig. 9). Fig 9 Discussion Although numerous studies have been published on CRF, effective drugs available for clinical treatment are very limited in supply [ 15 , 16 ]. Treatment of CRF by TCM has elicited positive results, however, and this approach has led to a diversification of treatment methods, broadening developmental prospects for therapy[ 17 ]. To name but a few of the effects, TCM has had impressive achievements in relieving symptoms of CRF, protecting residual renal function, delaying the progress of the disease, and postponing the time of dialysis and the requirement for kidney transplantation, thereby greatly improving the quality of life for patients with CRF[ 18 ]. Jianshen Granules are a clinically effective prescription medicine, composed of 11 separate TCMs, and has been shown to be suitable for the treatment of early CRF. It has been used for 9 years as a hospital formulation in the Air Force Medical Center of PLA. The prescription helps to maintain kidney function, and the kidneys are stimulated with Radix Rehmanniae and Cornus , thereby and maintaining the remaining metabolic function of the kidneys. It can also nourish the blood, promote blood circulation, and improve the state of systemic deficiency via the presence of the ingredients Poria cocos , Astragali radix, and Angelica sinensis . Detoxifying turbidity and removing toxins in the body are accomplished by lumbricus , Honeysuckle , and Rhubarb. Moreover, Jianshen Granules also have the function of being able to activate blood circulation, removing blood stasis and reducing glomerular fibrosis, courtesy of the presence of Salvia miltiorrhiza radix and Ligusticum chuanxiong Hort. The combination of the various traditional medicines not only improves the functioning of the spleen and kidney, but also removes blood stasis, reduces turbidity and detoxifies the blood, promotes the excretion of toxins in the body, and promotes the decomposition, transformation and recovery of the renal function of metabolic waste. Scr and BUN are mainly excreted in the urine following glomerular filtration[ 19 ]. When the renal parenchyma is damaged, the glomerular filtration rate decreases, resulting in increases in the levels of Scr and BUN in the blood[ 20 ]. Therefore, Scr and BUN are the main indicators of clinical diagnosis of renal failure. In the present study, the Scr and BUN levels were significantly elevated in 5/6 nephrectomized rats, but their levels were reduced upon treatment with Jianshen Granules, suggesting that Jianshen Granules help to alleviate the symptoms of renal failure. Clinical trials have shown that reducing UPr may protect the kidneys; these results were corroborated by the present study, in which Jianshen Granules lowered the UPr in the 5/6 nephrectomized rats. It has also been demonstrated that Jianshen Granules have the function of protecting kidney function. ALT and AST may be used to evaluate whether liver function has been compromised. In our experiments, the levels of ALT and AST in 5/6 nephrectomized rats of the Jianshen Granule group were not significantly different from those of the sham group, demonstrating that Jianshen Granules have no liver toxicity. Tubulointerstitial fibrosis is a common pathological pathway for the progression of chronic kidney diseases to end‑stage renal failure caused by various etiologies[ 21 ]. TGF‑β1 is a driving force of renal fibrosis[ 22 ]. Clinical data published previously have shown that TGF‑β1 levels in the kidney and urine of patients with kidney diseases were markedly increased, and this increase was positively correlated with the degree of renal fibrosis[ 23 ]. In the present study, both the protein and mRNA expression levels of TGF‑β1 in 5/6 nephrectomized rats were significantly increased, and these increases were inhibited upon treatment with Jianshen Granules. These findings indicate that Jianshen Granules may relieve the symptoms of renal failure by downregulating TGF‑β1 expression. It has been reported that oxidative stress is involved in damage to the glomerulus and tubulointerstitium [ 24 ], processes which lead to the chronic development of renal failure, ultimately leading to the end stage of renal failure[ 25 ]. When the body is under oxidative stress conditions, the balance between oxidation and anti‑oxidation is disrupted. The increases in ROS levels in the cells exceed their scavenging capacity, which may lead to oxidative damage, abnormal protein expression, and cell damage [ 26 , 27 ]. ROS induces apoptosis by altering the MMP. Furthermore, scholar[ 28 ]provided evidence that cell apoptosis, including experiments performed on renal tubular epithelial HKC cells, is a critical determinant of renal fibrosis, which eventually results in CRF. Constructing the cell model of oxidative stress injury by subjecting cells to H 2 O 2 treatment is currently recognized and widely used[ 29 ]. The present study has shown that Jianshen Granules are able to inhibit H 2 O 2 ‑induced apoptosis of the HKC cells. Although the intracellular ROS of HKC cells were markedly increased upon H 2 O 2 treatment, these increases were reversed by treatment with Jianshen Granules. Furthermore, the Ca 2+ level is in equilibrium when cells are in their normal state, but this balance is destroyed when the cells are damaged. It has been demonstrated that increases in Ca 2+ concentration of the cells lead to cellular dysfunction, resulting in an imbalance of energy metabolism, which subsequently leads to the pathological state of the body[ 30 ]. It has been shown that increases in the Ca 2+ concentration are negatively correlated with cell viability, indicating that cell death is associated with an increase in intracellular Ca 2+ concentration. In vitro studies have confirmed that ROS lead to the change of intracellular Ca 2+ [ 31 ]. Numerous in vitro studies have demonstrated that ROS can induce extracellular Ca 2 + influx, and they may therefore be convenient signal markers in regulating calcium signaling processes[ 32 ]. Mitochondria are the main site for the production of ROS, and also the main target of ROS. Numerous studies have shown that excessive ROS can cause oxidative damage to mitochondria, resulting in their abnormal function[ 33 , 34 ]. The abnormalities of this function are mainly manifested in a reduction of MMP, mitochondrial DNA mutation, disruption of the mitochondrial respiratory chain, and so on [ 35 ]. In the present study, the increase in Ca 2+ concentration, and concomitant decrease in MMP, caused by ROS were inhibited by Jianshen Granules, indicating that Jianshen Granules are able to inhibit cell injury. During renal pathogenesis, apoptosis of HKC cells may lead to atrophy of renal tubular and interstitial fibrosis, which ultimately leads to the progression of chronic kidney disease to end‑stage renal failure[ 36 ]. Previous studies have shown that preventing apoptosis of the HKC cells may effectively delay the progression of renal fibrosis, and reduce the damage caused to renal function[ 37 , 38 ]. Apoptosis of HKC cells may be induced by TGF‑β1. Previous studies have also shown that reducing the mRNA expression level of TGF‑β1, and downregulating the expression of TGF‑β1 protein, can reduce the apoptosis of HKC cells[ 39 ]. Therefore, TGF‑β1 may be a therapeutic target for clinical prevention and treatment of renal tubular atrophy, alleviating the degree of renal fibrosis, and delaying renal dysfunction[ 40 ]. In the present study, upregulation of the levels of TGF‑β1 mRNA and protein was inhibited upon treatment with Jianshen Granules. Therefore, downregulating TGF‑β1 expression may have contributed to the apoptosis inhibition in HKC cells mediated by Jianshen Granules. Our research also has certain limitations. Jianshen granules are composed of 11 kinds of traditional Chinese medicine, and the exact active ingredients cannot be determined at present. Next, we will use fingerprints to determine the active ingredients. Conclusion In conclusion, the present study has demonstrated that Jianshen Granules are able to reduce the levels of Scr, BUN and UPr in CRF rats, and thereby may protect the residual renal function, alleviating the symptoms of renal failure. Moreover, this medicine had no obvious side effects on liver function. Jianshen Granules are also able to inhibit apoptosis induced by H 2 O 2 . Taken together, the results of the present study have shown that Jianshen Granules may alleviate renal failure by inhibiting the expression of TGF‑β1. This study has confirmed the efficacy of Jianshen Granules with respect to therapeutic treatment of CRF, thereby providing important information for the clinical treatment of CRF. Abbreviations CRF, chronic renal failure; UCG, uremic clearance granule; ROS, reactive oxygen species; PLA, Chinese People's Liberation Army; TGF β1, transforming growth factor β1; TCM, traditional Chinese medicine. Declarations Ethics approval and consent to participate All experimental procedures involving the animals were performed according to the protocols approved by National Beijing Center for Drug Safety Evaluation and Research, the approval number is IACUC-2018-035. Consent for publication Not applicable. Availability of data and materials All data generated or analysed during this study are included in this published article. All figures can be used as supplementary information to the data. Competing interests The authors have no conflicts of interest to disclosure. Funding This work was supported by grants from Beijing Municipal Science & Technology Commission (No.Z161100001816008), the expenditure of the the study was supported by the funder. Authors' contributions L-N Du and H-L Yuan were contributed to the conceptualization, study design, and manuscript revision. Y Wu, X-X Zhang, J Kong, and H-J Lu contributed to the data collection, analysis and interpretation. X-X Zhang, H-Y Qiu involved in drafting manuscript. Acknowledgements The authors want to thank Dr. Qingxin Mu with his help in modifying the manuscript . References Liu M, Park J, Wu X, LI Y, Tran Q, Mun K, Lee Y, Hur GM, Wen A, Park J: Shen-Kang protects 5/6 nephrectomized rats against renal injury by reducing oxidative stress through the MAPK signaling pathways. International journal of molecular medicine 2015, 36:975-984. Zhang L, Wang F, Wang L, Wang W, Liu B, Liu J, Chen M, He Q, Liao Y, Yu X: Prevalence of chronic kidney disease in China: a cross-sectional survey. The Lancet 2012, 379(9818):815-822. Kontomanolis E, Panagoutsos S, Pasadakis P, Koukouli Z, Liberis A: Chronic renal failure, diabetes mellitus type-II, and gestation: an overwhelming combination. Clin Exp Obstet Gynecol 2016, 43(2):276-279. Khoury T, Tzukert K, Abel R, Abu Rmeileh A, Levi R, Ilan Y: The gut-kidney axis in chronic renal failure: A new potential target for therapy . Hemodialysis international International Symposium on Home Hemodialysis 2017, 21 (3):323-334. Neto JRS, e Castro LMF, de Oliveira FS, Silva AM, dos Reis LM, Quirino APA, Dragosavac D, Kosour CJJopts: Comparison between two physiotherapy protocols for patients with chronic kidney disease on dialysis . Journal of physical therapy science 2016, 28(5):1644-1650. Impellizzeri D, Esposito E, Attley J, Cuzzocrea SJPR: Targeting inflammation: new therapeutic approaches in chronic kidney disease (CKD) . Pharmacological Research 2014, 81 :91-102. Brunet P: Treatment of chronic kidney failure by haemodialysis . Soins; la Revue de Reference Infirmiere 2018, 62 (826):21-23. Guan Y, Wu X, Duan J, Yin Y, Guo C, Wei G, Wang Y, Zhu Y, Weng Y, Xi M et al : Effects and Mechanism of Combination of Rhein and Danshensu in the Treatment of Chronic Kidney Disease . The American journal of Chinese medicine 2015, 43 (7):1381-1400. Xu L, Ma J, Chen B: Clinical observation on Jianshen Granules combined with syndrome differentiation and treatment on chronic renal failure . Journal of Beijing University of Traditional Chinese Medicine 2005, 28 (6):83-85. Limei X, Jianwei M, Xinying M: Effect of Jianshen Granule on Kidney