Toxicology Study and MMP-1 and COL1A1 Expression of Malang Green Apple Juice Fermented by Lactobacillus plantarum DAD-13 and Saccharomyces cerevisiae Fermipan on Human Fibroblast: Potential Modality of Anti-aging

Toxicology Study and MMP-1 and COL1A1 Expression of... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research <input type="hidden" id="meta-article-title" value="Toxicology Study and MMP-1 and COL1A1 Expression of Malang Green Apple Juice Fermented by Lactobacillus plantarum DAD-13 and Saccharomyces cerevisiae Fermipan on Human Fibroblast: Potential Modality of Anti-aging" /> { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/14-1226" }, "headline": "Toxicology Study and MMP-1 and COL1A1 Expression of Malang Green Apple Juice Fermented by Lactobacillus...", "datePublished": "2025-11-07T10:39:29", "dateModified": "2025-12-22T15:43:08", "author": [ { "@type": "Person", "name": "Mirna Theresia Eka Wardana" }, { "@type": "Person", "name": "Dyah Ayu Mira Oktarina" }, { "@type": "Person", "name": "Abrory Agus Cahya Pramana" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": " Background Continuous exposure to sunlight and pollution without adequate protection can damage skin, making it prone to premature aging. One of the natural ingredients for anti-aging is antioxidant. Malang green apple (Malus sylvestris Mill) contains bioactive compounds that can act as antioxidants, but its use is still limited to only as food ingredient. Furthermore, some studies show the potency of fruit fermentation to increase these bioactive compounds. Thus, this study is a preliminary study to examine the anti-aging potency of fermented Malang green apples. Methods Human foreskin fibroblasts were treated with fermented Malang green apple juice extract (FAJ) by Lactobacillus plantarum DAD-13 and Saccharomyces cerevisiae Fermipan and its unfermented (AJ) for 24, 48, and 72 hours. Cell viability was measured using the MTT assay and collagen deposition was measured using the Sirius red staining method. The expression of matrix metalloproteinase 1 (MMP-1) and collagen type 1 alpha 1 chain (COL1A1) was measured in fibroblasts after treatment with extracts. Results Cell viability and collagen deposition of fibroblasts tended to be higher after 48 h of extract exposure. Fibroblasts that received FAJ 62.5 μg/mL showed higher cell viability than negative control (p <0.05) and FAJ 31.25 μg/mL showed higher collagen deposition than negative control (p <0.05) at 48 hours of extract exposure. AJ and FAJ also decreased MMP-1 gene expression. They showed a significant decrease in MMP-1 levels (p <0.01) compared to the untreated group, whereas they showed increased expression of COL1A1 at low concentrations. There was no significant difference in the gene expression between FAJ and AJ. Conclusions Our results indicated that Malang green apple juice extract affected fibroblast cell viability, collagen deposition, MMP-1, and COL1A1 gene expression. Better results were obtained at lower concentrations. Exposure of lower concentrations of FAJ to skin fibroblasts for 48 h resulted in better results. " } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/14-1226/v1", "name": "Toxicology Study and MMP-1 and COL1A1 Expression of Malang Green Apple..." } } ] } Home Browse Toxicology Study and MMP-1 and COL1A1 Expression of Malang Green Apple... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Wardana MTE, Oktarina DAM and Pramana AAC. Toxicology Study and MMP-1 and COL1A1 Expression of Malang Green Apple Juice Fermented by Lactobacillus plantarum DAD-13 and Saccharomyces cerevisiae Fermipan on Human Fibroblast: Potential Modality of Anti-aging [version 1; peer review: awaiting peer review] . F1000Research 2025, 14 :1226 ( https://doi.org/10.12688/f1000research.166528.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Research Article Toxicology Study and MMP-1 and COL1A1 Expression of Malang Green Apple Juice Fermented by Lactobacillus plantarum DAD-13 and Saccharomyces cerevisiae Fermipan on Human Fibroblast: Potential Modality of Anti-aging [version 1; peer review: awaiting peer review] Mirna Theresia Eka Wardana https://orcid.org/0009-0002-0004-2588 1 , Dyah Ayu Mira Oktarina https://orcid.org/0000-0002-5723-2051 2 , Abrory Agus Cahya Pramana 3 Mirna Theresia Eka Wardana https://orcid.org/0009-0002-0004-2588 1 , Dyah Ayu Mira Oktarina https://orcid.org/0000-0002-5723-2051 2 , Abrory Agus Cahya Pramana 3 PUBLISHED 07 Nov 2025 Author details Author details 1 Faculty of Medicine, Public Health, and Nursing, Universitas Gadjah Mada, Yogyakarta, Special Region of Yogyakarta, Indonesia 2 Department of Dermatology and Venereology, Faculty of Medicine, Public Health, and Nursing, Universitas Gadjah Mada, Yogyakarta, Special Region of Yogyakarta, Indonesia 3 Department of Biochemistry, Faculty of Medicine, Public Health, and Nursing, Universitas Gadjah Mada, Yogyakarta, Special Region of Yogyakarta, Indonesia Mirna Theresia Eka Wardana Roles: Data Curation, Formal Analysis, Investigation, Writing – Original Draft Preparation Dyah Ayu Mira Oktarina Roles: Conceptualization, Funding Acquisition, Resources, Supervision Abrory Agus Cahya Pramana Roles: Methodology, Writing – Review & Editing OPEN PEER REVIEW DETAILS REVIEWER STATUS This article is included in the Plant Science gateway. This article is included in the Advances in Fibroblast Research collection. Abstract Background Continuous exposure to sunlight and pollution without adequate protection can damage skin, making it prone to premature aging. One of the natural ingredients for anti-aging is antioxidant. Malang green apple ( Malus sylvestris Mill) contains bioactive compounds that can act as antioxidants, but its use is still limited to only as food ingredient. Furthermore, some studies show the potency of fruit fermentation to increase these bioactive compounds. Thus, this study is a preliminary study to examine the anti-aging potency of fermented Malang green apples. Methods Human foreskin fibroblasts were treated with fermented Malang green apple juice extract (FAJ) by Lactobacillus plantarum DAD-13 and Saccharomyces cerevisiae Fermipan and its unfermented (AJ) for 24, 48, and 72 hours. Cell viability was measured using the MTT assay and collagen deposition was measured using the Sirius red staining method. The expression of matrix metalloproteinase 1 (MMP-1) and collagen type 1 alpha 1 chain (COL1A1) was measured in fibroblasts after treatment with extracts. Results Cell viability and collagen deposition of fibroblasts tended to be higher after 48 h of extract exposure. Fibroblasts that received FAJ 62.5 μg/mL showed higher cell viability than negative control (p <0.05) and FAJ 31.25 μg/mL