Mesenchymal Stem Cell-derived Exosomal miR-125b-5p Suppressed Retinal Microvascular Endothelial Cell Ferroptosis by Targeting P53 in Diabetic Retinopathy

Mesenchymal Stem Cell-derived Exosomal miR-125b-5p Suppressed Retinal Microvascular Endothelial Cell Ferroptosis by Targeting P53 in Diabetic Retinopathy | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Mesenchymal Stem Cell-derived Exosomal miR-125b-5p Suppressed Retinal Microvascular Endothelial Cell Ferroptosis by Targeting P53 in Diabetic Retinopathy Jun Tong, Yueqin Chen, Jinjin Xiang, Genhong Yao, Zhenping Huang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4001751/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Progressive endothelial cell injury of retinal vascular is a vital factor in diabetic retinopathy (DR) pathogenesis. Mesenchymal stromal cells-derived small extracellular vesicles (MSC-sEVs) showed beneficial effects on DR. However, the effects of MSC-sEVs in endothelial dysfunction of DR and the mechanism is still unclear. In this study, MSC-sEVs mitigated retinal blood-retina barrier(BRB) impairment in rats with streptozotocin (STZ)-induced DR by reducing ferroptosis in vivo and in vitro . MSC-sEVs miRNA sequencing analysis revealed that miR-125b-5p may mediate HRMEC ferroptosis and P53 as a downstream target based on dual-luciferase reporter assays. Silencing miR-125b-5p in MSC-sEVs reversed the therapeutic effects of MSC-sEVs on rats with DR and advanced glycation end products (AGE)-treated HRMECs. Additionally, overexpression of miR-125b-5p could diminish ferroptosis in HRMECs, and this effect could be effectively reversed by overexpressing P53. This study indicated the potential therapeutic effect of MSC-sEVs on vascular endothelial function maintenance and that the delivery of sEVs carrying miR-125b-5p could prevent endothelial cell ferroptosis by inhibiting P53, thereby protecting the BRB. small extracellular vesicles diabetic retinopathy HRMEC ferroptosis miR-125b-5p Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Diabetic retinopathy (DR) is recognized as a vision-threatening complication of diabetes, resulting in blindness among working people[ 1 ]. The pathogenesis of DR involves microvascular defects, neuronal dysfunction, and blood‒retinal barrier breakdown, which are responsible for vision loss[ 2 ]. It is expected that there will be 191 million DR suffers by 2040 globally, causing detrimental effects on individuals, families, and society[ 3 ]. The occurrence and progression of DR are so subtle that it is difficult to detect and assess visual impairment. The optimal time to diagnose and treat DR patients is easily missed in the clinic. Thus, further investigation into the pathogenesis of DR and identifying novel biomarkers is urgently required. Mesenchymal stem cells (MSCs) provide an approach for treating neurodegenerative disease through the secretion of many bioactive constituents, including extracellular vesicles (EVs), which are associated with angiogenesis, inflammation, and neurogenesis[ 4 – 6 ]. Small extracellular vesicles (sEVs), which are known as exosomes, are EVs ranging in diameter from 30 to 150 nm that derive from the invagination of endosomal membranes and are essential components of paracrine secretion[ 7 ]. Compared to stem cells, EVs have less immunogenicity and better circulatory stability, which makes them extremely promising for use in biotherapy. For instance, EVs isolated from MSCs can aid neurovascular remodeling and restore neurological function in diabetic complications[ 8 , 9 ]. Additionally, the abundant microRNAs in EVs mitigate the damage to neurological function induced by hypoxia and ischemia[ 10 , 11 ]. Ferroptosis, which is a new type of programmed cell death that differs from apoptosis, is characterized by high iron-dependent lipid peroxidation. The loss of selective permeability in cell membranes results from lipid peroxide