TGF-β1,ET-1mRNA and Function of Rats with Diabetic Nephrosis(DN) . Journal of Zhejiang University of Traditional Chinese Medicine 2010, 34 (3):307-308. Suzuki Y, Yamaguchi I, Onoda N, Saito T, Myojo K, Imaizumi M, Takada C, Kimoto N, Takaba K, Yamate JJE et al : Differential renal glomerular changes induced by 5/6 nephrectomization between common marmoset monkeys (Callithrix jacchus) and rats . Experimental toxicologic pathology 2013, 65(5):667-676. Xiao X, Mo L, Song S, Qin M, Yang XJNfykdxxbJoSMU: Compound huang gan delays chronic renal failure after 5/6 nephrectomy in rats . Journal of Southern Medical University 2014, 34 (11):1661-1667. Maria DA, Xueliang D, Daniela P, Massimo P-M, Angelo C, Ferdinando G, Angela Bruna M, Anna Laura C, Michael B, Ida G: Urea-induced ROS cause endothelial dysfunction in chronic renal failure . Atherosclerosis 2015, 239 (2):393-400. Wang Y, Han B, Ding J, Qiu C, Wang W: Endoplasmic reticulum stress mediates osteocyte death under oxygen-glucose deprivation in vitro . Acta histochemica 2020, 122 (6):151577. Tang P, Zhang Y, Chan M, Lam W, Chung J, Kang W, To K, Lan H, Tang P: The Emerging Role of Innate Immunity in Chronic Kidney Diseases . International journal of molecular sciences 2020, 21 (11). Rapa S, Di Iorio B, Campiglia P, Heidland A, Marzocco S: Inflammation and Oxidative Stress in Chronic Kidney Disease-Potential Therapeutic Role of Minerals, Vitamins and Plant-Derived Metabolites . International journal of molecular sciences 2019, 21 (1). Zhu X, Chen Z: The improvement effects of Yiqi Huashi Tongluo Formula on oxidative stress and renal fibrosis of experimental CRF rats . Chinese journal of applied physiology 2020, 36 (1):67-72. Yang X, Hu C, Wang S, Chen Q: Clinical efficacy and safety of Chinese herbal medicine for the treatment of patients with early diabetic nephropathy: A protocol for systematic review and meta-analysis . Medicine 2020, 99 (29):e20678. Khan Z, Pandey MJSjobs: Role of kidney biomarkers of chronic kidney disease: An update . Saudi journal of biological sciences 2014, 21 (4):294-299. Ma W, Wang K-J, Cheng C-S, Yan G-q, Lu W-L, Ge J-F, Cheng Y-X, Li NJJoe: Bioactive compounds from Cornus officinalis fruits and their effects on diabetic nephropathy . Journal of ethnopharmacology 2014, 153 (3):840-845. Wang Z, Zhang B, Chen Z, He Y, Ru F, Liu P, Chen X: The long noncoding RNA myocardial infarction-associated transcript modulates the epithelial-mesenchymal transition in renal interstitial fibrosis . Life sciences 2020, 241 :117187. M MX, J N-PD, Y LH: TGF-beta: the master regulator of fibrosis . Nat Rev Nephrol 2016, 12 (6):325-338. Sureshbabu A, Muhsin SA, Choi MEJAJoP-RP: TGF-β signaling in the kidney: profibrotic and protective effects . American Journal of Physiology-Renal Physiology 2016, 310 (7):F596-F606. Small DM, Bennett NC, Roy S, Gabrielli BG, Johnson DW, Gobe GCJNEN: Oxidative stress and cell senescence combine to cause maximal renal tubular epithelial cell dysfunction and loss in an in vitro model of kidney disease . Nephron Experimental Nephrology 2012, 122 (3-4):123-130. Small D, Coombes J, Bennett N, Johnson D, Gobe G: Oxidative stress, anti-oxidant therapies and chronic kidney disease . Nephrology Carlton, Vic 2012, 17 (4):311-321. Turan B: Role of antioxidants in redox regulation of diabetic cardiovascular complications . Current pharmaceutical biotechnology 2010, 11 (8):819-836. Lee K, Kim E, Kim C, Choi J, Bae E, Ma S, Park J, Jung Y, Kim S, Lee J et al : Macrophage-stimulating protein attenuates hydrogen peroxide-induced apoptosis in human renal HK-2 cells . European journal of pharmacology 2013, 715 :304-311. Poprac P, Jomova K, Simunkova M, Kollar V, Rhodes C, Valko M: Targeting Free Radicals in Oxidative Stress-Related Human Diseases . Trends in pharmacological sciences 2017, 38 (7):592-607. Duan R, Xing X, Qi Y, Yin N, Hao H, Chu H, Gao Y, Wang W, Lv PJNr: Taxane-derived compounds protect SK-N-SH cells against oxidative stress injury induced by H 2 O 2 . Neurological research 2017, 39 (7):632-639. Huang C-C, Aronstam RS, Chen D-R, Huang Y-WJTiv: Oxidative stress, calcium homeostasis, and altered gene expression in human lung epithelial cells exposed to ZnO nanoparticles . Toxicology in vitro 2010, 24 (1):45-55. Liang W-Z, Chou C-T, Chang H-T, Cheng J-S, Kuo D-H, Ko K-C, Chiang N-N, Wu R-F, Shieh P, Jan C-RJC-bi: The mechanism of honokiol-induced intracellular Ca 2+ rises and apoptosis in human glioblastoma cells . Chemico-biological interactions 2014, 221 :13-23. Zhang X, Lee M, Wilson C, McCarron J: Hydrogen peroxide depolarizes mitochondria and inhibits IP-evoked Ca release in the endothelium of intact arteries . Cell calcium 2019, 84 :102108. Li Y, Ren K: The Mechanism of Contrast-Induced Acute Kidney Injury and Its Association with Diabetes Mellitus . Contrast media & molecular imaging 2020, 2020 :3295176. Miao J, Liu J, Niu J, Zhang Y, Shen W, Luo C, Liu Y, Li C, Li H, Yang P et al : Wnt/β-catenin/RAS signaling mediates age-related renal fibrosis and is associated with mitochondrial dysfunction . Aging cell 2019, 18 (5):e13004. Xu S, Chamseddine A, Carrell S, Miller F: Nox4 NADPH oxidase contributes to smooth muscle cell phenotypes associated with unstable atherosclerotic plaques . Redox biology 2014, 2 :642-650. Liu X, Miao J, Wang C, Zhou S, Chen S, Ren Q, Hong X, Wang Y, Hou F, Zhou L et al : Tubule-derived exosomes play a central role in fibroblast activation and kidney fibrosis . Kidney international 2020, 97 (6):1181-1195. Gewin L: Renal fibrosis: Primacy of the proximal tubule . Matrix biology : journal of the International Society for Matrix Biology 2018:248-262. Duffield JSJTJoci: Cellular and molecular mechanisms in kidney fibrosis . 2014, 124 (6):2299-2306. Zhu J, Wen K: Astragaloside IV inhibits TGF-β1-induced epithelial-mesenchymal transition through inhibition of the PI3K/Akt/NF-κB pathway in gastric cancer cells . Phytotherapy research : PTR 2018, 32 (7):1289-1296. I L, G W: Transforming growth factor-β and the progresssion of renal disease. Nephrol Dial Transplant 2014, 29 (1):37-45. Tables Table Ⅰ Primers of renal tissue Renal tissue Primers TGF-β1 F GAAGGACCTGGGTTGGAAG TGF-β1 R CGGGTTGTGTTGGTTGTAG β-actin F GGGAAATCGTGCGTGACATT β-actin R GCGGCAGTGGCCATCTC Table Ⅱ Primers of HKC cells HKC cells Primers TGF-β1 F GGAAATTGAGGGCTTTCGCC TGF-β1 R CCGGTAGTGAACCCGTTGAT β-actin F CGGCGCCCTATAAAACCCA β-actin R TCATCATCCATGGTGAGCTGG Supplementary Files ARRIVE.docx Cite Share Download PDF Status: Posted Version 2 posted You are reading this latest preprint version Show more versions Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-18615","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research article","associatedPublications":[],"authors":[{"id":1674731,"identity":"659c9115-3477-43f8-ab26-c9addc601c2b","order_by":0,"name":"Yan Wu","email":"","orcid":"","institution":"Air Force Of Medical Center, PLA","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Wu","suffix":""},{"id":1674732,"identity":"4c6633f2-c0f3-432c-9e9c-57efda9e84b6","order_by":1,"name":"Xianxie Zhang","email":"","orcid":"","institution":"Air Force Medical Center, PLA","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xianxie","middleName":"","lastName":"Zhang","suffix":""},{"id":1674733,"identity":"0840ca67-7725-4535-996e-27359936c023","order_by":2,"name":"Jian Kong","email":"","orcid":"","institution":"Air Force Medical Center, PLA","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Kong","suffix":""},{"id":1674734,"identity":"e28feec6-3575-4205-a923-1178aa390e20","order_by":3,"name":"Haiying Qiu","email":"","orcid":"","institution":"Air Force Medical Center, PLA","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Haiying","middleName":"","lastName":"Qiu","suffix":""},{"id":1674735,"identity":"4666e65c-cead-4805-98d3-ed523eb4c815","order_by":4,"name":"Hongjie Lu","email":"","orcid":"","institution":"Air Force Medical Center, PLA","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hongjie","middleName":"","lastName":"Lu","suffix":""},{"id":1674736,"identity":"752599d4-7d5e-46e8-bd63-613d490857f3","order_by":5,"name":"Lina Du","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAnklEQVRIiWNgGAWjYDCCA8wNBxgYbHj42RuI1sII0pImI9lzgAQtQPKwjcGNBCJ18N1IbDxcUHOeB2gL44ePOURokbyR2HB4xrHbIL8wS87cRoQWA5AWHrbbIFvYmHmJ1/LvHA/QL6Ro4W07QIIWyTMPgVr6koEOO9hMnF/4jicf/szzzc6en7354IePxGhBAuAIGgWjYBSMglFAFQAAggY8bn3DTJ4AAAAASUVORK5CYII=","orcid":"","institution":"Beijing Institute of Radiation Medicine","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Lina","middleName":"","lastName":"Du","suffix":""},{"id":1674737,"identity":"a0538ff8-e580-46f1-8415-3fd87b6deb1f","order_by":6,"name":"Hailong Yuan","email":"","orcid":"","institution":"Air Force Medical Center, PLA","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hailong","middleName":"","lastName":"Yuan","suffix":""}],"badges":[],"createdAt":"2020-03-20 11:49:50","currentVersionCode":2,"declarations":"","doi":"10.21203/rs.3.rs-18615/v2","doiUrl":"https://doi.org/10.21203/rs.3.rs-18615/v2","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":2073049,"identity":"745dc683-f81c-44c9-8400-247568be02be","added_by":"auto","created_at":"2020-08-25 17:13:41","extension":"tif","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":12062,"visible":true,"origin":"","legend":"Scr and BUN levels of the rats in sham and model groups prior to administration of the medicine. Each value is expressed as the mean ± S.E.M (n=8). *P\u003c0.05 compared with the model group. Scr, serum creatinine; BUN, blood urea nitrogen.","description":"","filename":"Figure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-18615/v2/Figure1.tif"},{"id":2073050,"identity":"dcdde826-4248-4709-9738-cae44039c66e","added_by":"auto","created_at":"2020-08-25 17:13:41","extension":"tiff","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":839644,"visible":true,"origin":"","legend":"Effect of Jianshen Granules on body weight in the different experimental groups. Each value is expressed as the mean ± S.E.M (n=8).","description":"","filename":"Figure2.tiff","url":"https://assets-eu.researchsquare.com/files/rs-18615/v2/Figure2.tiff"},{"id":2073051,"identity":"4b5ecb74-0a2d-40b0-8ec6-b33e808368e1","added_by":"auto","created_at":"2020-08-25 17:13:41","extension":"tif","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2512063,"visible":true,"origin":"","legend":"Effects of Jianshen Granules on rats subjected to 5/6 Nx. The levels of the following piochemical parameters were investigated: (A) BUN; (B) Scr; (C) ALT; (D) AST; and (E) SOD. Each value is expressed as the mean ± S.E.M (n=8). *P\u003c0.05, the model group compared with the JS L group; #P\u003c0.05, the model group compared with the JS M group; △P\u003c0.05, the model group compared with the JS H group; ▲P\u003c0.05, the model group compared with the UCG group; ◇P\u003c0.05, the model group compared with the sham group. For further details concerning the establishment of the model groups, see the Materials and methods section. 