SLC6A6 alleviates cellular senescence in glioblastoma via the CSK/AKT/FoxO1 signaling

SLC6A6 alleviates cellular senescence in glioblastoma via the CSK/AKT/FoxO1 signaling | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article SLC6A6 alleviates cellular senescence in glioblastoma via the CSK/AKT/FoxO1 signaling Wei Li, Xianyou Xia, Ting Wang, Yu Zheng, Yunzhi Liu, Enqi Lin, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5790052/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract ・Background: Malignant glioblastoma exhibits cellular senescence characterized by changing tumor microenvironment. Solute carrier family 6 member 6 (SLC6A6), a multichannel transmembrane protein, plays a crucial role in regulating cell proliferation, apoptosis, differentiation and cellular microenvironment. However, the molecular mechanism of SLC6A6 in the cellular senescence of glioblastoma remains unknown. Our study aimed to elucidate the regulatory role and molecular mechanisms of SLC6A6 in the proliferation and senescence of glioblastoma cells. ・Methods: Expression of SLC6A6 was examined in tumor samples from 50 patients with glioblastoma, and associations between SLC6A6 expression and survival outcome were evaluated using Kaplan–Meier survival and Cox regression analyses. To investigate the mechanism of SLC6A6, we used short hairpin RNA (shRNA) and overexpression vector to construct SLC6A6-knockdown and -overexpression glioblastoma cells, respectively. The role of SLC6A6 in glioblastoma was confirmed in vitro and in an orthotopic glioblastoma mouse model. ・Results: Patients with high expression of SLC6A6 had a worse prognosis. Downregulation of SLC6A6 protein inhibited malignant phenotypes of glioblastoma cells in vitro. In addition, SLC6A6 affected tumor senescence by directly binding to CSK with its N-terminal cytoplasmic domain, thereby enhancing AKT phosphorylation. Furthermore, SLC6A6 knockdown inhibited tumor growth and shortened survival in the glioblastoma xenograft mouse model. ・Conclusion: SLC6A6 can promote malignant progression and inhibit cellular senescence of glioblastoma cells by affecting the CSK/AKT/FoxO1 signaling pathway. SLC6A6 might be a valuable biomarker in the treatment of glioblastoma. SLC6A6 glioblastoma AKT FOXO1 cellular senescence Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Glioblastoma (GBM), which primarily originates from normal glial cells, is the most common form of primary neurogenic tumor in adults 1 , 2 Despite the development in therapy, including surgery resection, radiotherapy, and temozolomide chemotherapy, the outcomes for most patients remain poor 3 – 5 . The median survival time is about 12–14 months, with a 5-year survival rate of below 5% 6 . Therefore, to discover new therapeutic targets with high specificity and sensitivity for GBM is an extremely urgent need. In recent studies, it has been demonstrated that the metabolic and epigenetic signature of a tumor changes as the disease progresses 7 , 8 . Solute carriers (SLCs), one of the largest groups of transporters, play a crucial role in tumor metabolism and epigenetics 9 . The human SLC6A6 is a multichannel membrane protein with high affinity whereas low capacity for its substrates 10 . It acts as the transporter of taurine, primarily responsible for transporting taurine and β-alanine in a Na + and Cl − -dependent manner 11 . Importantly, SLC6A6 can regulate cell proliferation, apoptosis, differentiation, and cellular osmolality 12 – 16 . Dysfunction of SLC6A6 is implicated in cardiovascular diseases, retinopathy, sarcopenia, and hyperammonemia 17 – 20 . Furthermore, SLC6A6 participates in the development of many tumors. For example, gastric cancer patients with high SLC6A6 expression have a poor prognosis 21 , 22 . In colorectal cancer, SLC6A6 correlates with survival and resistance to chemotherapy 23 . However, the specific mechanisms underlying how SLC6A6 contributes to glioblastoma have not been illustrated. To fill in the gap in knowledge, we investigated its mode of action and explored whether it can be used as a potential therapeutic target for glioblastoma. Material and Methods 2.1. Clinical sample collection and follow-up A total of 50 naïve patients with glioblastoma who had not received prior treatment (radiotherapy or chemotherapy) before surgery were randomly recruited from Tianjin Neurological Central Hospital (Tianjin, China) between January 2017 and December 2018. The diagnosis of glioblastoma was confirmed independently by two senior neuropathologists. After surgery, the patients were enrolled in clinical follow-up assessments every 6 months, with the last follow-up completed in December 2023. This study has been approved by Tianjin Neurological Central Hospital’s Institutional Research Ethics Committee and Institutional Animal Care and Use Committee (IACUC). Prior to using any clinical data, informed consent was obtained from each patient. 2.2. Hematoxylin–eosin staining (HE) Tumor tissues from humans and mice were fixed in 4% formalin, embedded in paraffin, and sectioned. For H&E staining, paraffin-embedded tissue sections were examined. 2.3. Cell culture The human glioblastoma cell lines U251,LN229,TJ905 and U87 were obtained from the American Type Culture Collection (Manassas, Virginia, USA). These cells were grown in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 μg/mL penicillin, and 100 μg/mL streptomycin at 37°C in a humidified incubator with 5% CO 2 . To conduct rescue experiments, SC79 (Master of Bioactive Molecules, USA) was dissolved in DMSO at a concentration of 10 μM. 2.4. RT-qPCR Total RNA from GBM cells was extracted using the TRIzol reagent. Then, the RNA was reverse-transcribed into cDNA using an RT-PCR kit from Genstar (Beijing, China). The 7500 Fast RT-PCR system (Applied Biosystems) was used to perform RT-qPCR reactions with SYBR Green Master Mix (Vazyme, Nanjing, China). A reference gene, rP0, was used for RT-qPCR analysis. Quantification was conducted using the ΔΔCt method. The following qPCR primers were used: rP0-PF, TTCATTGTGGGAGCAGAC; rP0-PR, CAGCAGTTTCTCCAGAGC; SLC6A6-PF, CTCTGCGTTCCCTTGGTCAT; SLC6A6-PR, CGGTGCGAGAGTTGTAAGGT; P16-PF, TGTGCATGACGTGCGGG; P16-PR, GCCCATCATCATCACCTGAATC; P21-PF, CAGCAGAATAAAAGGTGCCACAG; P21-PR, CCATGAGCGCATCGCAATC; IL-1A-PF, AGTGCTGCTGAAGGAGATGCCTGA; IL-1-APR, CCCCTGCCAAGCACACCCAGTA; IL-1B-PF, TGATGGCTTATTACAGTGGCAA; IL1-B-PR, GGTGGTCGGAGATTCGTAGC; IL-6-PF, CATCCATCTTTTTCAGCCAT; IL-6-PR, ATGTAGCCGCCCCACACAGA; IL-8-PF, AAGACATACTCCAAACCTTTCCACC; IL-8-PR, TTCAAAAACTTCTCCACAACCCTCT; MMP3-PF, ACAAAGGATACAACAGGGACCAA; MMP3-PR, ACCGAGTCAGGTCTGTGAGT; CCL2-PF, TCAAACTGAAGCTCGCACTCT; CCL2-PR, GGCATTGATTGCATCTGGC; CCL5-PF, CCCCATATTCCTCGGACACC; CCL5-PR, CATCCTTGACCTGTGGACGA; CCL20-PF, GGCGAATCAGAAGCAAGCAAC; CCL20-PR, AGCATTGATGTCACAGCCTTC; CXCL1-PF, TCCTGCATCCCCCATAGTTA; CCXCL1-PR, CTTCAGGAACAGCCACCAGT; CXCL9-PF, TGATTGGAGTGCAAGGAACC; CXCL9-PR, ATAGTCCCTTGGTTGGTGCTG; CXCL10-PF, TCCACGTGTTGAGATCATTGCTA; CXCL10-PR, ATCGATTTTGCTCCCCTCTGG. 2.5. Western blot analysis Cells were harvested at 80%–90% confluence, lysed with 1× SDS loading buffer, and heated at 95°C for 10 min to denature proteins. The SDS-PAGE was used to separate the cell lysates, and membranes were then transferred to nitrocellulose (at 300 mA for 120 min, depending on the target protein’s molecular weight). The membranes were blocked with 5% nonfat milk in Tris-Buffered Saline with Tween-20 (TBST) for 1 h and incubated at 4°C overnight with primary antibodies against SLC6A6 (1:1000, ABclonal, A14783), GAPDH (1:10000, ABclonal, AC002), Flag (1:1000, CST, 8146S), p-AKT (Thr308) (1:1000, CST, 13038T), AKT (1:1000, CST, 4691T), p-FOXO1 (1:1000, Proteintech, 28757-1-AP), FOXO1 (1:1000, Proteintech, 66457-1-Ig), β-actin (1:10000, ABclonal, AC026), P16 (1:1000, Proteintech, 10883-1-AP), P21 (1:1000, Proteintech, 10355-1-AP), and CSK (1:1000, ABclonal, A0666). After incubation with primary antibodies, the membranes were washed with TBST (200 rpm) for three times, 8 min each time, followed by incubation with secondary antibodies for 1–2 h. The membranes were washed again with TBST, and immunoreactivity was detected using an enhanced chemiluminescence (ECL) system, and then imaged. 2.6. Cell proliferation assay U87, U251, LN229 and TJ905cells (2,500 cells per 150 μL per well) were seeded in 96-well plates and grown for 24, 48, 72, and 96 h, respectively. Fresh medium (90 μL) and 10 μL of Cell Counting Kit 8 solution (New Cell & Molecular Biotech, Suzhou, China) were added to each well, and cells were incubated for 3 h at 37°C in the dark. Microplate reader (Bio-TEK Instruments, USA) was used to measure the absorbance at 450 nm. 2.7. Scratch wound healing assay Cells were grown to confluence in six-well plates overnight. A wound was made across the cell monolayer using a pipette tip, and the cells were washed twice with phosphate-buffered saline (PBS) to remove debris. Wound healing was observed using an inverted microscope at 0 and 24 h (Nikon, Tokyo, Japan). The images were analyzed using ImageJ software. Wound closure was calculated by subtracting the 24-h wound area from the 0-h wound area. 2.8. Limiting dilution and tumor sphere formation Serum-free DMEM/F12 supplemented with 20 μL/mL B27 (Gibco), 5 μg/mL insulin, 20 ng/mL basic fibroblast growth factor (bFGF, Sino Biological, China), and 10 ng/mL Epidermal Growth Factor (EGF, Sino Biological, China) was used. In 96-well plates, 100, 20, and 10 cells per well, respectively, were plated for U87, U251, LN229 and TJ905. After 14 days, the wells were examined for tumor sphere formation. Glioblastoma stem cell (GSC) frequency was computed using the Extreme Limiting Dilution Analysis (http://bioinf.wehi.edu.au/software/elda/). 2.9. SA-β-Gal staining Senescence was assessed in U251 and LN229 cells and frozen pancreas sections using an X-Gal staining kit (Beyotime, China) following the manufacturer’s protocol. Staining was visualized using a microscope (SC180, Olympus, Tokyo, Japan). 