showed higher collagen deposition than negative control (p <0.05) at 48 hours of extract exposure. AJ and FAJ also decreased MMP-1 gene expression. They showed a significant decrease in MMP-1 levels (p <0.01) compared to the untreated group, whereas they showed increased expression of COL1A1 at low concentrations. There was no significant difference in the gene expression between FAJ and AJ. Conclusions Our results indicated that Malang green apple juice extract affected fibroblast cell viability, collagen deposition, MMP-1, and COL1A1 gene expression. Better results were obtained at lower concentrations. Exposure of lower concentrations of FAJ to skin fibroblasts for 48 h resulted in better results. READ ALL READ LESS Keywords Malang green apple juice, fermentation, anti-aging, MMP-1, COL1A1, Lactobacillus plantarum, Saccharomyces cerevisiae Corresponding Author(s) Dyah Ayu Mira Oktarina ( [email protected] ) Close Corresponding author: Dyah Ayu Mira Oktarina Competing interests: No competing interests were disclosed. Grant information: This study was funded by the Faculty of Medicine, Public Health, and Nursing, Gadjah Mada University under the program “Hibah Dana Masyarakat (DAMAS)”. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2025 Wardana MTE et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Wardana MTE, Oktarina DAM and Pramana AAC. Toxicology Study and MMP-1 and COL1A1 Expression of Malang Green Apple Juice Fermented by Lactobacillus plantarum DAD-13 and Saccharomyces cerevisiae Fermipan on Human Fibroblast: Potential Modality of Anti-aging [version 1; peer review: awaiting peer review] . F1000Research 2025, 14 :1226 ( https://doi.org/10.12688/f1000research.166528.1 ) First published: 07 Nov 2025, 14 :1226 ( https://doi.org/10.12688/f1000research.166528.1 ) Latest published: 22 Dec 2025, 14 :1226 ( https://doi.org/10.12688/f1000research.166528.2 )  There is a newer version of this article available. Suppress this message for one day. Introduction Aging is a naturally occurring biological process that differs among individuals. 1 Given its feature as the outermost part of the human body, signs of aging in the skin are more noticeable by the human eye than in other organs. 1 , 2 Skin aging can be divided into intrinsic and extrinsic aging. 3 , 4 Intrinsic aging is a physiological process characterized by a progressive decline in body functions. 3 , 5 On the other hand, extrinsic aging is estimated to be the cause of 80% of all signs of aging, and is caused by a multitude of factors, including UV exposure, air pollution, and lifestyle factors such as diet and smoking. 6 Ultraviolet irradiation causes damage to fibroblasts by reducing collagen synthesis, increasing the rate of its breakdown, promoting oxidative stress, and increasing the content of matrix metalloproteinases (MMP) that help break down collagen. 7 Various types of MMPs are responsible for pathophysiological processes, not only limited to aging; however, MMP-1 degrades type I and III collagen, where collagen is responsible for the elasticity and strength of the skin. 8 Ingredients with anti-aging effects can inhibit the aging process. The use of materials with antioxidants is one way to prevent aging by reducing and neutralizing reactive oxygen species (ROS). 4 , 5 , 9 , 10 Antioxidants can be obtained from natural ingredients such as fruits and vegetables, including apples. 11 Green apples contain catechins, vitamin C, quercetin, tocopherols, and carotenoids. 12 , 13 The Malang green apple ( Malus sylvestris mill) contains a high amount of quercetin, a natural antioxidant. 14 Thus, Malang green apple has the potential to be developed as an anti-aging ingredient. Unfortunately, Malang green apple is limited to food processing. On the other hand, fermentation can increase a material’s bioactive compounds. Fermentation by lactic acid bacteria in fruits has been shown to increase their antioxidant activity. 15 Thus, in this study, we investigated the effect of the fermentation process in Malang green apple juice, especially the green apple variety from Malang, Indonesia on cell viability and collagen deposition in skin fibroblasts. We also assessed MMP-1 expression in treated fibroblast cells. We hope that this research can add more benefit value to Malang green apple as a potential anti-aging ingredient. Methods Study design This was an in vitro experimental study. This study was conducted by the Department of Dermatology and Venereology in collaboration with the Department of Biochemistry, Faculty of Medicine, Public Health, and Nursing, Gadjah Mada University. Study procedure 1. Green apple juice making and pasteurization Malang green apple were obtained from a traditional market in Malang, Indonesia. Green apple juice 70% (w:v) was prepared by adding 10 mL of 0.05 M citric acid and 10 ml of 100 mg/mL ascorbic acid to green apple slices that had previously been sprayed with 0.05 M citric acid. The addition of an acidifying agent can prevent enzymatic browning by reducing pH. 13 It was crushed with a blender, filtered, and pasteurized at 105 °C in an autoclave for 1 minute. 2. Green apple juice fermentation Pasteurized Malang green apple juice was fermented with 1.8% (v:v) Lactobacillus plantarum DAD-13 + 1.8% (v:v) Saccharomyces cerevisiae Fermipan for 1 day at 37 °C. 3. Green apple juice extraction Fermented and non-fermented Malang green apple juice is added with ethyl acetate at a ratio of 1:1 (v:v) and macerated for 1 day. The ethyl acetate layer was extracted again using ethyl acetate. The filtrate was evaporated on evaporation porcelain and then transferred to a glass vial (dried in an oven at 45 °C) to obtain fermented and non-fermented Malang green apple juice extracts. 4. Cell culture Fibroblast cell lines were obtained from human foreskin. The growth process of fibroblast cell lines was conducted in the Laboratory of Dermatology Venerology, Department of Dermatology and Venereology, Faculty of Medicine, Public Health, and Nursing, Gadjah Mada University. Fibroblast cell lines were grown in Dulbecco’s modification of Eagle’s medium (DMEM, Gibco ® , USA) supplemented with 1 ml 1% penicillin-streptomycin (Gibco ® , USA) and 1 ml amphotericin B. Cells were incubated in an incubator at 37 °C and 5% CO 2 . 