5/6 Nx, 5/6 nephrectomy; BUN, blood urea nitrogen; SCr, serum creatinine; ALT, alanine aminotransferase; AST, aspartate aminotransferase; SOD, super oxide dismutase. ","description":"","filename":"Figure3.tif","url":"https://assets-eu.researchsquare.com/files/rs-18615/v2/Figure3.tif"},{"id":2073052,"identity":"bb8e03d6-5252-4a9b-8f49-0f6cf3285448","added_by":"auto","created_at":"2020-08-25 17:13:41","extension":"tif","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":876346,"visible":true,"origin":"","legend":"Effects of Jianshen Granules on rats subjected to 5/6 Nx. The levels of the following piochemical parameters were investigated: (A) UPr; (B) volume of urine. Each value is expressed as the mean ± S.E.M (n=8). *P\u003c0.05, the model group compared with the JS L group; #P\u003c0.05, the model group compared with the JS M group; △P\u003c0.05, the model group compared with the JS H group; ▲P\u003c0.05, the model group compared with the UCG group. UPr, urine protein. \n\n","description":"","filename":"Figure4.tif","url":"https://assets-eu.researchsquare.com/files/rs-18615/v2/Figure4.tif"},{"id":2073053,"identity":"61391f54-2238-4645-b614-915569630d2f","added_by":"auto","created_at":"2020-08-25 17:13:41","extension":"tif","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":5850161,"visible":true,"origin":"","legend":"Histopathological changes in renal tissue obtained from 5/6 nephrectomized rats. Shown are the results from (A) H\u0026E staining; (B) Masson’s staining (magnification, x200). The black arrows represent tubular lesions, such as tubulointerstitial infiltration by inflammatory cells, tubular dilatation, tubular atrophy, and tubulointerstitial fibrosis. (C) Scores of Renal lesion tissue. (a) Sham group; (b) Model group; (c) J L group; (d) J M group; (e) J H group; (f) UCG group. For further details concerning the establishment of the model groups, see the Materials and methods section.","description":"","filename":"Figure5.tif","url":"https://assets-eu.researchsquare.com/files/rs-18615/v2/Figure5.tif"},{"id":2073054,"identity":"791165c3-bd04-48b2-9a57-73d73c403646","added_by":"auto","created_at":"2020-08-25 17:13:42","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":89516,"visible":true,"origin":"","legend":"Effect of Jianshen Granules on the concentration of TGF β1 in the kidney tissues. Shown are (A) western blot analysis of TGF β1; (B) mRNA expression of TGF β1; and (C) TGF β1 expression analysis using an ELISA kit. Each value is expressed as the mean ± S.E.M (n=8). *P\u003c0.05; **P\u003c0.01 compared with the model group. TGF β1, transforming growth factor β1. The figure of 6A was cropped.","description":"","filename":"6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-18615/v2/6.jpg"},{"id":2073055,"identity":"9e43a20c-c7c6-4fa3-b668-07198816d52d","added_by":"auto","created_at":"2020-08-25 17:13:42","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":52307,"visible":true,"origin":"","legend":"Effects of Jianshen Granules on the viability of HKC cells. Values are presented as the mean ± S.E.M (n=8 per group). **P\u003c0.01 compared with the H2O2 group.","description":"","filename":"7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-18615/v2/7.jpg"},{"id":2073056,"identity":"430f14d3-f4e4-42c2-9684-0c3d9b98cb12","added_by":"auto","created_at":"2020-08-25 17:13:42","extension":"tif","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":4255944,"visible":true,"origin":"","legend":"Effects of Jianshen Granules on H2O2 induced oxidative stress in HKC cells. Shown are the results of experiments that investigated (A) the extent of apoptosis; (B) level of ROS; (C) Level of Ca2+; (D) level of MMP [(a) Control group; (b) H2O2 group; (c) JS L group; (d) JS M group; (e) JS H group; (f) UCG group]. For further details concerning the establishment of the model groups, see the Materials and methods section. #P\u003c0.05 compared with the control group; *P\u003c0.05 compared with the H2O2 group. ROS, reactive oxygen species; MMP, mitochondrial membrane potential.","description":"","filename":"Figure8.tif","url":"https://assets-eu.researchsquare.com/files/rs-18615/v2/Figure8.tif"},{"id":2073057,"identity":"aec8c5d3-03c7-4eb7-a9a0-f34fc79e4799","added_by":"auto","created_at":"2020-08-25 17:13:42","extension":"tiff","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":442866,"visible":true,"origin":"","legend":"Effect of Jianshen Granules on the concentration of TGF β1 in the H2O2 induced apoptosis of HKC cells. Shown are the results of experiments that investigated (A) western blot analysis of TGF β1 and (B) mRNA expression of TGF β1. Each value is expressed as the mean ± S.E.M (n=8). *P\u003c0.05 compared with the model group. TGF β1, transforming growth factor β1. The figure of 9A was cropped.","description":"","filename":"Figure9.tiff","url":"https://assets-eu.researchsquare.com/files/rs-18615/v2/Figure9.tiff"},{"id":13585212,"identity":"8cc1dca6-b236-455a-b605-a7f8243b4a63","added_by":"auto","created_at":"2021-09-17 04:42:38","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":19957110,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-18615/v2/2250efaf-de7d-4ce5-b4c2-41927ccf836a.pdf"},{"id":2073059,"identity":"52bab0c8-2ac3-45c6-8842-da6845081b5b","added_by":"auto","created_at":"2020-08-25 17:13:42","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":677789,"visible":true,"origin":"","legend":"","description":"","filename":"ARRIVE.docx","url":"https://assets-eu.researchsquare.com/files/rs-18615/v2/ARRIVE.docx"}],"financialInterests":"","formattedTitle":"Preliminary study of the mechanism underlying how Jianshen Granules ameliorate renal failure in 5/6 nephrectomy model rats","fulltext":[{"header":"Background","content":"\u003cp\u003eChronic renal failure (CRF) is a well‑recognized public health problem worldwide, characterized by evidence of renal damage or dysfunction[\u003ca href=\"#_ENREF_1\"\u003e1\u003c/a\u003e]. CRF is characterized by the progressive loss of renal function, chronic inflammation, oxidative stress, vascular remodeling, and glomerular and tubulointerstitial scarring[\u003ca href=\"#_ENREF_2\"\u003e2\u003c/a\u003e]. CRF has also been demonstrated to increase the risk of cardiovascular disease, diabetic nephropathy, and renal osteodystrophy[\u003ca href=\"#_ENREF_3\"\u003e3\u003c/a\u003e, \u003ca href=\"#_ENREF_4\"\u003e4\u003c/a\u003e]. At the moment, kidney transplantation surgery and hemodialysis therapy are increasingly applied in clinical treatment; however, these therapies are expensive and difficult to be applied widely[\u003ca href=\"#_ENREF_5\"\u003e5\u003c/a\u003e]. Furthermore, these therapies may cause inflammatory reactions and oxidative stress during the course of treatment, thereby increasing the risk of complications. Therefore, it is important for clinical practice that effective and safe alternative therapies be sought after[\u003ca href=\"#_ENREF_6\"\u003e6\u003c/a\u003e, \u003ca href=\"#_ENREF_7\"\u003e7\u003c/a\u003e].\u003c/p\u003e\n\u003cp\u003eTraditional Chinese medicine (TCM) has abundant clinical applications and has demonstrable curative effects. Renal failure ensues largely as a consequence of endocrine disorders that lead to disturbance of the microcirculation. Based on TCM theory, renal failure is due to \u0026ldquo;deficient functioning of the spleen and kidney\u0026rdquo;, \"interior accumulation of dampness and turbidity\", and \"accumulated poison gathered in the kidney\". It is characterized as one of the \u0026ldquo;consumptive diseases\u0026rdquo;[\u003ca href=\"#_ENREF_8\"\u003e8\u003c/a\u003e].\u003c/p\u003e\n\u003cp\u003eJianshen Granules, a traditional Chinese herbal medicine designed by the renowned TCM physician Dr Zhan‑min Liu, working in Air Force Medical Center of PLA , has been used clinically in the treatment of renal diseases for a large number of years in the Air Force Medical Center of the Chinese People's Liberation Army (PLA). It was approved for the production of military preparations in 2006. Jianshen Granules are composed of Radix \u003cem\u003eRehmanniae\u003c/em\u003e, \u003cem\u003eCornus\u003c/em\u003e, \u003cem\u003ePoria cocos\u003c/em\u003e, \u003cem\u003eAstragali \u003c/em\u003eradix, \u003cem\u003eAngelica sinensis\u003c/em\u003e, \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e radix, \u003cem\u003eLigusticum chuanxiong\u003c/em\u003e Hort, \u003cem\u003elumbricus\u003c/em\u003e, \u003cem\u003eHoneysuckle\u003c/em\u003e, Fried \u003cem\u003eatractylodes\u003c/em\u003e and \u003cem\u003eRhubarb\u003c/em\u003e. A clinical study conducted by the Air Force Medical Center on 61 patients with CRF revealed that the overall response rate of Jianshen Granules was 85.24%. Jianshen Granules not only enhanced recovery of the spleen and kidney, but were also demonstrated to clear stasis, promote the excretion of toxins and metabolic wastes from the body, and restore renal functions [\u003ca href=\"#_ENREF_9\"\u003e9\u003c/a\u003e, \u003ca href=\"#_ENREF_10\"\u003e10\u003c/a\u003e].\u003c/p\u003e\n\u003cp\u003eRodent models are commonly used in preclinical CRF studies[\u003ca href=\"#_ENREF_11\"\u003e11\u003c/a\u003e]. The partially nephrectomized rat model has been used extensively to investigate archetypal pathological changes in CRF[\u003ca href=\"#_ENREF_12\"\u003e12\u003c/a\u003e]. Residual kidneys of nephrectomized rats often show adaptive and compensatory growth following injury, which is similar to the development of human diseases.\u003c/p\u003e\n\u003cp\u003eThe present study aimed to confirm the therapeutic effects, and delineate the underlying mechanism of action of, Jianshen Granules on kidney injury induced by 5/6 nephrectomy in rats, as well as effects on the damage caused to HKC cells.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAnimals\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e. \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSprague‑Dawley\u003cstrong\u003e (\u003c/strong\u003eSD) male rats, aged 8 weeks with a body weight of 180‑240 g were held at the National Beijing Center for Drug Safety Evaluation and Research. In accordance with the guidelines of the Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA), the rats were maintained under conditions of controlling temperature (\u0026lt;30℃), humidity (\u0026lt;70%), and circadian circulation for 12 h. Each rat was individually housed in a plastic cage with free access to high pressure‑treated tap‑water and standard rat food. The certificate number for the animals in these experiments was SCXK‑2012‑0004. Following the operation (see below), the activity levels of the rats and the healing of their surgical wounds were monitored daily.\u003c/p\u003e\n\u003cp\u003eAll experimental procedures involving the animals were performed according to the protocols approved by National Beijing Center for Drug Safety Evaluation and Research, the approval number is IACUC-2018-035.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAnimals groups and drug administration\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAnimals were randomized according to their body weight and divided into 2 groups prior to surgery: Animals with sham surgery, and animals with 5/6 nephrectomy. The levels of serum creatinine (Scr) and blood urea nitrogen (BUN) were determined 2 weeks after the operation to establish whether or not the model had been successful. After confirming the model had been established successfully, the experimental rats were divided into the respective model groups: The uremic clearance granules(Cunsun Co., LTD., NeiMenggu, China ) group (UCG), Jianshen granule (produced by Youcare Pharmaceutical Group Co., LTD., Beijing, China) low‑dose group (JS‑L), Jianshen granule middle‑dose group (JS‑M), Jianshen granule high‑dose group (JS‑H), and sham operation group, with 8 rats in each group. The UCG group was given a gavage of 3.6 mg/g/day premixing solution. The dose of UCG was obtained by converting the dose of UCG in the instructions according to the dose‑ratio table of human and animal body surface area ratio in \"Pharmacological Experimental Methodology\". The JS‑L, JS‑M, and JS‑H groups were administered a gavage of 0.96, 1.92, and 3.84 mg/g/day premixing solution, respectively. The dose of Jianshen Granules was calculated according to clinical dose. The sham and model groups were provided with an equal volume of distilled water. Medicine was administered twice daily, and all groups received the medicine continuously over a period of 8 weeks.