buildup[ 12 , 13 ]. The glutathione peroxidase 4 (GPX4) enzyme is an essential component in preventing peroxidation damage to the cell membrane, which may protect the cell from oxidative stress. The antioxidant glutathione is depleted during ferroptosis, leading to GPX4 failure and fatal accumulation of lipid peroxides[ 14 – 16 ]. It have been reported that P53 can regulate solute carrier family 7, member 11 (SLC7A11) to aggravate ferroptosis by preventing the absorption of cysteine. The defective mutant P53 restores SLC7A11 expression and ameliorates ferroptosis[ 17 , 18 ]. As a result, addressing P53/SLC7A11 signaling might be a therapeutic approach for reversing ferroptosis. In this study, we investigated whether MSCs-sEVs could mitigate ferroptosis and explored the underlying mechanisms of MSCs-sEVs in STZ-induced rats. Our results showed that EVs containing miRNA-125b-5p alleviated ferroptosis in diabetic retinopathy by inhibiting P53. This study offers novel insight into the mechanisms by which MSCs-sEVs can treat DR. Methods and Materials Cell culture Human umbilical cord MSCs were obtained from Nanjing Drum Tower Hospital’s Rheumatology and Immunology Department. MSCs (3 to 5 generations) were cultured in Dulbecco’s modified Eagle’s medium (DMEM)/F12 containing 10% fetal bovine serum (FBS) (Bio-Channel Biotechnology, Nanjing, China). The human retina microvascular endothelial cells (HRMECs) used in this study were obtained from the Ophthalmology Department of Nanjing Jinling Hospital. HRMECs were cultured and passaged every 3–4 days in endothelial cell medium. The HRMECs (2 to 5 generations) were used in further studies. Cell transfection and coculture To inhibit the level of miR-125b-5p in MSC-sEVs, lentivirus that carried miR-125b-5p inhibitor and negative control (UCACAAGUUAGGGUCUCAGGGA, CAGUACUUUUGUGUAGUACAA) were transfected into MSCs, respectively, following the manufacturer’s protocol (GeneChem, Shanghai, China). The P53 overexpression plasmid (General Biol., Anhui, China) and the control plasmid were transfected into HRMECs using Lipo3000 (Invitrogen, Waltham, MA, USA). AGEs (ab51995, Abcam, USA) were applied to simulate the diabetic microenvironment. HRMECs were cocultured in a medium containing 200 µg/mL AGEs and MSC-sEVs (sEV, sEV miR−125b−5p(−) and sEV miR−NC ) for 48 hours. HRMECs with or without P53-OE were transfected with either the miR-125b-5p mimic or its corresponding negative control. The treated HRMECs were then stimulated with 200 µg/mL AGEs for another 48 h and collected for further analysis. Isolation and identification of MSC-sEVs MSCs were cultured until they reached 70%-80% confluence. Then, 5% exosome-free FBS was added to the flask, and MSCs were cultured for another 48 hours. MSC-sEVs were extracted from the MSCs supernatant using differential centrifugation as previously described[ 19 ]. The morphological characteristics of MSC-sEVs were determined using TEM (Hitachi HT7800, Tokyo, Japan). The diameter and quality of the MSC-sEVs were estimated using nanoparticle tracking analysis (NTA). Flow cytometry was also applied to determine the surface biomarkers of MSC-sEVs. Labeling and uptake of MSC-sEVs Did solution (abcam, Cambridge, UK) was used to fluorescently label MSC-sEVs. The removal of excess dye was centrifugated at 100,000×g. Did-labeled sEVs were cocultured with HRMECs for 24 h. The cells fixed and stained with DAPI. The absorption of MSC-sEVs by the HRMECs was captured by laser confocal microscopy. To assess the uptake of sEVs in vivo, Did-labeled MSC-sEVs were intravitreally injected. 24 hours after the injection, frozen sections of the eyes were examined. The retinal sections were incubated with Isolectin-B4 overnight and stained with DAPI. The confocal microscope was used for image acquirement. Establishment and treatment of the DR rat model All procedures for rat experiments were approved by the Institutional Ethics Committee of Nanjing Drum Tower Hospital, Medical School of Nanjing University and by the Rules for the Care and Use of Laboratory Animals formulated by the National Institutes of Health. After adaptive feeding, 8-week-old male rats (weight 200 ± 20 g) were intraperitoneally administered 60 mg/kg streptozotocin (STZ). 