2.10. Co-immunoprecipitation (Co-IP) Cells were washed for three times in PBS at 80%–90% confluence. Then, cells were lysed with 1 mL of lysis buffer (Genstar, China) with phenylmethyl sulfonyl fluoride (Master of Bioactive Molecules, USA) on ice for 30 min. The lysed cells were centrifuged at 4°C for 15 min at 15,000 g . The input was 60 µL of the supernatant. The rest of the supernatant was incubated with rotation in 20 µL anti-flag beads at 4°C overnight. The beads were washed for three times with the lysis buffer. The beads were boiled and samples were added in 1× LDS loading buffer at 70°C for 10 min and confirmed by Western blot. 2.11. RNA-seq and analysis RNA sequencing (RNA-seq) was conducted by Beijing Genomics Institute (BGI, Shenzhen, China) using a BGISEQ-500 apparatus for single-end, 1×50-bp sequencing. The DESeq R package (4.3.2) was used to perform differentially expressed gene (DEG) analysis with the criteria of |log2(FoldChange)| > 2 and an adjusted p value < 0.05. We conducted enrichment analyses for GO, KEGG, and GSEA using the R package clusterProfiler. The statistically significant enrichment was defined as an adjusted p value < 0.05. 2.12. Mouse models All animal studies followed the guidelines of the Tianjin Medical University Animal Use and Care Committee. Female BALB/c nude mice (8 weeks old) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China), and divided into two groups (n = 6 per group). Transduced U251-luciferase cells (2 × 10 5 cells) were stereotactically injected into the right frontal lobe of the brains. The mice were injected intraperitoneally with 150 μg/g D-fluorescein after anesthesia for imaging. Bioluminescence was captured using a charge-coupled device camera (IVIS, PerkinElmer, Massachusetts, USA) to measure tumor size. The mice were closely monitored for 50 days after injection, and euthanized due to neurological impairment. Brain samples were fixed in formalin and subjected to routine H&E and IHC staining. 2.13. Statistical analysis All experiments were performed in triplicate. Statistical analysis was performed using SPSS software (version 25.0; USA) and GraphPad Prism software. Differences were determined using t tests, one-way ANOVA, or two-way ANOVA when appropriate. Overall survival (OS) and disease-free survival (DFS) were determined using Kaplan–Meier and log-rank tests. The Cox proportional-hazards models were employed. A p < 0.05 was considered statistically significant. Results 3.1. High SLC6A6 expression as a poor prognostic indicator To explore if SLC6A6 expression correlates with clinical outcomes, the GEPIA clinical dataset (gepia2.cancer-pku.cn) confirmed that high SLC6A6 expression in GBM correlated with shorter OS and DFS (Fig. 1A, B). SLC6A6 expression was also significantly higher in GBM (N = 518) than in low-grade glioma (LGG) samples (N = 163) (Fig. 1C). In addition, protein levels of SLC6A6 were analyzed using IHC. SLC6A6 was predominantly located in the cytoplasm and cell membrane (with higher abundance) in glioblastoma patients (Fig. 1D). SLC6A6 protein expression levels were scored on a scale from 0 to 5 based on staining intensity and distribution. The 50 patients were categorized into low- and high-expression groups based on their average scores. Kaplan–Meier survival curves revealed that high SLC6A6 expression was associated with significantly shorter DFS (P = 0.035) and OS (P = 0.018) compared with the low-expression group (Fig. 1E, F). Univariate and multivariate Cox regression analyses, which included variables such as gender, age, tumor size, smoking, drinking, intraoperative hemorrhage, and SLC6A6 protein expression level, identified only SLC6A6 protein expression as an independent prognostic factor for OS and DFS in glioblastoma patients (Fig. 1G, H). These findings suggest that SLC6A6 expression promotes glioblastoma progression and serves as an independent prognostic factor. 3.2. Effect of SLC6A6 on malignant phenotypes in vitro Expression levels of SLC6A6 in various GBM cell lines were reviewed from the Human Protein Atlas (www.proteinatlas.org). Subsequently, shRNAs (shSLC6A6-1, shSLC6A6-2) were utilized to knock down SLC6A6 in U251 and LN229 glioblastoma cells, as confirmed by Western blotting and real-time PCR (Fig. 2A, B). CCK-8 assays indicated that SLC6A6 KD impaired cell proliferation (Fig. 2C). Wound-healing and transwell assays demonstrated that SLC6A6 KD reduced cell migration and invasion (Fig. 2D, E). In addition, SLC6A6 KD inhibited tumor sphere formation (Fig. 2F). By contrast, SLC6A6 OE in U87 and TJ905 cells enhanced these malignant traits (Fig. 3A-F). 3.3. Impact on AKT phosphorylation and cellular senescence To elucidate SLC6A6-related signaling pathways, transcriptome sequencing was performed on SLC6A6-KD U251 cells, revealing significant changes in 695 genes (130 upregulated and 565 downregulated) at a |fold change| ≥ 2 and adjusted p value < 0.05 (Fig. 4A). KEGG and GO pathway enrichment analyses identified several key pathways, in particular AKT signaling pathway, cell cycle, and cellular senescence. Gene Set Enrichment Analysis (GSEA) supported a link between SLC6A6 and these pathways (Fig. 4B, C). SA-β-Gal staining revealed that SLC6A6 KD markedly promoted cellular senescence in U251and LN229 cells (Fig. 4D). Based on Western blot analysis, phosphorylation of AKT was decreased (with intact total AKT), while phosphorylation of FoxO1 was markedly increased in the cytoplasm of SLC6A6-KD cells, with FoxO1 expression shifted to the nucleus (Fig. 3E). Increased mRNA levels of cell cycle–related biomarkers (P16 and P21) were observed in SLC6A6-KD cells (Fig. 4F). Notably, phosphorylated AKT may affect senescence of pancreatic β cells through FoxO1 24 . Thus, SLC6A6 might influence cellular senescence through modulation of AKT phosphorylation and FoxO1 translocation. 3.4. Rescue of malignant phenotypes by AKT activation SC79 (10 μM), an AKT activator, was used to enhance AKT phosphorylation in SLC6A6-KD U251 and LN229 cells as illustrated by Western blotting (Fig. 5A). CCK-8 assays indicated that SC79 restored cell proliferation in SLC6A6-KD cells (Fig. 5B). Moreover, SC79 rescued migration, invasion and sphere formation caused by SLC6A6-KD in U251 and LN229 cells, as shown by wound-healing, transwell, and limiting dilution assays, respectively (Fig. 5C–E). These results suggest that SLC6A6 promotes proliferation, migration and invasion, as well as GSC self-renewal, partially through the AKT signaling pathway. 3.5. The N-terminal cytoplasmic domain of SLC6A6 interacts with C-Src tyrosine kinase (CSK) To explore molecular mechanisms, we performed LC-MS analysis. Interestingly, intracellular taurine level was not changed in SLC6A6-KD U251 cells compared with controls (Fig. 6A). So we performed mass spectrometry and AlphaFold3 to identify protein-protein interactions in SLC6A6 OE 293T cells (Fig. 6B,C). CSK was identified as a potential binding partner. Co-IP in U251and LN229 cells confirmed the interaction between SLC6A6 and CSK (Fig. 6D). Consistently, OE of CSK in SLC6A6-KD cells increased AKT phosphorylation and alleviated cellular senescence (Fig. 6E). Structure prediction using UniProt Knowledgebase indicated that the N-terminal cytoplasmic domain of SLC6A6 is essential for binding to CSK. Then, different SLC6A6 domains were overexpressed (Fig. 6F). Based on Co-IP assays, vectors lacking this domain (SLC6A6#2) were not able to interact with CSK, restore AKT phosphorylation or alleviate cellular senescence (Fig. 6G-I). Thus, the N-terminal cytoplasmic domain of SLC6A6 is crucial for its interaction with CSK to activate AKT signaling. 3.6. In vivo effects of SLC6A6 KD SLC6A6-KD and control U251 cells were subcutaneously injected into an intracranial xenograft mouse model. Mouse in control group died successively at 21 days. Bioluminescence imaging over 7, 14, and 21 days revealed significantly slower tumor growth ( p < 0.05, Fig. 7A, B) and longer OS ( p < 0.05, Fig. 7C) in SLC6A6-KD group. After 21 days, tumors were removed and analyzed by H&E and IHC staining (Fig. 7D). SLC6A6 staining was significantly stronger in tumor tissues of control group compared with KD group. Additionally, tumors in SLC6A6-KD group were notably smaller. Discussion Importantly, multichannel transmembrane protein SLC6A6 regulates cell proliferation and survival 25 , 26 . SLC6A6 is associated with poor OS in gastric cancer 21 . Additionally, SLC6A6 induces resistance to chemotherapy in colon cancer 23 . However, the role of SLC6A6 in glioblastoma is underexplored. In this study, we provide both clinical and experimental evidence of SLC6A6 critically involved in glioblastoma. Based on clinical data and databases, SLC6A6 expression was significantly higher in glioblastoma samples. Moreover, SLC6A6 enhanced tumor cell aggressiveness and predicted poorer outcome. Accordingly, downregulation of SLC6A6 significantly inhibits GBM development and progression. These findings suggest that SLC6A6 could serve as a potential biomarker for GBM prognosis and a target for therapeutic interventions. This malignant phenotype is consistent with previous studies 21 . However, the precise mechanisms by which SLC6A6 influences glioblastoma progression are not yet fully understood. To explore molecular mechanisms, we performed LC-MS analysis. Interestingly, intracellular taurine level was not changed in SLC6A6-KD U251 cells compared with controls (Fig. 6 A). Previous studies have revealed that MCT7, PAT1, GAT2, and GAT3 can transport taurine 19 , 27 – 30 . Thus, transcriptional sequencing was performed following SLC6A6 KD in U251 cells. KEGG analysis revealed enrichment in those pathways related to inhibited AKT signaling. SLC6A6 may affect cell proliferation, carcinogenesis, aging, and lifespan through this pathway. Notably, senescent cells were more common in response to SLC6A6 KD. Cellular senescence, a process known to inhibit tumor progression, was of particular interest. It functions as a protective mechanism against damage, but it can also be used as an effective antitumor mechanism due to antiproliferation 31 , 32 . Senescence is triggered by specific signals that activate senescence-related pathways. Senescent cells