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eInduction of renal failure: subtotal nephrectomy\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSubtotal nephrectomy (5/6 nephrectomy) was performed in order to induce CRF. Rats were anesthetized with pentobarbital injection (i.p.), the dose of pentobarbital was 40mg/kg, and a dorsoventral incision parallel to spinal cord was made to expose the left kidney, which was then freed of connective tissue. The renal artery was ligated, and the upper and lower poles of the left kidney were cut out (2/3 nephrectomy). The cavity was closed by double sutures of muscle and skin using a non‑absorbable surgical suture once the bleeding had ceased. One week after the 2/3 nephrectomy, the right kidney was exposed and removed (i.e., 5/6 nephrectomy). In each case, benzyl penicillin was applied on sutures to prevent infections immediately following the surgery, Animals in the sham group underwent the same surgical procedure as above, except that the kidneys were not removed or cut: The kidneys were merely touched with forceps and threads. Similar post‑operative care was also administered. After the operation, rats were placed individually in cages and were granted free access to food and water.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eBiological detection\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDuring the administration period, the physiological state of the rats was observed, and their body weight was recorded every week. In addition, the behavior, mental state, hair, and other physiological parameters of the rats were also monitored. Serum was collected from the fundus vein every 2 weeks, heparin was used as anticoagulant, and the plasma was subsequently separated by centrifugation at 13,000 \u003cem\u003eg\u003c/em\u003e for 10 min at 4\u0026deg;C. Plasma was collected and used for estimation of the sought‑after biochemical parameters, including Scr, BUN, super oxide dismutase (SOD), alanine aminotransferase (ALT) and aspartate aminotransferase (AST). The plasma biochemical index was measured using a kinetic color test (i.e., the Jaffe method using an Olympus AU400\u003csup\u003e\u0026reg;\u003c/sup\u003e clinical chemistry analyzer). Immediately before and after the 4th, the 6th and the 8th week post‑surgery, 2 ml urine sample was collected from all the groups for analysis of the level of urine protein (UPr). Subsequently, the urine volume was measured during the last week of medicine administration.\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eA serum TGF‑\u0026beta;1 ELISA kit for rats (Shanghai Westang Bio‑Tech Co., Ltd; Shanghai, China) was used to determine the TGF‑\u0026beta;1 level in the rat serum. In a glass tissue grinder, the rat kidneys were homogenized for 30 sec in prechilled methanol. The homogenate was centrifuged at 4\u0026deg;C for 20 min at 13,000 \u003cem\u003eg\u003c/em\u003e, and the supernatant was retained.\u003c/p\u003e\n\u003cp\u003eAll the rats were euthanized with pentobarbital injection (i.p.), the dose of pentobarbital was 130mg/kg. Then, the kidney remnants were taken out, weighed, teared off of the envelope, flushed with PBS, and fixed in 10% buffered formalin. Kidneys were then processed in paraffin. The pathologist, who was blinded to the treatment, duration, and genotype of the samples, examined the representative kidney sections of 3 rats from every group. Sections (5 \u0026mu;m‑thick) of tissue, following Masson and hematoxylin and eosin (H\u0026amp;E) staining, were evaluated according to a standard staining protocol. At high magnification (x 200), 6 complete glomeruli were randomly selected, histology scores were assessed according to morphological criteria, and the ratio of the proportion of the kidney affected by individual changes to the total area of the kidney sectioned was determined. To calculate the glomerular sclerosis index (GSI), histological scores were presented on an ordinal scale of 1‑4. According to the lesion degree of renal tubules and glomerulus, the higher the score, the more serious the lesion.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eCell culture and treatment\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHKC cells (a proximal tubule epithelial cell line) were grown in DMEM (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum. Cells were maintained at 37\u0026deg;C in an incubator under a saturated humid atmosphere containing 95% air and 5% CO\u003csub\u003e2\u003c/sub\u003e. Cells were passaged once every 3 days. The cells were purchased from National Infrastructure of Cell Resource (Beijing, China), and all experiments were performed on cells between passages 10‑20. The HKC cells were pretreated with H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (0.6 mM) for 4 h, and then co‑treated with Jianshen Granule solution (at concentrations of 0.5, 1, 2 mg/ml) or UCG solution (1 mg/ml) for 24 h.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eCell viability analysis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCytotoxicity was assayed in HKC cells grown in 96‑well plates. Cells (1.5x10\u003csup\u003e5 \u003c/sup\u003ecells/ml; 0.1 ml per well) were seeded into plates and allowed to grow overnight before replacement of the medium with serum‑free medium supplemented with H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e for 4 h, and then co‑treated with Jianshen Granule solution (0.5, 1, 2 mg/ml) or UCG solution (1 mg/ml) for 24 h. Subsequently, 10 \u0026mu;l Cell Counting Kit‑8 (CCK‑8) (Sigma‑Aldrich, Darmstadt, Germany) was added into each well and incubated for 1‑4 h. The absorbance was read at 450 nm with a PerkinElmer Victor X Microplate Reader (PerkinElmer, Inc., Waltham, MA, USA). Reductions in optical density (OD) due to drug treatment were used to assess cell viability and normalized against control incubated in medium (100% viability).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eMeasurement of the mitochondrial membrane potential (MMP)\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMMP was measured using flow cytometry, and the mitochondrial‑specific cationic dye, JC‑1. HKC cells (1.5x10\u003csup\u003e5\u003c/sup\u003e cells/ml) were plated in 12‑well plates with H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e for 4 h, and then co‑treated with Jianshen Granule solution (0.5, 1, 2 mg/ml) or UCG solution (1 mg/ml) for 24 h. Cells were harvested, washed twice with PBS, and incubated with 0.5 mL JC‑1 (25 \u0026mu;M) for 20 min at 37\u0026deg;C. MMP was assayed, and green (JC‑1 monomer) and red (JC‑1 aggregate) fluorescence were monitored at emission wavelengths of 525 and 595 nm, respectively. Changes in the ratio between measurements were indicative of changes in the MMP.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eMeasurements of intracellular ROS and Ca\u003csup\u003e2+\u003c/sup\u003e\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHKC cells (1.5x10\u003csup\u003e5\u003c/sup\u003e cells/ml) were plated in 12‑well plates with the indicated concentrations of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e for 4 h, and subsequently co‑treated with Jianshen Granule solution (0.5, 1, 2 mg/ml) or UCG solution (1 mg/ml) for 24 h. Intracellular ROS and cytosolic Ca\u003csup\u003e2+\u003c/sup\u003e were measured using the fluorescent probes Dichlorofluorescein diacetate (DCFH DA) (Sigma‑Aldrich, Darmstadt, Germany) and fluo‑3‑acetoxymethyl ester (Fluo‑3‑AM) (Biosea Biotechnology, Beijing, China), respectively, and a fluorescence‑activated cell sorter. DCFH‑DA is converted into a fluorescent compound in the presence of ROS. Fluo‑3‑AM was added to treated cells to measure Ca\u003csup\u003e2+\u003c/sup\u003e. After treatment with the indicated drugs, cells were incubated with DCFH‑DA (10 \u0026mu;M) for 20 min at 37\u0026deg;C in the dark (for the ROS assay) or Fluo‑3/AM (5 \u0026mu;mol/l) for 30 min at 37\u0026deg;C (the Ca\u003csup\u003e2+\u003c/sup\u003e assay), and the cells were then harvested and suspended in 500 \u0026mu;l HBSS. Intracellular ROS and Ca\u003csup\u003e2+\u003c/sup\u003e were measured using a flow cytometer (excitation wavelength, 488 nm; emission wavelength, 535 nm).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eCell apoptosis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eApoptosis was also measured using Annexin V‑fluorescein isothiocyanate (FITC)‑propidium iodide (PI) double‑stained apoptosis detection kit (Biosea Biotechnology ,Beijing, China). HKC cells were plated (1.5x10\u003csup\u003e5\u003c/sup\u003e cells/ml; 0.1 ml) in 12‑well plates with the indicated concentrations of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e for 4 h, and then co‑treated with Jianshen Granule solution (0.5, 1, 2 mg/ml) or UCG solution (1 mg/ml) for 24 h. Cells were harvested, washed twice with ice‑cold PBS, and then suspended in 200 \u0026mu;l ice‑cold binding buffer. Subsequently, 10 \u0026mu;l HRP FITC‑labeled annexin V and 5 \u0026mu;L PI were added to the cells. The cell suspension was gently mixed, and incubated for 15 min at room temperature in the dark. Apoptosis was monitored using flow cytometry (488 nm excitation wavelength), and the fluorescence intensity was measured at 530 nm (emission wavelength). Annexin V\u003csup\u003e+\u003c/sup\u003e/PI\u003csup\u003e‑\u003c/sup\u003e was used to document early apoptosis, whereas AnnexinV\u003csup\u003e+\u003c/sup\u003e/PI\u003csup\u003e+\u003c/sup\u003e was used to assess the late apoptotic stages or necrotic cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eRT‑qPCR assay\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHKC cells were treated with different concentrations of Jianshen Granule solution for the indicated times. Total RNA was extracted from kidney tissue and HKC cells using Invitrogen\u003csup\u003e\u0026reg;\u003c/sup\u003e TRIzol reagent (Thermo Fisher Scientific, Inc.), and cDNA was made by random hexamers. Quantitative PCR was monitored in a Real‑Time PCR detection system (Gene Amp 2400\u003csup\u003e\u0026reg;\u003c/sup\u003e; PerkinElmer, Inc.) with SYBR Green Supermix (Bio‑Rad Laboratories, Inc., Hercules, CA, USA) and relevant primers. The primer sequences are shown in Tables 1 and 2. The percentages of the above molecules were quantified using StepOne Plus\u003csup\u003eTM\u003c/sup\u003e Real Time PCR (Applied Biosystems; StepOne Plus\u003csup\u003eTM\u003c/sup\u003e 272006169).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1 Primers of renal tissue\u003c/strong\u003e\u003c/p\u003e\n\u003ctable\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"235\"\u003e\u003cstrong\u003e\u003cbr /\u003e \u003c/strong\u003e\n\u003cp\u003e\u003cstrong\u003eRenal tissue\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"288\"\u003e\n\u003cp\u003e\u003cstrong\u003ePrimers\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"235\"\u003e\n\u003cp\u003eTGF-\u0026beta;1 F\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"288\"\u003e\n\u003cp\u003eGAAGGACCTGGGTTGGAAG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"235\"\u003e\n\u003cp\u003eTGF-\u0026beta;1 R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"288\"\u003e\n\u003cp\u003eCGGGTTGTGTTGGTTGTAG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"235\"\u003e\n\u003cp\u003e\u0026beta;-actin F\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"288\"\u003e\n\u003cp\u003eGGGAAATCGTGCGTGACATT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"235\"\u003e\n\u003cp\u003e\u0026beta;-actin R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"288\"\u003e\n\u003cp\u003eGCGGCAGTGGCCATCTC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2 Primers of HKC cells\u003c/strong\u003e\u003c/p\u003e\n\u003ctable\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"235\"\u003e\n\u003cp\u003e\u003cstrong\u003eHKC cells\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"288\"\u003e\n\u003cp\u003e\u003cstrong\u003ePrimers\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"235\"\u003e\n\u003cp\u003eTGF-\u0026beta;1 F\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"288\"\u003e\n\u003cp\u003eGGAAATTGAGGGCTTTCGCC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"235\"\u003e\n\u003cp\u003eTGF-\u0026beta;1 R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"288\"\u003e\n\u003cp\u003eCCGGTAGTGAACCCGTTGAT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"235\"\u003e\n\u003cp\u003e\u0026beta;-actin F\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"288\"\u003e\n\u003cp\u003eCGGCGCCCTATAAAACCCA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"235\"\u003e\n\u003cp\u003e\u0026beta;-actin R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"288\"\u003e\n\u003cp\u003eTCATCATCCATGGTGAGCTGG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eWestern blot assay\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eProteins from kidney tissues and HKC cells were acquired and sonicated in RIPA lysis buffer. Aliquots (40 \u0026micro;g) of proteins were subjected to SDS‑PAGE (10% gels), and electro‑transferred to PVDF membranes. The protein‑containing PVDF membrane was blocked in blocking buffer (5% non‑fat dry milk in Tris‑buffered saline containing 0.1% Tween‑20; TBST) for 2 h, incubated with the primary antibody (see above) for 3 h, and subsequently incubated at 4\u0026deg;C overnight. The membranes were incubated with secondary antibody (HRP‑conjugated IgG for 1 h) and the protein bands were quantified using a luminescent image analyzer (GE Healthcare Bio‑Sciences AB; Image Quant LAS 500; Sweden). The protein expression levels were normalized against GAPDH.