Exosomes from adipose derived stem cells improve perforator flap survival through miR-590-3p-mediated M2 macrophage polarization and angiogenesis function

Exosomes from adipose derived stem cells improve perforator flap survival through miR-590-3p-mediated M2 macrophage polarization and angiogenesis function | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Exosomes from adipose derived stem cells improve perforator flap survival through miR-590-3p-mediated M2 macrophage polarization and angiogenesis function Yiwen Deng, Chunjie Li, Dandan Song, Xiancheng Wang, Zhihua Qiao, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6987555/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background : Adipose-derived stem cell exosomes (ADSCs-Exos) are crucial in macrophage polarization and offer therapeutic potential for enhancing wound healing in perforator flaps. However, the mechanisms through which ADSCs-Exos facilitate wound healing and angiogenesis in these flaps are not fully understood. This study aims to elucidate the role of ADSCs-Exos in modulating macrophage activity and promoting vascularization and tissue repair in perforator flaps. Methods :We successfully isolated and confirmed ADSCs exosomes and assessed their effects on macrophage polarization and miR-590-3p expression by co-culturing ADSC-Exos with macrophages.We manipulated the expression of the target gene (miR-590-3p or STAT1) in macrophages to investigate its impact on macrophage polarization. The effects of upregulating or downregulating target genes on endothelial cell proliferation, migration, and angiogenesis were evaluated by co-culturing macrophages with endothelial cells. By applying the supernatant of macrophages with either overexpression or knockdown of the target gene to the SD rat perforator flap model, we investigated the effects of miR-590-3p/STAT1 pathway-mediated macrophage polarization on inflammation and angiogenesis of the perforator flap, and explored the underlying mechanism. Results : We found that miR-590-3p was highly expressed in ADSCs-Exos and promoted M2 macrophage polarization through STAT1, reducing the expression of TNF-αand NOS2 and promoting the expression of Arg-1.By altering the expression of miR-590-3p and STAT1 in macrophages, the study demonstrated enhanced endothelial cell proliferation, migration, and angiogenesis. In a rat perforator flap model, the application of macrophage supernatant with overexpressed or knocked-down target genes showed that ADSC-Exos, mediated by the miR-590-3p/STAT1 pathway, reduced inflammation, improved Choke II vessels, and promoted wound healing. Conclusions: The study identifies a novel therapeutic mechanism where miR-590-3p in ADSC exosomes regulates the miR-590-3p/STAT1 pathway, leading to reduced inflammation, improved vascularization in perforator flaps, and enhanced wound healing. These findings suggest that ADSCs-Exos could be a promising approach for treating complex wounds, offering new avenues for therapeutic interventions aimed at improving vascularization and tissue repair. Vascular proliferation Macrophage ADSCs Exosome miR-590-3p Polarization Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction The International Society for Wound Healing defines chronic wounds as wounds that are unable to achieve a state of anatomical and functional integrity through a normal, organized, and timely reparative process. 1 The management of chronic wounds has consistently posed challenges, prompting significant scrutiny due to escalating healthcare expenditures and mortality rates. 2 Chronic wounds encompass distinct phases of inflammation, proliferation, and remodeling, typically initiated by trauma, cutaneous injury, and various pathological conditions. 3 The role of M2 macrophages in wound healing, particularly during the later stages of neovascularization and tissue remodeling, has been substantiated by relevant studies. 4 , 5 Macrophages play a pivotal role in the body's immune system, exhibiting phagocytic functions and serving as crucial mediators of inflammation, fibrosis, and wound healing through the secretion of cytokines and growth factors. 6 Additionally, macrophages play a crucial role in the initiation and resolution of inflammation induced by pathogens or injuries. 7 Macrophages can be broadly classified into two types: classically activated macrophages (M1) and alternatively activated macrophages (M2). 8 The phenotypic modulation of cells induced by the surrounding microenvironment results in macrophage polarization, which activates specific functional programs. 9 M1 macrophages can be induced by granulocyte-macrophage colony-stimulating factor (GM-CSF) or interferon-γ (IFN-γ). Upon stimulation with bacterial products such as lipopolysaccharide (LPS), macrophages produce high levels of proinflammatory cytokines including interleukin 23(IL-23) and IL-12. M2 macrophages can be induced by IL-4 and exhibit elevated levels of IL-10 and arginase 1(ARG-1), which confer anti-inflammatory and tissue reparative properties within the organism. 10 , 11 Adipose-derived stem cells (ADSCs) are versatile stem cells that possess regenerative medicine efficacy and tissue repair functions. 12 Relevant studies have substantiated the close association between ADSCs and the modulation of inflammatory responses. Exosomes from adipose-derived stem cells (ADSC-Exos) have been shown to regulate macrophage polarization. 13 Accumulating evidence suggests miRNA as a new subcellular entity acting as a fundamental link between inflammation and ADSC-Exos. 14 , 15 microRNA-590-3p(miR-590-3p) is a recently discovered signaling molecule that exerts regulatory effects on the pathogenesis and progression of tumors, atherosclerosis, and inflammatory disorders. 16 – 19 The relationship between exosome-mediated macrophage polarization and miR-590-3p, as well as the relevant regulatory molecular mechanism, remains unclear. The flap technique plays a crucial role in the management of chronic wounds, while addressing the global challenge of flap survival remains imperative.Vascular endothelial cells constitute the innermost layer of blood vessels, playing a pivotal role in the mechanism of wound healing vascularization, and providing paracrine support to neighboring non-vascular cells. 20 Macrophages exerts a significant impact on the physiological functions of vascular endothelial cells. 21 The mechanism of communication between macrophages and endothelial cells remains the central focus of ongoing research. Endothelial cells play a significant role in the vascularization of flaps. These perforator angiosomes are classified into three distinct zones, progressing from proximal to distal: the anatomical zone, the hemodynamic zone, and the potential zone 22 . The transitional area between the hemodynamic and potential zones is designated as the Choke II zone. Inadequate blood supply within the Choke II zone frequently results in ischemic necrosis of the multiterritory perforator flap, significantly impacting the viability of the flap 23 . The role of ADSC-Exosomes in enhancing flap survival and wound healing by improving the Choke II zone, as well as the specific underlying mechanisms, warrants further investigation. The present study is primarily divided into three sections. Firstly, this study is to validate the correlation between ADSCs-Exos mediated miR-590-3p and macrophage polarization at the cellular level, thereby providing fundamental molecular theoretical support. Furthermore, we investigated the impact of miR-590-3p-mediated macrophage polarization on endothelial cell proliferation and vascularization. Thirdly, an experimental model of perforator flap will be established in SD rats to validate the impact of miR-590-3p on flap survival and tissue angiogenesis mechanism. Materials and methods Animal Twelve-week-old Sprague-Dawley (SD) rats were purchased from Hunan SilaikeJinDa Laboratory Animals Co, LTD (Chang-sha, China). The animals were maintained under controlled conditions with a temperature of 22 ± 1°C, a relative humidity of 50 ± 1%, and a light-dark cycle of 12/12 h. The animal studies, including the rat euthanasia procedure, were conducted in accordance with the regulations and guidelines of The Second Xiangya Hospital, Central South University of Medicine institutional animal care. These studies were carried out following the ARRIVE guidelines 24 . Cells and cell culture The Raw264.7 cells and Human Umbilical Vein Endothelial Cells (HUVECs) were purchased from the Chinese Academy of Sciences Cell Bank (Shanghai, China). The Raw264.7 cells were cultured in Dulbecco’s modified Eagle medium (Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (Gibco, Grand Island, NY, USA) and 1% double antibiotics (streptomycin + penicillin; Gibco,Grand Island, NY, USA). HUVECs were cultured in endothelial cell medium (iCell Bioscience, China). The cells were maintained at a temperature of 37°C in a humidified atmosphere containing 5% CO2 and 95% air. Isolation and identification of ADSCs The subcutaneous adipose tissue in the inguinal region of 12-week-old male SD rat was aseptically isolated and digested with type I collagenase (Solarbio,China) for 1h on a constant temperature shaker. After filtration using a 70 µm grid, the digestion of ADSCs was terminated by adding DMEM medium supplemented with 10% FBS and 100 U/ml double antibiotics. Following centrifugation, the ADSCs were cultured in complete medium under humidified conditions containing 5% CO 2 /95% air at 37°C. The third passage of ADSCs was collected and rinsed with phosphate buffer solution (PBS). The phenotypes of ADSCs, including CD14 (Biolegend,USA), CD19 (Biolegend,USA), CD34 (Invitrogen,USA), CD44 (Invitrogen,USA), CD73 (Biolegend,USA) and CD90 (Biolegend,USA) were analyzed using flow cytometry. The third generation of ADSCs were cultured in osteogenic induction medium for a duration of 3 weeks, followed by staining with alizarin red. Additionally, the cells were incubated in adipogenic induction medium for 2 weeks and stained with oil red o. Isolation and characterization of ADSC‑Exos For the extraction of ADSC-Exos, a specific protocol based on ultracentrifugation can be followed as described in previous study. 25 ADSC samples were subjected to centrifugation at 300, 2000, and 10000 g for 10, 10, and 30 min respectively to obtain supernatant. The collected supernatant was then ultracentrifuged at 100000 g for 75 min to isolate the precipitate which was subsequently resuspended in PBS and centrifuged again at the same speed for another 75 min. The precipitate obtained following the aforementioned procedure is ADSC-Exos. Nanoparticle tracking analysis (NTA)(ZetaView, Particle Metrix, Meerbusch, Germany) enables the determination of exosomal diameter. The morphological characteristics of exosomes were examined using a transmission electron microscope (JEM-2100F, Japan Electronics Corporation, Tokyo, Japan). Western blotting was employed to detect the presence of exosomal protein markers CD9 (Abcam, UK), CD63 (Abcam, UK) and HSP90 (Abcam, UK). Co‑culture of Raw264.7 cells with ADSC‑Exos The Raw264.7 cells were cultured according to previously described methods in DMEM supplemented with 10% FBS and 1% double antibiotics solution. 26 The Raw264.7 cells in the ADSC‑Exos group were cultured with 20µg/ml ADSC-Exos. The negative control group was simultaneously established, and exosome-depleted serum was employed for cultivation. The M1 macrophages group was treated with 1000ng/ml LPS and 20ng/ml IFN-γ. The expression level of miRNA-590-3p was detected using RT-qPCR, and the expression levels of Arg-1 and TNF-α in Raw264.7 cells in different groups were also assessed using RT-qPCR. miRNA transfection RAW264.7 cells were transfected with 10nM miR-590-3p mimics (HanHeng, China) and 10nM miR-590-3p inhibitors (HanHeng, China) using Invigentech INVI DNA RNA transfection reagent(Invigentech, USA) overnight in DMEM, resulting in the acquisition of 1×10 6 RAW cells per well. The primer sequences of mi-RNA listed in Table 1 . Simultaneously, a blank control group was established. The miRNA transfection efficiency was assessed by RT-qPCR to detect the expression of miR-590-3p in each group. Table 1 Primer nucleotide sequences of mi-RNA and si-RNA Name Primer sequence mimics NC Primer F: UCACAACCUCCUAGAAAGAGUAGA Primer R: UCUACUCUUUCUAGGAGGUUGUGA miR-590-3p mimics Primer F: UAAUUUUAUGUAUAAGCUAGU Primer R: ACUAGCUUAUACAUAAAAUUA inhibitor NC Primer F: UAAUUUUAUGUAUAAGCUAGU miR-590-3p inhibitor Primer F: ACUAGCUUAUACAUAAAAUUA si-STAT1 Primer F: CACUGUGAUGUUAGAUAAATT Primer R: UUUAUCUAACAUCACAGUGTT si-STAT1 NC Primer F: UUCUCCGAACGUGUCACGUTT Primer R: ACGUGACACGUUCGGAGAATT The Invigentech INVI DNA RNA transfection reagent was combined with miR-590-3p mimics, miR-590-3p mimics NC, miR-590-3p inhibitor, and miR-590-3p inhibitor NC, respectively. The medium was replenished 24h post-transfection of macrophages. The miR-590 mimics group and miR-590 mimics NC group were treated with LPS (1000 ng/ml) and IFN-γ (20 ng/ml) for 24 h. The miR-590 inhibitor group and the miR-590 inhibitor NC group were treated with IL-4 (20 ng/ml) for 24h. RT-qPCR was employed to assess the expression levels of STAT1, TNF-α, ARG-1, and NOS2 in each experimental group. Flow cytometry was utilized for the detection of CD86 and CD206 expression levels in macrophages. Western Blot analysis was performed to determine the protein expression levels of STAT1, p-STAT1, INOS, and Arg-1 in each group.· si-RNA transfection According to the Invigentech transfection protocol, RAW264.7 cells were transfected with si-STAT1 and si-STAT1 NC separately. The primer sequences of si-RNA listed in Table 1 . Gene silencing was assessed 24h post-transfection using RT-qPCR. Subsequently, LPS (1000ng/ml) and IFN-γ (20ng/ml) were added to each group for an additional 24h incubation. RT-qPCR was used to detect the expression levels of STAT1, TNF-α, Arg-1 and NOS2 in each group. The expression levels of CD86 and CD206 in macrophages were detected by flow cytometry. The protein expression levels of STAT1, p-STAT1, iNOS and Arg-1 in each group were detected by Western Blot. Western blot The samples were treated with RIPA peptide lysis buffer containing 1% protease inhibitors (Roche, Switzerland). Following a series of electrophoresis, membrane transfer, and blocking procedures, the membranes were incubated overnight at 4°C with the following antibodies: anti-STAT1(Proteintech, China), anti-p-STAT1(Proteintech, China), anti-Arg-1(Abcam, UK), anti-TNF-α(Proteintech, China), anti-NOS2(Abcam, UK), and anti-GAPDH(Abcam, UK). After co-culturing macrophages with endothelial cells in each group, the target proteins were detected using anti-Bcl-2(Abcam, UK), anti-Bax(Abcam, UK), anti-Caspase3(Abcam, UK), anti-MMP-9(Abcam, UK), anti-MMP-2(Abcam, UK) and anti-VEGFR1(Proteintech, China). In the perforator flap model, the target proteins in the tissue were detected using anti-STAT1 (Proteintech, China), anti-VEGF (Abcam, UK), anti-IL-6 (Abcam, UK), anti-VCAM-1 (Abcam, UK), anti-IL-1 (Abcam, UK), anti-MCP-1 (Abcam, UK), and anti-iCAM-1(Abcam, UK).Membranes were rinsed three times with tris-buffered saline gradient (TBST) and incubated with peroxidase-labeled secondary antibodies for 2h at room temperature. Finally, protein signals were developed using enhanced chemiluminescence (ECL) reagents (Sigma, Germany) and visualized using the Biorad Gel Doc EQ system. Quantitative analysis of gray values was performed using Image J software (Rawak software, Inc.). Reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) The Total RNA Extraction Kit reagent (Accurate Biology,China) was used for the extraction of each cell sample. Subsequently, the extracted RNA was reverse transcribed into cDNA using a kit (Accurate Biology,China) following the manufacturer's instructions. The amplification of cDNA templates was performed using the SYBR Green kit (Accurate Biology,China). The expression of miR-590-3p was normalized to U6 transcript levels. Relative mRNA expression levels were normalized to β-actin. Primer sequences listed in Table 2 were synthesized by Hanheng Biotechnology Co., LTD (Shanghai, China). RT-qPCR analysis was conducted three times for each sample and the relative fold change in gene expression was calculated using the 2 - CΔΔt method(Table 2 ). Table 2 Primer nucleotide sequences of RT-qPCR Name Primer sequence TNF-α Primer F: GCCAGGAGGGAGAACAGAAACTC Primer R: GGCCAGTGAGTGAAAGGGACA Arg − 1 Primer F: CAGCACTGAGGAAAGCTGGT Primer R: ACAGACCGTGGGTTCTTCAC NOS2 Primer F: ACTACTGCTGGTGGTGACAA Primer R: GAAGGTGTGGTTGAGTTCTCTAAG STAT1 Primer F: AGCTTGACGACCCTAAGCG Primer R: CCCACTATCCGGGACATCTCA miR-590-3p GCGCGTAATTTTATGTATAAGCTAG U6 Primer F: CTCGCTTCGGCAGCACA Primer R: AACGCTTCACGAATTTGCGT Β-actin Primer F: GGCTGTATTCCCCTCCATCG Primer R: GGCTGTATTCCCCTCCATCG VEGF1 Primer F: TCACCAAGGCCAGCACATAG Primer R: GAGGCTCCAGGGCATTAGAC MMP-2 Primer F: GCAGTGGGGGCTTAAGAAGA Primer R: CTTGGGGCAGCCATAGAAGG Bax Primer F: GGGGAGCAGCCCAGAGG Primer R: TCAGCTGCCACTCGGAAAAA Bcl-2 Primer F: AACATCGCCCTGTGGATGAC Primer R: ACTTGTGGCCCAGATAGGCA Caspase3 Primer F: GCAGCAAACCTCAGGGAAAC Primer R: CAGTTCTGTACCACGGCAGG MMP-9 Primer F: GTACTCGACCTGTACCAGCG Primer R: TTCAGGGCGAGGACCATAGA VEGF-A Primer F: TGAGACCCTGGTGGACATCT Primer R: GCTGGCTTTGGTGAGGTTTG VCAM-1 Primer F: TGTAACTCTGGGAAACTGGAAAGA Primer R: TCAGGAGCCAAACACTTGACC IL-1β Primer F: CCCTGAACTCAACTGTGAAATAGCA Primer R: CCCAAGTCAAGGGCTTGGAA IL-6 Primer F: ATTGTATGAACAGCGATGATGCAC Primer R: CCAGGTAGAAACGGAACTCCAGA iCAM-1 Primer F: GGCTTCTGCCACCATCACT Primer R: TGTCTCATTCCCACGGAGCA MCP-1 Primer F: CTATGCAGGTCTCTGTCACGC Primer R: CAGCCGACTCATTGGGATCA Flow cytometry The cells from each group were collected and subjected to two washes with 2 ml of 0.5% BSA-PBS. Subsequently, the cells were centrifuged at 500 g for 5 min at a temperature of 4°C. The cells were preincubated with a mouse Fc receptor blocker (BioLegend, USA) for 15 min. The cells were then resuspended in an appropriate flow buffer, and the antibodies CD86 (BioLegend, USA) and CD206 (BioLegend, USA) were added to each group of sample cells for flow assays. Subsequently, the cells were incubated at 4°C in the dark for 45 min. After the completion of incubation, the cells were subjected to a second round of centrifugation and subsequently analyzed using a flow cytometry instrument(BECKMAN COULTER, USA). Co‑culture of Raw264.7 cells with HUVEC cells The experimental part was divided into four groups: miR-590-3p mimics NC + si-STAT1 NC group, miR-590-3p mimics + si-STAT1-NC group, miR-590-3p mimics NC + si-STAT1 group and miR-590-3p mimics + si-STAT1 group. According to the aforementioned transfection protocol, INVI DNA RNA transfection reagent was utilized for the transfection of miR-590-3p mimics, miR-590-3p mimics NC, and miR-590-3p inhibitor into the corresponding groups of macrophages. Following this transfection procedure, si-STAT1 and si-STAT1 NC were transfected based on the specific transfection conditions for each group. Transwell chambers (6.5mm, 3.0µm pore size) were utilized for the co-culture of HUVECs and RAW 264.7 macrophages. HUVECs were seeded in the lower chamber while macrophages were placed in the upper chamber. Following a 48h co-culture period, HUVECs were extracted for subsequent analysis. Tube formation assay in vitro HUVEC were co-cultured with four groups of RAW 264.7 subjected to different interventions and seeded in 48-well culture plates precoated with 130µl matrigel basement membrane matrix (BD Biosciences, USA). After incubating for 4h, tube images were captured using a digital camera, and tube formation was quantified using the Image J software. CCK‑8 assay The Cell Counting Kit-8 (CCK-8; Solarbio, China) was utilized to assess the impact of macrophages on HUVEC proliferation in each experimental group. In brief, cells were seeded into 96-well plates at a density of 3,000 cells per well. After incubation, the cells were washed three times with PBS, followed by the addition of 10 µl of CCK-8 solution (10 µl; 1:10 diluted) into fresh culture medium at 37°C for 2 h at different time points (0, 24, 48, and 72h). The optical absorbance at 450 nm for each sample was finally measured using an absorbance microplate reader (ELx800, BioTek, USA). The presence of a higher optical density (OD) value suggests a more advantageous cellular condition. Scratch assay The impact of macrophages in each intervention group on HUVEC migration was assessed using the scratch wound assay. The HUVECs from each group were seeded in 6-well plates (5×10 5 cells/tube). Once the plates were fully covered with a monolayer of cells, the upper suspension cells were gently washed off using PBS by crossing the center with a 10 µl pipette tip. Subsequently, photographs were captured under an inverted microscope after incubating for 0h and 24h in serum-free medium to determine the percentage of migrated area. Cell apoptosis assay The HUVECs cell suspension in each group was aliquoted into EP tubes, diluted with Binding Buffer, and then combined with 5µl Annexin V-APC (Elabscience, China) and 5µl Propidium Iodide (Solarbio, China). The cells were incubated at 25°C for 15 min, followed by analysis using flow cytometry. Establishment of rat perforator flap models In this experiment, 40 male SD rats were randomly divided into 4 groups according to different cell suspensions injected subcutaneously. To minimize bias arising from animal factors, we assigned unique identification numbers to 40 Sprague-Dawley rats and created corresponding numbered cards. Four researchers subsequently drew the cards in a randomized sequence to determine the allocation of rats into respective experimental groups. The grouping conditions were the same as the cell experiment: miR-590-3p mimics NC + si-STAT1 NC group, miR-590-3p mimics + si-STAT1-NC group, miR-590-3p mimics NC + si-STAT1 group and miR-590-3p mimics + si-STAT1 group. All rats were anesthetized by intraperitoneal injection with 3% sodium pentobarbital at a dose of 60 mg/kg. After successful anesthesia, the surgical area was treated with hair removal and disinfection. A 12×3cm flap was constructed on the right back of the rat, with the upper boundary being the two lines of the subscapular horn on both sides of the rat, and the lower boundary being the line of the posterior superior iliac spine on both sides (Fig. 7 A). Blunt separation was performed in the carnal membrane and the puncture branches of the dorsal thoracic artery and intercostal artery were ligation using non-absorbable surgical sutures (Fig. 7 B). Two key areas, chokeⅠ and choke Ⅱ, were labeled on the back epidermis of rats, interrupted suture with 5 − 0 non-absorbable nylon thread in situ, sterilized the operation area again, and then put back into a separate cage after the rats recovered safely. Macrophages were transfected 24 hours later by adding IL-4 (20 ng/ml) to induce differentiation into M2 macrophages, and then co-cultured with endothelial cells. The prepared 1 ml cell suspension was injected subcutaneously into the skin at the proximal 1/3 of the vascular body area of the dorsal thoracic artery of the rat flap at the same time point on the 0, 1, 3, 5 and 7 days after surgery, respectively. The injection was performed with isoflurane (0.41 ml/min at 4 L/min Fresh gas flow) under inhalation anesthesia. On the 8th day after operation, full-layer skin flaps with a central area of chokeⅡ of 2 cm×2 cm were selected for RT-QPCR, Western blot, HE staining and immunofluorescence staining. Primer sequences listed in Table 2 were synthesized by Hanheng Biotechnology Co., LTD (Shanghai, China) The survival rate of the perforator flap The condition of the rat skin flap was carefully observed and recorded within 7 days after the construction of the rat skin flap. The evaluation indexes include skin flap color changes, tissue softness and elasticity assessment, skin and hair growth status, infection, and necrosis. Once the skin flap color turns black, the tissue becomes hard and atrophy, lack of elasticity, and no blood flow during cutting, the skin flap necrosis can be determined. The survival rate of skin flap in each group was calculated as follows: The survival rate of skin flap = \(\:\frac{Flap\:survival\:area}{\:Total\:flap\:area}\) ×100% Gelatin-lead oxide angiography First, the infusion solution was prepared: 100 mL normal saline + 5 g gelatin powder + 100 g lead oxide powder, stirred in a constant temperature water bath at 40℃ until dissolved. Three rats were taken from each of the four groups. After satisfactory anesthesia, the right common carotid artery of the rats was fully exposed. 