can release senescence-associated secretory phenotype (SASP) factors that impact neighboring tumor cells, and thus restricting tumor cell proliferation 33 – 36 . PI3K/AKT/FoxO1 pathway modulates aging in pancreatic β cells 24 . Based on mass spectrometry and co-IP analyses, SLC6A6 can bind to CSK, which in turn influences the phosphorylation level of AKT and affects tumorigenesis of glioblastoma 37 , consistent with previous studies 38 – 40 . In addition, a functional domain of SLC6A6 was determined. The N-terminal cytoplasmic domain of SLC6A6 is crucial for its interaction with CSK and AKT signaling activation. Our results indicate that SLC6A6 may enhance glioblastoma cell proliferation, migration, invasion and self-renewal capacity of GSCs, whereas inhibits cellular senescence. SLC6A6 may resist cellular senescence via the N-terminal cytoplasmic domain, to activate CSK/AKT/FoxO1 pathway, which plays a role in promoting glioblastoma progression (Fig. 7 ). Declarations Acknowledgments: We thank Dr. Xinghe Bu members of the Xudong Wu laboratory for discussions and support. his study was supported by grants from the neurosurgery department of Tianjin Huanhu Hospital for their help in gathering the tumor biopsies. This work was sponsored by Tianjin Health Research Project (Grant No.TJWJ2022QN060); National Natural Science Foundation of China (Grant No.82103247, 82171359). Funding Information : This study was supported by grants from the neurosurgery department of Tianjin Huanhu Hospital for their help in gathering the tumor biopsies. This work was sponsored by Tianjin Health Research Project (Grant No.TJWJ2022QN060); National Natural Science Foundation of China (Grant No.82103247, 82171359). Conflict of Interest : The authors have no conflict interest. Ethics Statement : Approval of the research protocol by an Institutional Reviewer Board: Tianjin Neurological Central Hospital’s Institutional Research Ethics Committee (approval NO.2019-14) approved the study Informed Consent: Prior to using any clinical data, informed consent was obtained from each patient. Animal Studies: All animal studies were approved by the guidelines of the Tianjin Medical University Animal Use and Care Committee (TMUaMEC2017009). Author Contributions Wei Li, Xianyou Xia, Ting Wang: Data curation; formal analysis; investigation; visualization; writing – original draft. Yu Zheng, Yunzhi Liu, Enqi Lin, Yuhang Liao, Guojia Wu, Runzhe Chen: Methodology, Software, Validation; Bo Wang, Dong Wang, Hao Zhuang: Conceptualization, Funding acquisition, Methodology, Resources, Supervision, Writing - review & editing. References Brennan CW, Verhaak RG, McKenna A, et al. The somatic genomic landscape of glioblastoma. Cell . 2013; 155: 462-477. Sun X, Klingbeil O, Lu B, et al. BRD8 maintains glioblastoma by epigenetic reprogramming of the p53 network. Nature . 2023; 613: 195-202. Dixit D, Prager BC, Gimple RC, et al. The RNA m6A Reader YTHDF2 Maintains Oncogene Expression and Is a Targetable Dependency in Glioblastoma Stem Cells. Cancer discovery . 2021; 11: 480-499. Stupp R, Hegi ME, Mason WP, et al. Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. The Lancet Oncology . 2009; 10: 459-466. Stupp R, Taillibert S, Kanner A, et al. Effect of Tumor-Treating Fields Plus Maintenance Temozolomide vs Maintenance Temozolomide Alone on Survival in Patients With Glioblastoma: A Randomized Clinical Trial. Jama . 2017; 318: 2306-2316. Thakkar JP, Dolecek TA, Horbinski C, et al. Epidemiologic and molecular prognostic review of glioblastoma. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology . 2014; 23: 1985-1996. Dong F, Li Q, Yang C, et al. PRMT2 links histone H3R8 asymmetric dimethylation to oncogenic activation and tumorigenesis of glioblastoma. Nature communications . 2018; 9: 4552. Faubert B, Solmonson A, DeBerardinis RJ. Metabolic reprogramming and cancer progression. Science (New York, NY) . 2020; 368. César-Razquin A, Snijder B, Frappier-Brinton T, et al. A Call for Systematic Research on Solute Carriers. Cell . 2015; 162: 478-487. Tran TT, Mu A, Adachi Y, Adachi Y, Taketani S. Neurotransmitter transporter family including SLC6A6 and SLC6A13 contributes to the 5-aminolevulinic acid (ALA)-induced accumulation of protoporphyrin IX and photodamage, through uptake of ALA by cancerous cells. Photochemistry and photobiology . 2014; 90: 1136-1143. Ansar M, Ranza E, Shetty M, et al. Taurine treatment of retinal degeneration and cardiomyopathy in a consanguineous family with SLC6A6 taurine transporter deficiency. Human molecular genetics . 2020; 29: 618-623. Liao XB, Peng YQ, Zhou XM, et al. Taurine restores Axl/Gas6 expression in vascular smooth muscle cell calcification model. Amino acids . 2010; 39: 375-383. Rong Z, Li F, Zhang R, et al. Ant-Neointimal Formation Effects of SLC6A6 in Preventing Vascular Smooth Muscle Cell Proliferation and Migration via Wnt/β-Catenin Signaling. International journal of molecular sciences . 2023; 24. Warskulat U, Borsch E, Reinehr R, et al. Taurine deficiency and apoptosis: findings from the taurine transporter knockout mouse. Archives of biochemistry and biophysics . 2007; 462: 202-209. Xie H, Yang B, Zhou XM, et al. L-carnitine and taurine synergistically inhibit the proliferation and osteoblastic differentiation of vascular smooth muscle cells. Acta pharmacologica Sinica . 2010; 31: 289-296. Han X, Chesney RW. Knockdown of TauT expression impairs human embryonic kidney 293 cell development. Advances in experimental medicine and biology . 2013; 776: 307-320. Ito T, Yamamoto N, Nakajima S, Schaffer SW. Beta-Catenin and SMAD3 Are Associated with Skeletal Muscle Aging in the Taurine Transpoeter Knockout Mouse. Advances in experimental medicine and biology . 2017; 975 Pt 1: 497-502. Preising MN, Görg B, Friedburg C, et al. Biallelic mutation of human SLC6A6 encoding the taurine transporter TAUT is linked to early retinal degeneration. FASEB journal : official publication of the Federation of American Societies for Experimental Biology . 2019; 33: 11507-11527. Qvartskhava N, Jin CJ, Buschmann T, et al. Taurine transporter (TauT) deficiency impairs ammonia detoxification in mouse liver. Proceedings of the National Academy of Sciences of the United States of America . 2019; 116: 6313-6318. Xiang L, Chen XJ, Wu KC, et al. miR-183/96 plays a pivotal regulatory role in mouse photoreceptor maturation and maintenance. Proceedings of the National Academy of Sciences of the United States of America . 2017; 114: 6376-6381. Dazhi W, Jing D, Chunling R, Mi Z, Zhixuan X. Elevated SLC6A6 expression drives tumorigenesis and affects clinical outcomes in gastric cancer. Biomarkers in medicine . 2019; 13: 95-104. Cao T, Zhang W, Wang Q, et al. Cancer SLC6A6-mediated taurine uptake transactivates immune checkpoint genes and induces exhaustion in CD8(+) T cells. Cell . 2024; 187: 2288-2304.e2227. Yasunaga M, Matsumura Y. Role of SLC6A6 in promoting the survival and multidrug resistance of colorectal cancer. Scientific reports . 2014; 4: 4852. Zhang W, Wu N, Wang H, et al. Sulfated fuco-manno-glucuronogalactan alleviates pancreatic beta cell senescence via PI3K/AKT/FoxO1 pathway. International journal of biological macromolecules . 2023; 236: 123846. Kaesler S, Sobiesiak M, Kneilling M, et al. Effective T-cell recall responses require the taurine transporter Taut. European journal of immunology . 2012; 42: 831-841. Warskulat U, Heller-Stilb B, Oermann E, et al. Phenotype of the taurine transporter knockout mouse. Methods in enzymology . 2007; 428: 439-458. Baliou S, Kyriakopoulos AM, Goulielmaki M, Panayiotidis MI, Spandidos DA, Zoumpourlis V. Significance of taurine transporter (TauT) in homeostasis and its layers of regulation (Review). Molecular medicine reports . 2020; 22: 2163-2173. Higuchi K, Sugiyama K, Tomabechi R, Kishimoto H, Inoue K. Mammalian monocarboxylate transporter 7 (MCT7/Slc16a6) is a novel facilitative taurine transporter. The Journal of biological chemistry . 2022; 298: 101800. Nielsen CU, Bjerg M, Ulaganathan N, Holm R. Oral and intravenous pharmacokinetics of taurine in sprague-dawley rats: the influence of dose and the possible involvement of the proton-coupled amino acid transporter, PAT1, in oral taurine absorption. Physiological reports . 2017; 5. Tomi M, Tajima A, Tachikawa M, Hosoya K. Function of taurine transporter (Slc6a6/TauT) as a GABA transporting protein and its relevance to GABA transport in rat retinal capillary endothelial cells. Biochimica et biophysica acta . 2008; 1778: 2138-2142. Krtolica A, Parrinello S, Lockett S, Desprez PY, Campisi J. Senescent fibroblasts promote epithelial cell growth and tumorigenesis: a link between cancer and aging. Proceedings of the National Academy of Sciences of the United States of America . 2001; 98: 12072-12077. Hannan KM, Pearson RB. Too much or too little: harnessing senescence to control oncogene-driven cancer. Cell cycle (Georgetown, Tex) . 2012; 11: 3147-3148. Iannello A, Thompson TW, Ardolino M, Lowe SW, Raulet DH. p53-dependent chemokine production by senescent tumor cells supports NKG2D-dependent tumor elimination by natural killer cells. The Journal of experimental medicine . 2013; 210: 2057-2069. Krizhanovsky V, Yon M, Dickins RA, et al. Senescence of activated stellate cells limits liver fibrosis. Cell . 2008; 134: 657-667. Kuilman T, Michaloglou C, Vredeveld LC, et al. Oncogene-induced senescence relayed by an interleukin-dependent inflammatory network. Cell . 2008; 133: 1019-1031. Liu D, Hornsby PJ. Senescent human fibroblasts increase the early growth of xenograft tumors via matrix metalloproteinase secretion. Cancer research . 2007; 67: 3117-3126. Shi S, Zhong D, Xiao Y, et al. Syndecan-1 knockdown inhibits glioma cell proliferation and invasion by deregulating a c-src/FAK-associated signaling pathway. Oncotarget . 2017; 8: 40922-40934. Dey N, Howell BW, De PK, Durden DL. CSK negatively regulates nerve growth factor induced neural differentiation and augments AKT kinase activity. Experimental cell research . 2005; 307: 1-14. Gu J, Nada S, Okada M, Sekiguchi K. Csk regulates integrin-mediated signals: involvement of differential activation of ERK and Akt. Biochemical and biophysical research communications . 