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eStatistical analysis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data are expressed as the mean \u0026plusmn; SEM. \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05 was considered to indicate a statistically significant value. All the statistical calculations were performed using Prism software package (GraphPad Prism, version 5) with unpaired or paired t‑test, depending on the type of comparison being made.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAnimal model of nephrectomy\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe rat CRF model was established by 5/6 nephrectomy. The levesl of Scr and BUN in rat serum of the model group were found to be significantly higher than those of the sham group (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05). This suggested that the model had been built successfully (Fig. 1).\u003c/p\u003e\n\u003cp\u003eFig 1\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003ePharmacodynamic evaluation\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDuring the drug administration, the rats of the sham group were noted to be livelier and more energetic, with bright hair color and normal gains of weight. By contrast, the 5/6 nephrectomy model rats were mentally depressed, with slightly protruding eyeballs, dark hair color and a lower consumption of food. However, upon treatment of Jianshen granule and UCG, the mental state of the rats was gradually restored, which became similar to that of the sham operation group.\u003c/p\u003e\n\u003cp\u003eNo significant differences in the weight of the rats before or after the nephrectomy were observed. However, the body weight of the rats in the nephrectomy group were found to be lower than those of the sham group 2 weeks after surgery (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05). By the end of the treatment cycle, the body weights of the rats in the JS‑L and JS‑M groups were significantly higher compared with that of the model group (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05). The boy weights in the JS‑H group were lower compared with that of the model group, until after 7 or 8 weeks. Taken together, these results suggested that low or medium doses of Jianshen Granules enabled the CRF rats to retain their weights, whereas a high dose of Jianshen Granules had no effect (Fig. 2).\u003c/p\u003e\n\u003cp\u003eFig 2\u003c/p\u003e\n\u003cp\u003eChanges in renal function can be assessed according to the levels of Scr and BUN. In the present study, the Scr and BUN levels were significantly increased in the model group compared with the sham group (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05). However, treatment with Jianshen Granules did lead to a significant reduction in the increases of Scr and BUN levels that were observed in CRF rats (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05), signifying that residual renal functions were protected, and renal failure symptoms were relieved (Fig. 3A and B). Furthermore, no differences were observed between the Jianshen group and the UCG group.\u003c/p\u003e\n\u003cp\u003eChanges in the levels of ALT and AST can be used to characterize the degree of damage of liver function. In these experiments, no significant differences were observed between the sham group and the other groups attributable to fluctuations in the ALT and AST values in each group, indicating that Jianshen Granules caused no damage to the liver function of CRF rats (Fig. 3C and D).\u003c/p\u003e\n\u003cp\u003eCompared with the model group, the level of SOD in each treatment group increased, but there was no statistical difference among the three groups (Fig. 3E). This shows that Jianshen granule can reduce oxidative stress in vivo.\u003c/p\u003e\n\u003cp\u003eFig 3\u003c/p\u003e\n\u003cp\u003eIn terms of the analysis of the level of UPr, the UPr level of the model group was shown to increase rapidly, and the UPr level in the JS group was significantly lower compared with that in the model group (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05). The UPr content was lowest in the JS‑M group. Furthermore, the UPr level in the JS groups were lower compared with that in the UCG group (Fig. 4A). The volume of urine in the JS groups were also lower compared with that in the model group, while the JS‑M group had the lowest levels of all JS groups, also lower than the UCG group. These results suggested that Jianshen Granules may lead to an improvement in reabsorption of the renal tubules, and the effect was observed to be the best in the JS‑M group (Fig. 4B).\u003c/p\u003e\n\u003cp\u003eFig 4\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eHistological analysis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe sham group appeared to have no obvious renal lesions, whereas the other groups exhibited different degrees of lesions, including renal membrane fibrosis, renal interstitium (i.e. interstitial fibrosis and chronic inflammation), and renal parenchyma lesions (i.e. renal tubule dilatation, protein tube type, peripheral glomerular fibrosis, glomerular mesangial hyperplasia and glomerular cysts deposition). Although the Jianshen Granule group also had similar pathological changes, these were significantly less severe compared with the other groups (Fig. 5A and B). According to the GSI, histological scores were determined (Fig. 5C). The model group rats were observed to have significantly higher scores compared with sham group, which indicated that severe renal lesions existed in the model group. The scores of the Jianshen Granule groups and the UCG group were lower compared with that of model group; taken together, these results demonstrated that Jianshen Granule and UCG treatment was able to relieve the lesions, and the JS‑M group experienced the best effect.\u003c/p\u003e\n\u003cp\u003eFig 5\u003c/p\u003e\n\u003cp\u003ePrevious research has shown that TGF‑\u0026beta;1 is a key pro‑fibrotic growth factor involved in renal fibrogenesis, and an important factor among cytokines due to its upregulation in patients with chronic renal failure. In the present study, the TGF‑\u0026beta;1 level was shown to be increased in the kidney tissues of 5/6 nephrectomy rats, whereas Jianshen Granule treatment led to a marked decrease in the level of TGF‑\u0026beta;1. These results were confirmed by western blot analysis of TGF‑\u0026beta;1 (Fig. 6A). Similar results were also obtained by ELISA (Fig.6C). In addition, the mRNA expression level of TGF‑\u0026beta;1 was markedly reduced upon treatment with Jianshen Granules (Fig. 6B).\u003c/p\u003e\n\u003cp\u003eFig 6\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eCell function is influenced by Jianshen Granules\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) is able to cause oxidative damage to cells, leading to apoptosis. In order to evaluate the effects of Jianshen Granules on H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e‑induced cell death, the viability of the HKC cells by CCK‑8 assay was first investigated, and it was identified that Jianshen Granules led to a significant improvement in the HKC cells\u0026rsquo; viability compared with H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e group (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01) (Fig. 7).\u003c/p\u003e\n\u003cp\u003eFig 7\u003c/p\u003e\n\u003cp\u003eIn addition, annexin‑V and PI staining were performed, and flow cytometry was used to distinguish living cells from apoptotic and necrotic cells. These experiments demonstrated that the number of apoptotic cells in the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e group was significantly higher compared with those in the control group (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01), whereas the extent of apoptosis of HKC cells in the JS‑M, JS‑H and UCG groups was significantly lower compared with that in the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e group (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 or \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05). However, no significant differences were observed among the JS‑M, JS‑H and UCG groups. These results revealed that treatment with Jianshen Granules was able to protect the HKC cells from H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e‑induced apoptosis (Fig. 8A).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;As a marker of oxidative stress, ROS participate in renal injury through oxidative stress and inflammatory reactions, and the levels of ROS are increased markedly in both acute and chronic renal failure[\u003ca href=\"#_ENREF_13\"\u003e13\u003c/a\u003e]. In the present study, the levels of intracellular ROS in the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e group were found to be significantly higher compared with those of the control group (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01) (Fig. 8B). In addition, the ROS level in the Jianshen Granule treatment group was also significantly lower compared with that in the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e group (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05). Therefore, ROS production was shown to be effectively inhibited by Jianshen Granules.\u003c/p\u003e\n\u003cp\u003eWhen cells are stimulated by external stress, the mitochondrial function is compromised, with a decrease in the MMP, and an increase in the levels of ROS and the intracellular Ca\u003csup\u003e2+\u003c/sup\u003e concentration [\u003ca href=\"#_ENREF_14\"\u003e14\u003c/a\u003e]. In the present study, after HKC cells were stimulated by H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, the intracellular Ca\u003csup\u003e2+ \u003c/sup\u003elevel increased significantly, whereas the MMP level decreased significantly (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 and \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, respectively). After administration of Jianshen Granules or UCG, the Ca\u003csup\u003e2+\u003c/sup\u003e concentration was reduced markedly, and the MMP level was elevated to an appreciable extent compared with that in the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e group (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01). The decreases in Ca\u003csup\u003e2+\u003c/sup\u003e and MMP caused by cell damage were also found to be alleviated following treatment with Jianshen Granules (Fig. 8C and D).\u003c/p\u003e\n\u003cp\u003eFig 8\u003c/p\u003e\n\u003cp\u003eTo further investigate the correlation between TGF‑\u0026beta;1 and renal failure, the protein expression level of TGF‑\u0026beta;1 was analyzed by western blot analysis, and the mRNA expression level of TGF‑\u0026beta;1 was also assessed by RT‑qPCR in the HKC cells. In these experiments, the TGF‑\u0026beta;1 level was increased in the HKC cells induced by H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, whereas Jianshen Granules were able to significantly decrease the protein and mRNA expression of TGF‑\u0026beta;1 (Fig. 9).