24 G disposable silicone intravenous indent needle was inserted into the right common carotid artery from the head to the tail, and 2 mL heparin sodium solution (50 IU/mL) was injected into the right common carotid artery at the same time to ensure that the blood in the rats was completely emptied. The pre-configured gelatine-lead oxide mixture was then slowly injected into the right common carotid artery using a 20 mL syringe at a dose of 30 mL/kg. During the infusion process, the infusion was stopped immediately when spotty or patchy color of the infusion was observed in the cornea and limbs of the rats. The experimental specimens were placed in a refrigerator at 4℃ overnight. On the next day, the flap tissue of the back of the rats was separated, and X-ray was performed after tiling (conditions were 40 kV, 5 mA, exposure time was 0.1s). Statistical analysis The statistical data were reported as the mean ± standard deviation. One-way analysis of variance (ANOVA) and t-test were employed to compare the data between groups. P value less than 0.05 was considered statistically significant. The data analysis and statistical figure drawing were performed using GraphPad Prism 8.0 software (GraphPad, La Jolla, CA,USA, http://www.graphpad . com). Results Isolation and characterization of ADSCs and ADSC‑Exos ADSCs obtained from the inguinal region of SD-rats exhibited robust growth(Fig. 1 A) and demonstrated successful differentiation into both adipocytes(Fig. 1 B) and osteoblasts(Fig. 1 C). The flow cytometry analysis revealed that ADSCs exhibited high expression levels of CD19, CD14, and CD34, while demonstrating low expression levels of CD44, CD73 and CD90(Fig. 1 G). Transmission electron microscopy showed that the morphology of exsomes was double-membrane structure and cup-like shape(Fig. 1 D). NTA analysis of ADSC-Exos further suggested that the average diameter of exosomes was (82.23 ± 21.21) nm(Fig. 1 E). The western blot results demonstrated that ADSCs-Exos exhibited high expression levels of CD9, CD63, and HSP90(Fig. 1 F). ADSC‑Exos can enhance the expression of miR 590-3p in RAW 264.7 The expression of miR-590-3p was detected using RT-qPCR in both the ADSC‑Exos group and the control group. Compared to the control group, the ADSC‑Exos group exhibited significantly elevated levels of miR-590-3p expression(Fig. 2 A). ADSC‑Exos can enhance the expression of anti-inflammatory factors in RAW 264.7 Compared to the control group, the LPS + IFN-γ stimulation group exhibited a 6-fold increase in TNF-α gene expression and a 0.5-fold decrease in Arg-1 gene expression(Fig. 2 B and Fig. 2 C). The expression of the Arg-1 gene was upregulated 4-fold in response to ADSC-Exos group compared to the control group(Fig. 2 B). The expression of the TNF-α gene did not show any significant difference between ADSC-Exos group and the control group(Fig. 2 C). The induction of M2 macrophage polarization was observed upon miR-590-3p stimulation. To investigate the impact of miR-590-3p on M2 macrophage polarization, RAW 264.7 were transfected with miR-590-3p mimics, miR-590-3p mimics NC, miR-590-3p inhibitor, miR-590-3p inhibitor NC. RT-qPCR results and fluorescence microscopy findings demonstrated the successful transfection of macrophages(Fig. 1 H, 1 I, 1 J). RT-qPCR results demonstrated a significant decrease in the expression levels of TNF-α and iNOS in the miR-590-3p mimics group, while there was an increase in the expression level of Arg-1(Fig. 2 E, 2 F, 2 G). Conversely, the miR-590-3p inhibitor group exhibited elevated expression levels of TNF-α, iNOS, and STAT1, accompanied by a reduction in the expression level of Arg-1(Fig. 2 I, 2 J, 2 K). The Western Blot results revealed a significant decrease in the expression levels of iNOS, STAT1 and p-STAT1 proteins in the miR-590-3p mimics group, while there was an increase in the expression level of Arg-1 protein(Fig. 3 A, 3 C, 3 D, 3 E, 3 B). Conversely, the miR-590-3p inhibitor group exhibited a decrease in the expression level of Arg-1 protein and an increase in the expression levels of iNOS, STAT1 and p-STAT1proteins(Fig. 3 F, 3 G, 3 H, 3 I). The flow cytometry results demonstrated that the expression level of CD206 was higher in the miR-590-3p mimics group compared to the miR-590-3p mimics NC group(Fig. 4 D), while the expression level of CD86 was lower in the miR-590-3p mimics group than in the miR-590-3p mimics NC group(Fig. 4 A). The inhibition of miR-590-3p led to a reduction in the expression of CD206 and an elevation in the expression of CD86. (Fig. 4 E, 4 B). MiR-590-3p mediated STAT1 involved in the regulation of macrophage polarization We detected the expression of STAT1 in RAW 264.7 after transfection with miR-590-3p mimics, miR-590-3p mimics NC, miR-590-3p inhibitor and miR-590-3p inhibitor NC. The expression level of STAT1 was downregulated in the miR-590-3p mimics group(Fig. 2 D). Conversely, the miR-590-3p inhibitor group exhibited an upregulation in STAT1 expression(Fig. 2 H). Western Blot results demonstrated a significant decrease in the expression level of STAT1 protein in the miR-590-3p mimics group(Fig. 3 D), whereas an increase in STAT1 protein expression was observed in the miR-590-3p inhibitor group(Fig. 3 H). In addition, we detected inflammatory cytokines in RAW 264.7 transfected with si-STAT1 and si-STAT1 NC. RT-qPCR analysis revealed a significant decrease in the expression levels of TNF-αand NOS2, while an increase was observed in the expression level of Arg-1 within the si-STAT1 group(Fig. 2 N, 2 O, 2 M). Western Blot results demonstrated a significant reduction in the expression levels of iNOS, STAT1 and p- STAT1 proteins in the si-STAT1 group, accompanied by an increase in the expression level of Arg-1 protein(Fig. 3 K, 3 L, 3 M, 3 J). The flow cytometry results revealed that the expression of CD206 was significantly higher in the si-STAT1 group compared to the si-STAT1 NC group(Fig. 4 F), while the expression of CD86 was notably lower in the si-STAT1 group than in the si-STAT1 NC group(Fig. 4 C). The co-culture of RAW 264.7 cells with miR-590-3p overexpression and HUVEC resulted in enhanced migration of HUVEC The expression of miR-590-3p and STAT1 in each group was detected using RT-qPCR after transfection. Notably, miR-590-3p expression exhibited the most significant change, while STAT1 expression showed the least pronounced alteration in the miR-590-3p mimics + si-STAT1 group, indicating successful transfection of RAW 264.7 (Fig. 6 I and Fig. 6 J). The scratch assay was employed to assess the impact of each intervention strategy on HUVEC migration by RAW264.7. The migration rate of the miR-590-3p mimics + si-STAT1 group exhibited the highest level, while both the miR-590-3p mimics NC + si-STAT1 group and miR-590-3p mimics + si-STAT1 NC group also demonstrated significantly elevated migration rates compared to the miR-590-3p mimics NC + si-STAT1 NC group. These differences were found to be statistically significant(Fig. 5 A and Fig. 5 G). The scratch assay demonstrated that the overexpression of miR-590-3p significantly enhanced the migratory capacity of HUVEC. The co-culture of RAW 264.7 cells with miR-590-3p overexpression and HUVEC resulted in a reduction in HUVEC apoptosis The apoptosis rate of cells was determined using flow cytometry analysis. The average apoptosis rate of HUVEC in the miR-590-3p mimics + si-STAT1 NC group, miR-590-3p mimics NC + si-STAT1 group, and miR-590-3p mimics + si-STAT1 group were 21.14%, 14.72%, 14.24%, and 10.48% respectively. Compared to the control group, the other three groups exhibited a significant reduction in apoptosis rate, with the miR-590-3p mimics + si-STAT1 group demonstrating the lowest level of apoptosis(Fig. 5 B, 5 H). Western blotting was employed to detect the expression levels of apoptosis-related proteins in each experimental group. Compared to the miR-590-3p mimics NC + si-STAT1 NC group, there was a significant reduction observed in Bax (Fig. 6 A, 6 C) and Caspase3 (Fig. 6 A, 6 E) protein levels in the miR-590-3p mimics + si-STAT1 NC group, miR-590-3p mimics NC + si-STAT1 group, as well as the miR-590-3p mimics + si-STAT1 group. The inverse trend was observed for Bcl-2(Fig. 6 A, 6 D). The RT-qPCR results demonstrated that, compared to the miR-590-3p mimics NC + si-STAT1 NC group, the expression levels of Bax (Fig. 6 K) and Caspase3 (Fig. 6 M) were downregulated, while the expression level of Bcl-2 (Fig. 6 L) was upregulated in the remaining three groups. The co-culture of RAW 264.7 cells with miR-590-3p overexpression and HUVEC resulted in enhanced proliferation of HUVEC The effect of miR-590-3p overexpression in RAW 264.7 on HUVEC proliferation was assessed using the CCK-8 assay. The OD values were measured at 24h, 48h, and 72h in this experiment to assess the rate of cellular proliferation. The CCK8 assay revealed a significant increase in proliferation ability for the miR-590-3p mimics + si-STAT1 NC group, miR-590-3p mimics NC + si-STAT1 group, and miR-590-3p mimics + si-STAT1 group compared to the control group(Fig. 5 D). The co-culture of RAW 264.7 cells with miR-590-3p overexpression significantly augmented the angiogenic potential of HUVEC The tube formation assay was employed to assess the angiogenic potential of HUVEC, and cellular morphology was examined under a microscope following 4 h of incubation. The expression levels of miR-590-3p mimics + si-STAT1 NC group, miR-590-3p mimics NC + si-STAT1 group, and miR-590-3p mimics + si-STAT1 group were significantly higher compared to the control group(Fig. 5 C, 5 E, 5 F). The miR-590-3p mimics + si-STAT1 group exhibited the most pronounced improvement based on the tubule experiment results. Western blotting was employed to detect the expression of vascularization-related proteins in each experimental group. Compared to the miR-590-3p mimics NC + si-STAT1 NC group, there was a significant increase in the expression levels of VEGFR1(Fig. 6 A, 6 H), MMP-9(Fig. 6 A, 6 F), and MMP-2(Fig. 6 A, 6 G) in miR-590-3p mimics + si-STAT1 group, miR-590-3p mimics + si-STAT1 NC group and miR-590-3p mimics NC + si-STAT1 group. Additionally, the expression level of miR-590-3p mimics + si-STAT1 group showed a marked enhancement. The RT-qPCR results demonstrated that the expressions of VEGFR1(Fig. 6 P), MMP-9(Fig. 6 N), and MMP-2(Fig. 6 O) were significantly upregulated in the three experimental groups compared to the miR-590-3p mimics NC + si-STAT1 NC group. Local injection of cell suspension after co-culture of miR-590-3p overexpressed macrophages and vascular endothelial cells can reduce the necrosis rate of the distal flap The operation was successful for all 40 rats, with no fatalities. On the first day post-operation, stasis was observed at the distal end of the flap in each rat group. By the third day post-operation, varying degrees of necrosis were evident along the distal flap in all four groups of rats, and the boundary of necrosis was clearly discernible. After 5 days post-surgery, certain rat flaps in the miR-590-3p mimics NC + si-STAT1 group exhibited suboptimal wound healing. By day 7 post-surgery, the impaired healing of a portion of the proximal flap in the miR-590-3p mimics NC + si-STAT1 group demonstrated improvement, while there was a significant reduction in necrotic area observed in all groups for the distal flap.The survival rate of the flap in miR-590-3p mimics NC + si-STAT1 NC group was the lowest. miR-590-3p mimics + si-STAT1 group was the largest, and the flap survival rate of each group was (64.659 ± 1.457)%, (87.307 ± 0.911)%, (74.817 ± 1.000)% and (90.580 ± 0.819)%, respectively. The differences were statistically significant (Fig. 7 C , 7 G, p < 0.0001). Local injection of cell suspension after co-culture of miR-590-3p overexpressed macrophages and vascular endothelial cells inhibited the development of inflammation RT-qPCR showed that compared with the control group (miR-590-3p mimics NC + si-STAT1 NC group), The expression level of miR-590-3p mimics + si-STAT1 in the NC group and the miR-590-3p mimics + si-STAT1 group was significantly increased, reaching 4.153 times and 4.361 times that of the control group, respectively, and the difference was statistically significant (Fig. 8 I, p < 0.001). Compared with the control group (miR-590-3p mimics NC + si-STAT1 NC group), The expression of VEGF-A in miR-590-3p mimics + si-STAT1 NC group, miR-590-3p mimics NC + si-STAT1 group and miR-590-3p mimics + si-STAT1 group was increased(Fig. 8 K). It was increased to 1.23 times, 1.11 times and 1.30 times of control group, respectively. On the contrary, the expressions of STAT1, IL-6 ,VCAM-1 ,IL-1β,MCP-1 and iCAM-1 all decreased, and the differences were statistically significant (Fig. 8 J, 8 L, 8 M, 8 N, 8 O, 8 P). Western blot showed that compared with the control group (miR-590-3p mimics NC + si-STAT1 NC group), the protein expressions of STAT1 and IL-6, VCAM-1, IL-1β, MCP-1 and iCAM-1 in the other three groups were decreased to varying degrees(Fig. 8 A, 8 B, 8 D, 8 E, 8 F, 8 G, 8 H). On the contrary, the protein expression of VEGF was increased to varying degrees, and the difference was most significant in miR-590-3p mimics + si-STAT1 group (Fig. 8 A, 8 C). After HE staining, six different visual fields were randomly selected, the number of blood vessels in these visual fields was manually counted, and the average value was calculated, which was used as an indicator to measure microvascular density (MVD). It was found that compared with the control group (miR-590-3p mimics NC + si-STAT1 NC), the number of inflammatory cells in the other three groups was significantly reduced, and the average density of microvessels was also increased, among which the difference was most significant in the miR-590-3p mimics + si-STAT1 group. The mean microvessel density in chokeⅡ of the four groups was (9.21 ± 0.66) /mm², (14.71 ± 1.36) /mm², (12.06 ± 0.90) /mm², and (19.37 ± 0.78) /mm², respectively, with statistical significance compared with the control group (Fig. 7 E, 7 I, P < 0.001). Local injection of cell suspension after co-culture of miR-590-3p overexpressed macrophages and vascular endothelial cells can promote angiogenesis After immunofluorescence staining, three visual fields were randomly selected, and the images were imported into Image J software for counting, and mean fluorescence intensity (MFI) was selected as the evaluation index. Compared with the control group (miR-590-3p mimics NC + si-STAT1 NC), the average fluorescence intensity of CD31, CD34 and VEGF in the other three groups were increased to varying degrees. The increase was most significant in miR-590-3p mimics + si-STAT1 group (Fig. 7 D, 7 H). It was found by gelatin-lead oxide angiography that compared with the control group (miR-590-3p mimics NC + si-STAT1 NC), the other three groups of flaps had more angiogenesis in Choke Ⅱ area, and the structure was relatively clear and complete, and the vascular diameter was relatively larger. In particular, miR-590-3p mimics + si-STAT1 group was most significant (Fig. 7 F). Discussion The local damage to a perforator flap primarily arises from compromised blood flow in the choke vessel, leading to ischemia and hypoxia 27 . This is further exacerbated by reperfusion injury and the release of inflammatory mediators, which subsequently trigger cellular apoptosis and necrosis. The expression of angiogenesis factors and the organization of vascularization play a crucial role in skin flap regeneration. Therefore, there is a global research focus on exploring strategies to enhance flap survival. Macrophages and endothelial cells play an important role in wound healing, and whether ADSC-Exos has signaling pathways that regulate macrophages and endothelial cells needs verification. Several studies 28 – 30 have confirmed that the exosomes derived from mesenchymal stem cells have the ability to modulate macrophage polarization. ADSC-Exos exert a significant impact on abdominal aortic aneurysm 31 , tissue healing 32 and myocardial infarction 33 by regulating the expression of inflammation. Nevertheless, the role and underlying mechanisms of ADSC-Exos in macrophage polarization progress have not been thoroughly investigated. In the present study, we provided novel insights into the effect of ADSC-Exos in modulating the macrophage polarization pathological process. The findings simultaneously offer novel insights into the regulatory interaction between macrophages and endothelial cells(Fig. 9 ). In our study, ADSC-Exos exert a concurrent anti-inflammatory regulatory function in macrophages. Furthermore, our study confirms that stimulation with ADSC-Exos significantly increases the expression of miR-590-3p in RAW cells. These findings provide further evidence supporting the role of exosomes in mediating miRNA functions to regulate signaling pathways. miR-590-3p is a biological molecule that exists in exosomes and plays a pivotal role in the regulation of signaling pathways mediated by exosomes. Current findings 34 reveal that miR-590-3p molecule attenuates inflammatory signals and facilitates epithelial regeneration by specifically targeting LATS1, thereby activating the YAP/β-catenin-regulated transcriptional pathway. Another study 35 shows that miR-590-3p improves diabetic peripheral neuropathic pain by targeting RAP1A and inhibiting T-cell infiltration. In addition, miR-590-3p inhibited Th17 cells by suppressing autophagy. 36 miR-590-3p possesses the capability to attenuate lipopolysaccharide-induced acute kidney injury (AKI) and podocyte apoptosis through its targeting of TRAF6 37 . miR-590-3p can downregulate the expression of iNOS, thereby attenuating the inflammatory response. 38 However, the regulation of macrophage polarization by miR-590-3p lacks further investigation. The findings of this study complement the results obtained from mechanistic investigations on miR-590-3p and its impact on macrophage polarization. JAK/STAT1 pathway is a canonical inflammatory regulatory pathway that plays a pivotal role in macrophage polarization. 39 , 40 And JAK/STAT1 pathway is also activated by the pro-inflammatory cytokines TNF-α and IFN-γ. 41 , 42 Suppressors of cytokine signaling (SOCS) is involved in the suppression of M1 inflammatory phenotype through the JAK/STAT1 pathway. 43 The expression of STAT1 has also been demonstrated to be influenced by insulin. 44 The polarization of M1 macrophages is driven by methyltransferase like 3 (METTL3) through direct methylation of STAT1 mRNA. 45 miR-19a-3p exerts an inhibitory effect on M1 macrophage polarization by suppressing the STAT1/IRF1 signaling pathway. 46 The effect of LNA-anti-miR-150 in folic acid-induced RIF mice may be attributed to its ability to attenuate pro-inflammatory M1 and M2 macrophage polarization through the SOCS1/JAK1/STAT1 pathway. 47 The synergistic action of colorectal cancer-derived miR-21-5p and miR-200a induces polarization of macrophages towards an M2-like phenotype by modulating the PTEN/AKT and SCOS1/STAT1 signaling pathways. 48 The lncGBP9 molecule acts as a sponge for miR-34a, thereby rescuing the expression of SOCS3 and subsequently modulating macrophage polarization through the STAT1/STAT6 signaling pathway. 49 Recent research has also confirmed the macrophage polarization pathways including miR-139-3p/STAT1 50 , miR-155-5p/STAT1 51 , miR-146a-5p/STAT1 52 , miR-23a-3p/STAT1/STAT3 53 , miR-155-5p-SOCS1/JAK1/STAT1 54 , miR-382-5p/STAT1 55 , miR-103/STAT1 56 , STAT1-miR-155-SOCS1 57 , miR-21/STAT1 58 , miR-221/STAT11 59 , miR-1296/STAT1 60 , miR-146/STAT1 61 , miR-150/STAT1 62 ,miR-155/STAT1 63 . The summary indicates a close association between STAT1 and macrophage polarization, with microRNAs playing a pivotal role in its regulatory mechanism. Previous studies 34 have shown that miR-590-3p is associated with inflammatory expression. Our study elucidated that miR-590-3p may be involved in the polarization of macrophages through STAT1. The miR-590-3p minics group, miR-590-3p inhibitor group, si-STAT1 group, and corresponding control groups were established in our study. The results obtained from RT-qPCR, western blot, and flow cytometry collectively indicate that miR-590-3p mimics group possesses the potential to induced the polarization of macrophages towards M2 phenotype. The expression of miR-590-3p was found to exert a negative regulatory effect on the STAT1 signaling pathway. In the subsequent stage of this study, HUVECs were incorporated to explore the plausible association between macrophages and miR-590-3p in governing endothelial cell functionality. The functional status of HUVECs in each group was evaluated by co-cultivating them with macrophages derived from the corresponding transfection groups. After co-culture, the scratch test revealed that the migration rate of HUVECs was highest in both the miR-590-3p mimics + si-STAT1 group and the miR-590-3p mimics NC + si-STAT1 group. Additionally, the migration rate of the miR-590-3p mimics + si-STAT1 NC group was significantly higher than that of the control group, with a statistically significant difference. In the tubule formation assay, although there was no statistically significant difference observed between the miR-590-3p mimics NC + si-STAT1 NC group and the miR-590-3p mimics NC + si-STAT1 group, it is worth noting that under the regulation of si-STAT1, the miR-590-3p mimics NC + si-STAT1 group exhibited an overall trend towards promoting tube formation. The flow cytometry analysis revealed a significant decrease in the apoptosis rate of the three experimental groups compared to the the miR-590-3p mimics NC + si-STAT1 NC group. Notably, the apoptotic rate of the miR-590-3p mimics + si-STAT1 group exhibited a significantly lower level compared to that observed in the other experimental groups. The CCK-8 assay is widely employed for assessing cell proliferation and toxicity. In this study, the proliferation activity of the other three groups exhibited a higher level compared to that of the miR-590-3p mimics NC + si-STAT1 NC group. Collectively, the aforementioned experiments demonstrate that miR-590-3p and si-STAT1 are capable of regulating M2 macrophage polarization, enhancing HUVEC migration, inhibiting HUVEC apoptosis, and promoting angiogenesis. The BAX and Bcl-1 are commonly utilized as indicators to assess the extent of their influence on apoptosis. 64 Moreover, the apoptotic protease Caspase3, being a well-established player in cell apoptosis, is directly implicated in the process. 65 In this study, macrophages treated with miR-590-3p mimics and si-STAT1 exhibited a reduction in the Bax/Bcl ratio and Caspase-3 expression in endothelial cells, leading to inhibition of cell apoptosis and promotion of cell survival, thereby facilitating angiogenesis. The involvement of matrix metalloproteinases (MMPs) in tumor invasion, metastasis, and angiogenesis has been well-established. 66 The previous studies have demonstrated that MMP-2 and MMP-9 exert a stimulatory effect on the proliferation, migration, and cell cycle progression of vascular endothelial cells, thereby ultimately facilitating angiogenesis. 67 In this study, the expression of MMP-2 and MMP-9 at both gene and protein levels is significantly up-regulated by M2 macrophages, thereby facilitating cell migration and proliferation. The vascular endothelial growth factor (VEGF) can mediate the proliferation, migration, and tube formation of endothelial cells, thus serving as a reliable marker for vascularization. 68 , 69 M2 macrophages are capable of secreting VEGF and facilitating angiogenesis in HUVECs through their interaction with the VEGFR receptor. 70 Additionally, it has been suggested that M2 macrophages may exert a promotive effect on the expression of VEGFR1. 