2003; 303: 973-977. Van Slyke P, Coll ML, Master Z, Kim H, Filmus J, Dumont DJ. Dok-R mediates attenuation of epidermal growth factor-dependent mitogen-activated protein kinase and Akt activation through processive recruitment of c-Src and Csk. Molecular and cellular biology . 2005; 25: 3831-3841. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5790052","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":399992771,"identity":"2e9822d7-9d98-4a68-bd5e-9faa3064ed8d","order_by":0,"name":"Wei Li","email":"","orcid":"","institution":"Tianjin Medical University General Hospital, Tianjin Neurological Institute","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Li","suffix":""},{"id":399992773,"identity":"f43d2a1f-58f1-4c00-9756-18fb5f5dae85","order_by":1,"name":"Xianyou Xia","email":"","orcid":"","institution":"The Province and Ministry Co-sponsored Collaborative Innovation Center for Medical Epigenetics, Tianjin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xianyou","middleName":"","lastName":"Xia","suffix":""},{"id":399992774,"identity":"cb89e1f6-09ad-40ce-99f1-931734014c59","order_by":2,"name":"Ting Wang","email":"","orcid":"","institution":"The Affiliated Cancer Hospital of Zhengzhou University \u0026 Henan Cancer Hospital","correspondingAuthor":false,"prefix":"","firstName":"Ting","middleName":"","lastName":"Wang","suffix":""},{"id":399992775,"identity":"f4e89cc7-27f1-48b7-9065-23af8b427728","order_by":3,"name":"Yu Zheng","email":"","orcid":"","institution":"Tianjin Medical University Cancer Institute and Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Zheng","suffix":""},{"id":399992777,"identity":"43c9fa16-ae83-4948-b789-cf6a57b56493","order_by":4,"name":"Yunzhi Liu","email":"","orcid":"","institution":"The Province and Ministry Co-sponsored Collaborative Innovation Center for Medical Epigenetics, Tianjin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yunzhi","middleName":"","lastName":"Liu","suffix":""},{"id":399992778,"identity":"3720356b-803c-43bb-ba61-a384dc491c8b","order_by":5,"name":"Enqi Lin","email":"","orcid":"","institution":"Bengbu Medical University","correspondingAuthor":false,"prefix":"","firstName":"Enqi","middleName":"","lastName":"Lin","suffix":""},{"id":399992779,"identity":"38fa568a-8548-4ce1-a755-4bc297fbf136","order_by":6,"name":"Yuhang Liao","email":"","orcid":"","institution":"Tianjin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yuhang","middleName":"","lastName":"Liao","suffix":""},{"id":399992780,"identity":"515ede71-48d4-4d4d-95fa-78ff281a2054","order_by":7,"name":"Guojia Wu","email":"","orcid":"","institution":"Tianjin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Guojia","middleName":"","lastName":"Wu","suffix":""},{"id":399992781,"identity":"ebea5d3c-6477-43b7-9359-0864afc16784","order_by":8,"name":"Runzhe Chen","email":"","orcid":"","institution":"Tianjin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Runzhe","middleName":"","lastName":"Chen","suffix":""},{"id":399992782,"identity":"20c7012b-654f-4233-8b79-a85f12223ecd","order_by":9,"name":"Hao Zhuang","email":"","orcid":"","institution":"The Affiliated Cancer Hospital of Zhengzhou University \u0026 Henan Cancer Hospital","correspondingAuthor":false,"prefix":"","firstName":"Hao","middleName":"","lastName":"Zhuang","suffix":""},{"id":399992783,"identity":"6d221e61-5abb-4e2d-9ad2-20041d0d7482","order_by":10,"name":"Dong Wang","email":"","orcid":"","institution":"Tianjin Medical University General Hospital, Tianjin Neurological Institute","correspondingAuthor":false,"prefix":"","firstName":"Dong","middleName":"","lastName":"Wang","suffix":""},{"id":399992784,"identity":"7bb9de89-2325-421a-a3e2-935c3c187988","order_by":11,"name":"Bo Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3ElEQVRIiWNgGAWjYDCCAwxsUBbzAZgI0VrYEhtI1cJjSJwWvtsH2B58YDgsb86/5vujm20Mcnw3Ehg/F+DRInkugd1wBsNhw50z3m5szm1jMJa8kcAsPQOPFoMzDGzSPAy3GTfcOAvWkrjhRgIbMw8RWuw33DjzEKSlnmgtiRvO9zCCtCQYENIieYax3XCGwf/kDTfYDGfnnJMwnAm0TRqfFr4zzMcefKhIs91w/vCDzzllNvJ8x5MPfsanhYGBsQHoPCAtkQDiSUBFiAL8B4hUOApGwSgYBSMOAADDH1ACnHCCkgAAAABJRU5ErkJggg==","orcid":"","institution":"Tianjin Huanhu Hospital, Tianjin Neurosurgical Institute","correspondingAuthor":true,"prefix":"","firstName":"Bo","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2025-01-08 14:53:04","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5790052/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5790052/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":73676459,"identity":"e16d96ba-10fc-4f84-8f54-f011aee152f6","added_by":"auto","created_at":"2025-01-13 13:09:21","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":4350305,"visible":true,"origin":"","legend":"\u003cp\u003eHigh SLC6A6 expression as a poor prognostic indicator. (A, B) Impact of high SLC6A6 expression on overall survival (OS) of GBM patients from the GEPIA clinical dataset (***P \u0026lt; 0.001). (C) Comparison of SLC6A6 expression levels between GBM and lower-grade glioma (LGG) patients from the GEPIA dataset. (D) GBM samples stained with IHC showing SLC6A6 expression (Scale bar, 100 μm). \u0026nbsp;(E)Kaplan–Meier analysis of a correlation between SLC6A6 expression level and OS. (F) Hazard ratios (HRs) for OS by univariate (left) and multivariate (right) analyses. (G) Kaplan–Meier analysis of a correlation between SLC6A6 expression level and DFS. (H) HRs for DFS by univariate (left) and multivariate (right) analyses.\u003c/p\u003e","description":"","filename":"figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5790052/v1/030a72569347333ade047fc5.png"},{"id":73676458,"identity":"b507f403-ca06-477e-ab2c-2cd18f98f88e","added_by":"auto","created_at":"2025-01-13 13:09:21","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":7169192,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of SLC6A6 on malignant phenotypes in vitro. (A) RT-PCR analysis of SLC6A6 expression in U251and LN229 cells with SLC6A6-downregulation or empty virus. (***P \u0026lt; 0.001). \u0026nbsp;(B) Western blot analysis of SLC6A6 expression in U251 and LN229 cells infected with SLC6A6-downregulation virus or empty virus. (C) CCK8 proliferation assays in SLC6A6-knockdown U251and LN229 cells and controls (***P \u0026lt; 0.001). (D) Transwell assay in SLC6A6-knockdown U251and LN229 cells and controls (***P \u0026lt; 0.001). (E) Wound healing in SLC6A6-knockdown U251and LN229 cells and controls (***P \u0026lt; 0.001). (F) Extreme limiting dilution analysis in SLC6A6-knockdown U251and LN229 cells and controls (***P \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5790052/v1/ffdfa7c58faa401d3bdd2ed1.png"},{"id":73676465,"identity":"42abba98-81b8-4828-83f8-d38080fd646a","added_by":"auto","created_at":"2025-01-13 13:09:22","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":4037726,"visible":true,"origin":"","legend":"\u003cp\u003e(A) RT-PCR analysis of SLC6A6 expression in U87 and TJ905 cells with SLC6A6-overexpression or empty virus (***P \u0026lt; 0.001). (B) Western blot analysis of SLC6A6 expression in U87 and TJ905 cells infected with SLC6A6-overexpression virus or empty virus. (C) CCK8 proliferation assays (***P \u0026lt; 0.001). (D) Transwell assay in SLC6A6-overexpression U87and TJ905 cells and controls (***P \u0026lt; 0.001). (E) Wound healing assays (***P \u0026lt; 0.001). (F) Extreme limiting dilution (***P \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5790052/v1/402d4ea31787ff7e69fd2764.png"},{"id":73676460,"identity":"9187fd84-36e3-4c03-9cb1-16074148f327","added_by":"auto","created_at":"2025-01-13 13:09:22","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3833050,"visible":true,"origin":"","legend":"\u003cp\u003eImpact on AKT phosphorylation and cellular senescence. (A) Clustering and heat map analysis of differential gene expression between control and SLC6A6-knockdown groups in U251 cells. (B) KEGG pathway enrichment analysis of SLC6A6 downstream genes (|fold change| ≥ 2, adjusted P value \u0026lt; 0.05). (C) GSEA plots of downregulated gene signatures following SLC6A6 knockdown in U251 cells. (D) SA-β-Gal staining in SLC6A6-knockdown U251and LN229 cells and controls (***P \u0026lt; 0.001). (E) Western blot analysis of AKT, p-AKT, β-actin, p-FoxO1, and FoxO1 in the cytoplasm (Cyto) and nucleus (Nu) of SLC6A6-knockdown and control U251and LN229 cells. (F) RT-PCR analysis showing relative cellular senescence mRNA level of SLC6A6-knockdown and control U251and LN229 cells (*P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5790052/v1/c78f34a931f4c4fd963ca25a.png"},{"id":73676479,"identity":"df2dae04-7fed-42f8-9e88-cd9d7ce925cd","added_by":"auto","created_at":"2025-01-13 13:09:23","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":6791494,"visible":true,"origin":"","legend":"\u003cp\u003eRescue of malignant phenotypes by AKT activation. (A) Western blot analysis for AKT, p-AKT, and GAPDH in SLC6A6-knockdown and control U251and LN229 cells treated with SC79 or DMSO. (B) CCK8 proliferation assays of U251and LN229 cells treated as in (A). (***P \u0026lt; 0.001) (C) Transwell assay of U251and LN229 cells treated as in (A) (***P \u0026lt; 0.001). (D) Wound healing assays of U251and LN229 cells treated as in (A) (***P \u0026lt; 0.001). (E) Extreme limiting dilution analysis of U251and LN229 cells treated as in (A) (***P \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-5790052/v1/083e695499938a45539f7402.png"},{"id":73676485,"identity":"c515a875-ca41-422c-a696-8971c9f2238b","added_by":"auto","created_at":"2025-01-13 13:09:24","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":6597179,"visible":true,"origin":"","legend":"\u003cp\u003eThe N-terminal cytoplasmic domain of SLC6A6 interacts with CSK. (A)The level of cellular taurine in SLC6A6-knockdown U251 cells and control cells by LC-MS analysis. (B)Mass spectrometry analysis of SLC6A6-overexpression 293T cells. (C) AlphaFold3-predicted structure of SLC6A6 and CSK (ipTM = 0.56pTM = 0.69). (D) Co-immunoprecipitation (Co-IP) showing interaction between SLC6A6 and CSK in SLC6A6-overexpression 293T cells. (E) Western blotting for AKT, p-AKT of SLC6A6-knockdown or control U251and LN229 cells co-transfected with control vector or CSK-overexpression plasmid (***P \u0026lt; 0.001). (F) Construction of different SLC6A6 expression vectors (#1–3) using the pCDH-Flag vector. (G) Co-immunoprecipitation (Co-IP) showing interaction between different SLC6A6 expression vectors (#1–3) and CSK. (H) Western blotting for AKT, p-AKT, and Flag in SLC6A6-knockdown or control U251and LN229 cells treated with the vectors in (E). (G) SA-β-Gal staining of U251and LN229 cells treated as in (F) (***P \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-5790052/v1/86ad14232154dc8aac2c5f91.png"},{"id":73676472,"identity":"86c981ee-9c78-4768-9045-a0ecd4224db8","added_by":"auto","created_at":"2025-01-13 13:09:22","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":3292309,"visible":true,"origin":"","legend":"\u003cp\u003eIn vivo effects of SLC6A6 knockdown. (A) Representative luciferase images of tumors. (B) Quantification of luciferase activity at 7–21 days after tumor implantation (***P \u0026lt; 0.001). (C) Kaplan–Meier analysis of overall survival in mice (***P \u0026lt; 0.001). (D) HE staining of mouse brains injected with SLC6A6-knockdown U251 cells and control cells at 21 days after implantation. (E)Schematic diagram.