3 days later, glucose levels of rats > 16.7 mmol/L were included in the diabetes group. Rats were divided into groups through the utilization of a computer-based random order generator. Rats in the control group were administered citrate-buffered saline. Diabetic rats received an intravitreal injection of 5 µl of PBS, MSC-sEVs, MSC-sEV miR−NC , or MSC-sEV miR−125b−5p(−) . 1.5 × 10 9 sEVs were suspended in 5 µL of PBS for intravitreal injections. Injections procedures did not incorporate a blinding method. The tissues were collected for further analysis 4 weeks after injections. Hematoxylin-eosin staining The eyes were preserved in 4% paraformaldehyde, then treated with a 30% sucrose solution to remove water content. Tissues were embedded in paraffin, followed by slicing into 5-µm-thick sections. The sections were stained using hematoxylin–eosin (H&E), and pictures were taken using an FSX100 microscope. Retinal Vascular Permeability Assay The treated rats were femoral vein injection of 30 mg/mL Evans blue (EB) dye (Sigma, CA, USA) to assess the disruption of the BRB. The dye was injected into the femoral vein of the rats at 45 mg/kg. After 2 hours, the retinas were removed and examined. The tissues were homogenized in a trichloroacetic acid and ethanol solution, incubated for 24 h at 60°C, and then centrifugated at 10,000 × g for 15min. Following the collection of the supernatant, we gauged the absorbance using a microplate reader (Bio-Tek, Elx800, USA) at wavelengths of 620 nm and 740 nm. Immunofluorescence Staining For immunofluorescence labeling of 4-HNE, slices were fixed and permeabilized. After being blocked with 3% BSA in 1× PBS, the slices were incubated with rabbit anti-4-HNE antibodies (1:200; Abcam, Cambridge, UK) overnight at 4°C. The sections were incubated with donkey anti-rabbit IgG H&L (Alexa Fluor 555, 1:500; Invitrogen, USA) for 2 h. The sections were counterstained with DAPI and observed. For retinal flat mount immunofluorescence analysis, the eyes were fixed, dissected under a microscope, permeabilized with 2.5% Triton X-100, blocked with 3% BSA, incubated overnight with rabbit anti-collagen IV antibodies, and then incubated with corresponding fluorescent secondary antibody or isolectin B4 (IB4; 1:2000; Invitrogen). The samples were stained with DAPI, and captured under a confocal microscope. qRT‒PCR The miRNAs were extracted using TRIzol reagent. cDNA synthesis were used a First Strand cDNA Synthesis Kit (Vazyme Biotech, Nanjing, China). The stem-loop reverse-transcription (RT) primer was miR-125b-5p: 5’ -GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGGGAC-3’. qRT‒PCR was performed using a miRNA Universal SYBR Master Mix kit. Forward primer: miR-125b-5p: 5ʹ-CGCGAGTGTTCAATCCCAGA-3ʹ. The data were normalized to the endogenous control U6. For determining the relative expression levels, we employed the 2 −ΔΔCT method. Western Blot The treated cells and tissues were lysed with RIPA buffer (NCM Biotech Co., Ltd., China) and subjected to western blotting as described previously[ 20 ]. Antibodies against P53, SLC7A11 (1:1000; ABclonal, China), GPX4 (1:5000; Abcam, Cambridge, UK), and GAPDH (1:5000; ABclonal, China) were used followed the manufacturer's protocals. MiRNA sequencing of MSC-sEVs MiRNA library construction were carried out by Echo Biotech (Beijing, China). Sequencing libraries were created and samples were tagged with index codes to facilitate the identification of sequences. Unique molecular indexs (UMIs)-specific RT primers were created to measure miRNA levels. The sample, indexed through the acBot Cluster