5. Cell viability with MTT assay To conduct a cytotoxicity test on the fibroblast cell lines, the medium was aspirated and the cells were washed with phosphate-buffered saline (PBS). The cells were then separated by trypsin (Gibco ® , USA). Trypsin was inactivated in DMEM after 4 minutes, and the detached cells were centrifuged for 10 minutes at 2000 rpm. The cells were counted and plated the cells in 96-well plates (100 μL solution per well contained 10.000 cells/well). The fibroblast cell lines were incubated for 24 hours (37 °C, 5% CO 2 ). The next day, the cells were treated with fermented green apple juice extract and unfermented green apple extract at various concentrations ranging from 15.826 μg/mL to 1000 μg/mL. The 96-well plates were then incubated overnight. After incubation, the medium in each well was aspirated, and 100 μL of MTT was added to create formazan. 16 After 4 hours of incubation and formation of formazan, a stopper of 100 L SDS 10% in 0.1 N HCl was added and incubated overnight in the dark. The intensity of the purple color was measured using an ELISA reader at a wavelength of 595 nm. 6. Collagen deposition Collagen deposition in fibroblasts was determined according to the method proposed by 17 with some modifications. Fibroblasts (10.000 cells/well) treated with the extracts were incubated for 24, 48, or 72 hours. After incubation, the medium was aspirated, and the cells were washed twice with PBS. Bouin’s solution (100 μL) was added to each well and allowed to stand for 1 hour in the dark. Bouin’s solution was rinsed with deionized water until the yellow color disappeared and was left overnight. The wells were filled with Sirius red stain (100 μL per well), and the 96-well plate was shaken for 1 hour. Give 0.01 N HCl, followed by 0.5 N HCl, and then shake the well for 30 minutes. The absorbance was read using an ELISA reader at 550 nm. 7. MMP-1 and COL1A1 quantification Ribonucleic acid (RNA) was isolated from fibroblast cells using PRImeZOL TM reagent (RNA isolation reagent) according to the manufacturer’s instructions (Canvax, America). The cells were homogenized with the reagent. The supernatant from the sample was separated by adding 0.2 mL of chloroform per 1 mL of the reagent. After that, it was centrifuged for 15 minutes at 12000 rpm. The aqueous layer, containing RNA, was transferred to a different tube and precipitated with cold 70% isopropyl alcohol, followed by incubation at room temperature. Then, the sample was centrifuged at 12000 rpm for 10 minutes at 4°C to obtain RNA pellet. Pellet was washed with 75% ethanol and then vortexed and centrifuged at 7500 rpm for 5 minutes at 4 °C. The RNA pellet was dissolved with nuclease-free water (NFW) and incubated at 60°C for 5 minutes. Isolated RNA was stored at -20 °C. The isolated RNA was then subjected to complementary deoxyribonucleic acid (cDNA) preparation process according to the manufacturer’s instructions (SMOBio). Isolated RNA was mixed with 1μL of oligo (dT), and 10μL Diethyl pyrocarbonate (DEPC)-treated H 2 O, spun down, and incubated at 70 °C for 5 minutes, mixed again with a cDNA synthesis mixture consists of 4μL 5-RTX buffer, 5μL DEPC treated H2O, and 1μL RT-ase, and then incubated to make cDNA. The cDNA samples were diluted from 100ng/mL to 50ng/mL, 20μL of the sample was taken and added into 20μL of NFW, mixed by up and down method. The polymerase chain reaction (PCR) master mix was prepared by adding 10μL of the master mix, 0.8μL of the forward primer, 0.8μL of the reverse primer, 4.4 μL of NFW. Primers used were obtained from Integrated DNA Technologies (IDT), and the primer sequences are listed in Table 1 . The 16μL of the PCR mix was mixed with 4μL of the sample. The results of the samples were read using a Bio-Rad thermocycler. Table 1. Primer sequences for Beta Actin (ACTB) and MMP-1 gene. Gene Primer Sequence ACTB Forward 5′TTCTCTGACCTGAGTCTCCTT3′ Reverse 5′ACACCCACAACACTGTCTTAG3′ MMP-1 Forward 5′TTCCGCCTGTCTCAAGATGATAT3′ Reverse 5′AAAGGACAAAGCAGGATCACAGTT3′ Data analysis Cell viability and collagen deposition data were analyzed using two-way analysis of variance (ANOVA) and Dunnett’s test for post hoc analysis. MMP-1 gene expression was analyzed using one-way ANOVA. Data analysis was done using SPSS while GraphPad Prism 9.3.0 were utilized to make a graph. For all tests, statistical significance was defined as p < 0.05. Results Cell viability with MTT assay The effect of FAJ on fibroblast cell line viability was compared with that of the fibroblast cell line that received AJ after cells were exposed to the extract for 24, 48, and 72 hours ( Figure 1 ). The analysis of the fibroblast cell line showed a significant effect between different types of extracts (FAJ and AJ) and cell viability at 48 and 72 hours of extract exposure, while the variation of extract concentration from 15.625 μg/mL to 1000 μg/mL had a significant effect on cell viability after 24 and 72 hours of extract exposure (p < 0.05). The viability of fibroblasts receiving FAJ was higher than that of fibroblasts receiving AJ on 24-hour extract exposure, except at the concentration of 62.5 μg/mL, but it was not statistically significant. In the 24-hour extract exposure group, fibroblasts receiving FAJ and AJ 1000 μg/mL showed higher cell viability than the negative control. This pattern changed on 48-hour extract exposure. Fibroblasts receiving AJ at 125-500 μg/mL concentration and FAJ at 15.625 and 62.5 μg/mL concentration showed higher cell viability than the negative control (p < 0.05). The cell viability in FAJ was higher than that in AJ at 15.625 and 62.5 μg/mL. After receiving its peak at 48-hour extract exposure, cell viability decreased at 72-hour extract exposure. Cell viability in the fibroblast group of FAJ at the concentration of 15.625 – 31.25 μg/mL and 1000 μg/mL (72 hours) was lower than negative control (p < 0.05). Figure 1. Effect of JA and FAJ extract on fibroblasts cell viability. Cell line received various concentrations of JA and FAJ extracts for (A) 24 hours; (B) 48 hours; (C) 72 hours determined by MTT assay. The error bars depict mean values ± SD from triplicate experiments. The significance of difference was set to *p<0.05 , **p<0.01 , and ***p<0.001 compared with non-treated fibroblasts cell line. Collagen deposition The effect of FAJ on fibroblast collagen deposition was compared with that of the fibroblast cell line that received AJ after cells were exposed to the extract for 24, 48, and 72 hours. Overall, the collagen deposition ratio ( Figure 2 ) showed the same pattern as cell viability, which increased up to 48 hours and decreased after 72 hours of extract exposure, except in the fibroblasts group that received AJ 250-1000 μg/mL. The analysis carried out on the data showed that the duration of extract exposure (24, 48, and 72 hours) and variation of extract from 15.625 to 1000 μg/mL had a significant effect on the collagen deposition ratio, while different types of extracts had a significant effect on the collagen deposition ratio after 24 and 72 hours extract exposure. The collagen deposition ratio in fibroblasts receiving FAJ at a concentration of 31.25 