\u003c/p\u003e","description":"","filename":"figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-5790052/v1/e0461129bd630b100c76b8bc.png"},{"id":73678613,"identity":"0d6ce951-9018-40f0-8ebd-cab832432634","added_by":"auto","created_at":"2025-01-13 13:33:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":33759602,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5790052/v1/e631768f-681f-47e9-8987-420030fbddc7.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"SLC6A6 alleviates cellular senescence in glioblastoma via the CSK/AKT/FoxO1 signaling","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGlioblastoma (GBM), which primarily originates from normal glial cells, is the most common form of primary neurogenic tumor in adults\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e Despite the development in therapy, including surgery resection, radiotherapy, and temozolomide chemotherapy, the outcomes for most patients remain poor\u003csup\u003e\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. The median survival time is about 12\u0026ndash;14 months, with a 5-year survival rate of below 5%\u003csup\u003e6\u003c/sup\u003e. Therefore, to discover new therapeutic targets with high specificity and sensitivity for GBM is an extremely urgent need.\u003c/p\u003e \u003cp\u003eIn recent studies, it has been demonstrated that the metabolic and epigenetic signature of a tumor changes as the disease progresses\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Solute carriers (SLCs), one of the largest groups of transporters, play a crucial role in tumor metabolism and epigenetics\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. The human SLC6A6 is a multichannel membrane protein with high affinity whereas low capacity for its substrates\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. It acts as the transporter of taurine, primarily responsible for transporting taurine and β-alanine in a Na\u003csup\u003e+\u003c/sup\u003e and Cl\u003csup\u003e\u0026minus;\u003c/sup\u003e-dependent manner\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Importantly, SLC6A6 can regulate cell proliferation, apoptosis, differentiation, and cellular osmolality\u003csup\u003e\u003cspan additionalcitationids=\"CR13 CR14 CR15\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Dysfunction of SLC6A6 is implicated in cardiovascular diseases, retinopathy, sarcopenia, and hyperammonemia\u003csup\u003e\u003cspan additionalcitationids=\"CR18 CR19\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Furthermore, SLC6A6 participates in the development of many tumors. For example, gastric cancer patients with high SLC6A6 expression have a poor prognosis\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. In colorectal cancer, SLC6A6 correlates with survival and resistance to chemotherapy\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eHowever, the specific mechanisms underlying how SLC6A6 contributes to glioblastoma have not been illustrated. To fill in the gap in knowledge, we investigated its mode of action and explored whether it can be used as a potential therapeutic target for glioblastoma.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cp\u003e\u003cstrong\u003e2.1. Clinical sample collection and follow-up\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 50 na\u0026iuml;ve patients with glioblastoma who had not received prior treatment (radiotherapy or chemotherapy) before surgery were randomly recruited from Tianjin Neurological Central Hospital (Tianjin, China) between January 2017 and December 2018. The diagnosis of glioblastoma was confirmed independently by two senior neuropathologists. After surgery, the patients were enrolled in clinical follow-up assessments every 6 months, with the last follow-up completed in December 2023. This study has been approved by Tianjin Neurological Central Hospital\u0026rsquo;s Institutional Research Ethics Committee and Institutional Animal Care and Use Committee (IACUC). Prior to using any clinical data, informed consent was obtained from each patient.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2. Hematoxylin\u0026ndash;eosin staining (HE) \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTumor tissues from humans and mice were fixed in 4% formalin, embedded in paraffin, and sectioned. For H\u0026amp;E staining, paraffin-embedded tissue sections were examined.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3. Cell culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe human glioblastoma cell lines U251,LN229,TJ905 and U87 were obtained from the American Type Culture Collection (Manassas, Virginia, USA). These cells were grown in Dulbecco\u0026rsquo;s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 \u0026mu;g/mL penicillin, and 100 \u0026mu;g/mL streptomycin at 37\u0026deg;C in a humidified incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e. To conduct rescue experiments, SC79 (Master of Bioactive Molecules, USA) was dissolved in DMSO at a concentration of 10 \u0026mu;M.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4. RT-qPCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA from GBM cells was extracted using the TRIzol reagent. Then, the RNA was reverse-transcribed into cDNA using an RT-PCR kit from Genstar (Beijing, China). The 7500 Fast RT-PCR system (Applied Biosystems) was used to perform RT-qPCR reactions with SYBR Green Master Mix (Vazyme, Nanjing, China). A reference gene, rP0, was used for RT-qPCR analysis. Quantification was conducted using the \u0026Delta;\u0026Delta;Ct method. The following qPCR primers were used: rP0-PF, TTCATTGTGGGAGCAGAC; rP0-PR, CAGCAGTTTCTCCAGAGC; SLC6A6-PF, CTCTGCGTTCCCTTGGTCAT; SLC6A6-PR, CGGTGCGAGAGTTGTAAGGT; P16-PF, TGTGCATGACGTGCGGG; P16-PR, GCCCATCATCATCACCTGAATC; P21-PF, CAGCAGAATAAAAGGTGCCACAG; P21-PR, CCATGAGCGCATCGCAATC; IL-1A-PF, AGTGCTGCTGAAGGAGATGCCTGA; IL-1-APR, CCCCTGCCAAGCACACCCAGTA; IL-1B-PF, TGATGGCTTATTACAGTGGCAA; IL1-B-PR, GGTGGTCGGAGATTCGTAGC; IL-6-PF, CATCCATCTTTTTCAGCCAT; IL-6-PR, ATGTAGCCGCCCCACACAGA; IL-8-PF, AAGACATACTCCAAACCTTTCCACC; IL-8-PR, TTCAAAAACTTCTCCACAACCCTCT; MMP3-PF, ACAAAGGATACAACAGGGACCAA; MMP3-PR, ACCGAGTCAGGTCTGTGAGT; CCL2-PF, TCAAACTGAAGCTCGCACTCT; CCL2-PR, GGCATTGATTGCATCTGGC; CCL5-PF, CCCCATATTCCTCGGACACC; CCL5-PR, CATCCTTGACCTGTGGACGA; CCL20-PF, GGCGAATCAGAAGCAAGCAAC; CCL20-PR, AGCATTGATGTCACAGCCTTC; CXCL1-PF, TCCTGCATCCCCCATAGTTA; CCXCL1-PR, CTTCAGGAACAGCCACCAGT; CXCL9-PF, TGATTGGAGTGCAAGGAACC; CXCL9-PR, ATAGTCCCTTGGTTGGTGCTG; CXCL10-PF, TCCACGTGTTGAGATCATTGCTA; CXCL10-PR, ATCGATTTTGCTCCCCTCTGG.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5. Western blot analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were harvested at 80%\u0026ndash;90% confluence, lysed with 1\u0026times; SDS loading buffer, and heated at 95\u0026deg;C for 10 min to denature proteins. The SDS-PAGE was used to separate the cell lysates, and membranes were then transferred to nitrocellulose (at 300 mA for 120 min, depending on the target protein\u0026rsquo;s molecular weight). The membranes were blocked with 5% nonfat milk in Tris-Buffered Saline with Tween-20 (TBST) for 1 h and incubated at 4\u0026deg;C overnight with primary antibodies against SLC6A6 (1:1000, ABclonal, A14783), GAPDH (1:10000, ABclonal, AC002), Flag (1:1000, CST, 8146S), p-AKT (Thr308) (1:1000, CST, 13038T), AKT (1:1000, CST, 4691T), p-FOXO1 (1:1000, Proteintech, 28757-1-AP), FOXO1 (1:1000, Proteintech, 66457-1-Ig), \u0026beta;-actin (1:10000, ABclonal, AC026), P16 (1:1000, Proteintech, 10883-1-AP), P21 (1:1000, Proteintech, 10355-1-AP), and CSK (1:1000, ABclonal, A0666). After incubation with primary antibodies, the membranes were washed with TBST (200 rpm) for three times, 8 min each time, followed by incubation with secondary antibodies for 1\u0026ndash;2 h. The membranes were washed again with TBST, and immunoreactivity was detected using an enhanced chemiluminescence (ECL) system, and then imaged.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6. Cell proliferation assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eU87, U251, LN229 and TJ905cells (2,500 cells per 150 \u0026mu;L per well) were seeded in 96-well plates and grown for 24, 48, 72, and 96 h, respectively. Fresh medium (90 \u0026mu;L) and 10 \u0026mu;L of Cell Counting Kit 8 solution (New Cell \u0026amp; Molecular Biotech, Suzhou, China) were added to each well, and cells were incubated for 3 h at 37\u0026deg;C in the dark. Microplate reader (Bio-TEK Instruments, USA) was used to measure the absorbance at 450 nm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.7. Scratch wound healing assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were grown to confluence in six-well plates overnight. A wound was made across the cell monolayer using a pipette tip, and the cells were washed twice with phosphate-buffered saline (PBS) to remove debris. Wound healing was observed using an inverted microscope at 0 and 24 h (Nikon, Tokyo, Japan). The images were analyzed using ImageJ software. Wound closure was calculated by subtracting the 24-h wound area from the 0-h wound area.