Inhibition of SARS-CoV-2 Variants by Broad-Spectrum Antisense Oligonucleotides Targeting the Highly Conserved 3C-like protease

Inhibition of SARS-CoV-2 Variants by Broad-Spectrum Antisense Oligonucleotides Targeting the Highly Conserved 3C-like protease | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report Inhibition of SARS-CoV-2 Variants by Broad-Spectrum Antisense Oligonucleotides Targeting the Highly Conserved 3C-like protease Rui Su, Letian Li, Yiling Long, Wenjing Shi, Rongjun Xu, Wenjing Song, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8773157/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The emergence of drug-resistant SARS-CoV-2 variants underscores the urgent need for broad-spectrum antiviral strategies. This study aimed to design and screen antisense oligonucleotides (ASOs) targeting the highly conserved 3C-like protease (3CLpro) of SARS-CoV-2. Using RNAstructure v6.3 and OligoWalk, we designed ASOs based on secondary structure and thermodynamic stability. Among the candidates, 3CLp-4 demonstrated potent mRNA knockdown in 293T cells and significantly inhibited viral replication in a SARS-CoV-2 replicon system. In live virus infection models, 3CLp-4 effectively reduced viral RNA load and titers of the SARS-CoV-2 Wuhan-Hu-1, Delta, Omicron, and XBB.1.1.6 variants. These results highlight the broad-spectrum antiviral activity of 3CLp-4, supporting its potential as a resistance-resistant therapeutic agent against evolving SARS-CoV-2 variants. SARS-CoV-2 antisense oligonucleotides 3C-like protease viral variants Figures Figure 1 Figure 2 Introduction The COVID-19 pandemic, caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), remains a major global public health challenge 1 . Since the outbreak in 2020, the virus has continuously evolved, giving rise to multiple key variants with enhanced transmissibility and immune evasion capabilities, such as Alpha, Beta, Gamma, Delta, and Omicron, all designated by the World Health Organization as Variants of Concern (VOCs) 2 . The current list of VOCs includes several Omicron sublineages, for instance, BA.2.75 carrying spike mutations including W152R and F157L; BQ.1 with K444T and N460K; XBB with N460K and F490S; and XBB.1.5 with N460K, S486P, and F490S. These Omicron sublineages have successively emerged as dominant strains in various countries, transitioning from BA.1 and BA.2 to BA.5. It is noteworthy that all Omicron subvariants, including the recently identified BQ.1.1 and XBB, harbor multiple mutations within the receptor-binding domain of the spike protein. The primary target of current vaccines and therapeutic monoclonal antibodies 3 . These mutations are likely to confer increased resistance to existing monoclonal antibody-based treatments, thereby undermining the efficacy of current therapeutic strategies. In light of rapid viral evolution and the growing challenge of drug resistance, there is an urgent need to develop novel therapeutic approaches that target highly conserved viral regions and exhibit broad-spectrum antiviral activity. The 3CLpro, also known as the main protease, plays an essential role in coronavirus replication by cleaving the viral polyprotein precursors into functional proteins, making it an ideal antiviral target. This enzyme is highly conserved in both sequence and structure across coronaviruses, and its active site remains stable across different variants, largely unaffected by mutations in the spike protein 4 . Several small-molecule inhibitors targeting 3CLpro (e.g., Nirmatrelvir) have been approved by the U.S. FDA for clinical use. These inhibitors suppress viral replication by covalently modifying the enzyme’s active site 5 . However, prolonged monotherapy with protease inhibitors may induce resistance mutations, potentially limiting their long-term efficacy. Antisense oligonucleotides (ASOs) represent a novel therapeutic strategy based on sequence-specific recognition. They bind to target mRNA via Watson–Crick base pairing and facilitate its degradation, thereby blocking viral protein synthesis at the transcriptional level 6 . Compared to conventional small-molecule drugs, ASOs can be precisely designed to target highly conserved regions of the viral genome and are less susceptible to conformational changes in the encoded proteins. This gives ASOs a distinct advantage in countering viral evolution and delaying the emergence of drug resistance. Against this background, this study aims to design ASO drugs targeting conserved regions of the SARS-CoV-2 3CLpro gene. Using RNA Structure v6.3 for rational design, we systematically evaluated the antiviral efficacy of the resulting ASOs across multiple experimental systems, including plasmid-based expression systems, viral replicon models, and live virus infection assays with various strains (such as the original strain, Delta, Omicron, and XBB.1.1.6). Antiviral activity was assessed using quantitative real-time PCR, reporter gene activity assays, and viral titer measurements. This research aims to provide critical preclinical evidence for the development of ASO-based agents with broad-spectrum antiviral activity and resistance-resistant properties, thereby contributing to the strategic arsenal of anti-SARS-CoV-2 therapeutics. Methods Design and Construction of Antisense Oligonucleotides Antisense oligonucleotides (ASOs) were designed to specifically target and suppress the activity of the SARS-CoV-2 3CLpro gene. The reference sequence of 3CLpro (Accession: MN908947) was acquired from the National Center for Biotechnology Information (NCBI). Secondary structure modeling of the target RNA fragment was conducted using RNAstructure (version 6.3). The OligoWalk module integrated into the software was utilized to assess the simulated structures. Through computation of the Gibbs free energy change associated with ASO binding across all potential sites, the most thermodynamically favorable ASO binding site was selected. All designed ASO sequences were subsequently chemically synthesized. Each oligonucleotide was modified with a phosphorothioate (PS) backbone at every third nucleotide from both the 5′ and 3′ termini to enhance nuclease resistance. Maintenance and Subculture of 293T Cells 293T cells were propagated in Dulbecco’s Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. Cultures were maintained at 37°C in a humidified atmosphere of 5% CO₂ and 70% relative humidity. Subcultivation was carried out every 2–3 days based on cellular confluence. For passaging, the spent medium was aspirated, and the cell monolayer was rinsed twice with phosphate-buffered saline (PBS). Subsequently, 0.25% trypsin-EDTA was applied to dissociate the cells, followed by incubation for 1–2 minutes. The enzymatic reaction was halted by