\u003c/p\u003e\n\u003cp\u003eFig 9\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAlthough numerous studies have been published on CRF, effective drugs available for clinical treatment are very limited in supply [\u003ca href=\"#_ENREF_15\"\u003e15\u003c/a\u003e, \u003ca href=\"#_ENREF_16\"\u003e16\u003c/a\u003e]. Treatment of CRF by TCM has elicited positive results, however, and this approach has led to a diversification of treatment methods, broadening developmental prospects for therapy[\u003ca href=\"#_ENREF_17\"\u003e17\u003c/a\u003e]. To name but a few of the effects, TCM has had impressive achievements in relieving symptoms of CRF, protecting residual renal function, delaying the progress of the disease, and postponing the time of dialysis and the requirement for kidney transplantation, thereby greatly improving the quality of life for patients with CRF[\u003ca href=\"#_ENREF_18\"\u003e18\u003c/a\u003e].\u003c/p\u003e\n\u003cp\u003eJianshen Granules are a clinically effective prescription medicine, composed of 11 separate TCMs, and has been shown to be suitable for the treatment of early CRF. It has been used for 9 years as a hospital formulation in the Air Force Medical Center of PLA. The prescription helps to maintain kidney function, and the kidneys are stimulated with Radix \u003cem\u003eRehmanniae\u003c/em\u003e and \u003cem\u003eCornus\u003c/em\u003e, thereby and maintaining the remaining metabolic function of the kidneys. It can also nourish the blood, promote blood circulation, and improve the state of systemic deficiency via the presence of the ingredients \u003cem\u003ePoria cocos\u003c/em\u003e, \u003cem\u003eAstragali\u003c/em\u003e radix, and \u003cem\u003eAngelica sinensis\u003c/em\u003e. Detoxifying turbidity and removing toxins in the body are accomplished by \u003cem\u003elumbricus\u003c/em\u003e, \u003cem\u003eHoneysuckle\u003c/em\u003e, and \u003cem\u003eRhubarb.\u003c/em\u003e Moreover, Jianshen Granules also have the function of being able to activate blood circulation, removing blood stasis and reducing glomerular fibrosis, courtesy of the presence of \u003cem\u003eSalvia\u003c/em\u003e \u003cem\u003emiltiorrhiza\u003c/em\u003e radix and \u003cem\u003eLigusticum chuanxiong\u003c/em\u003e Hort. The combination of the various traditional medicines not only improves the functioning of the spleen and kidney, but also removes blood stasis, reduces turbidity and detoxifies the blood, promotes the excretion of toxins in the body, and promotes the decomposition, transformation and recovery of the renal function of metabolic waste.\u003c/p\u003e\n\u003cp\u003eScr and BUN are mainly excreted in the urine following glomerular filtration[\u003ca href=\"#_ENREF_19\"\u003e19\u003c/a\u003e]. When the renal parenchyma is damaged, the glomerular filtration rate decreases, resulting in increases in the levels of Scr and BUN in the blood[\u003ca href=\"#_ENREF_20\"\u003e20\u003c/a\u003e]. Therefore, Scr and BUN are the main indicators of clinical diagnosis of renal failure. In the present study, the Scr and BUN levels were significantly elevated in 5/6 nephrectomized rats, but their levels were reduced upon treatment with Jianshen Granules, suggesting that Jianshen Granules help to alleviate the symptoms of renal failure. Clinical trials have shown that reducing UPr may protect the kidneys; these results were corroborated by the present study, in which Jianshen Granules lowered the UPr in the 5/6 nephrectomized rats. It has also been demonstrated that Jianshen Granules have the function of protecting kidney function. ALT and AST may be used to evaluate whether liver function has been compromised. In our experiments, the levels of ALT and AST in 5/6 nephrectomized rats of the Jianshen Granule group were not significantly different from those of the sham group, demonstrating that Jianshen Granules have no liver toxicity.\u003c/p\u003e\n\u003cp\u003eTubulointerstitial fibrosis is a common pathological pathway for the progression of chronic kidney diseases to end‑stage renal failure caused by various etiologies[\u003ca href=\"#_ENREF_21\"\u003e21\u003c/a\u003e]. TGF‑\u0026beta;1 is a driving force of renal fibrosis[\u003ca href=\"#_ENREF_22\"\u003e22\u003c/a\u003e]. Clinical data published previously have shown that TGF‑\u0026beta;1 levels in the kidney and urine of patients with kidney diseases were markedly increased, and this increase was positively correlated with the degree of renal fibrosis[\u003ca href=\"#_ENREF_23\"\u003e23\u003c/a\u003e]. In the present study, both the protein and mRNA expression levels of TGF‑\u0026beta;1 in 5/6 nephrectomized rats were significantly increased, and these increases were inhibited upon treatment with Jianshen Granules. These findings indicate that Jianshen Granules may relieve the symptoms of renal failure by downregulating TGF‑\u0026beta;1 expression.\u003c/p\u003e\n\u003cp\u003eIt has been reported that oxidative stress is involved in damage to the glomerulus and tubulointerstitium [\u003ca href=\"#_ENREF_24\"\u003e24\u003c/a\u003e], processes which lead to the chronic development of renal failure, ultimately leading to the end stage of renal failure[\u003ca href=\"#_ENREF_25\"\u003e25\u003c/a\u003e]. When the body is under oxidative stress conditions, the balance between oxidation and anti‑oxidation is disrupted. The increases in ROS levels in the cells exceed their scavenging capacity, which may lead to oxidative damage, abnormal protein expression, and cell damage [\u003ca href=\"#_ENREF_26\"\u003e26\u003c/a\u003e, \u003ca href=\"#_ENREF_27\"\u003e27\u003c/a\u003e]. ROS induces apoptosis by altering the MMP. Furthermore, scholar[\u003ca href=\"#_ENREF_28\"\u003e28\u003c/a\u003e]provided evidence that cell apoptosis, including experiments performed on renal tubular epithelial HKC cells, is a critical determinant of renal fibrosis, which eventually results in CRF. Constructing the cell model of oxidative stress injury by subjecting cells to H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e treatment is currently recognized and widely used[\u003ca href=\"#_ENREF_29\"\u003e29\u003c/a\u003e]. The present study has shown that Jianshen Granules are able to inhibit H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e‑induced apoptosis of the HKC cells. Although the intracellular ROS of HKC cells were markedly increased upon H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2 \u003c/sub\u003etreatment, these increases were reversed by treatment with Jianshen Granules. Furthermore, the Ca\u003csup\u003e2+\u003c/sup\u003e level is in equilibrium when cells are in their normal state, but this balance is destroyed when the cells are damaged. It has been demonstrated that increases in Ca\u003csup\u003e2+\u003c/sup\u003e concentration of the cells lead to cellular dysfunction, resulting in an imbalance of energy metabolism, which subsequently leads to the pathological state of the body[\u003ca href=\"#_ENREF_30\"\u003e30\u003c/a\u003e]. It has been shown that increases in the Ca\u003csup\u003e2+\u003c/sup\u003e concentration are negatively correlated with cell viability, indicating that cell death is associated with an increase in intracellular Ca\u003csup\u003e2+\u003c/sup\u003e concentration. \u003cem\u003eIn vitro\u003c/em\u003e studies have confirmed that ROS lead to the change of intracellular Ca\u003csup\u003e2+\u003c/sup\u003e[\u003ca href=\"#_ENREF_31\"\u003e31\u003c/a\u003e]. Numerous \u003cem\u003ein vitro\u003c/em\u003e studies have demonstrated that ROS can induce extracellular Ca\u003csup\u003e2 +\u003c/sup\u003e influx, and they may therefore be convenient signal markers in regulating calcium signaling processes[\u003ca href=\"#_ENREF_32\"\u003e32\u003c/a\u003e]. Mitochondria are the main site for the production of ROS, and also the main target of ROS. Numerous studies have shown that excessive ROS can cause oxidative damage to mitochondria, resulting in their abnormal function[\u003ca href=\"#_ENREF_33\"\u003e33\u003c/a\u003e, \u003ca href=\"#_ENREF_34\"\u003e34\u003c/a\u003e]. The abnormalities of this function are mainly manifested in a reduction of MMP, mitochondrial DNA mutation, disruption of the mitochondrial respiratory chain, and so on [\u003ca href=\"#_ENREF_35\"\u003e35\u003c/a\u003e]. In the present study, the increase in Ca\u003csup\u003e2+\u003c/sup\u003e concentration, and concomitant decrease in MMP, caused by ROS were inhibited by Jianshen Granules, indicating that Jianshen Granules are able to inhibit cell injury.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;During renal pathogenesis, apoptosis of HKC cells may lead to atrophy of renal tubular and interstitial fibrosis, which ultimately leads to the progression of chronic kidney disease to end‑stage renal failure[\u003ca href=\"#_ENREF_36\"\u003e36\u003c/a\u003e]. Previous studies have shown that preventing apoptosis of the HKC cells may effectively delay the progression of renal fibrosis, and reduce the damage caused to renal function[\u003ca href=\"#_ENREF_37\"\u003e37\u003c/a\u003e, \u003ca href=\"#_ENREF_38\"\u003e38\u003c/a\u003e]. Apoptosis of HKC cells may be induced by TGF‑\u0026beta;1. Previous studies have also shown that reducing the mRNA expression level of TGF‑\u0026beta;1, and downregulating the expression of TGF‑\u0026beta;1 protein, can reduce the apoptosis of HKC cells[\u003ca href=\"#_ENREF_39\"\u003e39\u003c/a\u003e]. Therefore, TGF‑\u0026beta;1 may be a therapeutic target for clinical prevention and treatment of renal tubular atrophy, alleviating the degree of renal fibrosis, and delaying renal dysfunction[\u003ca href=\"#_ENREF_40\"\u003e40\u003c/a\u003e]. In the present study, upregulation of the levels of TGF‑\u0026beta;1 mRNA and protein was inhibited upon treatment with Jianshen Granules. Therefore, downregulating TGF‑\u0026beta;1 expression may have contributed to the apoptosis inhibition in HKC cells mediated by Jianshen Granules.\u003c/p\u003e\n\u003cp\u003eOur research also has certain limitations. Jianshen granules are composed of 11 kinds of traditional Chinese medicine, and the exact active ingredients cannot be determined at present. Next, we will use fingerprints to determine the active ingredients.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, the present study has demonstrated that Jianshen Granules are able to reduce the levels of Scr, BUN and UPr in CRF rats, and thereby may protect the residual renal function, alleviating the symptoms of renal failure. Moreover, this medicine had no obvious side effects on liver function. Jianshen Granules are also able to inhibit apoptosis induced by H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e. Taken together, the results of the present study have shown that Jianshen Granules may alleviate renal failure by inhibiting the expression of TGF‑\u0026beta;1. This study has confirmed the efficacy of Jianshen Granules with respect to therapeutic treatment of CRF, \u0026nbsp;thereby providing important information for the clinical treatment of CRF.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eCRF, chronic renal failure; UCG, uremic clearance granule; ROS, reactive oxygen species; PLA, Chinese People's Liberation Army; TGF \u0026beta;1, transforming growth factor \u0026beta;1; TCM, traditional Chinese medicine.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experimental procedures involving the animals were performed according to the protocols approved by National Beijing Center for Drug Safety Evaluation and Research, the approval number is IACUC-2018-035.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analysed during this study are included in this published article. All figures can be used as supplementary information to the data.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflicts of interest to disclosure.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants from Beijing Municipal Science \u0026amp; Technology Commission (No.Z161100001816008), the expenditure of the the study was supported by the funder.