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.8. Limiting \u003c/strong\u003e\u003cstrong\u003edilution and tumor sphere formation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSerum-free DMEM/F12 supplemented with 20 \u0026mu;L/mL B27 (Gibco), 5 \u0026mu;g/mL insulin, 20 ng/mL basic fibroblast growth factor (bFGF, Sino Biological, China), and 10 ng/mL Epidermal Growth Factor (EGF, Sino Biological, China) was used. In 96-well plates, 100, 20, and 10 cells per well, respectively, were plated for U87, U251, LN229 and TJ905. After 14 days, the wells were examined for tumor sphere formation. Glioblastoma stem cell (GSC) frequency was computed using the Extreme Limiting Dilution Analysis (http://bioinf.wehi.edu.au/software/elda/).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.9. SA-\u0026beta;-Gal\u003c/strong\u003e\u003cstrong\u003estaining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSenescence was assessed in U251 and LN229 cells and frozen pancreas sections using an X-Gal staining kit (Beyotime, China) following the manufacturer\u0026rsquo;s protocol. Staining was visualized using a microscope (SC180, Olympus, Tokyo, Japan).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.10. Co-immunoprecipitation (Co-IP)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were washed for three times in PBS at 80%\u0026ndash;90% confluence. Then, cells were lysed with 1 mL of lysis buffer (Genstar, China) with phenylmethyl sulfonyl fluoride (Master of Bioactive Molecules, USA) on ice for 30 min. The lysed cells were centrifuged at 4\u0026deg;C for 15\u0026thinsp;min at 15,000 \u003cem\u003eg\u003c/em\u003e. The input was 60 \u0026micro;L of the supernatant. The rest of the supernatant was incubated with rotation in 20 \u0026micro;L anti-flag beads at 4\u0026deg;C overnight. The beads were washed for three times with the lysis buffer. The beads were boiled and samples were added in 1\u0026times; LDS loading buffer at 70\u0026deg;C for 10\u0026thinsp;min and confirmed by Western blot.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.11. RNA-seq and analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRNA sequencing (RNA-seq) was conducted by Beijing Genomics Institute (BGI, Shenzhen, China) using a BGISEQ-500 apparatus for single-end, 1\u0026times;50-bp sequencing. The DESeq R package (4.3.2) was used to perform differentially expressed gene (DEG) analysis with the criteria of |log2(FoldChange)| \u0026gt; 2 and an adjusted \u003cem\u003ep \u003c/em\u003evalue \u0026lt; 0.05. We conducted enrichment analyses for GO, KEGG, and GSEA using the R package clusterProfiler. The statistically significant enrichment was defined as an adjusted \u003cem\u003ep\u003c/em\u003e value \u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.12. Mouse models\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal studies followed the guidelines of the Tianjin Medical University Animal Use and Care Committee. Female BALB/c nude mice (8 weeks old) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China), and divided into two groups (n = 6 per group). Transduced U251-luciferase cells (2 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells) were stereotactically injected into the right frontal lobe of the brains. The mice were injected intraperitoneally with 150 \u0026mu;g/g D-fluorescein after anesthesia for imaging. Bioluminescence was captured using a charge-coupled device camera (IVIS, PerkinElmer, Massachusetts, USA) to measure tumor size. The mice were closely monitored for 50 days after injection, and euthanized due to neurological impairment. Brain samples were fixed in formalin and subjected to routine H\u0026amp;E and IHC staining.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.13. Statistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments were performed in triplicate. Statistical analysis was performed using SPSS software (version 25.0; USA) and GraphPad Prism software. Differences were determined using \u003cem\u003et\u003c/em\u003e tests, one-way ANOVA, or two-way ANOVA when appropriate. Overall survival (OS) and disease-free survival (DFS) were determined using Kaplan\u0026ndash;Meier and log-rank tests. The Cox proportional-hazards models were employed. A \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e3.1. High SLC6A6 expression as a poor prognostic indicator\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo explore if SLC6A6 expression correlates with clinical outcomes, the GEPIA clinical dataset (gepia2.cancer-pku.cn) confirmed that high SLC6A6 expression in GBM correlated with shorter OS and DFS (Fig. 1A, B). SLC6A6 expression was also significantly higher in GBM (N = 518) than in low-grade glioma (LGG) samples (N = 163) (Fig. 1C). In addition, protein levels of SLC6A6 were analyzed using IHC. SLC6A6 was predominantly located in the cytoplasm and cell membrane (with higher abundance) in glioblastoma patients (Fig. 1D). SLC6A6 protein expression levels were scored on a scale from 0 to 5 based on staining intensity and distribution. The 50 patients were categorized into low- and high-expression groups based on their average scores. Kaplan\u0026ndash;Meier survival curves revealed that high SLC6A6 expression was associated with significantly shorter DFS (P = 0.035) and OS (P = 0.018) compared with the low-expression group (Fig. 1E, F). Univariate and multivariate Cox regression analyses, which included variables such as gender, age, tumor size, smoking, drinking, intraoperative hemorrhage, and SLC6A6 protein expression level, identified only SLC6A6 protein expression as an independent prognostic factor for OS and DFS in glioblastoma patients (Fig. 1G, H). These findings suggest that SLC6A6 expression promotes glioblastoma progression and serves as an independent prognostic factor.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003e3.2. Effect of SLC6A6 on malignant phenotypes in vitro\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExpression levels of SLC6A6 in various GBM cell lines were reviewed from the Human Protein Atlas (www.proteinatlas.org). Subsequently, shRNAs (shSLC6A6-1, shSLC6A6-2) were utilized to knock down SLC6A6 in U251 and LN229 glioblastoma cells, as confirmed by Western blotting and real-time PCR (Fig. 2A, B). CCK-8 assays indicated that SLC6A6 KD impaired cell proliferation (Fig. 2C). Wound-healing and transwell assays demonstrated that SLC6A6 KD reduced cell migration and invasion (Fig. 2D, E). In addition, SLC6A6 KD inhibited tumor sphere formation (Fig. 2F). By contrast, SLC6A6 OE in U87 and TJ905 cells enhanced these malignant traits (Fig. 3A-F). \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3. Impact on AKT phosphorylation and cellular senescence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo elucidate SLC6A6-related signaling pathways, transcriptome sequencing was performed on SLC6A6-KD U251 cells, revealing significant changes in 695 genes (130 upregulated and 565 downregulated) at a |fold change| \u0026ge; 2 and adjusted \u003cem\u003ep\u003c/em\u003e value \u0026lt; 0.05 (Fig. 4A). KEGG and GO pathway enrichment analyses identified several key pathways, in particular AKT signaling pathway, cell cycle, and cellular senescence. Gene Set Enrichment Analysis (GSEA) supported a link between SLC6A6 and these pathways (Fig. 4B, C). SA-\u0026beta;-Gal staining revealed that SLC6A6 KD markedly promoted cellular senescence in U251and LN229 cells (Fig. 4D). Based on Western blot analysis, phosphorylation of AKT was decreased (with intact total AKT), while phosphorylation of FoxO1 was markedly increased in the cytoplasm of SLC6A6-KD cells, with FoxO1 expression shifted to the nucleus (Fig. 3E). Increased mRNA levels of cell cycle\u0026ndash;related biomarkers (P16 and P21) were observed in SLC6A6-KD cells (Fig. 4F). Notably, phosphorylated AKT may affect senescence of pancreatic \u0026beta; cells through FoxO1\u003csup\u003e24\u003c/sup\u003e. Thus, SLC6A6 might influence cellular senescence through modulation of AKT phosphorylation and FoxO1 translocation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4. Rescue of \u003c/strong\u003e\u003cstrong\u003emalignant \u003c/strong\u003e\u003cstrong\u003ephenotypes by AKT \u003c/strong\u003e\u003cstrong\u003eactivation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSC79 (10 \u0026mu;M), an AKT activator, was used to enhance AKT phosphorylation in SLC6A6-KD U251 and LN229 cells as illustrated by Western blotting (Fig. 5A). CCK-8 assays indicated that SC79 restored cell proliferation in SLC6A6-KD cells (Fig. 5B). Moreover, SC79 rescued migration, invasion and sphere formation caused by SLC6A6-KD in U251 and LN229 cells, as shown by wound-healing, transwell, and limiting dilution assays, respectively (Fig. 5C\u0026ndash;E). These results suggest that SLC6A6 promotes proliferation, migration and invasion, as well as GSC self-renewal, partially through the AKT signaling pathway.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.5. The N-terminal cytoplasmic domain of SLC6A6 interacts with C-Src tyrosine kinase (CSK)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo explore molecular mechanisms, we performed LC-MS analysis. Interestingly, intracellular taurine level was not changed in SLC6A6-KD U251 cells compared with controls (Fig. 6A). So we performed mass spectrometry and AlphaFold3 to identify protein-protein interactions in SLC6A6 OE 293T cells (Fig. 6B,C). CSK was identified as a potential binding partner. Co-IP in U251and LN229 cells confirmed the interaction between SLC6A6 and CSK (Fig. 6D). Consistently, OE of CSK in SLC6A6-KD cells increased AKT phosphorylation and alleviated cellular senescence (Fig. 6E).