μg/mL and AJ at 62.5 μg/mL for 24 and 48 hours was higher than that in the negative control (p < 0.05). Figure 2. Effect of JA and FAJ extract on collagen deposition in fibroblasts. Cell line received various concentrations of JA and FAJ extracts for (A) 24 hours; (B) 48 hours; (C) 72 hours. The error bars depict mean values ± SD from triplicate experiments. The significance was set to *p<0.05 , **p<0.01 , and ***p<0.001 , compared with non-treated fibroblasts cell line. MMP-1 and COL1A1 levels MMP-1 gene expression ( Figure 3 ) in fibroblasts treated with FAJ and AJ at concentrations of 31.25, 62.5, and 125 μg/mL for 48 hours showed significant downregulation relative to that in the control (p < 0.05). MMP-1 levels in the FAJ group at concentrations of 31.25, 62.5, and 125 μg/mL decreased by 89.02%, 89.63%, and 94.6%, respectively, compared to the control group, whereas in the AJ group, it decreased by 88.62%, 91.2%, and 86.6%, respectively, compared to the levels of MMP-1 in fibroblasts not treated with any extract. There were no significant differences in MMP-1 levels between AJ and FAJ. COL1A1 expression ( Figure 4 ) also exhibited a dose-dependent pattern, with higher concentrations of AJ and FAJ showing lower COL1A1 expression. COL1A1 levels in the FAJ group at concentrations of 31.25 and 62.5 μg/mL increased by 30% and 4%, respectively, compared to the control, whereas it decreased by 17% at a concentration of 125 μg/mL. In the AJ group, COL1A1 levels at concentrations of 31.25 and 62.5 μg/mL increased by 47% and 42%, respectively, compared to the control group, whereas it decreased by 12% at a concentration of 125 μg/mL. The changes in COL1A1 levels in both the AJ and FAJ groups were not statistically significant (p > 0.05). Figure 3. Expression of MMP-1 on fibroblasts treated with JA and FJA extract. The significance was set to *p<0.05 , **p<0.01 , and ***p<0.001 , compared with control. Figure 4. Expression of COL1A1 on fibroblasts treated with JA and FJA extract. The significance was set to *p<0.05 , **p<0.01 , and ***p<0.001 , compared with control. Discussion Our study conducted a toxicity study on fibroblasts receiving extracts from fermented and unfermented Malang green apple juice. We also conduct a study to know the expression of MMP-1 and COL1A1. In our study, exposure of human skin fibroblast to FAJ and AJ affected cell viability and collagen deposition. Fibroblasts that received FAJ and AJ showed an increase in cell viability along with increasing extract concentration at 24 hours exposure to FAJ 1000 μg/mL, which showed the highest increase compared to the negative control. However, this pattern changed after 48 hours of exposure. Fibroblasts that received low concentration of FAJ showed higher cell viability than those that received high concentration of FAJ, with a decrease starting at 62.5 μg/mL. In the AJ group, the pattern after 48 hours of exposure remained the same with 24 hours exposure group. Fibroblasts that received a low concentration of FAJ also showed higher collagen proliferation than those that received high concentrations. The results of cell viability and collagen deposition were also reflected by MMP-1 and COL1A1 expression. Low concentrations of FAJ and AJ increased COL1A1 expression compared to untreated cells one and decreased COL1A1 expression at 125 μg/mL, although the change was not statistically significant. FAJ and AJ also decreased MMP-1 expression in a dose-dependent pattern, indicating that this extract can inhibit one of the genes that control collagen degradation. However, the decrease in MMP-1 levels at 125 μg/mL, which is too strong, and the decrease in COL1A1 levels at the same concentration might indicate a decrease in living fibroblasts. Fibroblasts dominate the dermis. 18 These cells play important roles in the formation and repair of skin components by producing collagen and extracellular matrix. 19 Fibroblasts are skin cell types that have been widely used in in vitro research to determine the effect of exposure to certain extracts exposure before being tested on skin tissue. 20 The fermentation process carried out on green apple juice could increase the bioactive compounds contained in apple juice, especially compounds that with antioxidant activity. Antioxidants play a role in neutralizing the effects of reactive oxygen species (ROS) such that they do not cause damage and aging in cells. 21 Several previous studies have demonstrated the effect of fermentation on increasing antioxidant activity by increasing total phenol, anthocyanin, and flavonoid content, especially myricetin and quercetin 22 , 23 as well as increasing the biological activity of polyphenols. 24 Quercetin present in green apples has antioxidant activity that increases the lifetime and viability of fibroblasts. 25 Flavonoids and polyphenols contained in apples are also predicted to protect cells from oxidative stress and increase cell viability. 26 In addition, polysaccharides produced by lactobacilli can increase cell proliferation because of their effect on fibroblast growth factors. 27 The higher collagen deposition ratio in the extract group than in the negative control was in accordance with previous studies. Fermentation of fruit and vegetable drinks using Saccharomyces cerevisiae and Streptococcus thermophilus TCI125 could increase collagen levels. 28 The fermented extract can increase collagen levels, especially collagen type 1, by inhibiting mRNA expression and collagenase production. 29 Phenolic compounds found in apples can inhibit collagen degradation by inhibiting matrix metalloproteinase 1 (MMP-1) and these compounds also prevent cell damage from free radicals. 30 Collagen, especially type I collagen, is the most abundant protein in skin connective tissue and is responsible for maintaining skin structure. 31 Reduction in fibroblasts and collagen fragmentation due to chronological age or ultraviolet radiation can disturb skin elasticity and cause damage to the skin. 32 , 33 Increased production of MMP-1 caused by exposure to intrinsic and extrinsic factors is strongly related to collagen fragmentation, therefore, a decrease in its production may correlate with collagen increase and later have an anti-aging effect. 32 , 34 Several previous studies have shown that fermented extract can decrease the expression of MMP-1. 35 , 36 In our study, both Green Malang apple juice extracts significantly inhibited the expression of MMP-1. This indicates that FAJ and AJ exert anti-aging properties by decreasing one of the main causes of collagen degradation. Our study showed better results with low FAJ concentrations. This may have been caused by some factors. First, the antioxidant activity of the FAJ extract reached its maximum activity, thus reducing the antioxidant efficacy. 