adding complete medium, and the cell suspension was subdivided at a 1:3 ratio into fresh culture vessels. Transfection Procedure Cells were seeded in 6-well plates and transfected at 60–80% confluence using Lipofectamine 3000, according to the manufacturer's instructions. The experimental groups consisted of cells transfected with either 0.5 µM of candidate ASOs or an equivalent concentration of a scrambled control (SCR) oligonucleotide. Briefly, for each well, 10 µL of ASO (or SCR) and 5 µL of Lipofectamine 3000 were separately diluted in 250 µL of Opti-MEM, combined, and incubated for 20 minutes at room temperature to form complexes. The complexes were then added dropwise to the cells in serum-free medium. After 6 hours, the transfection medium was replaced with fresh complete medium. Cells were harvested for RNA extraction 48 hours post-transfection. Assessment of ASO-Mediated mRNA Knockdown via qPCR To evaluate the efficacy of ASO-induced mRNA degradation, quantitative real-time PCR (qPCR) was employed to measure changes in target mRNA expression post-transfection. Total RNA was extracted from transfected cells with TRIzol reagent and reverse-transcribed. qPCR was performed using SYBR Green Master Mix with the following primers: GAPDH-F: CAATGACCCCTTCATTGACC, GAPDH-R: GACAAGCTTCCCGTTCTCAG. 3CLp-F: TAATAAAGCACTACCCA, 3CLp-R: TCTAACACAAGACCATG. Gene expression was analyzed via the 2^ (–ΔΔCt) method using GAPDH as the endogenous control. Determination of NanoLuc Luciferase Activity NanoLuc® luciferase activity was measured using the Nano-Glo® Luciferase Assay System. Cells expressing NanoLuc were equilibrated to room temperature, and an equal volume of assay reagent was added. After 3 minutes of incubation, luminescence was quantified. The signal exhibits glow-type kinetics with a half-life of approximately 120 minutes. Evaluation of Antiviral Activity of ASOs Vero-E6 cells were seeded in 24-well plates at 1×10⁵ cells/well and cultured to 80–90% confluence. ASOs targeting 3CLpro were diluted to 0.5 µM in nuclease-free water. Transfection complexes were formed per manufacturer’s instructions and applied to cells in serum-free medium for 4–6 hours. After transfection, cells were infected with SARS-CoV-2 at an MOI of 0.01 for 1 hour. The inoculum was then replaced with maintenance medium containing 2% FBS. Quantification of Viral RNA Load At 12 hours post-infection, viral RNA was extracted from 100 µL of supernatant using a spin-column-based kit including steps for lysis, binding, washing, and elution. Viral RNA was eluted in 50 µL RNase-free water. The SARS-CoV-2 N gene was quantified by qRT-PCR using a Vazyme kit, and viral copy number was determined from a standard curve. Viral Titer Assay (TCID₅₀) Supernatants from infected cultures were serially diluted 10-fold and inoculated into Vero-E6 cells in 96-well plates (8 replicates per dilution). After 5 days of incubation, cytopathic effect was recorded, and TCID₅₀ was calculated using the Reed–Muench method. Statistical Analysis All data are expressed as mean ± standard deviation (SD) from at least three independent experiments. Statistical comparisons were performed using unpaired two-tailed Student’s t-tests in GraphPad Prism (v8.0). A p-value < 0.05 was considered statistically significant. Results Design and Antiviral Evaluation of Antisense Oligonucleotides Targeting SARS-CoV-2 3CLpro The design of ASOs critically depends on accurate simulation of the target sequence's secondary structure and comprehensive coverage of potential binding sites. In this study, the full sequence of 3CLpro (MN908947), comprising 918 nucleotides, was selected as the target. Its secondary structure was predicted using RNAstructure v6.3 (Fig. 1 A). All potential ASO binding sites within this structure were subsequently analyzed using the OligoWalk function. Guided by the principle of minimizing Gibbs free energy, properly designed antisense oligonucleotides bind to their target sequences in a manner that reduces the system's free energy under thermodynamic equilibrium. Following this rationale, ASOs targeting 3CLpro were designed and screened. The top five candidate ASOs, ranked from lowest to highest total Gibbs free energy, were selected for experimental validation (Fig. 1 B). To assess the ability of the designed ASOs to degrade 3CLpro mRNA, 293T cells were co-transfected with ASOs (0.5 µM) and the pCAG-nCoV-NSP5-FLAG plasmid (1 µg) using lipo3000. Total RNA was extracted 48 hours post-transfection. The relative expression levels of 3CLpro mRNA across different experimental groups were quantified by quantitative real-time PCR (qPCR). The results demonstrated that antisense oligonucleotides 3CLp-2 and 3CLp-4 inhibited 3CLpro mRNA to varying degrees, with 3CLp-4 exhibiting the most potent inhibitory effect and was therefore chosen for further investigation (Fig. 1 C). Building on the initial screening using the pCAG-nCoV-NSP5-FLAG plasmid, which identified effective antisense nucleic acids against 3CLpro mRNA, we next evaluated the inhibitory effect of ASOs on viral replication. A SARS-CoV-2 replicon system, featuring a secNluciferase reporter gene replacing the S and E structural proteins, was employed. Inhibition of viral transcription was assessed by measuring secNluciferase activity. Huh7 cells were transfected with 0.5 µM of either SCR (scrambled control) or 3CLp-4. qPCR results 48 hours post-transfection confirmed that 3CLp-4 effectively suppressed 3CLpro mRNA expression (Fig. 1 D). As this replicon system utilizes the secNluciferase reporter gene, inhibition of replicon transcription by ASOs was directly assessed by measuring secNanoLuci activity. Luminescence intensity in the 3CLp-4 treatment group was significantly lower than that in the SCR control group, indicating that 3CLp-4 markedly suppressed secNluciferase expression from the viral replicon (Fig. 1 E). To evaluate the antiviral activity of the designed ASO molecule 3CLp-4 against the ancestral SARS-CoV-2 strain, we conducted relevant experiments. Cells were transfected with SCR or 3CLp-4 at a final concentration of 0.5 µM. At 36 hours post-transfection, they were infected with SARS-CoV-2 at an MOI of 0.01. The viral load in the cell supernatant was measured at 72 hours post-infection. The data demonstrated that 3CLp-4 significantly reduced the viral load after viral entry (Fig. 1 F). Similarly, the viral titer in the supernatant was assessed at 72 hours post-infection, and the results indicated that 3CLp-4 significantly lowered the viral titer (Fig. 1 G) . In summary, this study, based on accurate simulation and thermodynamic analysis of the secondary structure of 3CLpro mRNA, successfully screened antisense oligonucleotide candidate molecules with high binding potential. Through systematic functional validation, we confirmed that ASO 3CLp-4 can significantly inhibit the expression of 3CLpro mRNA and effectively suppress viral transcription and replication in SARS-CoV-2 replicon systems and wild-type virus infection models, significantly reducing viral load and viral titers. 