\u003c/p\u003e\n\u003cp\u003eStructure prediction using UniProt Knowledgebase indicated that the N-terminal cytoplasmic domain of SLC6A6 is essential for binding to CSK. Then, different SLC6A6 domains were overexpressed (Fig. 6F). Based on Co-IP assays, vectors lacking this domain (SLC6A6#2) were not able to interact with CSK, restore AKT phosphorylation or alleviate cellular senescence (Fig. 6G-I). Thus, the N-terminal cytoplasmic domain of SLC6A6 is crucial for its interaction with CSK to activate AKT signaling.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.6. In vivo effects of SLC6A6 KD\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSLC6A6-KD and control U251 cells were subcutaneously injected into an intracranial xenograft mouse model. Mouse in control group died successively at 21 days. Bioluminescence imaging over 7, 14, and 21 days revealed significantly slower tumor growth (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, Fig. 7A, B) and longer OS (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, Fig. 7C) in SLC6A6-KD group. After 21 days, tumors were removed and analyzed by H\u0026amp;E and IHC staining (Fig. 7D). SLC6A6 staining was significantly stronger in tumor tissues of control group compared with KD group. Additionally, tumors in SLC6A6-KD group were notably smaller. \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eImportantly, multichannel transmembrane protein SLC6A6 regulates cell proliferation and survival\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. SLC6A6 is associated with poor OS in gastric cancer\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Additionally, SLC6A6 induces resistance to chemotherapy in colon cancer\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. However, the role of SLC6A6 in glioblastoma is underexplored. In this study, we provide both clinical and experimental evidence of SLC6A6 critically involved in glioblastoma.\u003c/p\u003e \u003cp\u003eBased on clinical data and databases, SLC6A6 expression was significantly higher in glioblastoma samples. Moreover, SLC6A6 enhanced tumor cell aggressiveness and predicted poorer outcome. Accordingly, downregulation of SLC6A6 significantly inhibits GBM development and progression. These findings suggest that SLC6A6 could serve as a potential biomarker for GBM prognosis and a target for therapeutic interventions. This malignant phenotype is consistent with previous studies\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. However, the precise mechanisms by which SLC6A6 influences glioblastoma progression are not yet fully understood.\u003c/p\u003e \u003cp\u003eTo explore molecular mechanisms, we performed LC-MS analysis. Interestingly, intracellular taurine level was not changed in SLC6A6-KD U251 cells compared with controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Previous studies have revealed that MCT7, PAT1, GAT2, and GAT3 can transport taurine\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan additionalcitationids=\"CR28 CR29\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Thus, transcriptional sequencing was performed following SLC6A6 KD in U251 cells. KEGG analysis revealed enrichment in those pathways related to inhibited AKT signaling. SLC6A6 may affect cell proliferation, carcinogenesis, aging, and lifespan through this pathway. Notably, senescent cells were more common in response to SLC6A6 KD. Cellular senescence, a process known to inhibit tumor progression, was of particular interest. It functions as a protective mechanism against damage, but it can also be used as an effective antitumor mechanism due to antiproliferation\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. Senescence is triggered by specific signals that activate senescence-related pathways. Senescent cells can release senescence-associated secretory phenotype (SASP) factors that impact neighboring tumor cells, and thus restricting tumor cell proliferation\u003csup\u003e\u003cspan additionalcitationids=\"CR34 CR35\" citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePI3K/AKT/FoxO1 pathway modulates aging in pancreatic β cells\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. Based on mass spectrometry and co-IP analyses, SLC6A6 can bind to CSK, which in turn influences the phosphorylation level of AKT and affects tumorigenesis of glioblastoma\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e, consistent with previous studies\u003csup\u003e\u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. In addition, a functional domain of SLC6A6 was determined. The N-terminal cytoplasmic domain of SLC6A6 is crucial for its interaction with CSK and AKT signaling activation.\u003c/p\u003e \u003cp\u003eOur results indicate that SLC6A6 may enhance glioblastoma cell proliferation, migration, invasion and self-renewal capacity of GSCs, whereas inhibits cellular senescence. SLC6A6 may resist cellular senescence via the N-terminal cytoplasmic domain, to activate CSK/AKT/FoxO1 pathway, which plays a role in promoting glioblastoma progression (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e We thank Dr. Xinghe Bu\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003emembers of the Xudong Wu laboratory for discussions and support. his study was supported by grants from the neurosurgery department of Tianjin Huanhu Hospital for their help in gathering the tumor biopsies. This work was sponsored by Tianjin Health Research Project (Grant No.TJWJ2022QN060); National Natural Science Foundation of China (Grant No.82103247, 82171359).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Information\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by grants from the neurosurgery department of Tianjin Huanhu Hospital for their help in gathering the tumor biopsies. This work was sponsored by Tianjin Health Research Project (Grant No.TJWJ2022QN060); National Natural Science Foundation of China (Grant No.82103247, 82171359).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflict interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Statement\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eApproval of the research protocol by an Institutional Reviewer Board:\u003c/strong\u003e\u0026nbsp;Tianjin Neurological Central Hospital\u0026rsquo;s Institutional Research Ethics Committee (approval NO.2019-14) approved the study\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInformed Consent:\u003c/strong\u003e\u0026nbsp;Prior to using any clinical data, informed consent was obtained from each patient.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimal Studies:\u003c/strong\u003e All animal studies were approved by the guidelines of the Tianjin Medical University Animal Use and Care Committee (TMUaMEC2017009).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWei Li, Xianyou Xia, Ting Wang: Data curation; formal analysis; investigation; visualization; writing \u0026ndash; original draft. Yu Zheng, Yunzhi Liu, Enqi Lin, Yuhang Liao, Guojia Wu, Runzhe Chen: Methodology, Software, Validation; Bo Wang, Dong Wang, Hao Zhuang: Conceptualization, Funding acquisition, Methodology, Resources, Supervision, Writing - review \u0026amp; editing.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBrennan CW, Verhaak RG, McKenna A, et al. The somatic genomic landscape of glioblastoma. \u003cem\u003eCell\u003c/em\u003e. 2013; 155: 462-477.\u003c/li\u003e\n\u003cli\u003eSun X, Klingbeil O, Lu B, et al. BRD8 maintains glioblastoma by epigenetic reprogramming of the p53 network. \u003cem\u003eNature\u003c/em\u003e. 2023; 613: 195-202.\u003c/li\u003e\n\u003cli\u003eDixit D, Prager BC, Gimple RC, et al. The RNA m6A Reader YTHDF2 Maintains Oncogene Expression and Is a Targetable Dependency in Glioblastoma Stem Cells. \u003cem\u003eCancer discovery\u003c/em\u003e. 2021; 11: 480-499.\u003c/li\u003e\n\u003cli\u003eStupp R, Hegi ME, Mason WP, et al. Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. \u003cem\u003eThe Lancet Oncology\u003c/em\u003e. 2009; 10: 459-466.\u003c/li\u003e\n\u003cli\u003eStupp R, Taillibert S, Kanner A, et al. Effect of Tumor-Treating Fields Plus Maintenance Temozolomide vs Maintenance Temozolomide Alone on Survival in Patients With Glioblastoma: A Randomized Clinical Trial. \u003cem\u003eJama\u003c/em\u003e. 2017; 318: 2306-2316.\u003c/li\u003e\n\u003cli\u003eThakkar JP, Dolecek TA, Horbinski C, et al. Epidemiologic and molecular prognostic review of glioblastoma. \u003cem\u003eCancer epidemiology, biomarkers \u0026amp; prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology\u003c/em\u003e. 2014; 23: 1985-1996.\u003c/li\u003e\n\u003cli\u003eDong F, Li Q, Yang C, et al. PRMT2 links histone H3R8 asymmetric dimethylation to oncogenic activation and tumorigenesis of glioblastoma. \u003cem\u003eNature communications\u003c/em\u003e. 2018; 9: 4552.\u003c/li\u003e\n\u003cli\u003eFaubert B, Solmonson A, DeBerardinis RJ. Metabolic reprogramming and cancer progression. \u003cem\u003eScience (New York, NY)\u003c/em\u003e. 2020; 368.\u003c/li\u003e\n\u003cli\u003eC\u0026eacute;sar-Razquin A, Snijder B, Frappier-Brinton T, et al. A Call for Systematic Research on Solute Carriers. \u003cem\u003eCell\u003c/em\u003e. 2015; 162: 478-487.\u003c/li\u003e\n\u003cli\u003eTran TT, Mu A, Adachi Y, Adachi Y, Taketani S. Neurotransmitter transporter family including SLC6A6 and SLC6A13 contributes to the 5-aminolevulinic acid (ALA)-induced accumulation of protoporphyrin IX and photodamage, through uptake of ALA by cancerous cells. \u003cem\u003ePhotochemistry and photobiology\u003c/em\u003e. 2014; 90: 1136-1143.\u003c/li\u003e\n\u003cli\u003eAnsar M, Ranza E, Shetty M, et al. Taurine treatment of retinal degeneration and cardiomyopathy in a consanguineous family with SLC6A6 taurine transporter deficiency. \u003cem\u003eHuman molecular genetics\u003c/em\u003e. 2020; 29: 618-623.\u003c/li\u003e\n\u003cli\u003eLiao XB, Peng YQ, Zhou XM, et al. Taurine restores Axl/Gas6 expression in vascular smooth muscle cell calcification model. \u003cem\u003eAmino acids\u003c/em\u003e. 2010; 39: 375-383.