37 The decrease in antioxidant activity due to the fermentation process has been shown by a decrease in total phenol content in strawberry fermentation due to anthocyanin condensation. 38 Red cabbage fermentation using Lactobacillus.acidophilus and Lactobacillus plantarum caused a decrease in anthocyanin content and total phenolic content after 7 days of fermentation. 39 Two, the fermentation process of green apple juice increased the acidity of the extract, which can negatively impact the fibroblasts. Saccharomyces cerevisiae and Lactobacillus plantarum can further decrease the pH of the juice more than a single fermentation. 40 Fibroblasts in an acidic environment (pH 5.5) showed lower proliferation activity than those in a neutral or base environment. 41 Three, the formation of pro-oxidant activity. A previous study showed that papierowka apple peel extract had a high polyphenol content and high pro-oxidant activity because phenolic components could also initiate the formation of ROS. 23 Overall, changes in the phenolic components that play a role in antioxidant components and activity are influenced by the probiotic strain, fermentation temperature, fermentation substrate, and fermentation period. 42 – 44 This study provides preliminary information on the effects of the fermentation process of local green apple juice from Malang, Indonesia on normal skin fibroblasts. Malang green apple juice (fermented and unfermented) affected cell viability, collagen deposition, and MMP-1 and COL1A1 levels in the skin fibroblasts. Exposure of skin fibroblast to fermented Malang green apple juice at low concentrations for 48 hours gave better results than exposure to high concentrations, given that the high concentration might undergo increased pH level, decreased antioxidant activity over time, or pro-oxidant activity. Our study was limited by the absence of high-performance liquid chromatography (HPLC) data to analyze the type and amount of compounds in FAJ, the pH value before and after fermentation, antioxidant activity, and the effect of different probiotic strains, temperature, and fermentation time on cell viability and collagen deposition in normal fibroblasts. Ethical considerations Ethical approval for this study was approved by the Ethics Committee of the Faculty of Medicine, Public Health, and Nursing, Universitas Gadjah Mada, with reference number KE/FK/0143/EC/2022 on February 9th 2022. Reporting guidelines Figshare: Dataset for ‘Toxicology Study and MMP-1 and COL1A1 Expression of Malang Green Apple Juice Fermented by Lactobacillus plantarum DAD-13 and Saccharomyces cerevisiae Fermipan on Human Fibroblast: Potential Modality of Anti-aging’, https://doi.org/10.6084/m9.figshare.28233320.v3 . Data availability Underlying data Figshare: Toxicology Study and MMP-1 and COL1A1 Expression of Malang Green Apple Juice Fermented by Lactobacillus plantarum DAD-13 and Saccharomyces cerevisiae Fermipan on Human Fibroblast: Potential Modality of Anti-aging. https://doi.org/10.6084/m9.figshare.28233320.v3 . 45 This project contains the following underlying data: • Data file 1: Datasets Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0). Extended data No extended data are associated with this article. Acknowledgements The authors extend their gratitude to the Department of Dermatology and Venereology and the Department of Biochemistry at the Faculty of Medicine, Public Health, and Nursing, Universitas Gadjah Mada, Yogyakarta for making this study a success. References 1. Jang JD, Kim M, Nam GH, et al. : Antiaging Activity of Peptide Identified from Fermented Trapa Japonica Fruit Extract in Human Dermal Fibroblasts. Evid-Based Complement Altern. Med. ECAM. 2020; 2020 : 5895029. PubMed Abstract | Publisher Full Text | Free Full Text 2. Garza L: Developmental Biology of the Skin. In: Fitzpatrick’s Dermatology.2019 [cited 2022 Jan 2]; 9e. Reference Source 3. de Araújo R , Lôbo M, Trindade K, et al. : Fibroblast Growth Factors: A Controlling Mechanism of Skin Aging. Skin Pharmacol. Physiol. 2019; 32 (5): 275–282. PubMed Abstract | Publisher Full Text 4. Zhang S, Duan E: Fighting against Skin Aging: The Way from Bench to Bedside. Cell Transplant. 2018 May; 27 (5): 729–738. PubMed Abstract | Publisher Full Text | Free Full Text 5. Bosch R, Philips N, Suárez-Pérez JA, et al. : Mechanisms of Photoaging and Cutaneous Photocarcinogenesis, and Photoprotective Strategies with Phytochemicals. Antioxid. Basel Switz. 2015 Mar 26; 4 (2): 248–268. PubMed Abstract | Publisher Full Text | Free Full Text 6. Rodan K, Fields K, Majewski G, et al. : Skincare Bootcamp: The Evolving Role of Skincare. Plast. Reconstr. Surg. Glob. Open. 2016 Dec; 4 (12 Suppl Anatomy and Safety in Cosmetic Medicine: Cosmetic Bootcamp): e1152. PubMed Abstract | Publisher Full Text | Free Full Text 7. Yamaba H, Haba M, Kunita M, et al. : Morphological change of skin fibroblasts induced by UV Irradiation is involved in photoaging. Exp. Dermatol. 2016 Aug; 25 (Suppl 3): 45–51. PubMed Abstract | Publisher Full Text 8. Bonté F, Girard D, Archambault JC, et al. : Skin Changes During Ageing. Subcell. Biochem. 2019; 91 : 249–280. Publisher Full Text 9. Petruk G, Del Giudice R, Rigano MM, et al. : Antioxidants from Plants Protect against Skin Photoaging. Oxidative Med. Cell. Longev. 2018; 2018 : 1454936. PubMed Abstract | Publisher Full Text | Free Full Text 10. Zouboulis CC, Ganceviciene R, Liakou AI, et al. : Aesthetic aspects of skin aging, prevention, and local treatment. Clin. Dermatol. 2019; 37 (4): 365–372. PubMed Abstract | Publisher Full Text 11. Cömert ED, Mogol BA, Gökmen V: Relationship between color and antioxidant capacity of fruits and vegetables. Curr. Res. Food Sci. 2020 Jun 1; 2 : 1–10. PubMed Abstract | Publisher Full Text | Free Full Text 12. Park S, Lim W, Bazer FW, et al. : Quercetin inhibits proliferation of endometriosis regulating cyclin D1 and its target microRNAs in vitro and in vivo. J. Nutr. Biochem. 2019 Jan; 63 : 87–100. PubMed Abstract | Publisher Full Text 13. Shafi W, Mansoor S, Jan S, et al. : Variability in Catechin and Rutin Contents and Their Antioxidant Potential in Diverse Apple Genotypes. Mol. Basel Switz. 2019 Mar 7; 24 (5): 943. Publisher Full Text 14. Rahmawati VA, Ramadon D, Anwar E, et al. : Formulation and in vitro Penetration Test of Ethosomal Gel Extract of Malang Apple Peel (Malus sylvestris Mill) Dosage Form Contain Quercetin. Pullman Raja Orchid Hotel, Khon Kaen, Thailand. 