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eL-N Du and H-L Yuan were contributed to the conceptualization, study design, and manuscript revision. Y Wu, X-X Zhang, J Kong, and H-J Lu contributed to the data collection, analysis and interpretation. X-X Zhang, H-Y Qiu involved in drafting manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors want to thank Dr. Qingxin Mu with his help in modifying the manuscript\u003cstrong\u003e . \u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLiu M, Park J, Wu X, LI Y, Tran Q, Mun K, Lee Y, Hur GM, Wen A, Park J: Shen-Kang protects 5/6 nephrectomized rats against renal injury by reducing oxidative stress through the MAPK signaling pathways. \u003cem\u003eInternational journal of molecular medicine\u003c/em\u003e 2015, 36:975-984.\u003c/li\u003e\n\u003cli\u003eZhang L, Wang F, Wang L, Wang W, Liu B, Liu J, Chen M, He Q, Liao Y, Yu X: Prevalence of chronic kidney disease in China: a cross-sectional survey. \u003cem\u003eThe Lancet\u003c/em\u003e 2012, 379(9818):815-822.\u003c/li\u003e\n\u003cli\u003eKontomanolis E, Panagoutsos S, Pasadakis P, Koukouli Z, Liberis A: Chronic renal failure, diabetes mellitus type-II, and gestation: an overwhelming combination. \u003cem\u003eClin Exp Obstet Gynecol\u003c/em\u003e 2016, 43(2):276-279.\u003c/li\u003e\n\u003cli\u003eKhoury T, Tzukert K, Abel R, Abu Rmeileh A, Levi R, Ilan Y: \u003cstrong\u003eThe gut-kidney axis in chronic renal failure: A new potential target for therapy\u003c/strong\u003e. \u003cem\u003eHemodialysis international International Symposium on Home Hemodialysis \u003c/em\u003e2017, \u003cstrong\u003e21\u003c/strong\u003e(3):323-334.\u003c/li\u003e\n\u003cli\u003eNeto JRS, e Castro LMF, de Oliveira FS, Silva AM, dos Reis LM, Quirino APA, Dragosavac D, Kosour CJJopts: \u003cstrong\u003eComparison between two physiotherapy protocols for patients with chronic kidney disease on dialysis\u003c/strong\u003e. \u003cem\u003eJournal of physical therapy science \u003c/em\u003e2016, 28(5):1644-1650.\u003c/li\u003e\n\u003cli\u003eImpellizzeri D, Esposito E, Attley J, Cuzzocrea SJPR: \u003cstrong\u003eTargeting inflammation: new therapeutic approaches in chronic kidney disease (CKD)\u003c/strong\u003e. \u003cem\u003ePharmacological Research\u003c/em\u003e 2014, \u003cstrong\u003e81\u003c/strong\u003e:91-102.\u003c/li\u003e\n\u003cli\u003eBrunet P: \u003cstrong\u003eTreatment of chronic kidney failure by haemodialysis\u003c/strong\u003e. \u003cem\u003eSoins; la Revue de Reference Infirmiere \u003c/em\u003e2018, \u003cstrong\u003e62\u003c/strong\u003e(826):21-23.\u003c/li\u003e\n\u003cli\u003eGuan Y, Wu X, Duan J, Yin Y, Guo C, Wei G, Wang Y, Zhu Y, Weng Y, Xi M\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eEffects and Mechanism of Combination of Rhein and Danshensu in the Treatment of Chronic Kidney Disease\u003c/strong\u003e. \u003cem\u003eThe American journal of Chinese medicine \u003c/em\u003e2015, \u003cstrong\u003e43\u003c/strong\u003e(7):1381-1400.\u003c/li\u003e\n\u003cli\u003eXu L, Ma J, Chen B: \u003cstrong\u003eClinical observation on Jianshen Granules combined with syndrome differentiation and treatment on chronic renal failure\u003c/strong\u003e. \u003cem\u003eJournal of Beijing University of Traditional Chinese Medicine \u003c/em\u003e2005, \u003cstrong\u003e28\u003c/strong\u003e(6):83-85.\u003c/li\u003e\n\u003cli\u003eLimei X, Jianwei M, Xinying M: \u003cstrong\u003eEffect of Jianshen Granule on Kidney TGF-\u0026beta;1,ET-1mRNA and Function of Rats with Diabetic Nephrosis(DN)\u003c/strong\u003e. \u003cem\u003eJournal of Zhejiang University of Traditional Chinese Medicine \u003c/em\u003e2010, \u003cstrong\u003e34\u003c/strong\u003e(3):307-308.\u003c/li\u003e\n\u003cli\u003eSuzuki Y, Yamaguchi I, Onoda N, Saito T, Myojo K, Imaizumi M, Takada C, Kimoto N, Takaba K, Yamate JJE\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eDifferential renal glomerular changes induced by 5/6 nephrectomization between common marmoset monkeys (Callithrix jacchus) and rats\u003c/strong\u003e.\u003cem\u003e Experimental toxicologic pathology\u003c/em\u003e 2013, 65(5):667-676.\u003c/li\u003e\n\u003cli\u003eXiao X, Mo L, Song S, Qin M, Yang XJNfykdxxbJoSMU: \u003cstrong\u003eCompound huang gan delays chronic renal failure after 5/6 nephrectomy in rats\u003c/strong\u003e. \u003cem\u003eJournal of Southern Medical University\u003c/em\u003e 2014, \u003cstrong\u003e34\u003c/strong\u003e(11):1661-1667.\u003c/li\u003e\n\u003cli\u003eMaria DA, Xueliang D, Daniela P, Massimo P-M, Angelo C, Ferdinando G, Angela Bruna M, Anna Laura C, Michael B, Ida G: \u003cstrong\u003eUrea-induced ROS cause endothelial dysfunction in chronic renal failure\u003c/strong\u003e. \u003cem\u003eAtherosclerosis \u003c/em\u003e2015, \u003cstrong\u003e239\u003c/strong\u003e(2):393-400.\u003c/li\u003e\n\u003cli\u003eWang Y, Han B, Ding J, Qiu C, Wang W: \u003cstrong\u003eEndoplasmic reticulum stress mediates osteocyte death under oxygen-glucose deprivation in vitro\u003c/strong\u003e. \u003cem\u003eActa histochemica \u003c/em\u003e2020, \u003cstrong\u003e122\u003c/strong\u003e(6):151577.\u003c/li\u003e\n\u003cli\u003eTang P, Zhang Y, Chan M, Lam W, Chung J, Kang W, To K, Lan H, Tang P: \u003cstrong\u003eThe Emerging Role of Innate Immunity in Chronic Kidney Diseases\u003c/strong\u003e. \u003cem\u003eInternational journal of molecular sciences \u003c/em\u003e2020, \u003cstrong\u003e21\u003c/strong\u003e(11).\u003c/li\u003e\n\u003cli\u003eRapa S, Di Iorio B, Campiglia P, Heidland A, Marzocco S: \u003cstrong\u003eInflammation and Oxidative Stress in Chronic Kidney Disease-Potential Therapeutic Role of Minerals, Vitamins and Plant-Derived Metabolites\u003c/strong\u003e. \u003cem\u003eInternational journal of molecular sciences \u003c/em\u003e2019, \u003cstrong\u003e21\u003c/strong\u003e(1).\u003c/li\u003e\n\u003cli\u003eZhu X, Chen Z: \u003cstrong\u003eThe improvement effects of Yiqi Huashi Tongluo Formula on oxidative stress and renal fibrosis of experimental CRF rats\u003c/strong\u003e. \u003cem\u003eChinese journal of applied physiology \u003c/em\u003e2020, \u003cstrong\u003e36\u003c/strong\u003e(1):67-72.\u003c/li\u003e\n\u003cli\u003eYang X, Hu C, Wang S, Chen Q: \u003cstrong\u003eClinical efficacy and safety of Chinese herbal medicine for the treatment of patients with early diabetic nephropathy: A protocol for systematic review and meta-analysis\u003c/strong\u003e. \u003cem\u003eMedicine \u003c/em\u003e2020, \u003cstrong\u003e99\u003c/strong\u003e(29):e20678.\u003c/li\u003e\n\u003cli\u003eKhan Z, Pandey MJSjobs: \u003cstrong\u003eRole of kidney biomarkers of chronic kidney disease: An update\u003c/strong\u003e. \u003cem\u003eSaudi journal of biological sciences \u003c/em\u003e2014, \u003cstrong\u003e21\u003c/strong\u003e(4):294-299.\u003c/li\u003e\n\u003cli\u003eMa W, Wang K-J, Cheng C-S, Yan G-q, Lu W-L, Ge J-F, Cheng Y-X, Li NJJoe: \u003cstrong\u003eBioactive compounds from Cornus officinalis fruits and their effects on diabetic nephropathy\u003c/strong\u003e. \u003cem\u003eJournal of ethnopharmacology\u003c/em\u003e 2014, \u003cstrong\u003e153\u003c/strong\u003e(3):840-845.\u003c/li\u003e\n\u003cli\u003eWang Z, Zhang B, Chen Z, He Y, Ru F, Liu P, Chen X: \u003cstrong\u003eThe long noncoding RNA myocardial infarction-associated transcript modulates the epithelial-mesenchymal transition in renal interstitial fibrosis\u003c/strong\u003e. \u003cem\u003eLife sciences \u003c/em\u003e2020, \u003cstrong\u003e241\u003c/strong\u003e:117187.\u003c/li\u003e\n\u003cli\u003eM MX, J N-PD, Y LH: \u003cstrong\u003eTGF-beta: the master regulator of fibrosis\u003c/strong\u003e. \u003cem\u003eNat Rev Nephrol \u003c/em\u003e2016, \u003cstrong\u003e12\u003c/strong\u003e(6):325-338.\u003c/li\u003e\n\u003cli\u003eSureshbabu A, Muhsin SA, Choi MEJAJoP-RP: \u003cstrong\u003eTGF-\u0026beta; signaling in the kidney: profibrotic and protective effects\u003c/strong\u003e. \u003cem\u003eAmerican Journal of Physiology-Renal Physiology \u003c/em\u003e2016, \u003cstrong\u003e310\u003c/strong\u003e(7):F596-F606.\u003c/li\u003e\n\u003cli\u003eSmall DM, Bennett NC, Roy S, Gabrielli BG, Johnson DW, Gobe GCJNEN: \u003cstrong\u003eOxidative stress and cell senescence combine to cause maximal renal tubular epithelial cell dysfunction and loss in an in vitro model of kidney disease\u003c/strong\u003e. \u003cem\u003eNephron Experimental Nephrology \u003c/em\u003e2012, \u003cstrong\u003e122\u003c/strong\u003e(3-4):123-130.\u003c/li\u003e\n\u003cli\u003eSmall D, Coombes J, Bennett N, Johnson D, Gobe G: \u003cstrong\u003eOxidative stress, anti-oxidant therapies and chronic kidney disease\u003c/strong\u003e. \u003cem\u003eNephrology Carlton, Vic \u003c/em\u003e2012, \u003cstrong\u003e17\u003c/strong\u003e(4):311-321.\u003c/li\u003e\n\u003cli\u003eTuran B: \u003cstrong\u003eRole of antioxidants in redox regulation of diabetic cardiovascular complications\u003c/strong\u003e. \u003cem\u003eCurrent pharmaceutical biotechnology \u003c/em\u003e2010, \u003cstrong\u003e11\u003c/strong\u003e(8):819-836.\u003c/li\u003e\n\u003cli\u003eLee K, Kim E, Kim C, Choi J, Bae E, Ma S, Park J, Jung Y, Kim S, Lee J\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eMacrophage-stimulating protein attenuates hydrogen peroxide-induced apoptosis in human renal HK-2 cells\u003c/strong\u003e. \u003cem\u003eEuropean journal of pharmacology \u003c/em\u003e2013, \u003cstrong\u003e715\u003c/strong\u003e:304-311.\u003c/li\u003e\n\u003cli\u003ePoprac P, Jomova K, Simunkova M, Kollar V, Rhodes C, Valko M: \u003cstrong\u003eTargeting Free Radicals in Oxidative Stress-Related Human Diseases\u003c/strong\u003e. \u003cem\u003eTrends in pharmacological sciences \u003c/em\u003e2017, \u003cstrong\u003e38\u003c/strong\u003e(7):592-607.\u003c/li\u003e\n\u003cli\u003eDuan R, Xing X, Qi Y, Yin N, Hao H, Chu H, Gao Y, Wang W, Lv PJNr: \u003cstrong\u003eTaxane-derived compounds protect SK-N-SH cells against oxidative stress injury induced by H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e\u003c/strong\u003e. \u003cem\u003eNeurological research\u003c/em\u003e 2017, \u003cstrong\u003e39\u003c/strong\u003e(7):632-639.\u003c/li\u003e\n\u003cli\u003eHuang C-C, Aronstam RS, Chen D-R, Huang Y-WJTiv: \u003cstrong\u003eOxidative stress, calcium homeostasis, and altered gene expression in human lung epithelial cells exposed to ZnO nanoparticles\u003c/strong\u003e. \u003cem\u003eToxicology in vitro\u003c/em\u003e 2010, \u003cstrong\u003e24\u003c/strong\u003e(1):45-55.\u003c/li\u003e\n\u003cli\u003eLiang W-Z, Chou C-T, Chang H-T, Cheng J-S, Kuo D-H, Ko K-C, Chiang N-N, Wu R-F, Shieh P, Jan C-RJC-bi: \u003cstrong\u003eThe mechanism of honokiol-induced intracellular Ca\u003csup\u003e2+\u003c/sup\u003e rises and apoptosis in human glioblastoma cells\u003c/strong\u003e. \u003cem\u003eChemico-biological interactions \u003c/em\u003e2014, \u003cstrong\u003e221\u003c/strong\u003e:13-23.\u003c/li\u003e\n\u003cli\u003eZhang X, Lee M, Wilson C, McCarron J: \u003cstrong\u003eHydrogen peroxide depolarizes mitochondria and inhibits IP-evoked Ca release in the endothelium of intact arteries\u003c/strong\u003e. \u003cem\u003eCell calcium \u003c/em\u003e2019, \u003cstrong\u003e84\u003c/strong\u003e:102108.\u003c/li\u003e\n\u003cli\u003eLi Y, Ren K: \u003cstrong\u003eThe Mechanism of Contrast-Induced Acute Kidney Injury and Its Association with Diabetes Mellitus\u003c/strong\u003e. \u003cem\u003eContrast media \u0026amp; molecular imaging \u003c/em\u003e2020, \u003cstrong\u003e2020\u003c/strong\u003e:3295176.\u003c/li\u003e\n\u003cli\u003eMiao J, Liu J, Niu J, Zhang Y, Shen W, Luo C, Liu Y, Li C, Li H, Yang P\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eWnt/\u0026beta;-catenin/RAS signaling mediates age-related renal fibrosis and is associated with mitochondrial dysfunction\u003c/strong\u003e. \u003cem\u003eAging cell \u003c/em\u003e2019, \u003cstrong\u003e18\u003c/strong\u003e(5):e13004.