\u003c/li\u003e\n\u003cli\u003eRong Z, Li F, Zhang R, et al. Ant-Neointimal Formation Effects of SLC6A6 in Preventing Vascular Smooth Muscle Cell Proliferation and Migration via Wnt/\u0026beta;-Catenin Signaling. \u003cem\u003eInternational journal of molecular sciences\u003c/em\u003e. 2023; 24.\u003c/li\u003e\n\u003cli\u003eWarskulat U, Borsch E, Reinehr R, et al. Taurine deficiency and apoptosis: findings from the taurine transporter knockout mouse. \u003cem\u003eArchives of biochemistry and biophysics\u003c/em\u003e. 2007; 462: 202-209.\u003c/li\u003e\n\u003cli\u003eXie H, Yang B, Zhou XM, et al. L-carnitine and taurine synergistically inhibit the proliferation and osteoblastic differentiation of vascular smooth muscle cells. \u003cem\u003eActa pharmacologica Sinica\u003c/em\u003e. 2010; 31: 289-296.\u003c/li\u003e\n\u003cli\u003eHan X, Chesney RW. Knockdown of TauT expression impairs human embryonic kidney 293 cell development. \u003cem\u003eAdvances in experimental medicine and biology\u003c/em\u003e. 2013; 776: 307-320.\u003c/li\u003e\n\u003cli\u003eIto T, Yamamoto N, Nakajima S, Schaffer SW. Beta-Catenin and SMAD3 Are Associated with Skeletal Muscle Aging in the Taurine Transpoeter Knockout Mouse. \u003cem\u003eAdvances in experimental medicine and biology\u003c/em\u003e. 2017; 975 Pt 1: 497-502.\u003c/li\u003e\n\u003cli\u003ePreising MN, G\u0026ouml;rg B, Friedburg C, et al. Biallelic mutation of human SLC6A6 encoding the taurine transporter TAUT is linked to early retinal degeneration. \u003cem\u003eFASEB journal : official publication of the Federation of American Societies for Experimental Biology\u003c/em\u003e. 2019; 33: 11507-11527.\u003c/li\u003e\n\u003cli\u003eQvartskhava N, Jin CJ, Buschmann T, et al. Taurine transporter (TauT) deficiency impairs ammonia detoxification in mouse liver. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America\u003c/em\u003e. 2019; 116: 6313-6318.\u003c/li\u003e\n\u003cli\u003eXiang L, Chen XJ, Wu KC, et al. miR-183/96 plays a pivotal regulatory role in mouse photoreceptor maturation and maintenance. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America\u003c/em\u003e. 2017; 114: 6376-6381.\u003c/li\u003e\n\u003cli\u003eDazhi W, Jing D, Chunling R, Mi Z, Zhixuan X. Elevated SLC6A6 expression drives tumorigenesis and affects clinical outcomes in gastric cancer. \u003cem\u003eBiomarkers in medicine\u003c/em\u003e. 2019; 13: 95-104.\u003c/li\u003e\n\u003cli\u003eCao T, Zhang W, Wang Q, et al. Cancer SLC6A6-mediated taurine uptake transactivates immune checkpoint genes and induces exhaustion in CD8(+) T cells. \u003cem\u003eCell\u003c/em\u003e. 2024; 187: 2288-2304.e2227.\u003c/li\u003e\n\u003cli\u003eYasunaga M, Matsumura Y. Role of SLC6A6 in promoting the survival and multidrug resistance of colorectal cancer. \u003cem\u003eScientific reports\u003c/em\u003e. 2014; 4: 4852.\u003c/li\u003e\n\u003cli\u003eZhang W, Wu N, Wang H, et al. Sulfated fuco-manno-glucuronogalactan alleviates pancreatic beta cell senescence via PI3K/AKT/FoxO1 pathway. \u003cem\u003eInternational journal of biological macromolecules\u003c/em\u003e. 2023; 236: 123846.\u003c/li\u003e\n\u003cli\u003eKaesler S, Sobiesiak M, Kneilling M, et al. Effective T-cell recall responses require the taurine transporter Taut. \u003cem\u003eEuropean journal of immunology\u003c/em\u003e. 2012; 42: 831-841.\u003c/li\u003e\n\u003cli\u003eWarskulat U, Heller-Stilb B, Oermann E, et al. Phenotype of the taurine transporter knockout mouse. \u003cem\u003eMethods in enzymology\u003c/em\u003e. 2007; 428: 439-458.\u003c/li\u003e\n\u003cli\u003eBaliou S, Kyriakopoulos AM, Goulielmaki M, Panayiotidis MI, Spandidos DA, Zoumpourlis V. Significance of taurine transporter (TauT) in homeostasis and its layers of regulation (Review). \u003cem\u003eMolecular medicine reports\u003c/em\u003e. 2020; 22: 2163-2173.\u003c/li\u003e\n\u003cli\u003eHiguchi K, Sugiyama K, Tomabechi R, Kishimoto H, Inoue K. Mammalian monocarboxylate transporter 7 (MCT7/Slc16a6) is a novel facilitative taurine transporter. \u003cem\u003eThe Journal of biological chemistry\u003c/em\u003e. 2022; 298: 101800.\u003c/li\u003e\n\u003cli\u003eNielsen CU, Bjerg M, Ulaganathan N, Holm R. Oral and intravenous pharmacokinetics of taurine in sprague-dawley rats: the influence of dose and the possible involvement of the proton-coupled amino acid transporter, PAT1, in oral taurine absorption. \u003cem\u003ePhysiological reports\u003c/em\u003e. 2017; 5.\u003c/li\u003e\n\u003cli\u003eTomi M, Tajima A, Tachikawa M, Hosoya K. Function of taurine transporter (Slc6a6/TauT) as a GABA transporting protein and its relevance to GABA transport in rat retinal capillary endothelial cells. \u003cem\u003eBiochimica et biophysica acta\u003c/em\u003e. 2008; 1778: 2138-2142.\u003c/li\u003e\n\u003cli\u003eKrtolica A, Parrinello S, Lockett S, Desprez PY, Campisi J. Senescent fibroblasts promote epithelial cell growth and tumorigenesis: a link between cancer and aging. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America\u003c/em\u003e. 2001; 98: 12072-12077.\u003c/li\u003e\n\u003cli\u003eHannan KM, Pearson RB. Too much or too little: harnessing senescence to control oncogene-driven cancer. \u003cem\u003eCell cycle (Georgetown, Tex)\u003c/em\u003e. 2012; 11: 3147-3148.\u003c/li\u003e\n\u003cli\u003eIannello A, Thompson TW, Ardolino M, Lowe SW, Raulet DH. p53-dependent chemokine production by senescent tumor cells supports NKG2D-dependent tumor elimination by natural killer cells. \u003cem\u003eThe Journal of experimental medicine\u003c/em\u003e. 2013; 210: 2057-2069.\u003c/li\u003e\n\u003cli\u003eKrizhanovsky V, Yon M, Dickins RA, et al. Senescence of activated stellate cells limits liver fibrosis. \u003cem\u003eCell\u003c/em\u003e. 2008; 134: 657-667.\u003c/li\u003e\n\u003cli\u003eKuilman T, Michaloglou C, Vredeveld LC, et al. Oncogene-induced senescence relayed by an interleukin-dependent inflammatory network. \u003cem\u003eCell\u003c/em\u003e. 2008; 133: 1019-1031.\u003c/li\u003e\n\u003cli\u003eLiu D, Hornsby PJ. Senescent human fibroblasts increase the early growth of xenograft tumors via matrix metalloproteinase secretion. \u003cem\u003eCancer research\u003c/em\u003e. 2007; 67: 3117-3126.\u003c/li\u003e\n\u003cli\u003eShi S, Zhong D, Xiao Y, et al. Syndecan-1 knockdown inhibits glioma cell proliferation and invasion by deregulating a c-src/FAK-associated signaling pathway. \u003cem\u003eOncotarget\u003c/em\u003e. 2017; 8: 40922-40934.\u003c/li\u003e\n\u003cli\u003eDey N, Howell BW, De PK, Durden DL. CSK negatively regulates nerve growth factor induced neural differentiation and augments AKT kinase activity. \u003cem\u003eExperimental cell research\u003c/em\u003e. 2005; 307: 1-14.\u003c/li\u003e\n\u003cli\u003eGu J, Nada S, Okada M, Sekiguchi K. Csk regulates integrin-mediated signals: involvement of differential activation of ERK and Akt. \u003cem\u003eBiochemical and biophysical research communications\u003c/em\u003e. 2003; 303: 973-977.\u003c/li\u003e\n\u003cli\u003eVan Slyke P, Coll ML, Master Z, Kim H, Filmus J, Dumont DJ. Dok-R mediates attenuation of epidermal growth factor-dependent mitogen-activated protein kinase and Akt activation through processive recruitment of c-Src and Csk. \u003cem\u003eMolecular and cellular biology\u003c/em\u003e. 2005; 25: 3831-3841.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"SLC6A6, glioblastoma, AKT, FOXO1, cellular senescence","lastPublishedDoi":"10.21203/rs.3.rs-5790052/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5790052/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003e・Background: \u003c/strong\u003eMalignant glioblastoma exhibits cellular senescence characterized by changing tumor microenvironment. \u0026nbsp;Solute carrier family 6 member 6 (SLC6A6), a multichannel transmembrane protein, plays a crucial role in regulating cell proliferation, apoptosis, differentiation and cellular microenvironment. However, the molecular mechanism of SLC6A6 in the cellular senescence of glioblastoma remains unknown. \u0026nbsp;Our study aimed to elucidate the regulatory role and molecular mechanisms of SLC6A6 in the proliferation and senescence of glioblastoma cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e・Methods: \u003c/strong\u003eExpression of SLC6A6 was examined in tumor samples from 50 patients with glioblastoma, and associations between SLC6A6 expression and survival outcome were evaluated using Kaplan–Meier survival and Cox regression analyses. To investigate the mechanism of SLC6A6, we used short hairpin RNA (shRNA) and overexpression vector to construct SLC6A6-knockdown and -overexpression glioblastoma cells, respectively. The role of SLC6A6 in glioblastoma was confirmed in vitro and in an orthotopic glioblastoma mouse model.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e・Results: \u003c/strong\u003ePatients with high expression of SLC6A6 had a worse prognosis. Downregulation of SLC6A6 protein inhibited malignant phenotypes of glioblastoma cells in vitro. In addition, SLC6A6 affected tumor senescence by directly binding to CSK with its N-terminal cytoplasmic domain, thereby enhancing AKT phosphorylation. Furthermore, SLC6A6 knockdown inhibited tumor growth and shortened survival in the glioblastoma xenograft mouse model.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e・Conclusion: \u003c/strong\u003eSLC6A6 can promote malignant progression and inhibit cellular senescence of glioblastoma cells by affecting the CSK/AKT/FoxO1 signaling pathway. SLC6A6 might be a valuable biomarker in the treatment of glioblastoma.\u003c/p\u003e","manuscriptTitle":"SLC6A6 alleviates cellular senescence in glioblastoma via the CSK/AKT/FoxO1 signaling","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-13 13:09:16","doi":"10.21203/rs.3.rs-5790052/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"77a851ee-d48e-4e57-b77f-2bce934befee","owner":[],"postedDate":"January 13th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-01-13T13:09:19+00:00","versionOfRecord":[],"versionCreatedAt":"2025-01-13 13:09:16","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5790052","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5790052","identity":"rs-5790052","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}