Generation System, was organized into clusters. After the clusters were created, paired-end reads were produced. An Illumina NovaSeq 6000 platform were used for the library preparations and sequenceing. Dual-Luciferase Reporter Assay Prediction of miR-125b-5p binding site in P53 3'UTR by miRanda database ( www.microrna.org/microrna/home.do ). The sequences that matched the 3′-UTR of P53 mRNA and miR-125b-5p binding sequence that contained the wild-type (WT) or mutated (MUT) were cloned into the control reporter vector (Promega, USA) to generate the pGL3-WT-P53 and pGL3-MUT-P53. MiR-125b-5p mimic or negative control was transfected into 293T cells and then cotransfected with pGL3-WT-P53 or pGL3-MUT-P53 3′-UTR. A luciferase assay kit (Promega, WI, USA) determined the Luciferase activity. Ferrous ions and lipid ROS detection The levels of total intracellular lipid ROS and ferrous ions in HRMECs were fluorescently determined using C11-BODIPY581/591 (5 µM, Invitrogen) and FerroOrange (10 µM, DOJINDO, Japan), respectively. HRMECs were cultured in antibiotic- and serum-free medium containing the C11-BODIPY solution for 20 min at 37°C and then subjected to FerroOrange staining at 37°C for 30 min. The intracellular ferrous ions and lipid ROS fluorescence were imaged under a confocal microscope. Transmission electron microscopy (TEM) detection HMRECs were fixed in 2.5% glutaraldehyde phosphate (Science Services), scraped, and collected. HMRECs were fixed in fresh glutaraldehyde for 2 h and then stored at 4°C. Subsequently, the cells were fixed with 1% osmic acid for 2 h. The cells were dehydrated, permeabilized, polymerized, and cut into 70-nm-thick sections. The samples were stained with uranium‒lead double stain. The samples were then observed by TEM. Statistical analysis The mean ± standard deviation is displayed based on data obtained from at least three independent experiments. Statistical analysis was conducted using GraphPad Prism 9.3.1. P values were calculated via Student’s t-test for two-group comparisons. For more than two-group comparisons, one-way ANOVA was used. Differences with a P value below 0.05 were deemed statistical significance. Results Characterization and identification of MSC-sEVs The collected MSC supernatant were subjected to ultracentrifugation to extract sEVs. MSC-sEVs were determined using transmission electron microscopy (TEM), NanoSight, and flow cytometry. TEM observation of the isolated vesicles revealed a uniform spherical shape with a double-layer membrane structure (Figure. 1A). The NanoSight results showed that the MSCs-sEVs had an average of 131.8 nm diameters, which was in keeping with the essential characteristics of EVs (Figure. 1B). The expression of CD63 and CD81 in sEVs, two well-known exosome molecular markers, was validated by flow cytometry (Figure. 1C). Thus, these characterizations showed that the particles collected from MSC-derived supernatants in this study were sEVs. Furthermore, as shown in Figure. 1D, Did-labeled MSCs-sEVs could be absorbed by HRMECs. MSC-sEVs administration attenuated diabetic retinopathy To investigate whether sEVs derived from MSCs could ameliorate diabetic retinopathy, we used hematoxylin-eosin (HE) staining to assess the structural morphology of retinal cells derived from rats. As shown in Figure. 1A, the tissues of the normal retina were clear and intact, and the cells were arranged in distinct layers with complete morphology. Rats in the sEVs group showed better structure improvements than those in the DR group, and the tissues were characterized by unclear layering, loosely and disordered arrangements of cells. Microvascular permeability was evaluated by Evans blue dye staining. Dye leakage was observed in the retinas of STZ-induced rat, but little Evans blue leakage was detected in the MSC-sEV-treated group (Figure. 