71 The findings of our study demonstrate that transfected miR-590-3p macrophages have the ability to enhance endothelial VEGFR1 expression, thereby facilitating angiogenesis. The potential of miR-590-3p in promoting tissue angiogenesis was further validated in animal models of perforator flaps. This study elucidates the cellular interactions in the microenvironment after perforator flap surgery, further revealing the mechanisms of flap survival and distal ischemic necrosis. In the structure of perforator flaps, In the miR-590-3p mimics + si-STAT1 group, both the gene and protein expression of VEGF-A were upregulated, while the gene expression of VCAM-1, IL-1β, IL-6, iCAM-1, and MCP-1 was downregulated. The protein expression of IL-6, IL-1β, MCP-1, and VCAM-1 was also reduced. This indicates that the cell suspension obtained by co-culturing macrophages and endothelial cells overexpressing miR-590-3p exerts an inhibitory effect on local inflammatory development in the flap.Furthermore,choke vessel plays a crucial role in interconnecting blood vessels, serving as a vital conduit to ensure stable blood supply across the flap region 72 . Therefore, maintaining the function of the choke vessel is paramount for ensuring flap survival in its early stages. Meanwhile, in our study, the miR-590-3p mimics + si-STAT1 group exhibited the most significant increase in choke vessels, providing microscopic evidence that ADSC-Exos-mediated miR-590-3p/STAT1 axis promotes tissue angiogenesis. However, our study still has some limitations. RAW246.9 and HUVECs were employed in the experiment, and employing primary macrophages for further validation would enhance the persuasiveness of the findings. The exosomes are abundant in a diverse array of regulatory factors; however, further investigation is required to establish correlations among these various regulatory factors in future studies. Subsequent research endeavors can delve deeper into exploring the effects of miR-590-3p-induced macrophages on the biological functions of animal models.Moreover, given the complex composition of ADSC-Exosomes, where miRNA constitutes only one of its components, and considering the variability in exosome content across different specimens, a direct comparison between ADSC-Exosomes and miRNA in mechanistic studies is not feasible; therefore, no dedicated exosome group was established for this mechanism research. Conclusions In summary, this study reveals that ADSC-Exos can mediate macrophage M2 polarization through the miR-590-3p/STAT1 pathway, thereby promoting endothelial cell proliferation, migration, and angiogenesis, with a positive effect on the angiogenesis and wound healing of the choke vessel of the perforator flap. The miR-590-3p molecule exhibits anti-inflammatory properties, thereby indicating its potential as a promising therapeutic approach for diseases associated with inflammation in the future. Abbreviations ADSCs-Exos Adipose-derived stem cell exosomes ADSCs Adipose-derived stem cells GM-CSF Granulocyte macrophage colony stimulating factor IFN-γ Interferon-γ LPS Lipopolysaccharide IL-23 Interleukin 23 ARG-1 Arginase 1 miR-590-3p MicroRNA-590-3p SD Sprague-dawley HUVECs Human umbilical vein endothelial cells PBS Phosphate buffer solution NTA Nanoparticle tracking analysis MMPs Matrix metalloproteinases ADSCs Adipose derived stem cells ADSCs-Exos Adipose-derived stem cell exosomes MSCs Mesenchyma stem cells PBS Phosphate buffer saline FBS Fetal bovine serum RT-PCR Realtime-polymerase chain reaction DMEM Dulbeccos minimum essential medium INOS Inducible nitric oxide synthase ARG- 1 Arginase- 1 rpm Revolutions per minute TNF-α Tumor necrosis factor-α LPS Lipopolysaccharides IFN-γ Interferon-gama IL-23 Interleukin 23 IL-6 Interleukin 6 IL-10 Interleukin 10 IL-1β Interleukin 1β NTA Nanoparticle tracking analysis MMPs Matrix metalloproteinases MMP-2 Matrix metalloproteinases 2 MMP-4 Matrix metalloproteinases 4 TNF-α Tumor necrosis factor-α OD Absorbance VEGF Vascular endothelia growth factor HE Hematoxylinand Eosin Stain MVD Microvessel density DCI Deep iliac circumflex artery Declarations Data and code availability The data supporting the findings of this study are available from the corresponding authors upon reasonable request. Consent for publication Consent for publication has been obtained. Competing interests All authors declare that they have no competing interests. Ethics approval The animal use protocol titled "The delivery of exosomes miR-590 participates in ADSC-induced macrophages M2 polarization to improve the blood supply of perforator flaps" has been reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of The Second Xiangya Hospital, Central South University, China on September 10, 2020, with the approval number 2020524. Funding National Natural Science Foundation of China (82272283) Author Contribution declaration Yiwen Deng:Conceptualization;Data curation;Methodology;Writing – original draft Chunjie Li:Data curation;Methodology;Software Dandan Song:Data curation;Methodology;Software;Validation Xiancheng Wang:Conceptualization;Methodology;Funding acquisition;Supervision;Writing – review and editing Zhihua Qiao:Supervision;Validation Quanding Yan:Supervision;Validation Clinical trial number not applicable. Acknowledgements The authors declare that they have not use AI-generated work in this manuscript. References Lazarus GS, Cooper DM, Knighton DR, Percoraro RE, Rodeheaver G, Robson MC. Definitions and guidelines for assessment of wounds and evaluation of healing. Wound Repair Regen Jul. 1994;2(3):165–70. 10.1046/j.1524-475X.1994.20305.x . Xiong Y, Lin Z, Bu P, et al. A Whole-Course-Repair System Based on Neurogenesis-Angiogenesis Crosstalk and Macrophage Reprogramming Promotes Diabetic Wound Healing. Adv Mater May. 2023;35(19):e2212300. 10.1002/adma.202212300 . Tehrany PM, Rahmanian P, Rezaee A, et al. Multifunctional and theranostic hydrogels for wound healing acceleration: An emphasis on diabetic-related chronic wounds. Environ Res Dec. 2023;1(Pt 1):117087. 10.1016/j.envres.2023.117087 . Yu DM, Zhao J, Lee EE, et al. GLUT3 promotes macrophage signaling and function via RAS-mediated endocytosis in atopic dermatitis and wound healing. J Clin Invest Nov. 2023;1(21). 10.1172/jci170706 . Rehak L, Giurato L, Meloni M, Panunzi A, Manti GM, Uccioli L. The Immune-Centric Revolution in the Diabetic Foot: Monocytes and Lymphocytes Role in Wound Healing and Tissue Regeneration-A Narrative Review. J Clin Med Feb. 2022;8(3). 10.3390/jcm11030889 . Hassanshahi A, Moradzad M, Ghalamkari S, Fadaei M, Cowin AJ, Hassanshahi M. Macrophage-Mediated Inflammation in Skin Wound Healing. Cells Sep. 2022;21(19). 10.3390/cells11192953 . Zhao X, Di Q, Liu H, et al. MEF2C promotes M1 macrophage polarization and Th1 responses. Cell Mol Immunol Apr. 2022;19(4):540–53. 10.1038/s41423-022-00841-w . Shan X, Hu P, Ni L, et al. Serine metabolism orchestrates macrophage polarization by regulating the IGF1-p38 axis. Cell Mol Immunol Nov. 2022;19(11):1263–78. 10.1038/s41423-022-00925-7 . Liu X, Ren X, Zhou L, et al. Tollip Orchestrates Macrophage Polarization to Alleviate Intestinal Mucosal Inflammation. J Crohns Colitis Aug. 2022;4(7):1151–67. 10.1093/ecco-jcc/jjac019 . Krausgruber T, Blazek K, Smallie T, et al. IRF5 promotes inflammatory macrophage polarization and TH1-TH17 responses. Nat Immunol Mar. 2011;12(3):231–8. 10.1038/ni.1990 . Fleetwood AJ, Lawrence T, Hamilton JA, Cook AD. Granulocyte-macrophage colony-stimulating factor (CSF) and macrophage CSF-dependent macrophage phenotypes display differences in cytokine profiles and transcription factor activities: implications for CSF blockade in inflammation. J Immunol Apr. 2007;15(8):5245–52. 10.4049/jimmunol.178.8.5245 . Hu N, Cai Z, Jiang X, et al. Hypoxia-pretreated ADSC-derived exosome-embedded hydrogels promote angiogenesis and accelerate diabetic wound healing. Acta Biomater Feb. 2023;157:175–86. 10.1016/j.actbio.2022.11.057 . Wang X, Chen S, Lu R, et al. Adipose-derived stem cell-secreted exosomes enhance angiogenesis by promoting macrophage M2 polarization in type 2 diabetic mice with limb ischemia via the JAK/STAT6 pathway. Heliyon Nov. 2022;8(11):e11495. 10.1016/j.heliyon.2022.e11495 . Jiao Y, Zhang T, Zhang C, et al. Exosomal miR-30d-5p of neutrophils induces M1 macrophage polarization and primes macrophage pyroptosis in sepsis-related acute lung injury. Crit Care Oct. 2021;12(1):356. 10.1186/s13054-021-03775-3 . Lai TC, Lee TL, Chang YC, et al. MicroRNA-221/222 Mediates ADSC-Exosome-Induced Cardioprotection Against Ischemia/Reperfusion by Targeting PUMA and ETS-1. Front Cell Dev Biol. 2020;8:569150. 10.3389/fcell.2020.569150 . Salem M, O'Brien JA, Bernaudo S, et al. miR-590-3p Promotes Ovarian Cancer Growth and Metastasis via a Novel FOXA2-Versican Pathway. Cancer Res Aug. 2018;1(15):4175–90. 10.1158/0008-5472.Can-17-3014 . Wang F, Zhang H, Wang C. MiR-590-3p regulates cardiomyocyte P19CL6 proliferation, apoptosis and differentiation in vitro by targeting PTPN1 via JNK/STAT/NF-kB pathway. Int J Exp Pathol Dec. 2020;101(6):196–202. 10.1111/iep.12377 . Wan Z, Li X, Luo X, Wang B, Zhou X, Chen A. The miR-590-3p/CFHR3/STAT3 signaling pathway promotes cell proliferation and metastasis in hepatocellular carcinoma. Aging (Albany NY) Jul. 2022;18(14):5783–99. 10.18632/aging.204178 . Yang K, Wang X, Sun Y, et al. MiR-590-3p affects the function of adipose-derived stem cells (ADSCs) on the survival of skin flaps by targeting VEGFA. Regen Ther Dec. 2022;21:322–30. 10.1016/j.reth.2022.07.010 . Trimm E, Red-Horse K. Vascular endothelial cell development and diversity. Nat Rev Cardiol Mar. 2023;20(3):197–210. 10.1038/s41569-022-00770-1 . Ge X, Tang P, Rong Y, et al. Exosomal miR-155 from M1-polarized macrophages promotes EndoMT and impairs mitochondrial function via activating NF-κB signaling pathway in vascular endothelial cells after traumatic spinal cord injury. Redox Biol May. 2021;41:101932. 10.1016/j.redox.2021.101932 . Jin Z, Chen S, Wu H, Wang J, Wang L, Gao W. Inhibition of autophagy after perforator flap surgery increases flap survival and angiogenesis. J Surg Res Nov. 2018;231:83–93. 10.1016/j.jss.2018.05.018 . Zeng X, Xie Y, Guo T, et al. Hypoxia-Inducible Factor-1α Potentiates Multiterritory Perforator Flap Survival by Augmenting Vascular Endothelial Growth Factor Expression in the Choke II Zone. Ann Plast Surg Nov. 2024;1(5):624–30. 10.1097/sap.0000000000004122 . Kilkenny C, Browne WJ, Cuthi I, Emerson M, Altman DG. Improving bioscience research reporting: the ARRIVE guidelines for reporting animal research. Vet Clin Pathol Mar. 2012;41(1):27–31. 10.1111/j.1939-165X.2012.00418.x . Xing H, Zhang Z, Mao Q, et al. Injectable exosome-functionalized extracellular matrix hydrogel for metabolism balance and pyroptosis regulation in intervertebral disc degeneration. J Nanobiotechnology Sep. 2021;6(1):264. 10.1186/s12951-021-00991-5 . Liu F, Qiu H, Xue M, et al. MSC-secreted TGF-β regulates lipopolysaccharide-stimulated macrophage M2-like polarization via the Akt/FoxO1 pathway. Stem Cell Res Ther Nov. 2019;26(1):345. 10.1186/s13287-019-1447-y . Xi S, Zhao J, Kang R, et al. The Effects of Angiosome Morphology on Choke Vessels and Flap Necrosis in a Rat Multiterritory Perforator Flap. Ann Plast Surg Oct. 2023;1(4):479–84. 10.1097/sap.0000000000003643 . Arabpour M, Saghazadeh A, Rezaei N. Anti-inflammatory and M2 macrophage polarization-promoting effect of mesenchymal stem cell-derived exosomes. Int Immunopharmacol Aug. 2021;97:107823. 10.1016/j.intimp.2021.107823 . Liu W, Yu M, Xie D, et al. Melatonin-stimulated MSC-derived exosomes improve diabetic wound healing through regulating macrophage M1 and M2 polarization by targeting the PTEN/AKT pathway. Stem Cell Res Ther Jun. 2020;29(1):259. 10.1186/s13287-020-01756-x . Nakao Y, Fukuda T, Zhang Q, et al. Exosomes from TNF-α-treated human gingiva-derived MSCs enhance M2 macrophage polarization and inhibit periodontal bone loss. Acta Biomater Mar 1. 2021;122:306–24. 10.1016/j.actbio.2020.12.046 . Hu J, Jiang Y, Wu X, et al. Exosomal miR-17-5p from adipose-derived mesenchymal stem cells inhibits abdominal aortic aneurysm by suppressing TXNIP-NLRP3 inflammasome. Stem Cell Res Ther Jul. 2022;26(1):349. 10.1186/s13287-022-03037-1 . Shi R, Jin Y, Zhao S, Yuan H, Shi J, Zhao H. Hypoxic ADSC-derived exosomes enhance wound healing in diabetic mice via delivery of circ-Snhg11 and induction of M2-like macrophage polarization. Biomed Pharmacother Sep. 2022;153:113463. 10.1016/j.biopha.2022.113463 . Deng S, Zhou X, Ge Z, et al. Exosomes from adipose-derived mesenchymal stem cells ameliorate cardiac damage after myocardial infarction by activating S1P/SK1/S1PR1 signaling and promoting macrophage M2 polarization. Int J Biochem Cell Biol Sep. 2019;114:105564. 10.1016/j.biocel.2019.105564 . Deng F, Yan J, Lu J, et al. M2 Macrophage-Derived Exosomal miR-590-3p Attenuates DSS-Induced Mucosal Damage and Promotes Epithelial Repair via the LATS1/YAP/ β-Catenin Signalling Axis. J Crohns Colitis Apr. 2021;6(4):665–77. 10.1093/ecco-jcc/jjaa214 . Wu Y, Gu Y, Shi B. miR-590-3p Alleviates diabetic peripheral neuropathic pain by targeting RAP1A and suppressing infiltration by the T cells. Acta Biochim Pol Dec. 2020;17(4):587–93. 10.18388/abp.2020_5451 . Huang J, Xu X, Wang X, et al. MicroRNA-590-3p inhibits T helper 17 cells and ameliorates inflammation in lupus mice. Immunology Feb. 2022;165(2):260–73. 10.1111/imm.13434 . Ma J, Li YT, Zhang SX, Fu SZ, Ye XZ. MiR-590-3p Attenuates Acute Kidney Injury by Inhibiting Tumor Necrosis Factor Receptor-Associated Factor 6 in Septic Mice. Inflammation Apr. 2019;42(2):637–49. 10.1007/s10753-018-0921-5 . Wu T, Xiang Y, Lv Y, Li D, Yu L, Guo R. miR-590-3p mediates the protective effect of curcumin on injured endothelial cells induced by angiotensin II. Am J Transl Res. 2017;9(2):289–300. Qin Y, Cai ML, Jin HZ, et al. Age-associated B cells contribute to the pathogenesis of rheumatoid arthritis by inducing activation of fibroblast-like synoviocytes via TNF-α-mediated ERK1/2 and JAK-STAT1 pathways. Ann Rheum Dis Nov. 2022;81(11):1504–14. 10.1136/ard-2022-222605 . Lee N, Heo YJ, Choi SE, et al. Anti-inflammatory Effects of Empagliflozin and Gemigliptin on LPS-Stimulated Macrophage via the IKK/NF-κB, MKK7/JNK, and JAK2/STAT1 Signalling Pathways. J Immunol Res. 2021;2021:9944880. 10.1155/2021/9944880 . Kandhaya-Pillai R, Yang X, Tchkonia T, Martin GM, Kirkland JL, Oshima J. TNF-α/IFN-γ synergy amplifies senescence-associated inflammation and SARS-CoV-2 receptor expression via hyper-activated JAK/STAT1. Aging Cell Jun. 2022;21(6):e13646. 10.1111/acel.13646 . Ivashkiv LB. IFNγ: signalling, epigenetics and roles in immunity, metabolism, disease and cancer immunotherapy. Nat Rev Immunol Sep. 2018;18(9):545–58. 10.1038/s41577-018-0029-z . Qin H, Holdbrooks AT, Liu Y, Reynolds SL, Yanagisawa LL, Benveniste EN. SOCS3 deficiency promotes M1 macrophage polarization and inflammation. J Immunol Oct. 2012;1(7):3439–48. 10.4049/jimmunol.1201168 . Yu T, Gao M, Yang P, et al. Insulin promotes macrophage phenotype transition through PI3K/Akt and PPAR-γ signaling during diabetic wound healing. J Cell Physiol Apr. 2019;234(4):4217–31. 10.1002/jcp.27185 . Liu Y, Liu Z, Tang H, et al. The N(6)-methyladenosine (m(6)A)-forming enzyme METTL3 facilitates M1 macrophage polarization through the methylation of STAT1 mRNA. Am J Physiol Cell Physiol Oct. 2019;1(4):C762–75. 10.1152/ajpcell.00212.2019 . Zhu X, Guo Q, Zou J, et al. MiR-19a-3p Suppresses M1 Macrophage Polarization by Inhibiting STAT1/IRF1 Pathway. Front Pharmacol. 2021;12:614044. 10.3389/fphar.2021.614044 . Hao X, Luan J, Jiao C, et al. LNA-anti-miR-150 alleviates renal interstitial fibrosis by reducing pro-inflammatory M1/M2 macrophage polarization. Front Immunol. 2022;13:913007. 10.3389/fimmu.2022.913007 . Yin Y, Liu B, Cao Y, et al. Colorectal Cancer-Derived Small Extracellular Vesicles Promote Tumor Immune Evasion by Upregulating PD-L1 Expression in Tumor-Associated Macrophages. Adv Sci (Weinh). Mar 2022;9(9):2102620. 10.1002/advs.202102620 . Zhou J, Li Z, Wu T, Zhao Q, Zhao Q, Cao Y. LncGBP9/miR-34a axis drives macrophages toward a phenotype conducive for spinal cord injury repair via STAT1/STAT6 and SOCS3. J Neuroinflammation Apr. 2020;28(1):134. 10.1186/s12974-020-01805-5 . Ning Y, Huang P, Chen G, et al. Atorvastatin-pretreated mesenchymal stem cell-derived extracellular vesicles promote cardiac repair after myocardial infarction via shifting macrophage polarization by targeting microRNA-139-3p/Stat1 pathway. BMC Med Mar. 2023;16(1):96. 10.1186/s12916-023-02778-x . Ge X, Meng Q, Wei L, et al. Myocardial ischemia-reperfusion induced cardiac extracellular vesicles harbour proinflammatory features and aggravate heart injury. J Extracell Vesicles Feb. 2021;10(4):e12072. 10.1002/jev2.12072 . Zhang Y, Le X, Zheng S, et al. MicroRNA-146a-5p-modified human umbilical cord mesenchymal stem cells enhance protection against diabetic nephropathy in rats through facilitating M2 macrophage polarization. Stem Cell Res Ther Apr. 2022;27(1):171. 10.1186/s13287-022-02855-7 . Jiang T, Sun L, Zhu J, et al. MicroRNA-23a-3p promotes macrophage M1 polarization and aggravates lipopolysaccharide-induced acute lung injury by regulating PLK1/STAT1/STAT3 signalling. Int J Exp Pathol Oct. 2022;103(5):198–207. 10.1111/iep.12445 . Bi J, Liu J, Chen X, et al. MiR-155-5p-SOCS1/JAK1/STAT1 participates in hepatic lymphangiogenesis in liver fibrosis and cirrhosis by regulating M1 macrophage polarization. Hum Exp Toxicol Jan-Dec. 2023;42:9603271221141695. 10.1177/09603271221141695 . Lv Y, Li Y, Wang J, et al. MiR-382-5p suppresses M1 macrophage polarization and inflammatory response in response to bronchopulmonary dysplasia through targeting CDK8: Involving inhibition of STAT1 pathway. Genes Cells Oct. 2021;26(10):772–81. 10.1111/gtc.12883 . Zhu X, Liu H, Zhang Z, et al. MiR-103 protects from recurrent spontaneous abortion via inhibiting STAT1 mediated M1 macrophage polarization. Int J Biol Sci. 2020;16(12):2248–64. 10.7150/ijbs.46144 . Jiang X, Zhou T, Xiao Y, et al. Tim-3 promotes tumor-promoting M2 macrophage polarization by binding to STAT1 and suppressing the STAT1-miR-155 signaling axis. Oncoimmunology. 2016;5(9):e1211219. 10.1080/2162402x.2016.1211219 . Xi J, Huang Q, Wang L, et al. miR-21 depletion in macrophages promotes tumoricidal polarization and enhances PD-1 immunotherapy. Oncogene Jun. 2018;37(23):3151–65. 10.1038/s41388-018-0178-3 . Cai M, Shi Y, Zheng T, et al. Mammary epithelial cell derived exosomal MiR-221 mediates M1 macrophage polarization via SOCS1/STATs to promote inflammatory response. Int Immunopharmacol Jun. 2020;83:106493. 10.1016/j.intimp.2020.106493 . Qu B, Liu J, Peng Z, et al. CircSOD2 polarizes macrophages towards the M1 phenotype to alleviate cisplatin resistance in gastric cancer cells by targeting the miR-1296/STAT1 axis. Gene Aug 23. 2023;887:147733. 10.1016/j.gene.2023.147733 . Zhang L, Fu Y, Wang H, et al. Severe Fever With Thrombocytopenia Syndrome Virus-Induced Macrophage Differentiation Is Regulated by miR-146. Front Immunol. 2019;10:1095. 10.3389/fimmu.2019.01095 . Qiu M, Ma J, Zhang J, Guo X, Liu Q, Yang Z. MicroRNA-150 deficiency accelerates intimal hyperplasia by acting as a novel regulator of macrophage polarization. Life Sci Jan 1. 2020;240:116985. 10.1016/j.lfs.2019.116985 . Zhang Y, Mei H, Chang X, Chen F, Zhu Y, Han X. Adipocyte-derived microvesicles from obese mice induce M1 macrophage phenotype through secreted miR-155. J Mol Cell Biol Dec. 2016;8(6):505–17. 10.1093/jmcb/mjw040 . Miranville A, Heeschen C, Sengenès C, Curat CA, Busse R, Bouloumié A. Improvement of postnatal neovascularization by human adipose tissue-derived stem cells. Circulation Jul. 2004;20(3):349–55. 10.1161/01.Cir.0000135466.16823.D0 . Eskandari E, Eaves CJ. Paradoxical roles of caspase-3 in regulating cell survival, proliferation, and tumorigenesis. J Cell Biol Jun. 2022;6(6). 10.1083/jcb.202201159 . Das S, Amin SA, Jha T. Inhibitors of gelatinases (MMP-2 and MMP-9) for the management of hematological malignancies. Eur J Med Chem Nov. 2021;5:223:113623. 10.1016/j.ejmech.2021.113623 . Liu Y, Zhang H, Yan L, et al. MMP-2 and MMP-9 contribute to the angiogenic effect produced by hypoxia/15-HETE in pulmonary endothelial cells. J Mol Cell Cardiol Aug. 2018;121:36–50. 10.1016/j.yjmcc.2018.06.006 . le Noble FAC, Mourad JJ, Levy BI, Struijker-Boudier HAJ. VEGF (Vascular Endothelial Growth Factor) Inhibition and Hypertension: Does Microvascular Rarefaction Play a Role? Hypertension May. 2023;80(5):901–11. 10.1161/hypertensionaha.122.19427 . Beheshtizadeh N, Gharibshahian M, Bayati M, et al. Vascular endothelial growth factor (VEGF) delivery approaches in regenerative medicine. Biomed Pharmacother Oct. 2023;166:115301. 10.1016/j.biopha.2023.115301 . Li X, Xie X, Lian W, et al. Exosomes from adipose-derived stem cells overexpressing Nrf2 accelerate cutaneous wound healing by promoting vascularization in a diabetic foot ulcer rat model. Exp Mol Med Apr. 2018;13(4):1–14. 10.1038/s12276-018-0058-5 . Shi R, Jin Y, Hu W, et al. Exosomes derived from mmu_circ_0000250-modified adipose-derived mesenchymal stem cells promote wound healing in diabetic mice by inducing miR-128-3p/SIRT1-mediated autophagy. Am J Physiol Cell Physiol. May 2020;1(5):C848–56. 10.1152/ajpcell.00041.2020 . Ji J, Chen D, Ni J, Chang F. Research Advances in Vascular Remodeling in Choke Vessels of Perforator Flap: A Systematic Review. Ann Plast Surg Aug. 2024;1(2):268–75. 10.1097/sap.0000000000003980 . Additional Declarations No competing interests reported. Supplementary Files STAT1.tif AGR1.tif PSTAT1.tif INOS.tif ACTIN.tif VEGFoverlay.tif STAT1overlay.tif MMP9overlay.tif MMP2overlay.tif GAPDHoverlay.tif Caspase3overlay.tif Baxoverlay.tif Bcl2overlay.tif VEGFA.tiff VCAM1.tiff STAT1.tiff MCP1.tiff IL6.tiff IL1.tiff ICAM1.tiff ACTIN.tiff Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6987555","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":486854630,"identity":"2868f9b9-18b1-4aeb-89cd-e6b9df2aa415","order_by":0,"name":"Yiwen Deng","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Yiwen","middleName":"","lastName":"Deng","suffix":""},{"id":486854631,"identity":"e125eb9f-563d-48b3-a8be-fb8854f5a8e9","order_by":1,"name":"Chunjie Li","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Chunjie","middleName":"","lastName":"Li","suffix":""},{"id":486854632,"identity":"ffca1124-5799-486f-a5a0-5577f2a862c9","order_by":2,"name":"Dandan Song","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Dandan","middleName":"","lastName":"Song","suffix":""},{"id":486854633,"identity":"cdc7baad-ad02-450f-841f-be88b059a562","order_by":3,"name":"Xiancheng Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABHklEQVRIie2NMUvDQBiGLwRuOs16IRj/wieBAxH0ryQUkuVaC0IpOBhQMglZD/on6uYYOUiXs64ZOtTFxQ4RUTIommK6HbGjYB744OF4Hw6hjo4/C9RH1zLG7s8L3jpRu96WCWoS48oN4t8SmN3LZzI8HliTy/zxLWZRmipA5UgiaxLrEzUIDwX0zugij7y927AvCg6GmEtEF5k2YRlnUIIZTClnjq3y/pQSMHcSiYD6+uRhxcCHizo5fXfs5CsCS4H52ZYU3FuWINe/YPslwT4gDqbRkpwUK2YImAWiCJmDFD6oZXh3PY8ILfSJnXLvlXycB6noPdnVGO9bqbxZVqMj1xL6pAbTjZmkkaw+oh03w3JjRtUy6+jo6Pi/fAOIc1+rqOChLAAAAABJRU5ErkJggg==","orcid":"","institution":"Central South University","correspondingAuthor":true,"prefix":"","firstName":"Xiancheng","middleName":"","lastName":"Wang","suffix":""},{"id":486854634,"identity":"3828396f-1ec1-45c8-b7c4-0797bc4ac09a","order_by":4,"name":"Zhihua Qiao","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Zhihua","middleName":"","lastName":"Qiao","suffix":""},{"id":486854635,"identity":"c50a9b6f-5f0d-460c-96ee-8efb50ef86be","order_by":5,"name":"Quanding Yan","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Quanding","middleName":"","lastName":"Yan","suffix":""}],"badges":[],"createdAt":"2025-06-27 03:38:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6987555/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6987555/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":87026927,"identity":"66fb95ce-1a9d-434c-8eb7-a6d33c0f4bbf","added_by":"auto","created_at":"2025-07-18 12:19:18","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1078462,"visible":true,"origin":"","legend":"\u003cp\u003eIsolation and characterization of ADSCs and ADSC-Exos. A P3-ADSCs exhibited a characteristic spindle-shaped fibroblast-like morphology in vitro.Scale bar: 100 μm. B The Oil-Red-O staining of ADSCs was evaluated positively following a 3-week induction of adipogenic differentiation. Scale bar: 100 μm. C The alizarin red staining of ADSCs was evaluated positively following a 3-week induction of osteogenic differentiation. Scale bar: 100 μm. D ADSC-exos exhibited a circular disk morphology under TEM. E NTA analysis indicates an average particle size of 100 nm. F Western blot of ADSC-Exos. G ADSC-specific surface markers, including CD14, CD19, CD34, CD44, CD73, and CD90 were quantified using flow cytometry. H The morphology of macrophages was observed at 24 h post-transfection using light microscopy. I Fluorescence microscope images of macrophages 24 h post-transfection with fluorescently labeled miRNA. K The assessment of miRNA transfection efficiency. ADSC, Adipose-derived mesenchymal stem cell; P3, passage 3 biomarkers. *P value\u0026lt;0.05, **P value\u0026lt;0.01, ***P value\u0026lt;0.001,****p value＜0.0001\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/37c7059b47a6d32a50272a31.jpg"},{"id":87026925,"identity":"3c0a05b6-57c2-4880-9c55-6d12cad4faae","added_by":"auto","created_at":"2025-07-18 12:19:18","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":879954,"visible":true,"origin":"","legend":"\u003cp\u003eADSC-Exos-carried miR-590-3p inactivated macrophage polarization.The effect of miR-590-3p on the polarization of Raw264.7 cells was evaluated using RT-qPCR. A The Raw264.7 cells were co-cultured with ADSC-Exos overnight, and the miR-590-3p level was detected by RT-qPCR. B The expression of Arg-1 in the exosome stimulation group was detected using RT-qPCR. C The expression of TNF-α in the exosome stimulation group was detected using RT-qPCR. D-G The gene expression levels of STAT1, Arg-1, TNF-α, and NOS2 were compared between the miR-590-3p mimics group and the miR-590-3p mimics NC group. H-K The gene expression levels of STAT1, Arg-1, TNF-α, and NOS2 were compared between miR-590-3p inhibitor group and miR-590-3p inhibitor NC group. L-O The gene expression levels of STAT1, Arg-1, TNF-α, and NOS2 were compared between si-STAT1 group and si-STAT1 NC group.