3CLp-4 exhibits broad-spectrum antiviral activity against multiple SARS-CoV-2 variants of concern In order to verify whether targeting the highly conserved catalytic core region of 3CLpro can effectively circumvent immune evasion and drug resistance issues caused by spike protein mutations, and to provide strategic support for addressing potential future variants, we subsequently selected the Delta, Omicron, and XBB.1.1.6 strains to validate the efficacy of our approach across these three variant viruses. To assess the antiviral effect of 3CLp-4 against the SARS-CoV-2 Delta variant, viral load detection was performed. Cells were transfected with 0.5 µM SCR or 3CLp-4 for 36 hours, followed by infection with the Delta strain at an MOI of 0.01. The viral load in the supernatant was measured at 72 hours post-infection. The results showed that 3CLp-4 significantly reduced the viral load within 72 hours after viral entry (Fig. 2 A). For the Omicron variant, this study also evaluated the impact of 3CLp-4 on its viral load. Under the same transfection and infection conditions (0.5 µM SCR or 3CLp-4 for 36 hours, infection with Omicron at an MOI of 0.01), the viral load in the supernatant was measured at 72 hours post-infection. The data indicated that 3CLp-4 significantly reduced the viral load within 72 hours after infection(Fig. 2 B). To further examine whether the designed 3CLp-4 exhibits inhibitory effects against the SARS-CoV-2 XBB.1.1.6 strain, an evaluation was conducted. Cells were transfected with SCR or 3CLp-4 at a final concentration of 0.5 µM. At 36 hours post-transfection, they were infected with SARS-CoV-2 XBB.1.1.6 at an MOI of 0.01. The viral load in the cell supernatant was measured at 24, 36, 72, and 96 hours post-infection. The results demonstrated that 3CLp-4 significantly reduced the viral load at 24, 36, and 72 hours post-infection, with the most pronounced inhibitory effect observed at 72 hours, while no significant inhibition was seen at 96 hours (Fig. 2 C). Similarly, the viral titer in the supernatant was measured at 24, 36, and 72 hours post-infection, and the data showed that 3CLp-4 significantly reduced the viral titer at 48 hours post-infection (Fig. 2 D). In summary, through systematic validation across multiple variants of concern, including Delta, Omicron, and XBB.1.1.6, this study confirms that the candidate drug 3CLp-4, which targets the catalytic core region of 3CLpro, exhibits broad-spectrum antiviral activity. Discussion The present study focuses on the key viral target of SARS-CoV-2, the 3CLpro, and involves the design and screening of a series of antisense oligonucleotide (ASO) drugs, whose antiviral potential was systematically evaluated across multiple experimental systems. Results demonstrate that the candidate molecule, 3CLp-4, effectively inhibits viral replication in various models, exhibiting potent and broad-spectrum inhibitory activity against multiple VOCs, including Omicron and XBB. This highlights its development value as a candidate anti-SARS-CoV-2 therapeutic. 3CLpro is highly conserved among coronaviruses, and its catalytic core has remained virtually unmutated across emerged variants, making it an ideal target for overcoming therapeutic challenges posed by viral evolution. In this study, rational design of ASOs was performed using the RNAstructure v6.3 software, with the OligoWalk module employed to assess binding free energy, leading to the identification of high-affinity ASO candidate molecules targeting the 3CLpro mRNA. Experimental validation confirmed that 3CLp-4 significantly reduces both 3CLpro mRNA levels and reporter gene activity, indicating not only efficient target binding but also effective gene silencing function. In authentic virus infection models, 3CLp-4 demonstrated significant antiviral activity against the ancestral strain, Delta, Omicron, and XBB.1.1.6. Notably, despite the extensive mutations in the spike protein of Omicron and its sub-lineages, which render many antibody therapies ineffective, 3CLp-4 maintained its antiviral efficacy. This underscores the considerable advantage of targeting conserved non-structural proteins in countering viral evolution. Compared to small-molecule inhibitors that directly target proteins (e.g., Nirmatrelvir), ASO drugs act further upstream at the genetic information level by degrading viral mRNA. This mechanism is less susceptible to variations in protein structure, thereby reducing the risk of drug resistance development. Furthermore, the efficacy of 3CLp-4 across multiple variants suggests that this strategy holds potential not only for monotherapy but also for combination regimens with RdRp inhibitors or small-molecule protease inhibitors, offering a multi-mechanistic, synergistic therapeutic approach that could further delay the emergence of resistance. This study, however, has several limitations. All experiments were conducted in cell-based models, and its efficacy and safety have not yet been validated in animal models. The delivery efficiency, in vivo stability, and tissue distribution of ASO drugs remain critical challenges for clinical translation. Additionally, the generally observed reduction in inhibitory effect beyond 96 hours indicates a need for further optimization of the ASO chemical modification strategy, such as increasing the phosphorothioate content or introducing GalNAc conjugates, to enhance nuclease resistance and improve liver targeting. In summary, this study successfully developed a highly effective ASO candidate drug, 3CLp-4, targeting the SARS-CoV-2 3CLpro, and confirmed its significant and broad-spectrum antiviral activity against multiple VOCs in vitro. These findings not only provide a novel therapeutic strategy for addressing current challenges of SARS-CoV-2 variation and drug resistance but also establish an experimental and theoretical foundation for developing antisense nucleic acid drugs against other highly variable viruses. Declarations Conflicts of Interest The authors declare that no conflicts of interest exist. Funding This work was supported by grants from the Shenzhen Science and Technology Major Project 2024: Key Technology Development of Artificial Intelligence-based Full Spectrum Drug Design Platform (No. KJZD20240903100304007), Science and Technology Program of Guangzhou City (No. 202206010063). National Natural Science Foundation of China (No. 32302955). Author Contribution Rui Su:Conceptualization,Writing - Original Draft Letian Li: Methodology, InvestigationYiling Long:Figure 1Wenjing Shi:Figure 2Rongjun Xu:Formal analysisWenjing Song:InvestigationXiuyuan Wang:MethodologyChang Li:Drafted the manuscriptJia Fei:Drafted the manuscript Acknowledgments We thank Medical Experimental Center, School of Medicine, Jinan University (Guangzhou, China) for providing the Instrument platform. Data Availability All data associated with this study are presented in the paper. Materials that support the findings of this study are available from the corresponding author upon request. Declaration of Interest Statement All authors declare that they have no competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Compliance with Ethics Requirements This article is not applicable. References Vitiello A, Ferrara F, Auti AM, Di Domenico M, Boccellino M (2022) Advances in the Omicron variant development. J Intern Med 292:81–90. 