2B, C). We next conducted double staining for collagen IV, which is an indicator of the basal membrane, and isolectin-B4 (IB4), which is a marker of retinal endothelial cells. The results showed that there were more acellular capillaries in diabetic retinas than in control retinas, and MSCs-sEVs reduced the number of acellular capillaries (Figure. 2D, E). These experiments suggested that MSC-sEVs treatment could attenuate diabetic retinopathy. MSC-sEVs inhibited ferroptosis in the retinas of STZ-induced rats Previous studies have revealed ferroptosis is associated with the progression of diabetic retinopathy[ 21 ]. To investigate whether ferroptosis was attenuated by MSC-sEV injection, we examined Did-labeled MSC-sEVs and found that some of the MSC-sEVs were colocalized with IB-4-stained endothelial cells (ECs) (Figure. 3A). Then, we measured the levels of 4-hydroxynonenal (4-HNE), a lipid peroxidation product, using immunofluorescence staining. 4-HNE was more reactive in the DR group, and the effects were attenuated in MSC-sEV-treated rats (Figure. 3B, C). Subsequently, we detected the levels of glutathione (GSH), which is a bioactive substance involved in antioxidant defense that protects cells from ferroptosis. GSH levels in the DR group were reduced, and MSC-sEVs reversed the change in GSH levels (Figure. 3D). WB was used to analyze the levels of SLC7A11 and GPX4, which are two ferroptosis-related markers. The levles of SLC7A11 and GPX4 was suppressed in the DR group but was upregulated by MSC-sEVs administration (Figure. 3F-H). These data demonstrated that MSC-sEVs inhibited ferroptosis in the retinas of STZ-induced rats MSC-sEVs protect HRMECs from AGE-induced ferroptosis We cultured HRMECs in 200 µg/ml AGEs for 48 h to mimic ferroptosis associated with diabetic retinopathy. As shown in Figure S1 , Cells underwent treatment with different concentrations of AGEs (0, 50, 100, 200, 400 µg/mL) for 48h. The results of the CCK-8 assay indicated a dose-dependent reduced cell activity, which was confirmed by the expression of the markers of ferroptosis-SLC7A11 and GPX4. AGEs-treated HRMECs exhibited small volumes, increased membrane density, mitochondrial shrinkage, and crest loss. Treatment of these cells with MSCs-sEVs restored mitochondrial morphology (Figure. 4A). The levels of detrimental oxidative stress products, including lipid reactive oxygen species (lipid-ROS), in HRMECs, were measured using C11-BODIPY 581/591 . Nonoxidized cells were labeled with red fluorescence and oxidized cells were labeled with green fluorescence. AGEs increased lipid-ROS levels, whereas MSC-sEVs reduced lipid-ROS levels compared to cells treated with AGEs alone (Figure. 4B, C). FerroOrange was used to examine ferrous ions in cells. As shown in Figure. 4D and E, AGEs induced intense ferrous fluorescence, and this effect was strongly reversed by MSC-sEV administration. WB indicated the levels of SLC7A11 and GPX4 in HRMECs treated with AGEs were lower than the control group. However, when HRMECs were treated with MSC-sEVs, the levels of SLC7A11 and GPX4 were restored (Figure. 4F-H). Collectively, these findings suggested that MSC-sEVs protected HRMECs from AGE-induced ferroptosis. MiR-125b-5p enrichment in MSC-sEVs suppresses ferroptosis We next investigated the miRNAs expression in MSC-sEVs and the underlying mechanism of the therapeutic benefits of MSC-sEVs. MiRNAs in MSC-sEVs were detected by microarray analysis. MiRNA-seq revealed the top ten most enriched miRNAs: miR-125b-5p, miR-21-5p, miR-143-3p, let-7i-5p, miR-146a-5p, miR-125b-5p, miR-199b-3p, miR-16-5p, miR-221-3p and let-7c-5p (Figure.5A,B). We searched for miRNAs that were involved in oxidative stress (miR-181a-5p, miR-126, miR-146a-5p, miR-125b-5p, miR-484, and miR-27)[ 22 – 27 ]. MiR-125b-5p and miR-146a-5p were candidates that were abundant in MSC-sEVs and were likely associated with ferroptosis (Figure. 5C). Subsequently, results of q-PCR showed that miR-125b-5p was downregulated in the DM group and was upregulated after MSC-sEVs administration (Figure. 