*P value\u0026lt;0.05, **P value\u0026lt;0.01, ***P value\u0026lt;0.001,****p value＜0.0001\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/a2494e983d20ba61f299e5c8.jpg"},{"id":87026922,"identity":"492f006e-d486-4daa-aebb-ccd191325934","added_by":"auto","created_at":"2025-07-18 12:19:17","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":990050,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of miR-590-3p on the polarization of Raw264.7 cells was evaluated using Western Blot. A The expression of proteins. B-E The protein expression levels of Arg-1, iNOS, STAT1, and p-STAT1 were compared between the miR-590-3p mimics group and the miR-590-3p mimics NC group. F-I The protein expression levels of Arg-1, iNOS, STAT1, and p-STAT1 were compared between miR-590-3p inhibitor group and miR-590-3p inhibitor NC group. J-M The protein expression levels of Arg-1, iNOS, STAT1, and p-STAT1 were compared between si-STAT1 group and si-STAT1 NC group. *P value\u0026lt;0.05, **P value\u0026lt;0.01, ***P value\u0026lt;0.001,****p value＜0.0001\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/6c8deab433b6a1b01846eb1a.jpg"},{"id":87028768,"identity":"54a48f49-0798-45c7-87cd-381ef36d8bf9","added_by":"auto","created_at":"2025-07-18 12:35:18","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3343035,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression of CD86 and CD206 in each group was assessed using flow cytometry. A The expression levels of CD86 were compared between miR-590-3p mimics group and miR-590-3p mimics NC group. B The expression levels of CD86 were compared between the cells in miR-590-3p inhibitor group and miR-590-3p inhibitor NC group.C The expression levels of CD86 were compared between si-STAT1 group and si-STAT1 NC group. D The expression levels of CD206 were compared between miR-590-3p mimics group and miR-590-3p mimics NC group. E The expression levels of CD206 were compared between the cells in miR-590-3p inhibitor group and miR-590-3p inhibitor NC group.F The expression levels of CD206 were compared between si-STAT1 group and si-STAT1 NC group. \u0026nbsp;*P value\u0026lt;0.05, **P value\u0026lt;0.01, ***P value\u0026lt;0.001,****p value＜0.0001\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/fb741e5e93679895999f7968.jpg"},{"id":87026910,"identity":"4f4c8c2a-ec15-4abb-807a-39cf0637813b","added_by":"auto","created_at":"2025-07-18 12:19:17","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1312758,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of miR-590-3p overexpression in Raw264.7 cells on cellular apoptosis and tissue vascularization following co-culture with HUVEC using Western Blot and RT-qPCR. A-H: Western Blot; I-P: RT-qpcr; A,B,C,E: miR-590-3p decreased STAT1, BAX, and Caspase3 expression following co-culture at 48h, as determined by WB in HUVECs; A,D,F,G,H: miR-590-3p increased Bcl-2,MMP-9,MMP-2,VEGFR1 expression following co-culture at 48h, as determined by WB in HUVECs; I,J: Transfection efficiency of miR-590-3p mimics and si-STAT1, as determined by RT- qPCR in RAW264.7;K,M: miR-590-3p decreased BAX and Caspase3 expression following co-culture at 48 h, as determined by RT- qPCR in HUVECs; L,N,O,P: miR-590-3p increased Bcl-2,MMP-9,MMP-2,VEGFR1 expression following co-culture at 48h, as determined by RT- qPCR in HUVECs.*P value\u0026lt;0.05, **P value\u0026lt;0.01, ***P value\u0026lt;0.001,****p value＜0.0001\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/26b5c37d4469bacd7ec84499.jpg"},{"id":87027884,"identity":"9cd899b4-4471-4251-a2b9-7666b9d0679e","added_by":"auto","created_at":"2025-07-18 12:27:17","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":702915,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of miR-590-3p overexpression in Raw264.7 cells on cellular apoptosis and tissue vascularization following co-culture with HUVEC using scratch assay, cell apoptosis assay,tube formation assay,CCK8.A,G: Quantitative analysis of the scratch wound assay;B,H: Quantitative analysis of cell apoptosis assay; C,E,F: Quantitative analysis of the tube formation assay;D: Quantitative analysis of CCK8.*P value\u0026lt;0.05, **P value\u0026lt;0.01, ***P value\u0026lt;0.001,****p value＜0.0001\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/5f0a2feb86068152982afa72.jpg"},{"id":87026902,"identity":"e778a3a7-72b1-48cc-9768-dc3df10c427a","added_by":"auto","created_at":"2025-07-18 12:19:16","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":3270072,"visible":true,"origin":"","legend":"\u003cp\u003eProcess of flap modeling and survival rate of flap after operation. A Preoperative flap design. B Flap vessel separation during operation, DCI: perforator branch of deep circumflex iliac artery; IC: Perforating branch of posterior intercostal artery; TD: Perforating branch of dorsal thoracic artery.C Flap survival in different treatment groups at 1, 3, 5 and 7 days after surgery; D Immunofluorescence of CD31, CD34 and VEGF in each group of skin flaps (200×);E HE staining of flap tissue in each group (100×);F Gelatin-lead oxide angiography vascular conditions, orange box selected for choke Ⅱ vascular conditions. G Semi-quantitative analysis of postoperative flap survival rate in each group.H Semi-quantitative analysis of immunofluorescence intensity of CD31, CD34 and VEGF in chokeⅡ of each group. I Semi-quantitative analysis of microvascular density in chokeⅡ area in each group. *P value\u0026lt;0.05, **P value\u0026lt;0.01, ***P value\u0026lt;0.001,****p value＜0.0001\u003c/p\u003e","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/eeaf29ea1f61cd466bc44570.jpg"},{"id":87027887,"identity":"b48176b8-f3da-4b40-8623-04c51bffff1c","added_by":"auto","created_at":"2025-07-18 12:27:18","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":658310,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of target protein and target gene in skin flap. A The expression of proteins. B The protein expression levels of STAT1. C The protein expression levels of VEGF. D The protein expression levels of IL-6. E The protein expression levels of VCAM-1. F The protein expression levels of IL-1β. G The protein expression levels of MCP-1. H The protein expression levels of iCAM-1 protein. I The gene expression levels of miR-590-3p. J The gene expression levels of STAT1. K The gene expression levels of VEGF-A. L The gene expression levels of IL-6. M The gene expression levels of VCAM-1. N The gene expression levels of IL-1β. O The gene expression levels of MCP-1. P The gene expression levels of iCAM-1. *P value\u0026lt;0.05, **P value\u0026lt;0.01, ***P value\u0026lt;0.001,****p value＜0.0001\u003c/p\u003e","description":"","filename":"Figure8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/7dc9dfdc88a8600eeb1ab6c7.jpg"},{"id":87026905,"identity":"20d57fe9-2a28-4089-bcbe-39e0ec9f7a19","added_by":"auto","created_at":"2025-07-18 12:19:16","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":367634,"visible":true,"origin":"","legend":"\u003cp\u003eFlow chart illustrating the mechanism by which ADSC-Exos modulates macrophage polarization via miR-590-3p and influences tissue vascularization and wound healing\u003c/p\u003e","description":"","filename":"figure9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/4481494181b753c0d708e4b7.jpg"},{"id":87874226,"identity":"f7125799-b775-4d83-b716-71bb6e32dee5","added_by":"auto","created_at":"2025-07-30 01:46:40","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":13470876,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/44027c49-29f2-476a-9f35-3a93b1289255.pdf"},{"id":87026973,"identity":"631c34c7-cc08-4148-9b26-71ba2321f2f3","added_by":"auto","created_at":"2025-07-18 12:19:19","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":15192402,"visible":true,"origin":"","legend":"","description":"","filename":"STAT1.tif","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/e75ff154360bf6202ff9b5ed.tif"},{"id":87026914,"identity":"5496d6d3-5362-417c-a158-8ca7629b86ed","added_by":"auto","created_at":"2025-07-18 12:19:17","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":14363896,"visible":true,"origin":"","legend":"","description":"","filename":"AGR1.tif","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/484f54e8eb1ccb4435488927.tif"},{"id":87026949,"identity":"ded6e240-a3e1-4d6c-87de-66172c99fa7b","added_by":"auto","created_at":"2025-07-18 12:19:18","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":15484014,"visible":true,"origin":"","legend":"","description":"","filename":"PSTAT1.tif","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/ebadb812b01d538fd7fd2ac4.tif"},{"id":87026906,"identity":"dd47f268-a474-4e70-9f9b-bd2145df0ff5","added_by":"auto","created_at":"2025-07-18 12:19:17","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":13148106,"visible":true,"origin":"","legend":"","description":"","filename":"INOS.tif","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/b0ad302f3bb1b1757fc31131.tif"},{"id":87026913,"identity":"feddd763-675c-4a28-b482-494739626bb6","added_by":"auto","created_at":"2025-07-18 12:19:17","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":17618540,"visible":true,"origin":"","legend":"","description":"","filename":"ACTIN.tif","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/63e42517c3928ec3f8f3a20a.tif"},{"id":87027892,"identity":"9fcbf973-b177-4dce-aa2b-5e52a6cac14b","added_by":"auto","created_at":"2025-07-18 12:27:18","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":5874104,"visible":true,"origin":"","legend":"","description":"","filename":"VEGFoverlay.tif","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/978890bea9e3e4a7f1b960f8.tif"},{"id":87028776,"identity":"61d4e5ae-922f-4ff0-a57a-923667a0a759","added_by":"auto","created_at":"2025-07-18 12:35:19","extension":"tif","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":5876996,"visible":true,"origin":"","legend":"","description":"","filename":"STAT1overlay.tif","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/ba6dc5df266a0aa44dca5250.tif"},{"id":87026950,"identity":"06609688-c7aa-415a-921d-f8928c7359e2","added_by":"auto","created_at":"2025-07-18 12:19:18","extension":"tif","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":5770608,"visible":true,"origin":"","legend":"","description":"","filename":"MMP9overlay.tif","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/5dc32f73db77ab5e0fe4b3a0.tif"},{"id":87026919,"identity":"34b84f2a-ac85-4ae3-9473-d095ab09a05f","added_by":"auto","created_at":"2025-07-18 12:19:17","extension":"tif","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":5935256,"visible":true,"origin":"","legend":"","description":"","filename":"MMP2overlay.tif","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/fa9506efb470eaa0422d9597.tif"},{"id":87028769,"identity":"c3e6633f-9fe0-46f9-93b3-62b9ffbb2d49","added_by":"auto","created_at":"2025-07-18 12:35:18","extension":"tif","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":5604536,"visible":true,"origin":"","legend":"","description":"","filename":"GAPDHoverlay.tif","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/4690760c5bdaea1299d24a60.tif"},{"id":87026953,"identity":"61a1aab0-0b41-4edc-8853-4712f942976f","added_by":"auto","created_at":"2025-07-18 12:19:18","extension":"tif","order_by":12,"title":"","display":"","copyAsset":false,"role":"supplement","size":5878060,"visible":true,"origin":"","legend":"","description":"","filename":"Caspase3overlay.tif","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/43ce27deba6557442315e758.tif"},{"id":87026916,"identity":"cb2d3a6e-120c-441b-8aae-5bb391dd266e","added_by":"auto","created_at":"2025-07-18 12:19:17","extension":"tif","order_by":13,"title":"","display":"","copyAsset":false,"role":"supplement","size":5879176,"visible":true,"origin":"","legend":"","description":"","filename":"Baxoverlay.tif","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/bd1e32109fb3a5daecb9efaf.tif"},{"id":87026904,"identity":"ca7c5bd0-5292-46cd-90f0-c43ffd2ed258","added_by":"auto","created_at":"2025-07-18 12:19:16","extension":"tif","order_by":14,"title":"","display":"","copyAsset":false,"role":"supplement","size":5859476,"visible":true,"origin":"","legend":"","description":"","filename":"Bcl2overlay.tif","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/82cd81a91e0926441cb03355.tif"},{"id":87026901,"identity":"b4bee82d-cb28-43b1-9230-131175152128","added_by":"auto","created_at":"2025-07-18 12:19:16","extension":"tiff","order_by":15,"title":"","display":"","copyAsset":false,"role":"supplement","size":2683414,"visible":true,"origin":"","legend":"","description":"","filename":"VEGFA.tiff","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/c96c2de67e7dae1f0dc303fb.tiff"},{"id":87026968,"identity":"69e9248e-49d7-4356-9d15-3c885c51dc2b","added_by":"auto","created_at":"2025-07-18 12:19:19","extension":"tiff","order_by":16,"title":"","display":"","copyAsset":false,"role":"supplement","size":2683414,"visible":true,"origin":"","legend":"","description":"","filename":"VCAM1.tiff","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/390f1b0901503c50641d0bf0.tiff"},{"id":87026907,"identity":"70fb11ee-c1e5-4813-af37-78ef896770f8","added_by":"auto","created_at":"2025-07-18 12:19:17","extension":"tiff","order_by":17,"title":"","display":"","copyAsset":false,"role":"supplement","size":2683414,"visible":true,"origin":"","legend":"","description":"","filename":"STAT1.tiff","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/5c14dc9ad0fd262edb9644c2.tiff"},{"id":87026934,"identity":"7fbebc4d-cf7e-4615-a62c-9ee1b457d042","added_by":"auto","created_at":"2025-07-18 12:19:18","extension":"tiff","order_by":18,"title":"","display":"","copyAsset":false,"role":"supplement","size":2683414,"visible":true,"origin":"","legend":"","description":"","filename":"MCP1.tiff","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/0fad498d99d5ba490ee342fe.tiff"},{"id":87026988,"identity":"62579254-7fa5-42a8-9a76-d1de5884c257","added_by":"auto","created_at":"2025-07-18 12:19:20","extension":"tiff","order_by":19,"title":"","display":"","copyAsset":false,"role":"supplement","size":2683414,"visible":true,"origin":"","legend":"","description":"","filename":"IL6.tiff","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/6e47b8bbcf293275534d484a.tiff"},{"id":87028771,"identity":"5cb23cd4-609b-458a-b816-b4d0259248b2","added_by":"auto","created_at":"2025-07-18 12:35:19","extension":"tiff","order_by":20,"title":"","display":"","copyAsset":false,"role":"supplement","size":2683414,"visible":true,"origin":"","legend":"","description":"","filename":"IL1.tiff","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/5742e9fba71ff39c3efdafb3.tiff"},{"id":87026967,"identity":"b762f4b9-7839-4f69-a149-3812e3d07df4","added_by":"auto","created_at":"2025-07-18 12:19:19","extension":"tiff","order_by":21,"title":"","display":"","copyAsset":false,"role":"supplement","size":2683414,"visible":true,"origin":"","legend":"","description":"","filename":"ICAM1.tiff","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/9768cf54f396237ff8b88f0d.tiff"},{"id":87026959,"identity":"5dd12160-21d5-4708-8fab-2d5eecaea171","added_by":"auto","created_at":"2025-07-18 12:19:19","extension":"tiff","order_by":22,"title":"","display":"","copyAsset":false,"role":"supplement","size":2683414,"visible":true,"origin":"","legend":"","description":"","filename":"ACTIN.tiff","url":"https://assets-eu.researchsquare.com/files/rs-6987555/v1/8bb0e1be5a2f4de9dfe16c3b.tiff"}],"financialInterests":"No competing interests reported.","formattedTitle":"Exosomes from adipose derived stem cells improve perforator flap survival through miR-590-3p-mediated M2 macrophage polarization and angiogenesis function","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe International Society for Wound Healing defines chronic wounds as wounds that are unable to achieve a state of anatomical and functional integrity through a normal, organized, and timely reparative process.\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e The management of chronic wounds has consistently posed challenges, prompting significant scrutiny due to escalating healthcare expenditures and mortality rates. \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003eChronic wounds encompass distinct phases of inflammation, proliferation, and remodeling, typically initiated by trauma, cutaneous injury, and various pathological conditions.\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003eThe role of M2 macrophages in wound healing, particularly during the later stages of neovascularization and tissue remodeling, has been substantiated by relevant studies.\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003eMacrophages play a pivotal role in the body's immune system, exhibiting phagocytic functions and serving as crucial mediators of inflammation, fibrosis, and wound healing through the secretion of cytokines and growth factors.\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e Additionally, macrophages play a crucial role in the initiation and resolution of inflammation induced by pathogens or injuries.\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003eMacrophages can be broadly classified into two types: classically activated macrophages (M1) and alternatively activated macrophages (M2).\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003eThe phenotypic modulation of cells induced by the surrounding microenvironment results in macrophage polarization, which activates specific functional programs.\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003eM1 macrophages can be induced by granulocyte-macrophage colony-stimulating factor (GM-CSF) or interferon-γ (IFN-γ). Upon stimulation with bacterial products such as lipopolysaccharide (LPS), macrophages produce high levels of proinflammatory cytokines including interleukin 23(IL-23) and IL-12. M2 macrophages can be induced by IL-4 and exhibit elevated levels of IL-10 and arginase 1(ARG-1), which confer anti-inflammatory and tissue reparative properties within the organism.\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003eAdipose-derived stem cells (ADSCs) are versatile stem cells that possess regenerative medicine efficacy and tissue repair functions.\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e Relevant studies have substantiated the close association between ADSCs and the modulation of inflammatory responses. Exosomes from adipose-derived stem cells (ADSC-Exos) have been shown to regulate macrophage polarization.\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e Accumulating evidence suggests miRNA as a new subcellular entity acting as a fundamental link between inflammation and ADSC-Exos.\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e microRNA-590-3p(miR-590-3p) is a recently discovered signaling molecule that exerts regulatory effects on the pathogenesis and progression of tumors, atherosclerosis, and inflammatory disorders.\u003csup\u003e\u003cspan additionalcitationids=\"CR17 CR18\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e The relationship between exosome-mediated macrophage polarization and miR-590-3p, as well as the relevant regulatory molecular mechanism, remains unclear.\u003c/p\u003e\u003cp\u003eThe flap technique plays a crucial role in the management of chronic wounds, while addressing the global challenge of flap survival remains imperative.Vascular endothelial cells constitute the innermost layer of blood vessels, playing a pivotal role in the mechanism of wound healing vascularization, and providing paracrine support to neighboring non-vascular cells.\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003eMacrophages exerts a significant impact on the physiological functions of vascular endothelial cells.\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003eThe mechanism of communication between macrophages and endothelial cells remains the central focus of ongoing research.\u003c/p\u003e\u003cp\u003eEndothelial cells play a significant role in the vascularization of flaps. These perforator angiosomes are classified into three distinct zones, progressing from proximal to distal: the anatomical zone, the hemodynamic zone, and the potential zone\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. The transitional area between the hemodynamic and potential zones is designated as the Choke II zone. Inadequate blood supply within the Choke II zone frequently results in ischemic necrosis of the multiterritory perforator flap, significantly impacting the viability of the flap\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. The role of ADSC-Exosomes in enhancing flap survival and wound healing by improving the Choke II zone, as well as the specific underlying mechanisms, warrants further investigation.\u003c/p\u003e\u003cp\u003eThe present study is primarily divided into three sections. Firstly, this study is to validate the correlation between ADSCs-Exos mediated miR-590-3p and macrophage polarization at the cellular level, thereby providing fundamental molecular theoretical support. Furthermore, we investigated the impact of miR-590-3p-mediated macrophage polarization on endothelial cell proliferation and vascularization. Thirdly, an experimental model of perforator flap will be established in SD rats to validate the impact of miR-590-3p on flap survival and tissue angiogenesis mechanism.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cem\u003eAnimal\u003c/em\u003e\u003c/p\u003e\u003cp\u003eTwelve-week-old Sprague-Dawley (SD) rats were purchased from Hunan SilaikeJinDa Laboratory Animals Co, LTD (Chang-sha, China). The animals were maintained under controlled conditions with a temperature of 22\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C, a relative humidity of 50\u0026thinsp;\u0026plusmn;\u0026thinsp;1%, and a light-dark cycle of 12/12 h. The animal studies, including the rat euthanasia procedure, were conducted in accordance with the regulations and guidelines of The Second Xiangya Hospital, Central South University of Medicine institutional animal care. These studies were carried out following the ARRIVE guidelines\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003e\u003cem\u003eCells and cell culture\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe Raw264.7 cells and Human Umbilical Vein Endothelial Cells (HUVECs) were purchased from the Chinese Academy of Sciences Cell Bank (Shanghai, China). The Raw264.7 cells were cultured in Dulbecco\u0026rsquo;s modified Eagle medium (Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (Gibco, Grand Island, NY, USA) and 1% double antibiotics (streptomycin\u0026thinsp;+\u0026thinsp;penicillin; Gibco,Grand Island, NY, USA). HUVECs were cultured in endothelial cell medium (iCell Bioscience, China). The cells were maintained at a temperature of 37\u0026deg;C in a humidified atmosphere containing 5% CO2 and 95% air.