10.1111/joim.13478 Vitiello A, Zovi A, Rezza G (2023) New emerging SARS-CoV-2 variants and antiviral agents. Drug Resist Updates 70:100986. https://doi.org/10.1016/j.drup.2023.100986 Imai M, Ito M, Kiso M, Yamayoshi S, Uraki R, Fukushi S, Watanabe S, Suzuki T, Maeda K, Sakai-Tagawa Y et al (2023) Efficacy of Antiviral Agents against Omicron Subvariants BQ.1.1 and XBB. N Engl J Med 388:89–91. 10.1056/NEJMc2214302 Al Adem K, Ferreira JC, Villanueva AJ, Fadl S, El-Sadaany F, Masmoudi I, Gidiya Y, Gurudza T, Cardoso THS, Saksena NK, Rabeh WM (2024) 3-chymotrypsin-like protease in SARS-CoV-2. Biosci Rep 44. 10.1042/bsr20231395 Zhu J, Zhang H, Lin Q, Lyu J, Lu L, Chen H, Zhang X, Zhang Y, Chen K (2022) Progress on SARS-CoV-2 3CLpro Inhibitors: Inspiration from SARS-CoV 3CLpro Peptidomimetics and Small-Molecule Anti-Inflammatory Compounds. Drug Des Devel Ther 16:1067–1082. 10.2147/dddt.S359009 Zhu C, Lee JY, Woo JZ, Xu L, Wrynla XH, Yamashiro LH, Ji F, Biering SB, Van Dis E, Gonzalez F et al (2022) An intranasal ASO therapeutic targeting SARS-CoV-2. Nat Commun 13:4503. 10.1038/s41467-022-32216-0 Additional Declarations No competing interests reported. Supplementary Files checklist.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8773157","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Short Report","associatedPublications":[],"authors":[{"id":603924920,"identity":"52477dd1-3f4a-4c75-8215-8f74e586bd19","order_by":0,"name":"Rui Su","email":"","orcid":"","institution":"Jinan University","correspondingAuthor":false,"prefix":"","firstName":"Rui","middleName":"","lastName":"Su","suffix":""},{"id":603924922,"identity":"80c1bfeb-bf1c-46c2-9a6c-67130241c37d","order_by":1,"name":"Letian Li","email":"","orcid":"","institution":"China Academy of Chinese Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Letian","middleName":"","lastName":"Li","suffix":""},{"id":603924923,"identity":"7e4d0b23-7185-4483-83ae-ca32ebd01ce3","order_by":2,"name":"Yiling Long","email":"","orcid":"","institution":"Jinan University","correspondingAuthor":false,"prefix":"","firstName":"Yiling","middleName":"","lastName":"Long","suffix":""},{"id":603924924,"identity":"c80494f6-b641-4095-b0ad-b33fc05e223b","order_by":3,"name":"Wenjing Shi","email":"","orcid":"","institution":"Jinan University","correspondingAuthor":false,"prefix":"","firstName":"Wenjing","middleName":"","lastName":"Shi","suffix":""},{"id":603924925,"identity":"9aaddbbb-b689-49e8-9084-04d29f5832ed","order_by":4,"name":"Rongjun Xu","email":"","orcid":"","institution":"Jinan University","correspondingAuthor":false,"prefix":"","firstName":"Rongjun","middleName":"","lastName":"Xu","suffix":""},{"id":603924926,"identity":"742cf7b8-a8c6-4a0e-b40f-25b02077ec2a","order_by":5,"name":"Wenjing Song","email":"","orcid":"","institution":"Jinan University","correspondingAuthor":false,"prefix":"","firstName":"Wenjing","middleName":"","lastName":"Song","suffix":""},{"id":603924927,"identity":"4fef7372-0415-4756-9d2c-42ae15794af3","order_by":6,"name":"Xiuyuan Wang","email":"","orcid":"","institution":"Jinan University","correspondingAuthor":false,"prefix":"","firstName":"Xiuyuan","middleName":"","lastName":"Wang","suffix":""},{"id":603924928,"identity":"2f1ad71b-17ba-42b6-b13f-4e9f7c8bf7e7","order_by":7,"name":"Chang Li","email":"","orcid":"","institution":"China Academy of Chinese Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Chang","middleName":"","lastName":"Li","suffix":""},{"id":603924929,"identity":"e1cd63c0-c3c6-4c33-9e9f-55a47900d834","order_by":8,"name":"Jia Fei","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1ElEQVRIiWNgGAWjYDAC5gMMByQMGOQYG0A8NiJ08LAlgLUYk6YFBBLBOojSYs/GfPCARYFdevPsHgOGD2WHGfhnNxCyhS0B6LDk3MY5ZwwYZ5w7zCBx5wABLfI9BkAtzLmNM3IMmHnbDjMYSCQQsoX/A1BLfTojSMtf4rTwgELscAJYCyNRWo6xgRx23LBxRlrBwZ5z6TwSNwhoYW9jfvxZ4k+1vOGM5I0PfpRZy/HPIKAFBJglgIRhAwPDAZC1hNUDAeMHICFPlNJRMApGwSgYkQAA9pg+UaOqHMQAAAAASUVORK5CYII=","orcid":"","institution":"Jinan University","correspondingAuthor":true,"prefix":"","firstName":"Jia","middleName":"","lastName":"Fei","suffix":""}],"badges":[],"createdAt":"2026-02-03 08:39:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8773157/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8773157/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":106723460,"identity":"1c9c5f80-f629-4163-b261-2671f1e1a692","added_by":"auto","created_at":"2026-04-12 17:47:53","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":405366,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Prediction of the secondary structure of 3CLp mRNA using RNAstructure v6.3 software.\u003cbr\u003e\n(B) Design of ASO sequences targeting 3CLp mRNA using RNAstructure v6.3 software.\u003cbr\u003e\n(C) qPCR analysis of changes in 3CLpro mRNA expression levels in 293T cells transfected with different antisense oligonucleotides (ASOs).\u003cbr\u003e\n(D) qPCR analysis of 3CLp mRNA expression levels in the HuH-7 viral replicon system.\u003cbr\u003e\n(E) Measurement of secNluciferase activity following transfection with 3CLp-4.\u003cbr\u003e\n(F) SARS-CoV-2 viral load measured 72 hours post-infection.\u003cbr\u003e\n(G) SARS-CoV-2 viral titer determined 72 hours post-infection.\u003c/p\u003e","description":"","filename":"3CLFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8773157/v1/7641352bfe2921ec89a37564.png"},{"id":104430104,"identity":"c51db858-1323-415d-9be7-b55c7426cd27","added_by":"auto","created_at":"2026-03-11 15:27:51","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":195841,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Delta variant viral load measured 72 hours post-infection.\u003cbr\u003e\n(B) Omicron variant viral load measured 72 hours post-infection.\u003cbr\u003e\n(C, D) Viral titer and viral load of the XBB.1.1.6 strain, respectively.