2016 [cited 2025 Jan 21]. Reference Source 15. Das G, Paramithiotis S, Sundaram Sivamaruthi B, et al. : Traditional fermented foods with anti-aging effect: A concentric review. Food Res. Int. 2020 Aug 1; 134 : 109269. PubMed Abstract | Publisher Full Text 16. Tolosa L, Donato MT, Gómez-Lechón MJ: General Cytotoxicity Assessment by Means of the MTT Assay. Methods Mol. Biol. Clifton NJ. 2015; 1250 : 333–348. PubMed Abstract | Publisher Full Text 17. Arriola Benitez PC, Scian R, Comerci DJ, et al. : Brucella abortus Induces Collagen Deposition and MMP-9 Down-Modulation in Hepatic Stellate Cells via TGF-β1 Production. Am. J. Pathol. 2013 Dec 1; 183 (6): 1918–1927. PubMed Abstract | Publisher Full Text 18. Tracy LE, Minasian RA, Caterson EJ: Extracellular Matrix and Dermal Fibroblast Function in the Healing Wound. Adv. Wound Care. 2016 Mar 1; 5 (3): 119–136. PubMed Abstract | Publisher Full Text | Free Full Text 19. Barbieri JS, Wanat K, Seykora J: Skin: Basic Structure and Function.McManus LM, Mitchell RN, editors. Pathobiology of Human Disease. San Diego: Academic Press; 2014 [cited 2025 Jan 21]; pp. 1134–1144. Reference Source 20. Fernandes IR, Russo FB, Pignatari GC, et al. : Fibroblast sources: Where can we get them? Cytotechnology. 2016 Mar; 68 (2): 223–228. PubMed Abstract | Publisher Full Text | Free Full Text 21. Addor FAS: Antioxidants in dermatology. An. Bras. Dermatol. 2017; 92 (3): 356–362. PubMed Abstract | Publisher Full Text | Free Full Text 22. Curiel JA, Pinto D, Marzani B, et al. : Lactic acid fermentation as a tool to enhance the antioxidant properties of Myrtus communis berries. Microb. Cell Factories. 2015 May 7; 14 : 67. PubMed Abstract | Publisher Full Text | Free Full Text 23. Li H, Huang J, Wang Y, et al. : Study on the nutritional characteristics and antioxidant activity of dealcoholized sequentially fermented apple juice with Saccharomyces cerevisiae and Lactobacillus plantarum fermentation. Food Chem. 2021 Nov 30; 363 : 130351. PubMed Abstract | Publisher Full Text 24. Zhang S, Hu C, Guo Y, et al. : Polyphenols in fermented apple juice: Beneficial effects on human health. J. Funct. Foods. 2021 Jan 1; 76 : 104294. Publisher Full Text 25. Chondrogianni N, Kapeta S, Chinou I, et al. : Anti-ageing and rejuvenating effects of quercetin. Exp. Gerontol. 2010 Oct; 45 (10): 763–771. PubMed Abstract | Publisher Full Text 26. Nurulita NA, Kusuma AM, Darsini D, et al. : The Cytoprotective and Cell Recovery Properties of Apple Extracts on H2O2 induced-NIH3T3 Cells: An Anti Aging Candidate. Indones. J. Cancer Chemoprevention. 2018 Jul 3; 9 (2): 78–85. Publisher Full Text 27. Shirzad M, Hamedi J, Motevaseli E, et al. : Anti-elastase and anti-collagenase potential of Lactobacilli exopolysaccharides on human fibroblast. Artif. Cells Nanomedicine Biotechnol. 2018; 46 (sup1): 1051–1061. PubMed Abstract | Publisher Full Text 28. Chan LP, Tseng YP, Liu C, et al. : Anti-oxidant and Anti-aging Activities of Fermented Vegetable-Fruit Drink. J. Food Nutr. Res. 2021; 9 (5): 240–250. Publisher Full Text 29. Kang YM, Hong CH, Kang SH, et al. : Anti-Photoaging Effect of Plant Extract Fermented with Lactobacillus buchneri on CCD-986sk Fibroblasts and HaCaT Keratinocytes. J. Funct. Biomater. 2020 Jan 9; 11 (1): 3. PubMed Abstract | Publisher Full Text | Free Full Text 30. Taofiq O, González-Paramás AM, Barreiro MF, et al. : Hydroxycinnamic Acids and Their Derivatives: Cosmeceutical Significance, Challenges and Future Perspectives, a Review. Mol. J. Synth. Chem. Nat. Prod. Chem. 2017 Feb 13; 22 (2): 281. Publisher Full Text 31. Ivarsson M, McWhirter A, Borg TK, et al. : Type I collagen synthesis in cultured human fibroblasts: Regulation by cell spreading, platelet-derived growth factor and interactions with collagen fibers. Matrix Biol. 1998 Feb 1; 16 (7): 409–425. PubMed Abstract | Publisher Full Text 32. Fligiel SEG, Varani J, Datta SC, et al. : Collagen Degradation in Aged/Photodamaged Skin In Vivo and After Exposure to Matrix Metalloproteinase-1 In Vitro. J. Invest. Dermatol. 2003 May 1; 120 (5): 842–848. PubMed Abstract | Publisher Full Text 33. Varani J, Dame MK, Rittie L, et al. : Decreased collagen production in chronologically aged skin: roles of age-dependent alteration in fibroblast function and defective mechanical stimulation. Am. J. Pathol. 2006 Jun; 168 (6): 1861–1868. PubMed Abstract | Publisher Full Text | Free Full Text 34. Rittié L, Fisher GJ: Natural and sun-induced aging of human skin. Cold Spring Harb. Perspect. Med. 2015 Jan 5; 5 (1): a015370. PubMed Abstract | Publisher Full Text | Free Full Text 35. Pham QL, Jang HJ, Kim KB: Anti-wrinkle effect of fermented black ginseng on human fibroblasts. Int. J. Mol. Med. 2017 Mar; 39 (3): 681–686. PubMed Abstract | Publisher Full Text 36. Ro HS, Jang HJ, Kim GR, et al. : Enhancement of the Anti-Skin Wrinkling Effects of Aloe arborescens Miller Extracts Associated with Lactic Acid Fermentation. Evid-Based Complement Altern. Med. ECAM. 2020; 2020 : 2743594. PubMed Abstract | Publisher Full Text | Free Full Text 37. Pokorný J: Are natural antioxidants better – and safer – than synthetic antioxidants? Eur. J. Lipid Sci. Technol. 2007; 109 (6): 629–642. Publisher Full Text 38. Lee PJ, Chen S: Effect of adding ball-milled achenes to must on bioactive compounds and antioxidant activities in fruit wine. J. Food Sci. Technol. 2016 Mar; 53 (3): 1551–1560. PubMed Abstract | Publisher Full Text | Free Full Text 39. Hunaefi D, Akumo DN, Smetanska I: Effect of Fermentation on Antioxidant Properties of Red Cabbages. Food Biotechnol. 2013 Feb; 27 (1): 66–85. Publisher Full Text 40. Jin X, Chen W, Chen H, et al. : Combination of Lactobacillus plantarum and Saccharomyces cerevisiae DV10 as Starter Culture to Produce Mango Slurry: Microbiological, Chemical Parameters and Antioxidant Activity. Mol. Basel Switz. 2019 Nov 28; 24 (23): 4349. Publisher Full Text 41. Kruse CR, Singh M, Targosinski S, et al. : The effect of pH on cell viability, cell migration, cell proliferation, wound closure, and wound reepithelialization: in vitro and in vivo study. Wound Repair Regen Off Publ Wound Heal Soc Eur Tissue Repair Soc. 2017 Apr; 25 (2): 260–269. Publisher Full Text 42. Ricci A, Cirlini M, Calani L, et al. : In vitro metabolism of elderberry juice polyphenols by lactic acid bacteria. Food Chem. 2019 Mar 15; 276 : 692–699. PubMed Abstract | Publisher Full Text 43. Shin D, Lee Y, Huang YH, et al. : Probiotic fermentation augments the skin anti-photoaging properties of Agastache rugosa through up-regulating antioxidant components in UV-B-irradiated HaCaT keratinocytes. BMC Complement. Altern. Med. 2018 Jun 26; 18 (1): 196. PubMed Abstract | Publisher Full Text | Free Full Text 44. Wu C, Li T, Qi J, et al. : Effects of lactic acid fermentation-based biotransformation on phenolic profiles, antioxidant capacity and flavor volatiles of apple juice. LWT. 2020 Mar 1; 122 : 109064. Publisher Full Text 45. Wardana M, Oktarina DAM, Pramana AAC: Toxicology Study and MMP-1 and COL1A1 Expression of Malang Green Apple Juice Fermented by Lactobacillus plantarum DAD-13 and Saccharomyces cerevisiae Fermipan on Human Fibroblast: Potential Modality of Anti-aging. figshare. 