\u003c/p\u003e\u003cp\u003e\u003cem\u003eIsolation and identification of ADSCs\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe subcutaneous adipose tissue in the inguinal region of 12-week-old male SD rat was aseptically isolated and digested with type I collagenase (Solarbio,China) for 1h on a constant temperature shaker. After filtration using a 70 \u0026micro;m grid, the digestion of ADSCs was terminated by adding DMEM medium supplemented with 10% FBS and 100 U/ml double antibiotics. Following centrifugation, the ADSCs were cultured in complete medium under humidified conditions containing 5% CO\u003csub\u003e2\u003c/sub\u003e/95% air at 37\u0026deg;C. The third passage of ADSCs was collected and rinsed with phosphate buffer solution (PBS). The phenotypes of ADSCs, including CD14 (Biolegend,USA), CD19 (Biolegend,USA), CD34 (Invitrogen,USA), CD44 (Invitrogen,USA), CD73 (Biolegend,USA) and CD90 (Biolegend,USA) were analyzed using flow cytometry. The third generation of ADSCs were cultured in osteogenic induction medium for a duration of 3 weeks, followed by staining with alizarin red. Additionally, the cells were incubated in adipogenic induction medium for 2 weeks and stained with oil red o.\u003c/p\u003e\u003cp\u003e\u003cem\u003eIsolation and characterization of ADSC‑Exos\u003c/em\u003e\u003c/p\u003e\u003cp\u003eFor the extraction of ADSC-Exos, a specific protocol based on ultracentrifugation can be followed as described in previous study.\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003eADSC samples were subjected to centrifugation at 300, 2000, and 10000 g for 10, 10, and 30 min respectively to obtain supernatant. The collected supernatant was then ultracentrifuged at 100000 g for 75 min to isolate the precipitate which was subsequently resuspended in PBS and centrifuged again at the same speed for another 75 min. The precipitate obtained following the aforementioned procedure is ADSC-Exos. Nanoparticle tracking analysis (NTA)(ZetaView, Particle Metrix, Meerbusch, Germany) enables the determination of exosomal diameter. The morphological characteristics of exosomes were examined using a transmission electron microscope (JEM-2100F, Japan Electronics Corporation, Tokyo, Japan). Western blotting was employed to detect the presence of exosomal protein markers CD9 (Abcam, UK), CD63 (Abcam, UK) and HSP90 (Abcam, UK).\u003c/p\u003e\u003cp\u003e\u003cem\u003eCo‑culture of Raw264.7 cells with ADSC‑Exos\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe Raw264.7 cells were cultured according to previously described methods in DMEM supplemented with 10% FBS and 1% double antibiotics solution.\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003eThe Raw264.7 cells in the ADSC‑Exos group were cultured with 20\u0026micro;g/ml ADSC-Exos. The negative control group was simultaneously established, and exosome-depleted serum was employed for cultivation. The M1 macrophages group was treated with 1000ng/ml LPS and 20ng/ml IFN-γ. The expression level of miRNA-590-3p was detected using RT-qPCR, and the expression levels of Arg-1 and TNF-α in Raw264.7 cells in different groups were also assessed using RT-qPCR.\u003c/p\u003e\u003cp\u003e\u003cem\u003emiRNA transfection\u003c/em\u003e\u003c/p\u003e\u003cp\u003eRAW264.7 cells were transfected with 10nM miR-590-3p mimics (HanHeng, China) and 10nM miR-590-3p inhibitors (HanHeng, China) using Invigentech INVI DNA RNA transfection reagent(Invigentech, USA) overnight in DMEM, resulting in the acquisition of 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e RAW cells per well. The primer sequences of mi-RNA listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Simultaneously, a blank control group was established. The miRNA transfection efficiency was assessed by RT-qPCR to detect the expression of miR-590-3p in each group.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer nucleotide sequences of mi-RNA and si-RNA\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eName\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer sequence\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emimics NC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: UCACAACCUCCUAGAAAGAGUAGA\u003c/p\u003e\u003cp\u003ePrimer R: UCUACUCUUUCUAGGAGGUUGUGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emiR-590-3p mimics\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: UAAUUUUAUGUAUAAGCUAGU\u003c/p\u003e\u003cp\u003ePrimer R: ACUAGCUUAUACAUAAAAUUA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003einhibitor NC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: UAAUUUUAUGUAUAAGCUAGU\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emiR-590-3p inhibitor\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: ACUAGCUUAUACAUAAAAUUA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003esi-STAT1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: CACUGUGAUGUUAGAUAAATT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer R: UUUAUCUAACAUCACAGUGTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003esi-STAT1 NC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: UUCUCCGAACGUGUCACGUTT\u003c/p\u003e\u003cp\u003ePrimer R: ACGUGACACGUUCGGAGAATT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eThe Invigentech INVI DNA RNA transfection reagent was combined with miR-590-3p mimics, miR-590-3p mimics NC, miR-590-3p inhibitor, and miR-590-3p inhibitor NC, respectively. The medium was replenished 24h post-transfection of macrophages. The miR-590 mimics group and miR-590 mimics NC group were treated with LPS (1000 ng/ml) and IFN-γ (20 ng/ml) for 24 h. The miR-590 inhibitor group and the miR-590 inhibitor NC group were treated with IL-4 (20 ng/ml) for 24h. RT-qPCR was employed to assess the expression levels of STAT1, TNF-α, ARG-1, and NOS2 in each experimental group. Flow cytometry was utilized for the detection of CD86 and CD206 expression levels in macrophages. Western Blot analysis was performed to determine the protein expression levels of STAT1, p-STAT1, INOS, and Arg-1 in each group.\u0026middot;\u003c/p\u003e\u003cp\u003e\u003cem\u003esi-RNA transfection\u003c/em\u003e\u003c/p\u003e\u003cp\u003eAccording to the Invigentech transfection protocol, RAW264.7 cells were transfected with si-STAT1 and si-STAT1 NC separately. The primer sequences of si-RNA listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Gene silencing was assessed 24h post-transfection using RT-qPCR. Subsequently, LPS (1000ng/ml) and IFN-γ (20ng/ml) were added to each group for an additional 24h incubation. RT-qPCR was used to detect the expression levels of STAT1, TNF-α, Arg-1 and NOS2 in each group. The expression levels of CD86 and CD206 in macrophages were detected by flow cytometry. The protein expression levels of STAT1, p-STAT1, iNOS and Arg-1 in each group were detected by Western Blot.\u003c/p\u003e\u003cp\u003e\u003cem\u003eWestern blot\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe samples were treated with RIPA peptide lysis buffer containing 1% protease inhibitors (Roche, Switzerland). Following a series of electrophoresis, membrane transfer, and blocking procedures, the membranes were incubated overnight at 4\u0026deg;C with the following antibodies: anti-STAT1(Proteintech, China), anti-p-STAT1(Proteintech, China), anti-Arg-1(Abcam, UK), anti-TNF-α(Proteintech, China), anti-NOS2(Abcam, UK), and anti-GAPDH(Abcam, UK). After co-culturing macrophages with endothelial cells in each group, the target proteins were detected using anti-Bcl-2(Abcam, UK), anti-Bax(Abcam, UK), anti-Caspase3(Abcam, UK), anti-MMP-9(Abcam, UK), anti-MMP-2(Abcam, UK) and anti-VEGFR1(Proteintech, China). In the perforator flap model, the target proteins in the tissue were detected using anti-STAT1 (Proteintech, China), anti-VEGF (Abcam, UK), anti-IL-6 (Abcam, UK), anti-VCAM-1 (Abcam, UK), anti-IL-1 (Abcam, UK), anti-MCP-1 (Abcam, UK), and anti-iCAM-1(Abcam, UK).Membranes were rinsed three times with tris-buffered saline gradient (TBST) and incubated with peroxidase-labeled secondary antibodies for 2h at room temperature. Finally, protein signals were developed using enhanced chemiluminescence (ECL) reagents (Sigma, Germany) and visualized using the Biorad Gel Doc EQ system. Quantitative analysis of gray values was performed using Image J software (Rawak software, Inc.).\u003c/p\u003e\u003cp\u003e\u003cem\u003eReverse transcription‑quantitative polymerase chain reaction (RT‑qPCR)\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe Total RNA Extraction Kit reagent (Accurate Biology,China) was used for the extraction of each cell sample. Subsequently, the extracted RNA was reverse transcribed into cDNA using a kit (Accurate Biology,China) following the manufacturer's instructions. The amplification of cDNA templates was performed using the SYBR Green kit (Accurate Biology,China). The expression of miR-590-3p was normalized to U6 transcript levels. Relative mRNA expression levels were normalized to β-actin. Primer sequences listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e were synthesized by Hanheng Biotechnology Co., LTD (Shanghai, China). RT-qPCR analysis was conducted three times for each sample and the relative fold change in gene expression was calculated using the 2\u003csup\u003e- CΔΔt\u003c/sup\u003e method(Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer nucleotide sequences of RT-qPCR\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eName\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer sequence\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTNF-α\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: GCCAGGAGGGAGAACAGAAACTC\u003c/p\u003e\u003cp\u003ePrimer R: GGCCAGTGAGTGAAAGGGACA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eArg \u0026minus;\u0026thinsp;1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: CAGCACTGAGGAAAGCTGGT\u003c/p\u003e\u003cp\u003ePrimer R: ACAGACCGTGGGTTCTTCAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNOS2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: ACTACTGCTGGTGGTGACAA\u003c/p\u003e\u003cp\u003ePrimer R: GAAGGTGTGGTTGAGTTCTCTAAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSTAT1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: AGCTTGACGACCCTAAGCG\u003c/p\u003e\u003cp\u003ePrimer R: CCCACTATCCGGGACATCTCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emiR-590-3p\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCGCGTAATTTTATGTATAAGCTAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eU6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: CTCGCTTCGGCAGCACA\u003c/p\u003e\u003cp\u003ePrimer R: AACGCTTCACGAATTTGCGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eΒ-actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: GGCTGTATTCCCCTCCATCG\u003c/p\u003e\u003cp\u003ePrimer R: GGCTGTATTCCCCTCCATCG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eVEGF1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: TCACCAAGGCCAGCACATAG\u003c/p\u003e\u003cp\u003ePrimer R: GAGGCTCCAGGGCATTAGAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMMP-2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: GCAGTGGGGGCTTAAGAAGA\u003c/p\u003e\u003cp\u003ePrimer R: CTTGGGGCAGCCATAGAAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBax\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: GGGGAGCAGCCCAGAGG\u003c/p\u003e\u003cp\u003ePrimer R: TCAGCTGCCACTCGGAAAAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBcl-2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: AACATCGCCCTGTGGATGAC\u003c/p\u003e\u003cp\u003ePrimer R: ACTTGTGGCCCAGATAGGCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCaspase3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: GCAGCAAACCTCAGGGAAAC\u003c/p\u003e\u003cp\u003ePrimer R: CAGTTCTGTACCACGGCAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMMP-9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: GTACTCGACCTGTACCAGCG\u003c/p\u003e\u003cp\u003ePrimer R: TTCAGGGCGAGGACCATAGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eVEGF-A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: TGAGACCCTGGTGGACATCT\u003c/p\u003e\u003cp\u003ePrimer R: GCTGGCTTTGGTGAGGTTTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eVCAM-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: TGTAACTCTGGGAAACTGGAAAGA\u003c/p\u003e\u003cp\u003ePrimer R: TCAGGAGCCAAACACTTGACC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIL-1β\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: CCCTGAACTCAACTGTGAAATAGCA\u003c/p\u003e\u003cp\u003ePrimer R: CCCAAGTCAAGGGCTTGGAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIL-6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: ATTGTATGAACAGCGATGATGCAC\u003c/p\u003e\u003cp\u003ePrimer R: CCAGGTAGAAACGGAACTCCAGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eiCAM-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: GGCTTCTGCCACCATCACT\u003c/p\u003e\u003cp\u003ePrimer R: TGTCTCATTCCCACGGAGCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMCP-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer F: CTATGCAGGTCTCTGTCACGC\u003c/p\u003e\u003cp\u003ePrimer R: CAGCCGACTCATTGGGATCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eFlow cytometry\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe cells from each group were collected and subjected to two washes with 2 ml of 0.5% BSA-PBS. Subsequently, the cells were centrifuged at 500 g for 5 min at a temperature of 4\u0026deg;C. The cells were preincubated with a mouse Fc receptor blocker (BioLegend, USA) for 15 min. The cells were then resuspended in an appropriate flow buffer, and the antibodies CD86 (BioLegend, USA) and CD206 (BioLegend, USA) were added to each group of sample cells for flow assays. Subsequently, the cells were incubated at 4\u0026deg;C in the dark for 45 min. After the completion of incubation, the cells were subjected to a second round of centrifugation and subsequently analyzed using a flow cytometry instrument(BECKMAN COULTER, USA).\u003c/p\u003e\u003cp\u003e\u003cem\u003eCo‑culture of Raw264.7 cells with HUVEC cells\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe experimental part was divided into four groups: miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 NC group, miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1-NC group, miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 group and miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group. According to the aforementioned transfection protocol, INVI DNA RNA transfection reagent was utilized for the transfection of miR-590-3p mimics, miR-590-3p mimics NC, and miR-590-3p inhibitor into the corresponding groups of macrophages. Following this transfection procedure, si-STAT1 and si-STAT1 NC were transfected based on the specific transfection conditions for each group. Transwell chambers (6.5mm, 3.0\u0026micro;m pore size) were utilized for the co-culture of HUVECs and RAW 264.7 macrophages. HUVECs were seeded in the lower chamber while macrophages were placed in the upper chamber. Following a 48h co-culture period, HUVECs were extracted for subsequent analysis.\u003c/p\u003e\u003cp\u003e\u003cem\u003eTube formation assay in vitro\u003c/em\u003e\u003c/p\u003e\u003cp\u003eHUVEC were co-cultured with four groups of RAW 264.7 subjected to different interventions and seeded in 48-well culture plates precoated with 130\u0026micro;l matrigel basement membrane matrix (BD Biosciences, USA). After incubating for 4h, tube images were captured using a digital camera, and tube formation was quantified using the Image J software.\u003c/p\u003e\u003cp\u003e\u003cem\u003eCCK‑8 assay\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe Cell Counting Kit-8 (CCK-8; Solarbio, China) was utilized to assess the impact of macrophages on HUVEC proliferation in each experimental group. In brief, cells were seeded into 96-well plates at a density of 3,000 cells per well. After incubation, the cells were washed three times with PBS, followed by the addition of 10 \u0026micro;l of CCK-8 solution (10 \u0026micro;l; 1:10 diluted) into fresh culture medium at 37\u0026deg;C for 2 h at different time points (0, 24, 48, and 72h). The optical absorbance at 450 nm for each sample was finally measured using an absorbance microplate reader (ELx800, BioTek, USA). The presence of a higher optical density (OD) value suggests a more advantageous cellular condition.\u003c/p\u003e\u003cp\u003e\u003cem\u003eScratch assay\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe impact of macrophages in each intervention group on HUVEC migration was assessed using the scratch wound assay. The HUVECs from each group were seeded in 6-well plates (5\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/tube). Once the plates were fully covered with a monolayer of cells, the upper suspension cells were gently washed off using PBS by crossing the center with a 10 \u0026micro;l pipette tip. Subsequently, photographs were captured under an inverted microscope after incubating for 0h and 24h in serum-free medium to determine the percentage of migrated area.\u003c/p\u003e\u003cp\u003e\u003cem\u003eCell apoptosis assay\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe HUVECs cell suspension in each group was aliquoted into EP tubes, diluted with Binding Buffer, and then combined with 5\u0026micro;l Annexin V-APC (Elabscience, China) and 5\u0026micro;l Propidium Iodide (Solarbio, China). The cells were incubated at 25\u0026deg;C for 15 min, followed by analysis using flow cytometry.\u003c/p\u003e\u003cp\u003e\u003cem\u003eEstablishment of rat perforator flap models\u003c/em\u003e\u003c/p\u003e\u003cp\u003eIn this experiment, 40 male SD rats were randomly divided into 4 groups according to different cell suspensions injected subcutaneously. To minimize bias arising from animal factors, we assigned unique identification numbers to 40 Sprague-Dawley rats and created corresponding numbered cards. Four researchers subsequently drew the cards in a randomized sequence to determine the allocation of rats into respective experimental groups. The grouping conditions were the same as the cell experiment: miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 NC group, miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1-NC group, miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 group and miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group. All rats were anesthetized by intraperitoneal injection with 3% sodium pentobarbital at a dose of 60 mg/kg. After successful anesthesia, the surgical area was treated with hair removal and disinfection. A 12\u0026times;3cm flap was constructed on the right back of the rat, with the upper boundary being the two lines of the subscapular horn on both sides of the rat, and the lower boundary being the line of the posterior superior iliac spine on both sides (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). Blunt separation was performed in the carnal membrane and the puncture branches of the dorsal thoracic artery and intercostal artery were ligation using non-absorbable surgical sutures (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). Two key areas, chokeⅠ and choke Ⅱ, were labeled on the back epidermis of rats, interrupted suture with 5\u0026thinsp;\u0026minus;\u0026thinsp;0 non-absorbable nylon thread in situ, sterilized the operation area again, and then put back into a separate cage after the rats recovered safely. Macrophages were transfected 24 hours later by adding IL-4 (20 ng/ml) to induce differentiation into M2 macrophages, and then co-cultured with endothelial cells. The prepared 1 ml cell suspension was injected subcutaneously into the skin at the proximal 1/3 of the vascular body area of the dorsal thoracic artery of the rat flap at the same time point on the 0, 1, 3, 5 and 7 days after surgery, respectively. The injection was performed with isoflurane (0.41 ml/min at 4 L/min Fresh gas flow) under inhalation anesthesia. On the 8th day after operation, full-layer skin flaps with a central area of chokeⅡ of 2 cm\u0026times;2 cm were selected for RT-QPCR, Western blot, HE staining and immunofluorescence staining. Primer sequences listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e were synthesized by Hanheng Biotechnology Co., LTD (Shanghai, China)\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eThe survival rate of the perforator flap\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe condition of the rat skin flap was carefully observed and recorded within 7 days after the construction of the rat skin flap. The evaluation indexes include skin flap color changes, tissue softness and elasticity assessment, skin and hair growth status, infection, and necrosis. Once the skin flap color turns black, the tissue becomes hard and atrophy, lack of elasticity, and no blood flow during cutting, the skin flap necrosis can be determined. The survival rate of skin flap in each group was calculated as follows: The survival rate of skin flap = \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\frac{Flap\\:survival\\:area}{\\:Total\\:flap\\:area}\\)\u003c/span\u003e\u003c/span\u003e\u003cem\u003e\u0026times;100%\u003c/em\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eGelatin-lead oxide angiography\u003c/em\u003e\u003c/p\u003e\u003cp\u003eFirst, the infusion solution was prepared: 100 mL normal saline\u0026thinsp;+\u0026thinsp;5 g gelatin powder\u0026thinsp;+\u0026thinsp;100 g lead oxide powder, stirred in a constant temperature water bath at 40℃ until dissolved. Three rats were taken from each of the four groups. After satisfactory anesthesia, the right common carotid artery of the rats was fully exposed. 24 G disposable silicone intravenous indent needle was inserted into the right common carotid artery from the head to the tail, and 2 mL heparin sodium solution (50 IU/mL) was injected into the right common carotid artery at the same time to ensure that the blood in the rats was completely emptied. The pre-configured gelatine-lead oxide mixture was then slowly injected into the right common carotid artery using a 20 mL syringe at a dose of 30 mL/kg. During the infusion process, the infusion was stopped immediately when spotty or patchy color of the infusion was observed in the cornea and limbs of the rats. The experimental specimens were placed in a refrigerator at 4℃ overnight. On the next day, the flap tissue of the back of the rats was separated, and X-ray was performed after tiling (conditions were 40 kV, 5 mA, exposure time was 0.1s).\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eThe statistical data were reported as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. One-way analysis of variance (ANOVA) and t-test were employed to compare the data between groups. P value less than 0.05 was considered statistically significant. The data analysis and statistical figure drawing were performed using GraphPad Prism 8.0 software (GraphPad, La Jolla, CA,USA, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.graphpad\u003c/span\u003e\u003cspan address=\"http://www.graphpad\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. com).\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cem\u003eIsolation and characterization of ADSCs and ADSC‑Exos\u003c/em\u003e\u003c/p\u003e\u003cp\u003eADSCs obtained from the inguinal region of SD-rats exhibited robust growth(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) and demonstrated successful differentiation into both adipocytes(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eB) and osteoblasts(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). The flow cytometry analysis revealed that ADSCs exhibited high expression levels of CD19, CD14, and CD34, while demonstrating low expression levels of CD44, CD73 and CD90(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). Transmission electron microscopy showed that the morphology of exsomes was double-membrane structure and cup-like shape(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). NTA analysis of ADSC-Exos further suggested that the average diameter of exosomes was (82.23\u0026thinsp;\u0026plusmn;\u0026thinsp;21.21) nm(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). The western blot results demonstrated that ADSCs-Exos exhibited high expression levels of CD9, CD63, and HSP90(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eF).