\u003c/li\u003e\n\u003cli\u003eXu S, Chamseddine A, Carrell S, Miller F: \u003cstrong\u003eNox4 NADPH oxidase contributes to smooth muscle cell phenotypes associated with unstable atherosclerotic plaques\u003c/strong\u003e. \u003cem\u003eRedox biology \u003c/em\u003e2014, \u003cstrong\u003e2\u003c/strong\u003e:642-650.\u003c/li\u003e\n\u003cli\u003eLiu X, Miao J, Wang C, Zhou S, Chen S, Ren Q, Hong X, Wang Y, Hou F, Zhou L\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eTubule-derived exosomes play a central role in fibroblast activation and kidney fibrosis\u003c/strong\u003e. \u003cem\u003eKidney international \u003c/em\u003e2020, \u003cstrong\u003e97\u003c/strong\u003e(6):1181-1195.\u003c/li\u003e\n\u003cli\u003eGewin L: \u003cstrong\u003eRenal fibrosis: Primacy of the proximal tubule\u003c/strong\u003e. \u003cem\u003eMatrix biology : journal of the International Society for Matrix Biology \u003c/em\u003e2018:248-262.\u003c/li\u003e\n\u003cli\u003eDuffield JSJTJoci: \u003cstrong\u003eCellular and molecular mechanisms in kidney fibrosis\u003c/strong\u003e. 2014, \u003cstrong\u003e124\u003c/strong\u003e(6):2299-2306.\u003c/li\u003e\n\u003cli\u003eZhu J, Wen K: \u003cstrong\u003eAstragaloside IV inhibits TGF-\u0026beta;1-induced epithelial-mesenchymal transition through inhibition of the PI3K/Akt/NF-\u0026kappa;B pathway in gastric cancer cells\u003c/strong\u003e. \u003cem\u003ePhytotherapy research : PTR \u003c/em\u003e2018, \u003cstrong\u003e32\u003c/strong\u003e(7):1289-1296.\u003c/li\u003e\n\u003cli\u003eI L, G W: \u003cstrong\u003eTransforming growth factor-\u0026beta; and the progresssion of renal disease.\u003c/strong\u003e \u003cem\u003eNephrol Dial Transplant \u003c/em\u003e2014, \u003cstrong\u003e29\u003c/strong\u003e(1):37-45.\u003c/li\u003e\n\u003c/ol\u003e\n"},{"header":"Tables","content":"\u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;text-align:center;text-indent:24.1pt;line-height:200%;background:white;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif; color: rgb(0, 0, 0); font-size: 10px;\"\u003eTable Ⅰ Primers of renal tissue\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003ctable style=\"border-collapse:collapse;border:none;\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 210.1pt;border-top: 1pt solid black;border-left: none;border-bottom: 1pt solid black;border-right: none;padding: 0in 5.4pt;vertical-align: top;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cstrong\u003e\u003cbr\u003e\u0026nbsp;\u003c/strong\u003e\u0026nbsp;\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;line-height:23.0pt;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cstrong\u003eRenal tissue\u003c/strong\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 3in;border-top: 1pt solid black;border-left: none;border-bottom: 1pt solid black;border-right: none;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;line-height:23.0pt;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cstrong\u003ePrimers\u003c/strong\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 210.1pt;border: none;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;line-height:23.0pt;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eTGF-\u0026beta;1 F\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 3in;border: none;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;line-height:23.0pt;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eGAAGGACCTGGGTTGGAAG\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 210.1pt;border: none;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;line-height:23.0pt;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eTGF-\u0026beta;1 R\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 3in;border: none;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;text-align:justify;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eCGGGTTGTGTTGGTTGTAG\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 210.1pt;border: none;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;text-align:justify;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u0026beta;-actin F\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 3in;border: none;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;text-align:justify;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eGGGAAATCGTGCGTGACATT\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 210.1pt;border-top: none;border-right: none;border-left: none;border-image: initial;border-bottom: 1pt solid black;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;line-height:23.0pt;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u0026beta;-actin R\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 3in;border-top: none;border-right: none;border-left: none;border-image: initial;border-bottom: 1pt solid black;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;line-height:23.0pt;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eGCGGCAGTGGCCATCTC\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;text-align:center;text-indent:24.1pt;line-height:200%;background:white;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cstrong\u003eTable Ⅱ Primers of HKC cells\u003c/strong\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n\u003ctable style=\"border-collapse:collapse;border:none;\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 218pt;border-top: 1pt solid black;border-left: none;border-bottom: 1pt solid black;border-right: none;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;line-height:23.0pt;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cstrong\u003eHKC cells\u003c/strong\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 218pt;border-top: 1pt solid black;border-left: none;border-bottom: 1pt solid black;border-right: none;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;line-height:23.0pt;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cstrong\u003ePrimers\u003c/strong\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 218pt;border: none;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;line-height:23.0pt;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eTGF-\u0026beta;1 F\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 218pt;border: none;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;line-height:23.0pt;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eGGAAATTGAGGGCTTTCGCC\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 218pt;border: none;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;line-height:23.0pt;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eTGF-\u0026beta;1 R\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 218pt;border: none;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eCCGGTAGTGAACCCGTTGAT\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 218pt;border: none;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;text-align:justify;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u0026beta;-actin F\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 218pt;border: none;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eCGGCGCCCTATAAAACCCA\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 218pt;border-top: none;border-right: none;border-left: none;border-image: initial;border-bottom: 1pt solid black;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;line-height:23.0pt;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u0026beta;-actin R\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 218pt;border-top: none;border-right: none;border-left: none;border-image: initial;border-bottom: 1pt solid black;padding: 0in 5.4pt;vertical-align: top;\"\u003e\n \u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;line-height:23.0pt;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eTCATCATCCATGGTGAGCTGG\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;\"\u003e\u003cspan style=\"font-family: Verdana, Geneva, sans-serif;\"\u003e\u003cspan style=\"font-size: 10px;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"margin:0in;font-size:16px;font-family:SimSun;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0); font-size: 10px; font-family: Verdana, Geneva, sans-serif;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"antioxidant, 5/6 nephrectomy, chronic renal failure, transforming growth factor β1, Jianshen Granule","lastPublishedDoi":"10.21203/rs.3.rs-18615/v2","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-18615/v2","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e: Chronic renal failure (CRF) is a worldwide public health concern, and at present, there are limited treatment options available. Jianshen Granules, a traditional Chinese herbal medicine, have been used clinically in the treatment of renal diseases for a large number of years in the Air Force Medical Center of the Chinese People's Liberation Army (PLA), and have shown great efficacy. In the present study, both the effectiveness and the mechanism of action of Jianshen Granules to treat CRF were investigated. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e A rat model of CRF was established by 5/6 nephrectomy. Rats were administered with distilled water, Uremic Clearance Granules (UCGs), or Jianshen Granules. During the administration period, the physiological state of the rats was observed, and the biochemical parameters of interest were measured. The pathology of the kidney tissues were assessed using hematoxylin and eosin (H.E.), and Masson’s staining. In addition, the expression level of transforming growth factor‑β1 (TGF‑β1) was detected. Human kidney cells (HKC cells) were used to investigate the effects of Jianshen Granules on apoptosis induced by hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e), whereas cell viability was assessed by Cell Counting Kit‑8 (CCK‑8) assay. The level of apoptosis, the mitochondrial membrane potential (MMP), and reactive oxygen species (ROS) and Ca\u003csup\u003e2 + \u003c/sup\u003elevels were measured using a flow cytometry. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e The results revealed that Jianshen Granules could reduce the levels of serum creatinine, blood urea nitrogen, alanine aminotransferase and aspartate aminotransferase, and the volume of urine in CRF rats. Renal histopathological examinations revealed that Jianshen Granules had an ameliorative effect on renal injury. In addition, Jianshen Granules led to a marked decrease in TGF‑β1 levels in CRF rats. Following treatment with Jianshen Granules, cell viability and the level of the MMP increased, whereas the levels of ROS and Ca\u003csup\u003e2+\u003c/sup\u003e were reduced significantly. The increased level of TGF‑β1 was detected in the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e‑treated group, although this increase was attenuated by treatment with Jianshen Granules. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e Taken together, the results of the present study have shown that Jianshen Granules are able to ameliorate renal failure in CRF rats, and to inhibit apoptosis of HKC cells induced by H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e via downregulation of TGF‑β1.\u003c/p\u003e","manuscriptTitle":"Preliminary study of the mechanism underlying how Jianshen Granules ameliorate renal failure in 5/6 nephrectomy model rats","msid":"","msnumber":"","nonDraftVersions":[{"code":2,"date":"2020-08-25 17:13:40","doi":"10.21203/rs.3.rs-18615/v2","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}},{"code":1,"date":"2020-04-21 17:44:04","doi":"10.21203/rs.3.rs-18615/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5060212d-69f9-4dbf-9602-5856e070bd5a","owner":[],"postedDate":"August 25th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":86716,"name":"Urology \u0026 Nephrology"}],"tags":[],"updatedAt":"2020-08-30T12:18:56+00:00","versionOfRecord":[],"versionCreatedAt":"2020-08-25 17:13:40","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v2","identity":"rs-18615","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-18615","identity":"rs-18615","version":["v2"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00