2025 [cited 2025 Jan 21]. Reference Source Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 07 Nov 2025 ADD YOUR COMMENT Comment Author details Author details 1 Faculty of Medicine, Public Health, and Nursing, Universitas Gadjah Mada, Yogyakarta, Special Region of Yogyakarta, Indonesia 2 Department of Dermatology and Venereology, Faculty of Medicine, Public Health, and Nursing, Universitas Gadjah Mada, Yogyakarta, Special Region of Yogyakarta, Indonesia 3 Department of Biochemistry, Faculty of Medicine, Public Health, and Nursing, Universitas Gadjah Mada, Yogyakarta, Special Region of Yogyakarta, Indonesia Mirna Theresia Eka Wardana Roles: Data Curation, Formal Analysis, Investigation, Writing – Original Draft Preparation Dyah Ayu Mira Oktarina Roles: Conceptualization, Funding Acquisition, Resources, Supervision Abrory Agus Cahya Pramana Roles: Methodology, Writing – Review & Editing Competing interests No competing interests were disclosed. Grant information This study was funded by the Faculty of Medicine, Public Health, and Nursing, Gadjah Mada University under the program “Hibah Dana Masyarakat (DAMAS)”. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Article Versions (2) version 2 Revised Published: 22 Dec 2025, 14:1226 https://doi.org/10.12688/f1000research.166528.2 version 1 Published: 07 Nov 2025, 14:1226 https://doi.org/10.12688/f1000research.166528.1 Copyright © 2025 Wardana MTE et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Wardana MTE, Oktarina DAM and Pramana AAC. Toxicology Study and MMP-1 and COL1A1 Expression of Malang Green Apple Juice Fermented by Lactobacillus plantarum DAD-13 and Saccharomyces cerevisiae Fermipan on Human Fibroblast: Potential Modality of Anti-aging [version 1; peer review: awaiting peer review] . F1000Research 2025, 14 :1226 ( https://doi.org/10.12688/f1000research.166528.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: AWAITING PEER REVIEW AWAITING PEER REVIEW ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 07 Nov 2025 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 Version 2 (revision) 22 Dec 25 read read Version 1 07 Nov 25 Phaniendra Alugoju , Palacký University, Šlechtitelů, Czech Republic Md Suzauddula Suzauddula , Kansas State University, Manhattan, USA Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Suzauddula M. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 06 Feb 2026 | for Version 2 Md Suzauddula Suzauddula , Kansas State University, Manhattan, KS, USA 0 Views copyright © 2026 Suzauddula M. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Comments Title The use of the term “toxicology study” is not fully justified by the experimental design. A toxicological evaluation generally requires parameters such as IC₅₀ determination, defined safety thresholds, and/or mechanistic toxicity assessments , which are not comprehensively addressed in the current manuscript. The phrase “Potential Modality of Anti-aging” is too strong for the scope of this study. The work is in vitro and exploratory , and no direct measurements of antioxidant activity, functional skin aging models, or clinical relevance are included. Therefore, the title overstates the translational significance of the findings. The authors are encouraged to revise the title accordingly. As a suggestion, the following revised title would be more accurate and appropriate: “Effects of Lactobacillus plantarum DAD-13 and Saccharomyces cerevisiae Fermipan-fermented Malang green apple juice on MMP-1 and COL1A1 expression in human dermal fibroblasts: Implications for skin aging.” Introduction While the authors discuss intrinsic and extrinsic aging, genetic factors are also a key contributor to intrinsic aging and should be explicitly mentioned. The introduction would benefit from inclusion of this aspect with appropriate citation . Numerous commercial chemical-based products are currently used to improve skin tone and delay aging; however, many are associated with side effects and long-term safety concerns . Highlighting these limitations would help establish a clearer research gap and rationale for exploring natural and fermented products. The authors are encouraged to articulate this gap more clearly in the introduction. The introduction would be strengthened by including quantitative evidence from previous studies demonstrating anti-aging effects of antioxidants derived from natural ingredients (e.g., percentage changes in collagen synthesis, reductions in MMP expression, or improvements in cell viability). The manuscript states that fermentation can increase bioactive compounds, but this claim requires supporting evidence . The authors should cite previous studies , preferably involving apples or botanically similar fruits, that demonstrate fermentation-induced enhancement of antioxidant or bioactive content. Methods The authors should specify the developmental stage of the green apples used (e.g., ripe, mature) and describe the selection criteria (freshness, absence of physical damage or disease). The type of food processor or blender used should be mentioned. Additionally, the term autoclave is not appropriate without specifying time, temperature, and pressure , and may not be suitable for juice pasteurization. This should be clarified or revised. It is assumed that the apple juice was cooled after pasteurization prior to microbial inoculation, as elevated temperatures would compromise microbial viability. This step should be explicitly described in the Methods section. The source of the fibroblast cell line should be clearly stated, for example: “Human foreskin fibroblast cell lines were obtained from [source].” In the description of cell culture conditions, the authors state that 10 mL FBS, 1 mL penicillin-streptomycin, and 1 mL amphotericin B were added; however, the total volume of DMEM is not specified. The final medium composition should be clearly described. In the MTT assay description, the sentence “a stopper of 100 L SDS 10% in 0.1 N HCl” is unclear. The unit should be corrected to 100 µL , and the sentence revised for clarity. The reported cell density of “10.000 cells/ml” appears to be incorrect. Please clarify whether this refers to 10,000 cells/mL or 10,000 cells per well , and revise accordingly. For MMP-1 and COL1A1 quantification , the authors should specify the number of cells used for RNA isolation and homogenization. The centrifugation temperature used during RNA