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eADSC‑Exos can enhance the expression of miR 590-3p in RAW 264.7\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe expression of miR-590-3p was detected using RT-qPCR in both the ADSC‑Exos group and the control group. Compared to the control group, the ADSC‑Exos group exhibited significantly elevated levels of miR-590-3p expression(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eADSC‑Exos can enhance the expression of anti-inflammatory factors in RAW 264.7\u003c/em\u003e\u003c/p\u003e\u003cp\u003eCompared to the control group, the LPS\u0026thinsp;+\u0026thinsp;IFN-γ stimulation group exhibited a 6-fold increase in TNF-α gene expression and a 0.5-fold decrease in Arg-1 gene expression(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eB and Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). The expression of the Arg-1 gene was upregulated 4-fold in response to ADSC-Exos group compared to the control group(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). The expression of the TNF-α gene did not show any significant difference between ADSC-Exos group and the control group(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003cem\u003eThe induction of M2 macrophage polarization was observed upon miR-590-3p stimulation.\u003c/em\u003e\u003c/p\u003e\u003cp\u003eTo investigate the impact of miR-590-3p on M2 macrophage polarization, RAW 264.7 were transfected with miR-590-3p mimics, miR-590-3p mimics NC, miR-590-3p inhibitor, miR-590-3p inhibitor NC. RT-qPCR results and fluorescence microscopy findings demonstrated the successful transfection of macrophages(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eH,\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eI,\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ). RT-qPCR results demonstrated a significant decrease in the expression levels of TNF-α and iNOS in the miR-590-3p mimics group, while there was an increase in the expression level of Arg-1(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eE,\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eF,\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). Conversely, the miR-590-3p inhibitor group exhibited elevated expression levels of TNF-α, iNOS, and STAT1, accompanied by a reduction in the expression level of Arg-1(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eI,\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ,\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eK). The Western Blot results revealed a significant decrease in the expression levels of iNOS, STAT1 and p-STAT1 proteins in the miR-590-3p mimics group, while there was an increase in the expression level of Arg-1 protein(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA,\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eC,\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eD,\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eE,\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Conversely, the miR-590-3p inhibitor group exhibited a decrease in the expression level of Arg-1 protein and an increase in the expression levels of iNOS, STAT1 and p-STAT1proteins(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eF,\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eG,\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eH,\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eI). The flow cytometry results demonstrated that the expression level of CD206 was higher in the miR-590-3p mimics group compared to the miR-590-3p mimics NC group(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eD), while the expression level of CD86 was lower in the miR-590-3p mimics group than in the miR-590-3p mimics NC group(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). The inhibition of miR-590-3p led to a reduction in the expression of CD206 and an elevation in the expression of CD86. (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eE, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eMiR-590-3p mediated STAT1 involved in the regulation of macrophage polarization\u003c/em\u003e\u003c/p\u003e\u003cp\u003eWe detected the expression of STAT1 in RAW 264.7 after transfection with miR-590-3p mimics, miR-590-3p mimics NC, miR-590-3p inhibitor and miR-590-3p inhibitor NC. The expression level of STAT1 was downregulated in the miR-590-3p mimics group(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Conversely, the miR-590-3p inhibitor group exhibited an upregulation in STAT1 expression(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). Western Blot results demonstrated a significant decrease in the expression level of STAT1 protein in the miR-590-3p mimics group(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eD), whereas an increase in STAT1 protein expression was observed in the miR-590-3p inhibitor group(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eH). In addition, we detected inflammatory cytokines in RAW 264.7 transfected with si-STAT1 and si-STAT1 NC. RT-qPCR analysis revealed a significant decrease in the expression levels of TNF-αand NOS2, while an increase was observed in the expression level of Arg-1 within the si-STAT1 group(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eN,\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eO,\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eM). Western Blot results demonstrated a significant reduction in the expression levels of iNOS, STAT1 and p- STAT1 proteins in the si-STAT1 group, accompanied by an increase in the expression level of Arg-1 protein(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eK,\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eL,\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eM, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eJ). The flow cytometry results revealed that the expression of CD206 was significantly higher in the si-STAT1 group compared to the si-STAT1 NC group(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eF), while the expression of CD86 was notably lower in the si-STAT1 group than in the si-STAT1 NC group(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003cem\u003eThe co-culture of RAW 264.7 cells with miR-590-3p overexpression and HUVEC resulted in enhanced migration of HUVEC\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe expression of miR-590-3p and STAT1 in each group was detected using RT-qPCR after transfection. Notably, miR-590-3p expression exhibited the most significant change, while STAT1 expression showed the least pronounced alteration in the miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group, indicating successful transfection of RAW 264.7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eI and Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eJ). The scratch assay was employed to assess the impact of each intervention strategy on HUVEC migration by RAW264.7. The migration rate of the miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group exhibited the highest level, while both the miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 group and miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 NC group also demonstrated significantly elevated migration rates compared to the miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 NC group. These differences were found to be statistically significant(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eG). The scratch assay demonstrated that the overexpression of miR-590-3p significantly enhanced the migratory capacity of HUVEC.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eThe co-culture of RAW 264.7 cells with miR-590-3p overexpression and HUVEC resulted in a reduction in HUVEC apoptosis\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe apoptosis rate of cells was determined using flow cytometry analysis. The average apoptosis rate of HUVEC in the miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 NC group, miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 group, and miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group were 21.14%, 14.72%, 14.24%, and 10.48% respectively. Compared to the control group, the other three groups exhibited a significant reduction in apoptosis rate, with the miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group demonstrating the lowest level of apoptosis(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eB,\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eH). Western blotting was employed to detect the expression levels of apoptosis-related proteins in each experimental group. Compared to the miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 NC group, there was a significant reduction observed in Bax (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eA,\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eC) and Caspase3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eA,\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eE) protein levels in the miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 NC group, miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 group, as well as the miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group. The inverse trend was observed for Bcl-2(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eA,\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). The RT-qPCR results demonstrated that, compared to the miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 NC group, the expression levels of Bax (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eK) and Caspase3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eM) were downregulated, while the expression level of Bcl-2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eL) was upregulated in the remaining three groups.\u003c/p\u003e\u003cp\u003e\u003cem\u003eThe co-culture of RAW 264.7 cells with miR-590-3p overexpression and HUVEC resulted in enhanced proliferation of HUVEC\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe effect of miR-590-3p overexpression in RAW 264.7 on HUVEC proliferation was assessed using the CCK-8 assay. The OD values were measured at 24h, 48h, and 72h in this experiment to assess the rate of cellular proliferation. The CCK8 assay revealed a significant increase in proliferation ability for the miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 NC group, miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 group, and miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group compared to the control group(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003e\u003cem\u003eThe co-culture of RAW 264.7 cells with miR-590-3p overexpression significantly augmented the angiogenic potential of HUVEC\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe tube formation assay was employed to assess the angiogenic potential of HUVEC, and cellular morphology was examined under a microscope following 4 h of incubation. The expression levels of miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 NC group, miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 group, and miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group were significantly higher compared to the control group(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eC,\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eE,\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eF). The miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group exhibited the most pronounced improvement based on the tubule experiment results. Western blotting was employed to detect the expression of vascularization-related proteins in each experimental group. Compared to the miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 NC group, there was a significant increase in the expression levels of VEGFR1(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eA,\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eH), MMP-9(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eA,\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eF), and MMP-2(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eA,\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eG) in miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group, miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 NC group and miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 group. Additionally, the expression level of miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group showed a marked enhancement. The RT-qPCR results demonstrated that the expressions of VEGFR1(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eP), MMP-9(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eN), and MMP-2(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eO) were significantly upregulated in the three experimental groups compared to the miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 NC group.\u003c/p\u003e\u003cp\u003e\u003cem\u003eLocal injection of cell suspension after co-culture of miR-590-3p overexpressed macrophages and vascular endothelial cells can reduce the necrosis rate of the distal flap\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe operation was successful for all 40 rats, with no fatalities. On the first day post-operation, stasis was observed at the distal end of the flap in each rat group. By the third day post-operation, varying degrees of necrosis were evident along the distal flap in all four groups of rats, and the boundary of necrosis was clearly discernible. After 5 days post-surgery, certain rat flaps in the miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 group exhibited suboptimal wound healing. By day 7 post-surgery, the impaired healing of a portion of the proximal flap in the miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 group demonstrated improvement, while there was a significant reduction in necrotic area observed in all groups for the distal flap.The survival rate of the flap in miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 NC group was the lowest. miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group was the largest, and the flap survival rate of each group was (64.659\u0026thinsp;\u0026plusmn;\u0026thinsp;1.457)%, (87.307\u0026thinsp;\u0026plusmn;\u0026thinsp;0.911)%, (74.817\u0026thinsp;\u0026plusmn;\u0026thinsp;1.000)% and (90.580\u0026thinsp;\u0026plusmn;\u0026thinsp;0.819)%, respectively. The differences were statistically significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e7\u003c/span\u003eC ,\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e7\u003c/span\u003eG, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001).\u003c/p\u003e\u003cp\u003e\u003cem\u003eLocal injection of cell suspension after co-culture of miR-590-3p overexpressed macrophages and vascular endothelial cells inhibited the development of inflammation\u003c/em\u003e\u003c/p\u003e\u003cp\u003eRT-qPCR showed that compared with the control group (miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 NC group), The expression level of miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 in the NC group and the miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group was significantly increased, reaching 4.153 times and 4.361 times that of the control group, respectively, and the difference was statistically significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eI, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Compared with the control group (miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 NC group), The expression of VEGF-A in miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 NC group, miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 group and miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group was increased(Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eK). It was increased to 1.23 times, 1.11 times and 1.30 times of control group, respectively. On the contrary, the expressions of STAT1, IL-6 ,VCAM-1 ,IL-1β,MCP-1 and iCAM-1 all decreased, and the differences were statistically significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eJ,\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eL,\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eM,\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eN,\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eO,\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eP).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWestern blot showed that compared with the control group (miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 NC group), the protein expressions of STAT1 and IL-6, VCAM-1, IL-1β, MCP-1 and iCAM-1 in the other three groups were decreased to varying degrees(Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA,\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB,\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD,\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE,\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eF,\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eG,\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eH). On the contrary, the protein expression of VEGF was increased to varying degrees, and the difference was most significant in miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA,\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003eAfter HE staining, six different visual fields were randomly selected, the number of blood vessels in these visual fields was manually counted, and the average value was calculated, which was used as an indicator to measure microvascular density (MVD). It was found that compared with the control group (miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 NC), the number of inflammatory cells in the other three groups was significantly reduced, and the average density of microvessels was also increased, among which the difference was most significant in the miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group. The mean microvessel density in chokeⅡ of the four groups was (9.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.66) /mm\u0026sup2;, (14.71\u0026thinsp;\u0026plusmn;\u0026thinsp;1.36) /mm\u0026sup2;, (12.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.90) /mm\u0026sup2;, and (19.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.78) /mm\u0026sup2;, respectively, with statistical significance compared with the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e7\u003c/span\u003eE, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e7\u003c/span\u003eI, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e\u003cp\u003e\u003cem\u003eLocal injection of cell suspension after co-culture of miR-590-3p overexpressed macrophages and vascular endothelial cells can promote angiogenesis\u003c/em\u003e\u003c/p\u003e\u003cp\u003eAfter immunofluorescence staining, three visual fields were randomly selected, and the images were imported into Image J software for counting, and mean fluorescence intensity (MFI) was selected as the evaluation index. Compared with the control group (miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 NC), the average fluorescence intensity of CD31, CD34 and VEGF in the other three groups were increased to varying degrees. The increase was most significant in miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e7\u003c/span\u003eD, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e7\u003c/span\u003eH).\u003c/p\u003e\u003cp\u003eIt was found by gelatin-lead oxide angiography that compared with the control group (miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 NC), the other three groups of flaps had more angiogenesis in Choke Ⅱ area, and the structure was relatively clear and complete, and the vascular diameter was relatively larger. In particular, miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group was most significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e7\u003c/span\u003eF).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe local damage to a perforator flap primarily arises from compromised blood flow in the choke vessel, leading to ischemia and hypoxia\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. This is further exacerbated by reperfusion injury and the release of inflammatory mediators, which subsequently trigger cellular apoptosis and necrosis. The expression of angiogenesis factors and the organization of vascularization play a crucial role in skin flap regeneration. Therefore, there is a global research focus on exploring strategies to enhance flap survival. Macrophages and endothelial cells play an important role in wound healing, and whether ADSC-Exos has signaling pathways that regulate macrophages and endothelial cells needs verification.\u003c/p\u003e\u003cp\u003eSeveral studies\u003csup\u003e\u003cspan additionalcitationids=\"CR29\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e have confirmed that the exosomes derived from mesenchymal stem cells have the ability to modulate macrophage polarization. ADSC-Exos exert a significant impact on abdominal aortic aneurysm\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e, tissue healing\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e and myocardial infarction\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e by regulating the expression of inflammation. Nevertheless, the role and underlying mechanisms of ADSC-Exos in macrophage polarization progress have not been thoroughly investigated. In the present study, we provided novel insights into the effect of ADSC-Exos in modulating the macrophage polarization pathological process. The findings simultaneously offer novel insights into the regulatory interaction between macrophages and endothelial cells(Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eIn our study, ADSC-Exos exert a concurrent anti-inflammatory regulatory function in macrophages. Furthermore, our study confirms that stimulation with ADSC-Exos significantly increases the expression of miR-590-3p in RAW cells. These findings provide further evidence supporting the role of exosomes in mediating miRNA functions to regulate signaling pathways. miR-590-3p is a biological molecule that exists in exosomes and plays a pivotal role in the regulation of signaling pathways mediated by exosomes. Current findings\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e reveal that miR-590-3p molecule attenuates inflammatory signals and facilitates epithelial regeneration by specifically targeting LATS1, thereby activating the YAP/β-catenin-regulated transcriptional pathway. Another study\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e shows that miR-590-3p improves diabetic peripheral neuropathic pain by targeting RAP1A and inhibiting T-cell infiltration. In addition, miR-590-3p inhibited Th17 cells by suppressing autophagy.\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e miR-590-3p possesses the capability to attenuate lipopolysaccharide-induced acute kidney injury (AKI) and podocyte apoptosis through its targeting of TRAF6\u003csup\u003e37\u003c/sup\u003e. miR-590-3p can downregulate the expression of iNOS, thereby attenuating the inflammatory response.\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003eHowever, the regulation of macrophage polarization by miR-590-3p lacks further investigation. The findings of this study complement the results obtained from mechanistic investigations on miR-590-3p and its impact on macrophage polarization.\u003c/p\u003e\u003cp\u003eJAK/STAT1 pathway is a canonical inflammatory regulatory pathway that plays a pivotal role in macrophage polarization.\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e,\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e And JAK/STAT1 pathway is also activated by the pro-inflammatory cytokines TNF-α and IFN-γ.