\u003c/p\u003e","description":"","filename":"3CLFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8773157/v1/90fef9482956081fac4dbc5c.png"},{"id":107868314,"identity":"b07fa826-ae3d-400f-99dc-92ecfdadd01a","added_by":"auto","created_at":"2026-04-27 07:10:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":710892,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8773157/v1/a0f8841c-6fcd-4187-a350-573824cc55f3.pdf"},{"id":104430105,"identity":"52e5a5ec-d50e-41ec-b49f-9ab2fc9b4fd6","added_by":"auto","created_at":"2026-03-11 15:27:51","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":14609,"visible":true,"origin":"","legend":"","description":"","filename":"checklist.docx","url":"https://assets-eu.researchsquare.com/files/rs-8773157/v1/2f81585e25243e3e9585e1be.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Inhibition of SARS-CoV-2 Variants by Broad-Spectrum Antisense Oligonucleotides Targeting the Highly Conserved 3C-like protease","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe COVID-19 pandemic, caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), remains a major global public health challenge\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Since the outbreak in 2020, the virus has continuously evolved, giving rise to multiple key variants with enhanced transmissibility and immune evasion capabilities, such as Alpha, Beta, Gamma, Delta, and Omicron, all designated by the World Health Organization as Variants of Concern (VOCs)\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. The current list of VOCs includes several Omicron sublineages, for instance, BA.2.75 carrying spike mutations including W152R and F157L; BQ.1 with K444T and N460K; XBB with N460K and F490S; and XBB.1.5 with N460K, S486P, and F490S. These Omicron sublineages have successively emerged as dominant strains in various countries, transitioning from BA.1 and BA.2 to BA.5. It is noteworthy that all Omicron subvariants, including the recently identified BQ.1.1 and XBB, harbor multiple mutations within the receptor-binding domain of the spike protein. The primary target of current vaccines and therapeutic monoclonal antibodies\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. These mutations are likely to confer increased resistance to existing monoclonal antibody-based treatments, thereby undermining the efficacy of current therapeutic strategies.\u003c/p\u003e \u003cp\u003eIn light of rapid viral evolution and the growing challenge of drug resistance, there is an urgent need to develop novel therapeutic approaches that target highly conserved viral regions and exhibit broad-spectrum antiviral activity.\u003c/p\u003e \u003cp\u003eThe 3CLpro, also known as the main protease, plays an essential role in coronavirus replication by cleaving the viral polyprotein precursors into functional proteins, making it an ideal antiviral target. This enzyme is highly conserved in both sequence and structure across coronaviruses, and its active site remains stable across different variants, largely unaffected by mutations in the spike protein\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Several small-molecule inhibitors targeting 3CLpro (e.g., Nirmatrelvir) have been approved by the U.S. FDA for clinical use. These inhibitors suppress viral replication by covalently modifying the enzyme\u0026rsquo;s active site\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. However, prolonged monotherapy with protease inhibitors may induce resistance mutations, potentially limiting their long-term efficacy.\u003c/p\u003e \u003cp\u003eAntisense oligonucleotides (ASOs) represent a novel therapeutic strategy based on sequence-specific recognition. They bind to target mRNA via Watson\u0026ndash;Crick base pairing and facilitate its degradation, thereby blocking viral protein synthesis at the transcriptional level\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Compared to conventional small-molecule drugs, ASOs can be precisely designed to target highly conserved regions of the viral genome and are less susceptible to conformational changes in the encoded proteins. This gives ASOs a distinct advantage in countering viral evolution and delaying the emergence of drug resistance.\u003c/p\u003e \u003cp\u003eAgainst this background, this study aims to design ASO drugs targeting conserved regions of the SARS-CoV-2 3CLpro gene. Using RNA Structure v6.3 for rational design, we systematically evaluated the antiviral efficacy of the resulting ASOs across multiple experimental systems, including plasmid-based expression systems, viral replicon models, and live virus infection assays with various strains (such as the original strain, Delta, Omicron, and XBB.1.1.6). Antiviral activity was assessed using quantitative real-time PCR, reporter gene activity assays, and viral titer measurements. This research aims to provide critical preclinical evidence for the development of ASO-based agents with broad-spectrum antiviral activity and resistance-resistant properties, thereby contributing to the strategic arsenal of anti-SARS-CoV-2 therapeutics.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eDesign and Construction of Antisense Oligonucleotides\u003c/h2\u003e \u003cp\u003eAntisense oligonucleotides (ASOs) were designed to specifically target and suppress the activity of the SARS-CoV-2 3CLpro gene. The reference sequence of 3CLpro (Accession: MN908947) was acquired from the National Center for Biotechnology Information (NCBI). Secondary structure modeling of the target RNA fragment was conducted using RNAstructure (version 6.3). The OligoWalk module integrated into the software was utilized to assess the simulated structures. Through computation of the Gibbs free energy change associated with ASO binding across all potential sites, the most thermodynamically favorable ASO binding site was selected. All designed ASO sequences were subsequently chemically synthesized. Each oligonucleotide was modified with a phosphorothioate (PS) backbone at every third nucleotide from both the 5\u0026prime; and 3\u0026prime; termini to enhance nuclease resistance.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMaintenance and Subculture of 293T Cells\u003c/h3\u003e\n\u003cp\u003e293T cells were propagated in Dulbecco\u0026rsquo;s Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. Cultures were maintained at 37\u0026deg;C in a humidified atmosphere of 5% CO₂ and 70% relative humidity. Subcultivation was carried out every 2\u0026ndash;3 days based on cellular confluence. For passaging, the spent medium was aspirated, and the cell monolayer was rinsed twice with phosphate-buffered saline (PBS). Subsequently, 0.25% trypsin-EDTA was applied to dissociate the cells, followed by incubation for 1\u0026ndash;2 minutes. The enzymatic reaction was halted by adding complete medium, and the cell suspension was subdivided at a 1:3 ratio into fresh culture vessels.\u003c/p\u003e\n\u003ch3\u003eTransfection Procedure\u003c/h3\u003e\n\u003cp\u003eCells were seeded in 6-well plates and transfected at 60\u0026ndash;80% confluence using Lipofectamine 3000, according to the manufacturer's instructions. The experimental groups consisted of cells transfected with either 0.5 \u0026micro;M of candidate ASOs or an equivalent concentration of a scrambled control (SCR) oligonucleotide. Briefly, for each well, 10 \u0026micro;L of ASO (or SCR) and 5 \u0026micro;L of Lipofectamine 3000 were separately diluted in 250 \u0026micro;L of Opti-MEM, combined, and incubated for 20 minutes at room temperature to form complexes. The complexes were then added dropwise to the cells in serum-free medium. After 6 hours, the transfection medium was replaced with fresh complete medium. Cells were harvested for RNA extraction 48 hours post-transfection.\u003c/p\u003e\n\u003ch3\u003eAssessment of ASO-Mediated mRNA Knockdown via qPCR\u003c/h3\u003e\n\u003cp\u003eTo evaluate the efficacy of ASO-induced mRNA degradation, quantitative real-time PCR (qPCR) was employed to measure changes in target mRNA expression post-transfection. Total RNA was extracted from transfected cells with TRIzol reagent and reverse-transcribed. qPCR was performed using SYBR Green Master Mix with the following primers: GAPDH-F: CAATGACCCCTTCATTGACC, GAPDH-R: GACAAGCTTCCCGTTCTCAG. 3CLp-F: TAATAAAGCACTACCCA, 3CLp-R: TCTAACACAAGACCATG. Gene expression was analyzed via the 2^\u003csup\u003e(\u0026ndash;ΔΔCt)\u003c/sup\u003e method using GAPDH as the endogenous control.\u003c/p\u003e\n\u003ch3\u003eDetermination of NanoLuc Luciferase Activity\u003c/h3\u003e\n\u003cp\u003eNanoLuc\u0026reg; luciferase activity was measured using the Nano-Glo\u0026reg; Luciferase Assay System. Cells expressing NanoLuc were equilibrated to room temperature, and an equal volume of assay reagent was added. After 3 minutes of incubation, luminescence was quantified. The signal exhibits glow-type kinetics with a half-life of approximately 120 minutes.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eEvaluation of Antiviral Activity of ASOs\u003c/h2\u003e \u003cp\u003eVero-E6 cells were seeded in 24-well plates at 1\u0026times;10⁵ cells/well and cultured to 80\u0026ndash;90% confluence. ASOs targeting 3CLpro were diluted to 0.5 \u0026micro;M in nuclease-free water. Transfection complexes were formed per manufacturer\u0026rsquo;s instructions and applied to cells in serum-free medium for 4\u0026ndash;6 hours. After transfection, cells were infected with SARS-CoV-2 at an MOI of 0.01 for 1 hour. The inoculum was then replaced with maintenance medium containing 2% FBS.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eQuantification of Viral RNA Load\u003c/h3\u003e\n\u003cp\u003eAt 12 hours post-infection, viral RNA was extracted from 100 \u0026micro;L of supernatant using a spin-column-based kit including steps for lysis, binding, washing, and elution. Viral RNA was eluted in 50 \u0026micro;L RNase-free water. The SARS-CoV-2 N gene was quantified by qRT-PCR using a Vazyme kit, and viral copy number was determined from a standard curve.\u003c/p\u003e\n\u003ch3\u003eViral Titer Assay (TCID₅₀)\u003c/h3\u003e\n\u003cp\u003eSupernatants from infected cultures were serially diluted 10-fold and inoculated into Vero-E6 cells in 96-well plates (8 replicates per dilution). After 5 days of incubation, cytopathic effect was recorded, and TCID₅₀ was calculated using the Reed\u0026ndash;Muench method.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eAll data are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) from at least three independent experiments. Statistical comparisons were performed using unpaired two-tailed Student\u0026rsquo;s t-tests in GraphPad Prism (v8.0). A p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eDesign and Antiviral Evaluation of Antisense Oligonucleotides Targeting SARS-CoV-2 3CLpro\u003c/h2\u003e \u003cp\u003eThe design of ASOs critically depends on accurate simulation of the target sequence's secondary structure and comprehensive coverage of potential binding sites. In this study, the full sequence of 3CLpro (MN908947), comprising 918 nucleotides, was selected as the target. Its secondary structure was predicted using RNAstructure v6.3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). All potential ASO binding sites within this structure were subsequently analyzed using the OligoWalk function. Guided by the principle of minimizing Gibbs free energy, properly designed antisense oligonucleotides bind to their target sequences in a manner that reduces the system's free energy under thermodynamic equilibrium. Following this rationale, ASOs targeting 3CLpro were designed and screened. The top five candidate ASOs, ranked from lowest to highest total Gibbs free energy, were selected for experimental validation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). To assess the ability of the designed ASOs to degrade 3CLpro mRNA, 293T cells were co-transfected with ASOs (0.5 \u0026micro;M) and the pCAG-nCoV-NSP5-FLAG plasmid (1 \u0026micro;g) using lipo3000. Total RNA was extracted 48 hours post-transfection. The relative expression levels of 3CLpro mRNA across different experimental groups were quantified by quantitative real-time PCR (qPCR). The results demonstrated that antisense oligonucleotides 3CLp-2 and 3CLp-4 inhibited 3CLpro mRNA to varying degrees, with 3CLp-4 exhibiting the most potent inhibitory effect and was therefore chosen for further investigation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Building on the initial screening using the pCAG-nCoV-NSP5-FLAG plasmid, which identified effective antisense nucleic acids against 3CLpro mRNA, we next evaluated the inhibitory effect of ASOs on viral replication. A SARS-CoV-2 replicon system, featuring a secNluciferase reporter gene replacing the S and E structural proteins, was employed. Inhibition of viral transcription was assessed by measuring secNluciferase activity. Huh7 cells were transfected with 0.5 \u0026micro;M of either SCR (scrambled control) or 3CLp-4. qPCR results 48 hours post-transfection confirmed that 3CLp-4 effectively suppressed 3CLpro mRNA expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). As this replicon system utilizes the secNluciferase reporter gene, inhibition of replicon transcription by ASOs was directly assessed by measuring secNanoLuci activity. Luminescence intensity in the 3CLp-4 treatment group was significantly lower than that in the SCR control group, indicating that 3CLp-4 markedly suppressed secNluciferase expression from the viral replicon (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). To evaluate the antiviral activity of the designed ASO molecule 3CLp-4 against the ancestral SARS-CoV-2 strain, we conducted relevant experiments. Cells were transfected with SCR or 3CLp-4 at a final concentration of 0.5 \u0026micro;M. At 36 hours post-transfection, they were infected with SARS-CoV-2 at an MOI of 0.01. The viral load in the cell supernatant was measured at 72 hours post-infection. The data demonstrated that 3CLp-4 significantly reduced the viral load after viral entry (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). Similarly, the viral titer in the supernatant was assessed at 72 hours post-infection, and the results indicated that 3CLp-4 significantly lowered the viral titer (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG) .\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn summary, this study, based on accurate simulation and thermodynamic analysis of the secondary structure of 3CLpro mRNA, successfully screened antisense oligonucleotide candidate molecules with high binding potential. Through systematic functional validation, we confirmed that ASO 3CLp-4 can significantly inhibit the expression of 3CLpro mRNA and effectively suppress viral transcription and replication in SARS-CoV-2 replicon systems and wild-type virus infection models, significantly reducing viral load and viral titers.\u003c/p\u003e \u003cp\u003e \u003cb\u003e3CLp-4 exhibits broad-spectrum antiviral activity against multiple SARS-CoV-2 variants of concern\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIn order to verify whether targeting the highly conserved catalytic core region of 3CLpro can effectively circumvent immune evasion and drug resistance issues caused by spike protein mutations, and to provide strategic support for addressing potential future variants, we subsequently selected the Delta, Omicron, and XBB.1.1.6 strains to validate the efficacy of our approach across these three variant viruses. To assess the antiviral effect of 3CLp-4 against the SARS-CoV-2 Delta variant, viral load detection was performed. Cells were transfected with 0.5 \u0026micro;M SCR or 3CLp-4 for 36 hours, followed by infection with the Delta strain at an MOI of 0.01. The viral load in the supernatant was measured at 72 hours post-infection. The results showed that 3CLp-4 significantly reduced the viral load within 72 hours after viral entry (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). For the Omicron variant, this study also evaluated the impact of 3CLp-4 on its viral load. Under the same transfection and infection conditions (0.5 \u0026micro;M SCR or 3CLp-4 for 36 hours, infection with Omicron at an MOI of 0.01), the viral load in the supernatant was measured at 72 hours post-infection. The data indicated that 3CLp-4 significantly reduced the viral load within 72 hours after infection(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). To further examine whether the designed 3CLp-4 exhibits inhibitory effects against the SARS-CoV-2 XBB.1.1.6 strain, an evaluation was conducted. Cells were transfected with SCR or 3CLp-4 at a final concentration of 0.5 \u0026micro;M. At 36 hours post-transfection, they were infected with SARS-CoV-2 XBB.1.1.6 at an MOI of 0.01. The viral load in the cell supernatant was measured at 24, 36, 72, and 96 hours post-infection. The results demonstrated that 3CLp-4 significantly reduced the viral load at 24, 36, and 72 hours post-infection, with the most pronounced inhibitory effect observed at 72 hours, while no significant inhibition was seen at 96 hours (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Similarly, the viral titer in the supernatant was measured at 24, 36, and 72 hours post-infection, and the data showed that 3CLp-4 significantly reduced the viral titer at 48 hours post-infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). In summary, through systematic validation across multiple variants of concern, including Delta, Omicron, and XBB.1.1.6, this study confirms that the candidate drug 3CLp-4, which targets the catalytic core region of 3CLpro, exhibits broad-spectrum antiviral activity.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe present study focuses on the key viral target of SARS-CoV-2, the 3CLpro, and involves the design and screening of a series of antisense oligonucleotide (ASO) drugs, whose antiviral potential was systematically evaluated across multiple experimental systems. Results demonstrate that the candidate molecule, 3CLp-4, effectively inhibits viral replication in various models, exhibiting potent and broad-spectrum inhibitory activity against multiple VOCs, including Omicron and XBB. This highlights its development value as a candidate anti-SARS-CoV-2 therapeutic.\u003c/p\u003e \u003cp\u003e3CLpro is highly conserved among coronaviruses, and its catalytic core has remained virtually unmutated across emerged variants, making it an ideal target for overcoming therapeutic challenges posed by viral evolution. In this study, rational design of ASOs was performed using the RNAstructure v6.3 software, with the OligoWalk module employed to assess binding free energy, leading to the identification of high-affinity ASO candidate molecules targeting the 3CLpro mRNA. Experimental validation confirmed that 3CLp-4 significantly reduces both 3CLpro mRNA levels and reporter gene activity, indicating not only efficient target binding but also effective gene silencing function.\u003c/p\u003e \u003cp\u003eIn authentic virus infection models, 3CLp-4 demonstrated significant antiviral activity against the ancestral strain, Delta, Omicron, and XBB.1.1.6. Notably, despite the extensive mutations in the spike protein of Omicron and its sub-lineages, which render many antibody therapies ineffective, 3CLp-4 maintained its antiviral efficacy. This underscores the considerable advantage of targeting conserved non-structural proteins in countering viral evolution.\u003c/p\u003e \u003cp\u003eCompared to small-molecule inhibitors that directly target proteins (e.g., Nirmatrelvir), ASO drugs act further upstream at the genetic information level by degrading viral mRNA. This mechanism is less susceptible to variations in protein structure, thereby reducing the risk of drug resistance development. Furthermore, the efficacy of 3CLp-4 across multiple variants suggests that this strategy holds potential not only for monotherapy but also for combination regimens with RdRp inhibitors or small-molecule protease inhibitors, offering a multi-mechanistic, synergistic therapeutic approach that could further delay the emergence of resistance.\u003c/p\u003e \u003cp\u003eThis study, however, has several limitations. All experiments were conducted in cell-based models, and its efficacy and safety have not yet been validated in animal models. The delivery efficiency, in vivo stability, and tissue distribution of ASO drugs remain critical challenges for clinical translation. Additionally, the generally observed reduction in inhibitory effect beyond 96 hours indicates a need for further optimization of the ASO chemical modification strategy, such as increasing the phosphorothioate content or introducing GalNAc conjugates, to enhance nuclease resistance and improve liver targeting.\u003c/p\u003e \u003cp\u003eIn summary, this study successfully developed a highly effective ASO candidate drug, 3CLp-4, targeting the SARS-CoV-2 3CLpro, and confirmed its significant and broad-spectrum antiviral activity against multiple VOCs in vitro. These findings not only provide a novel therapeutic strategy for addressing current challenges of SARS-CoV-2 variation and drug resistance but also establish an experimental and theoretical foundation for developing antisense nucleic acid drugs against other highly variable viruses.\u003c/p\u003e "},{"header":"Declarations","content":"\u003ch2\u003eConflicts of Interest\u003c/h2\u003e \u003cp\u003eThe authors declare that no conflicts of interest exist.\u003c/p\u003e \u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by grants from the Shenzhen Science and Technology Major Project 2024: Key Technology Development of Artificial Intelligence-based Full Spectrum Drug Design Platform (No. KJZD20240903100304007), Science and Technology Program of Guangzhou City (No. 202206010063). National Natural Science Foundation of China (No. 32302955).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eRui Su:Conceptualization,Writing - Original Draft Letian Li: Methodology, InvestigationYiling Long:Figure 1Wenjing Shi:Figure 2Rongjun Xu:Formal analysisWenjing Song:InvestigationXiuyuan Wang:MethodologyChang Li:Drafted the manuscriptJia Fei:Drafted the manuscript\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eWe thank Medical Experimental Center, School of Medicine, Jinan University (Guangzhou, China) for providing the Instrument platform.\u003c/p\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eData Availability\u003c/h2\u003e \u003cp\u003eAll data associated with this study are presented in the paper. Materials that support the findings of this study are available from the corresponding author upon request.\u003c/p\u003e \u003c/div\u003e\u003ch2\u003eDeclaration of Interest Statement\u003c/h2\u003e\n\u003cp\u003eAll authors declare that they have no competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompliance with Ethics Requirements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis article is not applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eVitiello A, Ferrara F, Auti AM, Di Domenico M, Boccellino M (2022) Advances in the Omicron variant development. J Intern Med 292:81\u0026ndash;90. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/joim.13478\u003c/span\u003e\u003cspan address=\"10.1111/joim.13478\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVitiello A, Zovi A, Rezza G (2023) New emerging SARS-CoV-2 variants and antiviral agents. Drug Resist Updates 70:100986. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.drup.2023.100986\u003c/span\u003e\u003cspan address=\"10.1016/j.drup.2023.100986\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eImai M, Ito M, Kiso M, Yamayoshi S, Uraki R, Fukushi S, Watanabe S, Suzuki T, Maeda K, Sakai-Tagawa Y et al (2023) Efficacy of Antiviral Agents against Omicron Subvariants BQ.1.1 and XBB. N Engl J Med 388:89\u0026ndash;91. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1056/NEJMc2214302\u003c/span\u003e\u003cspan address=\"10.1056/NEJMc2214302\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAl Adem K, Ferreira JC, Villanueva AJ, Fadl S, El-Sadaany F, Masmoudi I, Gidiya Y, Gurudza T, Cardoso THS, Saksena NK, Rabeh WM (2024) 3-chymotrypsin-like protease in SARS-CoV-2. Biosci Rep 44. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1042/bsr20231395\u003c/span\u003e\u003cspan address=\"10.1042/bsr20231395\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu J, Zhang H, Lin Q, Lyu J, Lu L, Chen H, Zhang X, Zhang Y, Chen K (2022) Progress on SARS-CoV-2 3CLpro Inhibitors: Inspiration from SARS-CoV 3CLpro Peptidomimetics and Small-Molecule Anti-Inflammatory Compounds. Drug Des Devel Ther 16:1067\u0026ndash;1082. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2147/dddt.S359009\u003c/span\u003e\u003cspan address=\"10.2147/dddt.S359009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu C, Lee JY, Woo JZ, Xu L, Wrynla XH, Yamashiro LH, Ji F, Biering SB, Van Dis E, Gonzalez F et al (2022) An intranasal ASO therapeutic targeting SARS-CoV-2. Nat Commun 13:4503. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-022-32216-0\u003c/span\u003e\u003cspan address=\"10.1038/s41467-022-32216-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"SARS-CoV-2, antisense oligonucleotides, 3C-like protease, viral variants","lastPublishedDoi":"10.21203/rs.3.rs-8773157/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8773157/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe emergence of drug-resistant SARS-CoV-2 variants underscores the urgent need for broad-spectrum antiviral strategies. This study aimed to design and screen antisense oligonucleotides (ASOs) targeting the highly conserved 3C-like protease (3CLpro) of SARS-CoV-2. Using RNAstructure v6.3 and OligoWalk, we designed ASOs based on secondary structure and thermodynamic stability. Among the candidates, 3CLp-4 demonstrated potent mRNA knockdown in 293T cells and significantly inhibited viral replication in a SARS-CoV-2 replicon system. In live virus infection models, 3CLp-4 effectively reduced viral RNA load and titers of the SARS-CoV-2 Wuhan-Hu-1, Delta, Omicron, and XBB.1.1.6 variants. These results highlight the broad-spectrum antiviral activity of 3CLp-4, supporting its potential as a resistance-resistant therapeutic agent against evolving SARS-CoV-2 variants.\u003c/p\u003e","manuscriptTitle":"Inhibition of SARS-CoV-2 Variants by Broad-Spectrum Antisense Oligonucleotides Targeting the Highly Conserved 3C-like protease","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-11 15:27:44","doi":"10.21203/rs.3.rs-8773157/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"65b17168-39ec-4db3-a3ea-708419e673c5","owner":[],"postedDate":"March 11th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-03-23T09:44:20+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-11 15:27:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8773157","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8773157","identity":"rs-8773157","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}