extraction (particularly during phase separation) should be stated to ensure reproducibility. Discussion The Discussion section currently repeats several results without sufficient interpretation. Instead, the authors should focus on integrating their findings with previously published literature . For example, studies showing that increased fibroblast viability and collagen production are indicative of anti-aging effects should be cited to support the study’s conclusions. The statement that “the decrease in MMP-1 levels at 125 μg/mL and the decrease in COL1A1 levels might indicate a decrease in living fibroblasts” requires further explanation. The authors should clarify the biological significance of this observation and support it with relevant literature addressing dose-dependent cytotoxicity or stress responses in fibroblasts. Finally, although some references are included in the Discussion, they are often presented in separate paragraphs rather than integrated into the interpretation of results . The authors are encouraged to consistently support their arguments with appropriate citations throughout the Discussion, particularly in the first and second paragraphs. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? I cannot comment. A qualified statistician is required. Are all the source data underlying the results available to ensure full reproducibility? No source data required Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Bioactive compounds on aging and colon cancer. reply Respond to this report Responses (0) Suzauddula MS. Peer Review Report For: Toxicology Study and MMP-1 and COL1A1 Expression of Malang Green Apple Juice Fermented by Lactobacillus plantarum DAD-13 and Saccharomyces cerevisiae Fermipan on Human Fibroblast: Potential Modality of Anti-aging [version 1; peer review: awaiting peer review] . F1000Research 2025, 14 :1226 ( https://doi.org/10.5256/f1000research.191669.r452989) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-1226/v2#referee-response-452989 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Alugoju P. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 29 Jan 2026 | for Version 2 Phaniendra Alugoju , Palacký University, Šlechtitelů, Olomouc, Czech Republic 0 Views copyright © 2026 Alugoju P. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The study entitled “Toxicology Study and MMP-1 and COL1A1 Expression of Malang Green Apple Juice Fermented by Lactobacillus plantarum DAD-13 and Saccharomyces cerevisiae Fermipan on Human Fibroblast: Potential Modality of Anti-aging” is interesting. I recommend that the authors revise the title so that it more accurately reflects the main objective of the study. Introduction Please briefly summarize the current knowledge on the importance of fermented food products with anti-aging potency in the introduction. Methods Please use clear and more scientific subheadings (1 Green apple juice making and pasteurization, 2 Green apple juice fermentation, and 3 Green apple juice extraction) in the methods section. Please use precise headings. Change “MMP-1 and COL1A1 quantification” to “Quantification of MMP‑1 and COL1A1 mRNA by RT‑qPCR” or “RT‑qPCR Analysis of MMP‑1 and COL1A1 Expression” MTT assay: “…a stopper of 100 L SDS 10% in 0.1 N HCl ….” Correct 100 L to 100 µL SDS 10% in 0.1 N HCl ….” Results Please carefully write the results section. The authors showed the cell viability at different time points: 24, 48, and 72h. But in the methods section, it is mentioned that cell viability was checked only after 24 h. Please correct this. What is the positive control used in this study? Data analysis must be done carefully, and statistical differences should be reported accordingly. At 24 h, it seems that there is no significant difference between control and AJ/FAJ extracts. After 48 h, cell viability is increased beyond 100% in the negative control. Authors must normalize treatment groups’ data to the negative control and then perform statistical analysis. Please specify how many fold differences were observed between treatment groups compared to the control. This applies to all figures and data. Analysis of the chemical composition of the extract is recommended. Is the work clearly and accurately presented and does it cite the current literature? Partly Is the study design appropriate and is the work technically sound? No Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? No source data required Are the conclusions drawn adequately supported by the results? Partly Competing Interests No competing interests were disclosed. Reviewer Expertise Cellular senescence and aging reply Respond to this report Responses (0) Alugoju P. Peer Review Report For: Toxicology Study and MMP-1 and COL1A1 Expression of Malang Green Apple Juice Fermented by Lactobacillus plantarum DAD-13 and Saccharomyces cerevisiae Fermipan on Human Fibroblast: Potential Modality of Anti-aging [version 1; peer review: awaiting peer review] . F1000Research 2025, 14 :1226 ( https://doi.org/10.5256/f1000research.191669.r445126) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-1226/v2#referee-response-445126 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "Toxicology Study and MMP-1 and COL1A1 Expression...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/14-1226/v1" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/14-1226/v1&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/14-1226/v1" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Wardana MTE et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/14-1226/v1/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/14-1226", templates : { twitter : "Toxicology Study and MMP-1 and COL1A1 Expression of Malang Green.... Wardana MTE et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/14-1226/v1" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/166528/183526") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "183526"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "445126": 12, "456454": 0, "445127": 0, "456455": 0, "445124": 0, "456452": 0, "445125": 0, "456453": 0, "445122": 0, "445123": 0, "456451": 0, "431488": 0, "445120": 0, "445121": 0, "456460": 0, "456458": 0, "456459": 0, "445128": 0, "456456": 0, "456457": 0, "452982": 0, "431479": 0, "452983": 0, "452981": 0, "452990": 0, "431486": 0, "431487": 0, "445119": 0, "431484": 0, "452988": 0, "431485": 0, "452989": 11, "431482": 0, "452986": 0, "431483": 0, "452987": 0, "431480": 0, "452984": 0, "431481": 0, "452985": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "eb8f31dd-fdd6-40f1-9b50-cfc2a7d6b57f"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "[email protected]", infoEmail: "[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });