Altered miR-410-3p and Target Genes (PCDH8, VEGFA, NUMB) Expression in Ovarian Endometriosis: A Case-Control Study

other OA: gold CC-BY-NC-ND-4.0
AI-generated deep summary by claude@2026-06, 2026-06-10 · read from full text

This case-control study assessed miR-410-3p and the expression of its predicted target genes PCDH8, VEGFA, and NUMB in ovarian endometriosis by measuring RNA from 48 ectopic lesions and 48 eutopic endometrial tissues, compared with 48 control endometrial samples collected during diagnostic laparoscopy; participants were sampled during the proliferative phase and excluded from confounding endometrial or inflammatory conditions. The key findings were decreased miR-410-3p in ectopic ovarian endometriosis relative to both eutopic tissues and controls, alongside increased VEGFA (and VEGF) and increased NUMB expression in ectopic lesions, while eutopic tissues did not differ significantly from controls for these measures. A major caveat is that the study primarily reports differential expression without direct functional assays demonstrating causal miR-410-3p regulation of these targets. Relevance to endometriosis: the paper’s title, design, and main results explicitly focus on ovarian endometriosis and investigate miR-410-3p, VEGFA, NUMB, and PCDH8 expression in eutopic versus ectopic endometrial tissue, with specific mention of endometriosis staging.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

BACKGROUND AND AIMS: Endometriosis is a condition in which tissue similar to the endometrium grows outside the uterus. Angiogenesis plays an important role in endometriosis development. Bioinformatics analysis indicates that miR-410-3p is involved in regulating VEGF, NUMB endocytic adaptor protein, and Protocadherin 8 (PCDH8) expression. Therefore, this study sought to assess miR-410-3p, VEGFA, NUMB, and PCDH8 expression in ovarian endometriosis. METHODS: The study analyzed 48 ectopic and eutopic tissue samples from individuals with ovarian endometriosis along with 48 controls. The levels of miR-410-3p and its corresponding hub genes were analyzed through real-time PCR. RESULTS: The findings demonstrated a decrease in miR-410-3p expression in the ectopic (0.53 ± 0.09-fold) compared to both the eutopic and the controls, which was 0.95 ± 0.09-fold and 1.007 ± 0.12-fold, respectively (p  0.99). The findings also indicated that VEGF expression was elevated in the ectopic (1.38 ± 0.26-fold) when in comparison to both eutopic and controls, which was 0.98 ± 0.08-fold and 1.002 ± 0.12-fold, respectively (p  0.99). The results for NUMB expression levels showed higher expression in ectopic (1.50 ± 0.33-fold) in comparison to the eutopic (0.98 ± 0.10-fold) and controls (1.004 ± 0.14-fold) (p  0.99). Moreover, PCDH8 expression was decreased in ectopic endometriosis (1.002 ± 0.14-fold) compared to both eutopic (1.001 ± 0.10-fold and controls (1.002 ± 0.14-fold) (p  0.99). CONCLUSION: It is proposed that miR-410-3p, along with its target genes VEGFA, NUMB, and PCDH8, may play a role in the ovarian endometriosis development and hold possible therapeutic significance for this disease.
Full text 19,738 characters · extracted from pmc · 10 sections · click to expand

Author

Niloufar Fardi Baghi: investigation, data curation, resources, and formal analysis. Farhad Mashayekhi: conceptualization, supervision, methodology, resources, writing – review and editing. Elham Hadipour: conceptualization and data analysis. Zivar Salehi: software, methodology, writing – review and editing.

Ethics

The study was done in line with the principles outlined in the 1964 Declaration of Helsinki. Ethical approval was obtained from the Ethics Committee of the University of Guilan (Approval ID: IR.GUILAN.REC.1403.034).

Consent

All participants in this project, including patients and controls, signed written informed consent.

Results

The results showed a significant decrease in miR‐410‐3p levels in ectopic ovarian endometriosis samples (0.53 ± 0.09‐fold) compared to the eutopic samples (0.95 ± 0.09‐fold) and controls (1.007 ± 0.12‐fold). Statistical analysis showed that the reduction in the expression of miR‐410‐3p in ovarian endometriosis was significant relative to both the control and eutopic groups ( p   0.99). Relative miR‐410‐3p expression in eutopic and ectopic tissue samples of patients with endometriosis (EM) and the control group. Statistical analysis indicated a significant reduction in miR‐410‐3p expression in the ectopic ovarian endometriosis tissue samples when compared to both the control and eutopic groups ( p   0.99). VEGF expression was assessed using real‐time PCR. The findings indicated that VEGF expression was elevated in the ectopic ovarian endometriosis tissue samples (1.38 ± 0.26‐fold) when in comparison to both eutopic samples and controls, which showed levels of 0.98 ± 0.08‐fold and 1.002 ± 0.12‐fold, respectively. Statistical analysis revealed a significant increase in VEGF expression in the ovarian endometriosis tissue samples compared to the control group and the eutopic group ( p   0.99). The expression levels of VEGFA in eutopic and ectopic tissue samples from patients with endometriosis (EM) and control subjects were analyzed. The statistical findings revealed a notable increase in VEGFA expression in the ectopic ovarian endometriosis tissue samples compared to both control and eutopic groups ( p   0.99). Analysis of NUMB expression revealed elevated levels in ectopic ovarian endometriosis tissues (1.50 ± 0.33‐fold) compared to the eutopic samples (0.98 ± 0.10‐fold) and controls (1.004 ± 0.14‐fold). Statistical evaluation showed a significant increase in NUMB expression in the ovarian endometriosis group compared to either controls ( p  < 0.001) or the eutopic groups ( p   0.99). The expression levels of NUMB were analyzed in both eutopic and ectopic tissue samples from endometriosis patients, as well as control subjects. The statistical analysis revealed a notable increase in NUMB expression in ectopic ovarian endometriosis tissue samples compared to both the control and eutopic groups ( p   0.99). The PCDH8 expression was assessed using real‐time PCR. Results indicated a reduction in PCDH8 expression in ectopic tissues (1.002 ± 0.14‐fold) compared to the eutopic samples (1.001 ± 0.10‐fold) and controls (1.002 ± 0.14‐fold). However, data analysis showed a significant rise in PCDH8 expression in the ectopic samples relative to both the control ( p  < 0.001) and eutopic ( p   0.99). The levels of PCDH8 expression were assessed in tissue samples from patients with endometriosis (EM), including both eutopic and ectopic tissues, as well as from control subjects. The statistical analysis showed a notable decrease in PCDH8 expression in ectopic ovarian endometriosis tissue samples compared to both the control group and the eutopic samples ( p   0.99).

Discussion

Endometriosis often results in infertility, dyspareunia, pelvic pain, and limitations in physical and sexual activities [ 14 ]. The condition commonly attributed to Sampson's theory of retrograde menstruation. While the exact causes are still not fully understood, genetic, epigenetic, hormonal imbalances, oxidative stress, and immune system factors are significant contributors [ 15 ]. Immune system dysregulation, which involves inflammatory elements, cytokines, and immune cells, promotes the implantation, growth, angiogenesis, and development of ectopic endometrial stromal cells (ESCs). Angiogenesis plays a key role in the development of endometriosis. Angiogenesis in endometriosis is intricately regulated by hormones, immune responses, and cytokines, leading to the identification and development of novel therapeutic targets [ 16 ]. Angiogenesis is essential for regular physiological functions, including the natural thickening and maturation of the endometrium, and plays a key role in the menstrual cycle [ 17 ]. The regulation of angiogenesis is influenced by both pro‐ and antiangiogenic factors. VEGF is one of the key stimulators of angiogenesis [ 16 ]. Studies have shown that VEGF levels are increased in this disease [ 18 ]. Additionally, altered serum VEGF levels have been documented in endometriosis [ 19 ]. It has been demonstrated that the average VEGF concentration in peritoneal fluid (PF) is increased in endometriosis patients. These findings indicate that abnormal levels of angiogenic factors may contribute to the development of the disease [ 20 ]. Furthermore, the VEGF + 405 G > C gene variation has been linked to an increased risk of endometriosis [ 21 ]. NUMB is an important regulator of angiogenesis, and postnatal inactivation of NUMB in endothelial cells has been shown to impair vessel development. NUMB proteins regulate VEGF receptor endocytosis, thereby supporting angiogenesis [ 10 ]. In the context of endometriosis, NUMB levels are greater in patients compared to controls [ 22 ]. Similarly, elevated NUMB expression has been observed in endometrial cancer tissues, suggesting a role in cancer development, potentially via nuclear translocation [ 23 ]. PCDH8 functions as a tumor suppressor, with its increased expression capable of inhibiting both EMT and angiogenesis. Studies have demonstrated that PCDH8 suppresses glioma cell proliferation [ 24 ]. Investigations into the impact of PCDH8 overexpression on angiogenesis revealed that PCDH8 decreased the secretion of VEGFA and inhibited the AKT signaling pathway, thereby reducing tumor‐induced angiogenesis. Consequently, PCDH8 overexpression seems to influence at least one signaling pathway that diminishes the production and release of angiogenic factors, ultimately hindering angiogenesis [ 25 ]. PCDH8 is capable of downregulating VEGFA and suppressing the AKT signaling pathway, which leads to decreased proliferative, invasive, angiogenic, and metastatic capabilities of the cells [ 9 ]. Additionally, studies indicate that PCDH8 expression is reduced in ovarian cancer tissues, with lower levels correlating with a poor prognosis. Experimental evidence shows that increasing PCDH8 expression can inhibit cell growth and migration of ovarian cancer cells. These data show that diminished PCDH8 expression might be used as a marker of poor prognosis, while PCDH8 itself could function as a potential suppressor of tumor in ovarian cancer [ 26 ]. A variety of miRNAs have been found to be altered in various diseases, leading to the discovery of numerous possible biomarkers. Studies investigating the link between miRNAs and various diseases have consistently demonstrated notable changes in miRNA expression, especially concerning inflammatory pathways. Given that endometriosis is categorized as an inflammatory disorder, it is reasonable to investigate the potential association between endometriosis and miRNAs. Recent studies have confirmed that miRNA expression is changed in women with endometriosis [ 27 ]. Specifically, miR‐410‐3p has been shown to inhibit tumor growth [ 28 ]. Various investigations have reported changes in miRNA profiles; for instance, Pashaei et al. suggested that the level of miR‐203a‐3p is changed in patients with endometriosis, suggesting that this miR‐203a‐3p may contribute to disease development [ 29 ]. The present study faced several limitations. This study focused solely on miR‐410‐3p and three of its target genes: VEGFA, NUMB, and PCDH8 . While a single miRNA can target various genes, a single gene can also be regulated by multiple regulatory RNAs, and their target genes might also influence the progression of endometriosis. The study determined that miR‐410‐3p expression levels in ectopic endometrium were lower than those observed in eutopic and control samples. Nevertheless, patients with an ovarian endometriosis diagnosis showed significantly higher expression levels of VEGFA and NUMB , along with reduced PCDH8 expression in ectopic tissues when compared to controls. The elevated VEGFA and NUMB expression could be attributed to the decreased presence of miR‐410‐3p, as both are identified as targets of this specific miRNA, according to bioinformatics analysis.

Conclusions

The findings of this study demonstrated a reduced expression of miR‐410‐3p in ovarian endometriosis. Additionally, ectopic endometrial tissues from affected patients showed increased VEGFA and NUMB expression and decreased PCDH8 levels compared to eutopic endometrial tissues and control samples. The current results also indicate that miR‐410‐3p may be a promising biomarker for ovarian endometriosis. Its reduced expression, along with the dysregulation of its target genes ( VEGFA, NUMB , and PCDH8 ), underscores a regulatory network linked to angiogenesis and the persistence of lesions. Additional research on circulating levels of miR‐410‐3p and longitudinal studies could validate its potential for early diagnosis, disease monitoring, and therapeutic targeting.

Introduction

The endometrium is a specialized tissue influenced by steroids, playing a crucial role in human reproductive processes. It lines the interior of the uterus and reacts to hormonal fluctuations, undergoing a regular cycle of thickening and shedding in most women of reproductive age [ 1 , 2 ]. The human endometrium consists of two layers: the superficial functionalis and the deeper basalis. The basalis layer remains intact during menstruation and serves as the foundation for the functionalis layer regeneration, which is shed in response to the withdrawal of progesterone [ 2 ]. Endometriosis occurs when functional endometrial tissue is located in the peritoneal cavity, typically seen on the outer surfaces of the uterus and ovaries, but occasionally found on the diaphragm as well. The primary signs associated with endometriosis include persistent painful menstruation, painful intercourse, and infertility [ 3 ]. The revised American Society for Reproductive Medicine (rASRM) scoring system classifies endometriosis into four stages based on severity, size, depth, location, and lesion quantity [ 4 ]. Endometriosis is a multifaceted condition with complex origins, and its precise causes remain largely unclear. Various genes, particularly those involved in angiogenesis, play vital roles in the onset of endometriosis. Macrophages, which promote blood formation and release trophic factors, are present in increased numbers in individuals with endometriosis. They are recognized as a source of VEGF, facilitating the formation of blood vessels within endometriotic lesions [ 5 ]. It is widely acknowledged that blood formation is essential for the formation and growth of endometriosis lesions in ectopic locations. Additionally, in ovarian cancer patients, VEGF serves as a prognostic marker for those with residual macroscopic disease, highlighting a direct link between angiogenesis and oxidative stress [ 6 , 7 ]. VEGF‐A serves three key roles in vascularization: stimulating endothelial cell growth and movement, and promoting the release of MMPs [ 8 ]. Research indicates that the release of VEGFA is inhibited by Protocadherin 8 (PCDH8), thereby hindering tumor‐associated angiogenesis. Consequently, the overexpression of PCDH8 appears to influence at least one signaling pathway, reducing the production and release of angiogenic factors like VEGF and ultimately limiting angiogenesis [ 9 ]. The NUMB endocytic adaptor protein regulates the endocytosis, signaling, and recycling of the VEGF receptor, which supports the angiogenic development of blood vessels. In vitro studies have demonstrated that Numb also governs VEGF receptor signaling [ 10 ]. MicroRNAs (miRNAs), a type of small noncoding RNA, are recognized as essential posttranscriptional regulators associated with various human diseases. They play a critical role in numerous cellular processes angiogenesis and cell death [ 11 ]). Research on global expression profiling has identified hundreds of miRNAs that exhibit alterations in many diseases, including endometriosis, leading to numerous potential biomarkers [ 12 ]. Some of these dysregulated miRNAs are directly implicated in disease pathways, while others are specifically associated with the presence of the disease, although their biological roles remain unclear. PCDH8 and NUMB , both of which play a role in regulating VEGFA, were selected because VEGFA is essential for angiogenesis, a process vital to the development of endometriosis. Research utilizing RNA‐seq data has identified miR‐410‐3p as a critical regulator within gene networks linked to endometriosis, indicating its important role in the disease's molecular pathways. miR‐410‐3p plays a key role in EMT, that facilitate cell migration in endometriosis [ 13 ]. Evidence from databases, including http://mirdb.org , suggests that miR‐410‐3p regulates PCDH8, VEGFA , and NUMB expression. Based on these insights, we aimed to evaluate miR‐410‐3p, PCDH8, VEGFA , and NUMB expression in ovarian endometriosis.

Transparency

The corresponding author, Farhad Mashayekhi, affirms that this manuscript is an honest, accurate, and transparent account of the study being reported; that no important aspects of the study have been omitted; and that any discrepancies from the study as planned (and, if relevant, registered) have been explained.

Coi Statement

The authors declare no conflicts of interest.

Materials And Methods

Three available online databases were employed for bioinformatics analysis and target gene identification: miRBase, miRTarBase, and the GEO repository maintained by NCBI (Figure  1 ). miR‐410‐3p‐protein interaction network. This figure shows miR‐410‐3p and its target genes, namely VEGFA, NUMB, and PCDH8. In this study, gene expression was evaluated using samples from 48 eutopic, 48 ectopic, and 48 control tissues. A total of 48 women diagnosed with ovarian endometriosis through pathology were recruited at Aria Hospital in Rasht, Iran, between August 2023 and May 2024. All participants underwent either laparoscopic or laparotomic surgical procedures. During elective diagnostic laparoscopy for endometriosis, both ectopic and eutopic endometrial tissue samples were collected. Pathological biopsies verified the existence of ovarian endometriosis as diagnosed by pathologists. The ages of the women ranged from 24 to 49 years, and they maintained regular menstrual cycles without having received any hormone medications or immunomodulatory treatments in the previous 3 months. These women did not have any other endometrial disorders, such as endometrial hyperplasia, carcinoma, nor did they have any inflammatory, autoimmune, endocrine diseases, or cancers. The control group comprised 48 normal endometrial samples from women admitted for various reasons, such as fallopian tube blockage and pelvic pain, who did not have endometriosis. Ectopic samples were taken during laparoscopic surgery from women with endometriosis, while the eutopic endometrial samples were collected using a pipelle. Control endometrial samples were sourced from women without any indication of endometriosis during diagnostic laparoscopy. Individuals with leiomyoma, adenomyosis, cancer, or a previous history of endometriosis were excluded from the control group. Table  1 summarizes the information regarding age, parity, and the stage of endometriosis in the patients with endometriosis. Tissue samples were collected throughout the proliferative phase of the menstrual cycle. Tissue samples were preserved in tubes with RNAlater (Ambion; Thermo Fisher Scientific Inc.) and kept at −70°C until used. The research was granted approval by the Ethics Committee of the University of Guilan (IR.GUILAN. REC.1403.034) and was conducted following the ethical guidelines established in the Declaration of Helsinki by the World Medical Association. Before the collection of samples, all women provided informed consent. Information regarding age, parity, and the stage of endometriosis in the patients being analyzed ( n  = 48 for each group). Total RNA was extracted following the manufacturer's protocol, by the Trizol guanidinium isothiocyanate–phenol–chloroform from Invitrogen (Carlsbad, CA). All RNA extraction procedures were done in RNase‐free conditions. The RNA samples' purity and concentration were measured using a NanoDrop (NanoDrop 2000/2000c Spectrophotometer). The integrity of the RNA was evaluated by running a 2.0% agarose gel electrophoresis. For cDNA synthesis, the PrimeScript cDNA Synthesis Kit (Thermo Fisher Scientific, USA) was used based on the instructions of the manufacturer, and the synthesized cDNA samples were kept at −70°C. Gene expression was assessed by a commercial master mix from Thermo Fisher Scientific, USA. Table  2 shows the sequence of primer used in this study which were designed using DNA sequences from the NCBI GenBank database with Oligo Primer Analysis Software (Version 7.54, Molecular Biology Insights, USA) and were synthesized by Bioneer, South Korea. miR‐410‐3p expression was normalized to U6. The PCR reaction (total volume 20 μL) included: 1 μL cDNA template, 1 μL forward primer, 1 μL reverse primer, 7 μL RNase‐free water, and 10 μL master mix. Thermal cycling conditions consisted of an initial denaturation at 94°C for 8 min, followed by 39 cycles of: Denaturation at 94°C for 15 s and annealing at 60°C for 20 s. Sequences of specific primers designed to evaluate the expression levels of miR410‐3p, hsa‐U6, VEGFA, NUMB, PCDH8 , and has‐GAPDH in the tissue samples of patients with endometriosis and controls. F: TGGGGGAGCCATGAGATAAG R: GTGCAGGGTCCGAGGT F: CTCGCTTCGGCAGCACA R: AACGCTTCACGAATTTGCGT F: TTGCCTTGCTGCTCTACCTCCA R: GATGGCAGTAGCTGCGCTGATA F: AACGCCAACTATCCCTAGG R: ACTGGTTTGGTCATCGGAG F: CCCAGATGTCAACCTTCTGTAA R: CTCTGCAACCCTACTGTCTTG F: GTCTCCTCTGACTTCAACAGCG R: ACCACCCTGTTGCTGTAGCCAA Data analysis was performed using GraphPad Prism version 8. Comparisons between two groups were conducted using the one‐way ANOVA. The size of the sample was calculated using G*Power software (version 3.1.9.4) through a power analysis to meet statistical requirements ( n  = 48 for each group).

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: pmc

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Outcome instruments

rASRM

Condition tags

endometriosis

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-08-20T06:14:21.026120+00:00
pmc
last seen: 2026-05-13T20:22:03.195721+00:00
pubmed
last seen: 2026-08-20T06:10:03.375217+00:00
unpaywall
last seen: 2026-05-11T08:34:28.763810+00:00
License: CC-BY-NC-ND-4.0 · commercial use OK · attribution required
Courtesy of the U.S. National Library of Medicine