\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e,\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003eSuppressors of cytokine signaling (SOCS) is involved in the suppression of M1 inflammatory phenotype through the JAK/STAT1 pathway.\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003eThe expression of STAT1 has also been demonstrated to be influenced by insulin.\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003eThe polarization of M1 macrophages is driven by methyltransferase like 3 (METTL3) through direct methylation of STAT1 mRNA.\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003emiR-19a-3p exerts an inhibitory effect on M1 macrophage polarization by suppressing the STAT1/IRF1 signaling pathway.\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003eThe effect of LNA-anti-miR-150 in folic acid-induced RIF mice may be attributed to its ability to attenuate pro-inflammatory M1 and M2 macrophage polarization through the SOCS1/JAK1/STAT1 pathway.\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003eThe synergistic action of colorectal cancer-derived miR-21-5p and miR-200a induces polarization of macrophages towards an M2-like phenotype by modulating the PTEN/AKT and SCOS1/STAT1 signaling pathways.\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003eThe lncGBP9 molecule acts as a sponge for miR-34a, thereby rescuing the expression of SOCS3 and subsequently modulating macrophage polarization through the STAT1/STAT6 signaling pathway.\u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003eRecent research has also confirmed the macrophage polarization pathways including miR-139-3p/STAT1\u003csup\u003e50\u003c/sup\u003e, miR-155-5p/STAT1\u003csup\u003e51\u003c/sup\u003e, miR-146a-5p/STAT1\u003csup\u003e52\u003c/sup\u003e, miR-23a-3p/STAT1/STAT3\u003csup\u003e53\u003c/sup\u003e, miR-155-5p-SOCS1/JAK1/STAT1\u003csup\u003e54\u003c/sup\u003e, miR-382-5p/STAT1\u003csup\u003e55\u003c/sup\u003e, miR-103/STAT1\u003csup\u003e56\u003c/sup\u003e, STAT1-miR-155-SOCS1\u003csup\u003e57\u003c/sup\u003e, miR-21/STAT1\u003csup\u003e58\u003c/sup\u003e, miR-221/STAT11\u003csup\u003e59\u003c/sup\u003e, miR-1296/STAT1\u003csup\u003e60\u003c/sup\u003e, miR-146/STAT1\u003csup\u003e61\u003c/sup\u003e, miR-150/STAT1\u003csup\u003e62\u003c/sup\u003e,miR-155/STAT1\u003csup\u003e63\u003c/sup\u003e. The summary indicates a close association between STAT1 and macrophage polarization, with microRNAs playing a pivotal role in its regulatory mechanism.\u003c/p\u003e\u003cp\u003ePrevious studies\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e have shown that miR-590-3p is associated with inflammatory expression. Our study elucidated that miR-590-3p may be involved in the polarization of macrophages through STAT1. The miR-590-3p minics group, miR-590-3p inhibitor group, si-STAT1 group, and corresponding control groups were established in our study. The results obtained from RT-qPCR, western blot, and flow cytometry collectively indicate that miR-590-3p mimics group possesses the potential to induced the polarization of macrophages towards M2 phenotype. The expression of miR-590-3p was found to exert a negative regulatory effect on the STAT1 signaling pathway.\u003c/p\u003e\u003cp\u003eIn the subsequent stage of this study, HUVECs were incorporated to explore the plausible association between macrophages and miR-590-3p in governing endothelial cell functionality. The functional status of HUVECs in each group was evaluated by co-cultivating them with macrophages derived from the corresponding transfection groups. After co-culture, the scratch test revealed that the migration rate of HUVECs was highest in both the miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group and the miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 group. Additionally, the migration rate of the miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 NC group was significantly higher than that of the control group, with a statistically significant difference. In the tubule formation assay, although there was no statistically significant difference observed between the miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 NC group and the miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 group, it is worth noting that under the regulation of si-STAT1, the miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 group exhibited an overall trend towards promoting tube formation. The flow cytometry analysis revealed a significant decrease in the apoptosis rate of the three experimental groups compared to the the miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 NC group. Notably, the apoptotic rate of the miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group exhibited a significantly lower level compared to that observed in the other experimental groups. The CCK-8 assay is widely employed for assessing cell proliferation and toxicity. In this study, the proliferation activity of the other three groups exhibited a higher level compared to that of the miR-590-3p mimics NC\u0026thinsp;+\u0026thinsp;si-STAT1 NC group. Collectively, the aforementioned experiments demonstrate that miR-590-3p and si-STAT1 are capable of regulating M2 macrophage polarization, enhancing HUVEC migration, inhibiting HUVEC apoptosis, and promoting angiogenesis.\u003c/p\u003e\u003cp\u003eThe BAX and Bcl-1 are commonly utilized as indicators to assess the extent of their influence on apoptosis. \u003csup\u003e\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e\u003c/sup\u003eMoreover, the apoptotic protease Caspase3, being a well-established player in cell apoptosis, is directly implicated in the process. \u003csup\u003e\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e\u003c/sup\u003e In this study, macrophages treated with miR-590-3p mimics and si-STAT1 exhibited a reduction in the Bax/Bcl ratio and Caspase-3 expression in endothelial cells, leading to inhibition of cell apoptosis and promotion of cell survival, thereby facilitating angiogenesis.\u003c/p\u003e\u003cp\u003eThe involvement of matrix metalloproteinases (MMPs) in tumor invasion, metastasis, and angiogenesis has been well-established.\u003csup\u003e\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e\u003c/sup\u003e The previous studies have demonstrated that MMP-2 and MMP-9 exert a stimulatory effect on the proliferation, migration, and cell cycle progression of vascular endothelial cells, thereby ultimately facilitating angiogenesis.\u003csup\u003e\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e\u003c/sup\u003eIn this study, the expression of MMP-2 and MMP-9 at both gene and protein levels is significantly up-regulated by M2 macrophages, thereby facilitating cell migration and proliferation.\u003c/p\u003e\u003cp\u003eThe vascular endothelial growth factor (VEGF) can mediate the proliferation, migration, and tube formation of endothelial cells, thus serving as a reliable marker for vascularization. \u003csup\u003e\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e,\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u003c/sup\u003eM2 macrophages are capable of secreting VEGF and facilitating angiogenesis in HUVECs through their interaction with the VEGFR receptor.\u003csup\u003e\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e\u003c/sup\u003e Additionally, it has been suggested that M2 macrophages may exert a promotive effect on the expression of VEGFR1.\u003csup\u003e\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e\u003c/sup\u003e The findings of our study demonstrate that transfected miR-590-3p macrophages have the ability to enhance endothelial VEGFR1 expression, thereby facilitating angiogenesis. The potential of miR-590-3p in promoting tissue angiogenesis was further validated in animal models of perforator flaps. This study elucidates the cellular interactions in the microenvironment after perforator flap surgery, further revealing the mechanisms of flap survival and distal ischemic necrosis.\u003c/p\u003e\u003cp\u003eIn the structure of perforator flaps, In the miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group, both the gene and protein expression of VEGF-A were upregulated, while the gene expression of VCAM-1, IL-1β, IL-6, iCAM-1, and MCP-1 was downregulated. The protein expression of IL-6, IL-1β, MCP-1, and VCAM-1 was also reduced. This indicates that the cell suspension obtained by co-culturing macrophages and endothelial cells overexpressing miR-590-3p exerts an inhibitory effect on local inflammatory development in the flap.Furthermore,choke vessel plays a crucial role in interconnecting blood vessels, serving as a vital conduit to ensure stable blood supply across the flap region\u003csup\u003e\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e\u003c/sup\u003e. Therefore, maintaining the function of the choke vessel is paramount for ensuring flap survival in its early stages. Meanwhile, in our study, the miR-590-3p mimics\u0026thinsp;+\u0026thinsp;si-STAT1 group exhibited the most significant increase in choke vessels, providing microscopic evidence that ADSC-Exos-mediated miR-590-3p/STAT1 axis promotes tissue angiogenesis.\u003c/p\u003e\u003cp\u003eHowever, our study still has some limitations. RAW246.9 and HUVECs were employed in the experiment, and employing primary macrophages for further validation would enhance the persuasiveness of the findings. The exosomes are abundant in a diverse array of regulatory factors; however, further investigation is required to establish correlations among these various regulatory factors in future studies. Subsequent research endeavors can delve deeper into exploring the effects of miR-590-3p-induced macrophages on the biological functions of animal models.Moreover, given the complex composition of ADSC-Exosomes, where miRNA constitutes only one of its components, and considering the variability in exosome content across different specimens, a direct comparison between ADSC-Exosomes and miRNA in mechanistic studies is not feasible; therefore, no dedicated exosome group was established for this mechanism research.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn summary, this study reveals that ADSC-Exos can mediate macrophage M2 polarization through the miR-590-3p/STAT1 pathway, thereby promoting endothelial cell proliferation, migration, and angiogenesis, with a positive effect on the angiogenesis and wound healing of the choke vessel of the perforator flap. The miR-590-3p molecule exhibits anti-inflammatory properties, thereby indicating its potential as a promising therapeutic approach for diseases associated with inflammation in the future.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eADSCs-Exos\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAdipose-derived stem cell exosomes\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eADSCs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAdipose-derived stem cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGM-CSF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGranulocyte macrophage colony stimulating factor\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eIFN-γ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eInterferon-γ\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eLPS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eLipopolysaccharide\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eIL-23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eInterleukin 23\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eARG-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eArginase 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003emiR-590-3p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMicroRNA-590-3p\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSprague-dawley\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eHUVECs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eHuman umbilical vein endothelial cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePhosphate buffer solution\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNanoparticle tracking analysis\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMMPs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMatrix metalloproteinases\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eADSCs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAdipose derived stem cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eADSCs-Exos\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAdipose-derived stem cell exosomes\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eMSCs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eMesenchyma stem cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePhosphate buffer saline\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eFBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eFetal bovine serum\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eRT-PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eRealtime-polymerase chain reaction\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eDMEM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eDulbeccos minimum essential medium\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eINOS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eInducible nitric oxide synthase\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eARG- 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eArginase- 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003erpm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eRevolutions per minute\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eTNF-α\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTumor\u0026nbsp;necrosis\u0026nbsp;factor-α\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eLPS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eLipopolysaccharides\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eIFN-γ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eInterferon-gama\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eIL-23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eInterleukin 23\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eIL-6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eInterleukin 6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eIL-10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eInterleukin 10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eIL-1β\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eInterleukin 1β\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNanoparticle tracking analysis\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMMPs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMatrix metalloproteinases\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMMP-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMatrix metalloproteinases 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMMP-4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMatrix metalloproteinases 4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTNF-α\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTumor necrosis factor-α\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eOD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAbsorbance\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eVEGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eVascular endothelia growth factor\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eHE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eHematoxylinand Eosin Stain\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMVD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMicrovessel density\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eDCI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eDeep iliac circumflex artery\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData and code availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data supporting the findings of this study are available from the corresponding authors upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConsent for publication has been obtained.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal use protocol titled \u0026quot;The delivery of exosomes miR-590 participates in ADSC-induced macrophages M2 polarization to improve the blood supply of perforator flaps\u0026quot; has been reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of The Second Xiangya Hospital, Central South University, China on September 10, 2020, with the approval number 2020524.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNational Natural Science Foundation of China (82272283)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYiwen Deng:Conceptualization;Data curation;Methodology;Writing \u0026ndash; original draft\u003c/p\u003e\n\u003cp\u003eChunjie Li:Data curation;Methodology;Software\u003c/p\u003e\n\u003cp\u003eDandan Song:Data curation;Methodology;Software;Validation\u003c/p\u003e\n\u003cp\u003eXiancheng Wang:Conceptualization;Methodology;Funding acquisition;Supervision;Writing \u0026ndash; review and editing\u003c/p\u003e\n\u003cp\u003eZhihua Qiao:Supervision;Validation\u003c/p\u003e\n\u003cp\u003eQuanding Yan:Supervision;Validation\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical trial number\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003enot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have not use AI-generated work in this manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLazarus GS, Cooper DM, Knighton DR, Percoraro RE, Rodeheaver G, Robson MC. Definitions and guidelines for assessment of wounds and evaluation of healing. Wound Repair Regen Jul. 1994;2(3):165\u0026ndash;70. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1046/j.1524-475X.1994.20305.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1524-475X.1994.20305.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXiong Y, Lin Z, Bu P, et al. A Whole-Course-Repair System Based on Neurogenesis-Angiogenesis Crosstalk and Macrophage Reprogramming Promotes Diabetic Wound Healing. Adv Mater May. 2023;35(19):e2212300. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/adma.202212300\u003c/span\u003e\u003cspan address=\"10.1002/adma.202212300\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTehrany PM, Rahmanian P, Rezaee A, et al. Multifunctional and theranostic hydrogels for wound healing acceleration: An emphasis on diabetic-related chronic wounds. Environ Res Dec. 2023;1(Pt 1):117087. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.envres.2023.117087\u003c/span\u003e\u003cspan address=\"10.1016/j.envres.2023.117087\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYu DM, Zhao J, Lee EE, et al. GLUT3 promotes macrophage signaling and function via RAS-mediated endocytosis in atopic dermatitis and wound healing. J Clin Invest Nov. 2023;1(21). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1172/jci170706\u003c/span\u003e\u003cspan address=\"10.1172/jci170706\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRehak L, Giurato L, Meloni M, Panunzi A, Manti GM, Uccioli L. The Immune-Centric Revolution in the Diabetic Foot: Monocytes and Lymphocytes Role in Wound Healing and Tissue Regeneration-A Narrative Review. J Clin Med Feb. 2022;8(3). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/jcm11030889\u003c/span\u003e\u003cspan address=\"10.3390/jcm11030889\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHassanshahi A, Moradzad M, Ghalamkari S, Fadaei M, Cowin AJ, Hassanshahi M. Macrophage-Mediated Inflammation in Skin Wound Healing. Cells Sep. 2022;21(19). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/cells11192953\u003c/span\u003e\u003cspan address=\"10.3390/cells11192953\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao X, Di Q, Liu H, et al. MEF2C promotes M1 macrophage polarization and Th1 responses. Cell Mol Immunol Apr. 2022;19(4):540\u0026ndash;53. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41423-022-00841-w\u003c/span\u003e\u003cspan address=\"10.1038/s41423-022-00841-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShan X, Hu P, Ni L, et al. Serine metabolism orchestrates macrophage polarization by regulating the IGF1-p38 axis. Cell Mol Immunol Nov. 2022;19(11):1263\u0026ndash;78. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41423-022-00925-7\u003c/span\u003e\u003cspan address=\"10.1038/s41423-022-00925-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu X, Ren X, Zhou L, et al. Tollip Orchestrates Macrophage Polarization to Alleviate Intestinal Mucosal Inflammation. J Crohns Colitis Aug. 2022;4(7):1151\u0026ndash;67. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/ecco-jcc/jjac019\u003c/span\u003e\u003cspan address=\"10.1093/ecco-jcc/jjac019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKrausgruber T, Blazek K, Smallie T, et al. IRF5 promotes inflammatory macrophage polarization and TH1-TH17 responses. Nat Immunol Mar. 2011;12(3):231\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ni.1990\u003c/span\u003e\u003cspan address=\"10.1038/ni.1990\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFleetwood AJ, Lawrence T, Hamilton JA, Cook AD. Granulocyte-macrophage colony-stimulating factor (CSF) and macrophage CSF-dependent macrophage phenotypes display differences in cytokine profiles and transcription factor activities: implications for CSF blockade in inflammation. J Immunol Apr. 2007;15(8):5245\u0026ndash;52. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4049/jimmunol.178.8.5245\u003c/span\u003e\u003cspan address=\"10.4049/jimmunol.178.8.5245\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHu N, Cai Z, Jiang X, et al. Hypoxia-pretreated ADSC-derived exosome-embedded hydrogels promote angiogenesis and accelerate diabetic wound healing. Acta Biomater Feb. 2023;157:175\u0026ndash;86. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.actbio.2022.11.057\u003c/span\u003e\u003cspan address=\"10.1016/j.actbio.2022.11.057\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang X, Chen S, Lu R, et al. Adipose-derived stem cell-secreted exosomes enhance angiogenesis by promoting macrophage M2 polarization in type 2 diabetic mice with limb ischemia via the JAK/STAT6 pathway. Heliyon Nov. 2022;8(11):e11495. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.heliyon.2022.e11495\u003c/span\u003e\u003cspan address=\"10.1016/j.heliyon.2022.e11495\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJiao Y, Zhang T, Zhang C, et al. Exosomal miR-30d-5p of neutrophils induces M1 macrophage polarization and primes macrophage pyroptosis in sepsis-related acute lung injury. Crit Care Oct. 2021;12(1):356. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13054-021-03775-3\u003c/span\u003e\u003cspan address=\"10.1186/s13054-021-03775-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLai TC, Lee TL, Chang YC, et al. MicroRNA-221/222 Mediates ADSC-Exosome-Induced Cardioprotection Against Ischemia/Reperfusion by Targeting PUMA and ETS-1. Front Cell Dev Biol. 2020;8:569150. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcell.2020.569150\u003c/span\u003e\u003cspan address=\"10.3389/fcell.2020.569150\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSalem M, O'Brien JA, Bernaudo S, et al. miR-590-3p Promotes Ovarian Cancer Growth and Metastasis via a Novel FOXA2-Versican Pathway. Cancer Res Aug. 2018;1(15):4175\u0026ndash;90. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1158/0008-5472.Can-17-3014\u003c/span\u003e\u003cspan address=\"10.1158/0008-5472.Can-17-3014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang F, Zhang H, Wang C. MiR-590-3p regulates cardiomyocyte P19CL6 proliferation, apoptosis and differentiation in vitro by targeting PTPN1 via JNK/STAT/NF-kB pathway. Int J Exp Pathol Dec. 2020;101(6):196\u0026ndash;202. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/iep.12377\u003c/span\u003e\u003cspan address=\"10.1111/iep.12377\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWan Z, Li X, Luo X, Wang B, Zhou X, Chen A. The miR-590-3p/CFHR3/STAT3 signaling pathway promotes cell proliferation and metastasis in hepatocellular carcinoma. Aging (Albany NY) Jul. 2022;18(14):5783\u0026ndash;99. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18632/aging.204178\u003c/span\u003e\u003cspan address=\"10.18632/aging.204178\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang K, Wang X, Sun Y, et al. MiR-590-3p affects the function of adipose-derived stem cells (ADSCs) on the survival of skin flaps by targeting VEGFA. Regen Ther Dec. 2022;21:322\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.reth.2022.07.010\u003c/span\u003e\u003cspan address=\"10.1016/j.reth.2022.07.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTrimm E, Red-Horse K. Vascular endothelial cell development and diversity. Nat Rev Cardiol Mar. 2023;20(3):197\u0026ndash;210. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41569-022-00770-1\u003c/span\u003e\u003cspan address=\"10.1038/s41569-022-00770-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGe X, Tang P, Rong Y, et al. Exosomal miR-155 from M1-polarized macrophages promotes EndoMT and impairs mitochondrial function via activating NF-κB signaling pathway in vascular endothelial cells after traumatic spinal cord injury. Redox Biol May. 2021;41:101932. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.redox.2021.101932\u003c/span\u003e\u003cspan address=\"10.1016/j.redox.2021.101932\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJin Z, Chen S, Wu H, Wang J, Wang L, Gao W. Inhibition of autophagy after perforator flap surgery increases flap survival and angiogenesis. J Surg Res Nov. 2018;231:83\u0026ndash;93. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jss.2018.05.018\u003c/span\u003e\u003cspan address=\"10.1016/j.jss.2018.05.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZeng X, Xie Y, Guo T, et al. Hypoxia-Inducible Factor-1α Potentiates Multiterritory Perforator Flap Survival by Augmenting Vascular Endothelial Growth Factor Expression in the Choke II Zone. Ann Plast Surg Nov. 2024;1(5):624\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/sap.0000000000004122\u003c/span\u003e\u003cspan address=\"10.1097/sap.0000000000004122\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKilkenny C, Browne WJ, Cuthi I, Emerson M, Altman DG. Improving bioscience research reporting: the ARRIVE guidelines for reporting animal research. Vet Clin Pathol Mar. 2012;41(1):27\u0026ndash;31. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1939-165X.2012.00418.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1939-165X.2012.00418.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXing H, Zhang Z, Mao Q, et al. Injectable exosome-functionalized extracellular matrix hydrogel for metabolism balance and pyroptosis regulation in intervertebral disc degeneration. J Nanobiotechnology Sep. 2021;6(1):264. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12951-021-00991-5\u003c/span\u003e\u003cspan address=\"10.1186/s12951-021-00991-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu F, Qiu H, Xue M, et al. MSC-secreted TGF-β regulates lipopolysaccharide-stimulated macrophage M2-like polarization via the Akt/FoxO1 pathway. Stem Cell Res Ther Nov. 2019;26(1):345. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13287-019-1447-y\u003c/span\u003e\u003cspan address=\"10.1186/s13287-019-1447-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXi S, Zhao J, Kang R, et al. The Effects of Angiosome Morphology on Choke Vessels and Flap Necrosis in a Rat Multiterritory Perforator Flap. Ann Plast Surg Oct. 2023;1(4):479\u0026ndash;84. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/sap.0000000000003643\u003c/span\u003e\u003cspan address=\"10.1097/sap.0000000000003643\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eArabpour M, Saghazadeh A, Rezaei N. Anti-inflammatory and M2 macrophage polarization-promoting effect of mesenchymal stem cell-derived exosomes. Int Immunopharmacol Aug. 2021;97:107823. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.intimp.2021.107823\u003c/span\u003e\u003cspan address=\"10.1016/j.intimp.2021.107823\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu W, Yu M, Xie D, et al. Melatonin-stimulated MSC-derived exosomes improve diabetic wound healing through regulating macrophage M1 and M2 polarization by targeting the PTEN/AKT pathway. Stem Cell Res Ther Jun. 2020;29(1):259. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13287-020-01756-x\u003c/span\u003e\u003cspan address=\"10.1186/s13287-020-01756-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNakao Y, Fukuda T, Zhang Q, et al. Exosomes from TNF-α-treated human gingiva-derived MSCs enhance M2 macrophage polarization and inhibit periodontal bone loss. Acta Biomater Mar 1. 2021;122:306\u0026ndash;24. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.actbio.2020.12.046\u003c/span\u003e\u003cspan address=\"10.1016/j.actbio.2020.12.046\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHu J, Jiang Y, Wu X, et al. Exosomal miR-17-5p from adipose-derived mesenchymal stem cells inhibits abdominal aortic aneurysm by suppressing TXNIP-NLRP3 inflammasome. Stem Cell Res Ther Jul. 2022;26(1):349. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13287-022-03037-1\u003c/span\u003e\u003cspan address=\"10.1186/s13287-022-03037-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShi R, Jin Y, Zhao S, Yuan H, Shi J, Zhao H. Hypoxic ADSC-derived exosomes enhance wound healing in diabetic mice via delivery of circ-Snhg11 and induction of M2-like macrophage polarization. Biomed Pharmacother Sep. 2022;153:113463. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biopha.2022.113463\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2022.113463\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDeng S, Zhou X, Ge Z, et al. Exosomes from adipose-derived mesenchymal stem cells ameliorate cardiac damage after myocardial infarction by activating S1P/SK1/S1PR1 signaling and promoting macrophage M2 polarization. Int J Biochem Cell Biol Sep. 2019;114:105564. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biocel.2019.105564\u003c/span\u003e\u003cspan address=\"10.1016/j.biocel.2019.105564\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDeng F, Yan J, Lu J, et al. M2 Macrophage-Derived Exosomal miR-590-3p Attenuates DSS-Induced Mucosal Damage and Promotes Epithelial Repair via the LATS1/YAP/ β-Catenin Signalling Axis. J Crohns Colitis Apr. 2021;6(4):665\u0026ndash;77. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/ecco-jcc/jjaa214\u003c/span\u003e\u003cspan address=\"10.1093/ecco-jcc/jjaa214\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu Y, Gu Y, Shi B. miR-590-3p Alleviates diabetic peripheral neuropathic pain by targeting RAP1A and suppressing infiltration by the T cells. Acta Biochim Pol Dec. 2020;17(4):587\u0026ndash;93. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18388/abp.2020_5451\u003c/span\u003e\u003cspan address=\"10.18388/abp.2020_5451\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuang J, Xu X, Wang X, et al. MicroRNA-590-3p inhibits T helper 17 cells and ameliorates inflammation in lupus mice. Immunology Feb. 2022;165(2):260\u0026ndash;73. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/imm.13434\u003c/span\u003e\u003cspan address=\"10.1111/imm.13434\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMa J, Li YT, Zhang SX, Fu SZ, Ye XZ. MiR-590-3p Attenuates Acute Kidney Injury by Inhibiting Tumor Necrosis Factor Receptor-Associated Factor 6 in Septic Mice. Inflammation Apr. 2019;42(2):637\u0026ndash;49. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10753-018-0921-5\u003c/span\u003e\u003cspan address=\"10.1007/s10753-018-0921-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu T, Xiang Y, Lv Y, Li D, Yu L, Guo R. miR-590-3p mediates the protective effect of curcumin on injured endothelial cells induced by angiotensin II. Am J Transl Res. 2017;9(2):289\u0026ndash;300.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQin Y, Cai ML, Jin HZ, et al. Age-associated B cells contribute to the pathogenesis of rheumatoid arthritis by inducing activation of fibroblast-like synoviocytes via TNF-α-mediated ERK1/2 and JAK-STAT1 pathways. Ann Rheum Dis Nov. 2022;81(11):1504\u0026ndash;14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1136/ard-2022-222605\u003c/span\u003e\u003cspan address=\"10.1136/ard-2022-222605\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLee N, Heo YJ, Choi SE, et al. Anti-inflammatory Effects of Empagliflozin and Gemigliptin on LPS-Stimulated Macrophage via the IKK/NF-κB, MKK7/JNK, and JAK2/STAT1 Signalling Pathways. J Immunol Res. 2021;2021:9944880. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2021/9944880\u003c/span\u003e\u003cspan address=\"10.1155/2021/9944880\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKandhaya-Pillai R, Yang X, Tchkonia T, Martin GM, Kirkland JL, Oshima J. TNF-α/IFN-γ synergy amplifies senescence-associated inflammation and SARS-CoV-2 receptor expression via hyper-activated JAK/STAT1. Aging Cell Jun. 2022;21(6):e13646. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/acel.13646\u003c/span\u003e\u003cspan address=\"10.1111/acel.13646\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIvashkiv LB. IFNγ: signalling, epigenetics and roles in immunity, metabolism, disease and cancer immunotherapy. Nat Rev Immunol Sep. 2018;18(9):545\u0026ndash;58. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41577-018-0029-z\u003c/span\u003e\u003cspan address=\"10.1038/s41577-018-0029-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQin H, Holdbrooks AT, Liu Y, Reynolds SL, Yanagisawa LL, Benveniste EN. SOCS3 deficiency promotes M1 macrophage polarization and inflammation. J Immunol Oct. 2012;1(7):3439\u0026ndash;48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4049/jimmunol.1201168\u003c/span\u003e\u003cspan address=\"10.4049/jimmunol.1201168\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYu T, Gao M, Yang P, et al. Insulin promotes macrophage phenotype transition through PI3K/Akt and PPAR-γ signaling during diabetic wound healing. J Cell Physiol Apr. 2019;234(4):4217\u0026ndash;31. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/jcp.27185\u003c/span\u003e\u003cspan address=\"10.1002/jcp.27185\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu Y, Liu Z, Tang H, et al. The N(6)-methyladenosine (m(6)A)-forming enzyme METTL3 facilitates M1 macrophage polarization through the methylation of STAT1 mRNA. Am J Physiol Cell Physiol Oct. 2019;1(4):C762\u0026ndash;75. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1152/ajpcell.00212.2019\u003c/span\u003e\u003cspan address=\"10.1152/ajpcell.00212.2019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhu X, Guo Q, Zou J, et al. MiR-19a-3p Suppresses M1 Macrophage Polarization by Inhibiting STAT1/IRF1 Pathway. Front Pharmacol. 2021;12:614044. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fphar.2021.614044\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2021.614044\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHao X, Luan J, Jiao C, et al. LNA-anti-miR-150 alleviates renal interstitial fibrosis by reducing pro-inflammatory M1/M2 macrophage polarization. Front Immunol. 2022;13:913007. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2022.913007\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2022.913007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYin Y, Liu B, Cao Y, et al. Colorectal Cancer-Derived Small Extracellular Vesicles Promote Tumor Immune Evasion by Upregulating PD-L1 Expression in Tumor-Associated Macrophages. Adv Sci (Weinh). Mar 2022;9(9):2102620. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/advs.202102620\u003c/span\u003e\u003cspan address=\"10.1002/advs.202102620\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhou J, Li Z, Wu T, Zhao Q, Zhao Q, Cao Y. LncGBP9/miR-34a axis drives macrophages toward a phenotype conducive for spinal cord injury repair via STAT1/STAT6 and SOCS3. J Neuroinflammation Apr. 2020;28(1):134. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12974-020-01805-5\u003c/span\u003e\u003cspan address=\"10.1186/s12974-020-01805-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNing Y, Huang P, Chen G, et al. Atorvastatin-pretreated mesenchymal stem cell-derived extracellular vesicles promote cardiac repair after myocardial infarction via shifting macrophage polarization by targeting microRNA-139-3p/Stat1 pathway. BMC Med Mar. 2023;16(1):96. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12916-023-02778-x\u003c/span\u003e\u003cspan address=\"10.1186/s12916-023-02778-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGe X, Meng Q, Wei L, et al. Myocardial ischemia-reperfusion induced cardiac extracellular vesicles harbour proinflammatory features and aggravate heart injury. J Extracell Vesicles Feb. 2021;10(4):e12072. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/jev2.12072\u003c/span\u003e\u003cspan address=\"10.1002/jev2.12072\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Y, Le X, Zheng S, et al. MicroRNA-146a-5p-modified human umbilical cord mesenchymal stem cells enhance protection against diabetic nephropathy in rats through facilitating M2 macrophage polarization. Stem Cell Res Ther Apr. 2022;27(1):171. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13287-022-02855-7\u003c/span\u003e\u003cspan address=\"10.1186/s13287-022-02855-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJiang T, Sun L, Zhu J, et al. MicroRNA-23a-3p promotes macrophage M1 polarization and aggravates lipopolysaccharide-induced acute lung injury by regulating PLK1/STAT1/STAT3 signalling. Int J Exp Pathol Oct. 2022;103(5):198\u0026ndash;207. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/iep.12445\u003c/span\u003e\u003cspan address=\"10.1111/iep.12445\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBi J, Liu J, Chen X, et al. MiR-155-5p-SOCS1/JAK1/STAT1 participates in hepatic lymphangiogenesis in liver fibrosis and cirrhosis by regulating M1 macrophage polarization. Hum Exp Toxicol Jan-Dec. 2023;42:9603271221141695. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1177/09603271221141695\u003c/span\u003e\u003cspan address=\"10.1177/09603271221141695\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLv Y, Li Y, Wang J, et al. MiR-382-5p suppresses M1 macrophage polarization and inflammatory response in response to bronchopulmonary dysplasia through targeting CDK8: Involving inhibition of STAT1 pathway. Genes Cells Oct. 2021;26(10):772\u0026ndash;81. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/gtc.12883\u003c/span\u003e\u003cspan address=\"10.1111/gtc.12883\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhu X, Liu H, Zhang Z, et al. MiR-103 protects from recurrent spontaneous abortion via inhibiting STAT1 mediated M1 macrophage polarization. Int J Biol Sci. 2020;16(12):2248\u0026ndash;64. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.7150/ijbs.46144\u003c/span\u003e\u003cspan address=\"10.7150/ijbs.46144\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJiang X, Zhou T, Xiao Y, et al. Tim-3 promotes tumor-promoting M2 macrophage polarization by binding to STAT1 and suppressing the STAT1-miR-155 signaling axis. Oncoimmunology. 2016;5(9):e1211219. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/2162402x.2016.1211219\u003c/span\u003e\u003cspan address=\"10.1080/2162402x.2016.1211219\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXi J, Huang Q, Wang L, et al. miR-21 depletion in macrophages promotes tumoricidal polarization and enhances PD-1 immunotherapy. Oncogene Jun. 2018;37(23):3151\u0026ndash;65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41388-018-0178-3\u003c/span\u003e\u003cspan address=\"10.1038/s41388-018-0178-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCai M, Shi Y, Zheng T, et al. Mammary epithelial cell derived exosomal MiR-221 mediates M1 macrophage polarization via SOCS1/STATs to promote inflammatory response. Int Immunopharmacol Jun. 2020;83:106493. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.intimp.2020.106493\u003c/span\u003e\u003cspan address=\"10.1016/j.intimp.2020.106493\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQu B, Liu J, Peng Z, et al. CircSOD2 polarizes macrophages towards the M1 phenotype to alleviate cisplatin resistance in gastric cancer cells by targeting the miR-1296/STAT1 axis. Gene Aug 23. 2023;887:147733. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.gene.2023.147733\u003c/span\u003e\u003cspan address=\"10.1016/j.gene.2023.147733\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang L, Fu Y, Wang H, et al. Severe Fever With Thrombocytopenia Syndrome Virus-Induced Macrophage Differentiation Is Regulated by miR-146. Front Immunol. 2019;10:1095. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2019.01095\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2019.01095\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQiu M, Ma J, Zhang J, Guo X, Liu Q, Yang Z. MicroRNA-150 deficiency accelerates intimal hyperplasia by acting as a novel regulator of macrophage polarization. Life Sci Jan 1. 2020;240:116985. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.lfs.2019.116985\u003c/span\u003e\u003cspan address=\"10.1016/j.lfs.2019.116985\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Y, Mei H, Chang X, Chen F, Zhu Y, Han X. Adipocyte-derived microvesicles from obese mice induce M1 macrophage phenotype through secreted miR-155. J Mol Cell Biol Dec. 2016;8(6):505\u0026ndash;17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/jmcb/mjw040\u003c/span\u003e\u003cspan address=\"10.1093/jmcb/mjw040\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMiranville A, Heeschen C, Sengen\u0026egrave;s C, Curat CA, Busse R, Bouloumi\u0026eacute; A. Improvement of postnatal neovascularization by human adipose tissue-derived stem cells. Circulation Jul. 2004;20(3):349\u0026ndash;55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1161/01.Cir.0000135466.16823.D0\u003c/span\u003e\u003cspan address=\"10.1161/01.Cir.0000135466.16823.D0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEskandari E, Eaves CJ. Paradoxical roles of caspase-3 in regulating cell survival, proliferation, and tumorigenesis. J Cell Biol Jun. 2022;6(6). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1083/jcb.202201159\u003c/span\u003e\u003cspan address=\"10.1083/jcb.202201159\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDas S, Amin SA, Jha T. Inhibitors of gelatinases (MMP-2 and MMP-9) for the management of hematological malignancies. Eur J Med Chem Nov. 2021;5:223:113623. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ejmech.2021.113623\u003c/span\u003e\u003cspan address=\"10.1016/j.ejmech.2021.113623\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu Y, Zhang H, Yan L, et al. MMP-2 and MMP-9 contribute to the angiogenic effect produced by hypoxia/15-HETE in pulmonary endothelial cells. J Mol Cell Cardiol Aug. 2018;121:36\u0026ndash;50. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.yjmcc.2018.06.006\u003c/span\u003e\u003cspan address=\"10.1016/j.yjmcc.2018.06.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ele Noble FAC, Mourad JJ, Levy BI, Struijker-Boudier HAJ. VEGF (Vascular Endothelial Growth Factor) Inhibition and Hypertension: Does Microvascular Rarefaction Play a Role? Hypertension May. 2023;80(5):901\u0026ndash;11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1161/hypertensionaha.122.19427\u003c/span\u003e\u003cspan address=\"10.1161/hypertensionaha.122.19427\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBeheshtizadeh N, Gharibshahian M, Bayati M, et al. Vascular endothelial growth factor (VEGF) delivery approaches in regenerative medicine. Biomed Pharmacother Oct. 2023;166:115301. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biopha.2023.115301\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2023.115301\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi X, Xie X, Lian W, et al. Exosomes from adipose-derived stem cells overexpressing Nrf2 accelerate cutaneous wound healing by promoting vascularization in a diabetic foot ulcer rat model. Exp Mol Med Apr. 2018;13(4):1\u0026ndash;14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s12276-018-0058-5\u003c/span\u003e\u003cspan address=\"10.1038/s12276-018-0058-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShi R, Jin Y, Hu W, et al. Exosomes derived from mmu_circ_0000250-modified adipose-derived mesenchymal stem cells promote wound healing in diabetic mice by inducing miR-128-3p/SIRT1-mediated autophagy. Am J Physiol Cell Physiol. May 2020;1(5):C848\u0026ndash;56. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1152/ajpcell.00041.2020\u003c/span\u003e\u003cspan address=\"10.1152/ajpcell.00041.2020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJi J, Chen D, Ni J, Chang F. Research Advances in Vascular Remodeling in Choke Vessels of Perforator Flap: A Systematic Review. Ann Plast Surg Aug. 2024;1(2):268\u0026ndash;75. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/sap.0000000000003980\u003c/span\u003e\u003cspan address=\"10.1097/sap.0000000000003980\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Vascular proliferation, Macrophage, ADSCs, Exosome, miR-590-3p, Polarization","lastPublishedDoi":"10.21203/rs.3.rs-6987555/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6987555/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e: Adipose-derived stem cell exosomes (ADSCs-Exos) are crucial in macrophage polarization and offer therapeutic potential for enhancing wound healing in perforator flaps. However, the mechanisms through which ADSCs-Exos facilitate wound healing and angiogenesis in these flaps are not fully understood. This study aims to elucidate the role of ADSCs-Exos in modulating macrophage activity and promoting vascularization and tissue repair in perforator flaps.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e:We successfully isolated and confirmed ADSCs exosomes and assessed their effects on macrophage polarization and miR-590-3p expression by co-culturing ADSC-Exos with macrophages.We manipulated the expression of the target gene (miR-590-3p or STAT1) in macrophages to investigate its impact on macrophage polarization. The effects of upregulating or downregulating target genes on endothelial cell proliferation, migration, and angiogenesis were evaluated by co-culturing macrophages with endothelial cells. By applying the supernatant of macrophages with either overexpression or knockdown of the target gene to the SD rat perforator flap model, we investigated the effects of miR-590-3p/STAT1 pathway-mediated macrophage polarization on inflammation and angiogenesis of the perforator flap, and explored the underlying mechanism.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e: We found that miR-590-3p was highly expressed in ADSCs-Exos and promoted M2 macrophage polarization through STAT1, reducing the expression of TNF-αand NOS2 and promoting the expression of Arg-1.By altering the expression of miR-590-3p and STAT1 in macrophages, the study demonstrated enhanced endothelial cell proliferation, migration, and angiogenesis. In a rat perforator flap model, the application of macrophage supernatant with overexpressed or knocked-down target genes showed that ADSC-Exos, mediated by the miR-590-3p/STAT1 pathway, reduced inflammation, improved Choke II vessels, and promoted wound healing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e The study identifies a novel therapeutic mechanism where miR-590-3p in ADSC exosomes regulates the miR-590-3p/STAT1 pathway, leading to reduced inflammation, improved vascularization in perforator flaps, and enhanced wound healing. These findings suggest that ADSCs-Exos could be a promising approach for treating complex wounds, offering new avenues for therapeutic interventions aimed at improving vascularization and tissue repair.\u003c/p\u003e","manuscriptTitle":"Exosomes from adipose derived stem cells improve perforator flap survival through miR-590-3p-mediated M2 macrophage polarization and angiogenesis function","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-18 12:19:10","doi":"10.21203/rs.3.rs-6987555/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e3cc255e-bd64-43bf-8156-868d96626e25","owner":[],"postedDate":"July 18th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-07-30T01:38:27+00:00","versionOfRecord":[],"versionCreatedAt":"2025-07-18 12:19:10","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6987555","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6987555","identity":"rs-6987555","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}