5D). Treatment with MSC-sEVs did not increase the miR-146a-5p level in the retina of DR (Figure. S2). To determine the impact of miR-125b-5p on ferroptosis, the levels of SLC7A11 and GPX4 were examined using WB. WB showed that miR-125b-5p mimics increased the protein expression of SLC7A11 and GPX4 (Figure. 5E-G). These data illustrated that miR-125b-5p was enriched in EVs, could inhibit ferroptosis, and be absorbed by HRMECs. We next constructed miR-125b-5p-knockdown MSCs using a lentivirus-based method and the corresponding negative control. sEV miR−125b−5p(−) and sEV miR−NC were isolated from the corresponding MSCs supernatants. Confocal microscopy showed HRMECs internalizing MSC-sEVs' GFP-labeled miR-125b-5p (Figure. 5H). MSC-sEVs mitigate ferroptosis by inhibiting P53 via delivery of miR-125b-5p To further investigate the impacts of miR-125b-5p, the online database miRanda predicted that p53 may be the target by which miR-125b-5p regulates ferroptosis (Figure. 6A). Additionally, the luciferase reporter assay showed upregulation of miR-125b-5p lowered the activity of the luciferase reporter. (Figure. 6B). To further verify whether miR-125b-5p targets P53 in HRMECs, Western blotting of p53 in HRMECs treated with the miR-125b-5p mimic or its scrambled control was performed. The results revealed that P53 protein levels was decreased after transfection with the miR-125b-5p mimic (Figure. 6C). Subsequently, we investigated whether MSC-sEV-derived miR-125b-5p regulated ferroptosis. MSCs were infected with an LV-miR-125b-5p inhibitor or negative control, and MSC-sEV miR−125b−5p(−) and MSC-sEV miR−NC were extracted, respectively. As shown in Figure. 6D-G, the levels of P53 in AGE-treated HRMECs were significantly reduced by MSC-sEV and sEV miR−NC administration, and the expression levels of SLC7A11 and GPX4 were increased. Furthermore, the inhibition of P53 and activation of SLC7A11 and GPX4 were partially reversed by treatment with sEV miR−125b−5p(−) . C11-BODIPY 581/591 staining showed that MSC-sEVs and sEV miR−NC treatment lowered the levels of lipid-ROS than in the AGEs group, and sEV miR−125b−5p(−) treatment reversed lipid-ROS levels in MSC-sEVs and sEV miR−NC -treated cells (Figure. 6H). Collectively, these findings suggested that MSC-sEVs mitigated ferroptosis via delivery of miR-125b-5p. Overexpression of P53 reverses the effects of miR-125b-5p on ferroptosis To examine whether miR-125b-5p regulates ferroptosis by inhibiting P53, a rescue analysis was conducted. HRMEC was cotransfected with miR-125b-5p mimics and P53 overexpression plasmids and then treated with AGEs. The data revealed that overexpression of miR-125b-5p could reduce fluorescence intensity of FerroOrange in HRMECs, and this reduction was nullified by P53 overexpression (Figure. 7A, B). Moreover, overexpression of miR-125b-5p inhibited the protein levels of P53 and increase SLC7A11 and GPX4 expression, P53 overexpression in HRMECs reversed the protein levels. (Figure. 7C-F). Collectively, these experiments demonstrated that miR-125b-5p inhibited ferroptosis by inhibiting P53 and disinhibiting the SLC7A11/GPX4 signaling pathway. MiR-125b-5p inhibition alleviates the efficacy of MSC-sEVs on STZ-induced rats To validate whether miR-125b-5p mediates the therapeutic benefits of MSC-sEVs on STZ-induced rats, MSC-EV miR−NC and MSC-sEV miR−125b−5p(−) were administered via intravitreal injection. The miR-125b-5p expression level in sEV miR−125b−5p(−) treated rats showed a noticeable decrease in expression compared to the sEV and sEV miR−NC treatment group (Figure. 8A). Consistent with the previous results, WB showed that inhibition of miR-125b-5p in MSC-sEVs was found to elevate P53 levels and diminish GPX4 and SLC7A11 levels in diabetic retinas (Figure.8B-E). The GSH levels were increased in the MSC-sEVs and MSC-EV miR−NC groups, and MSC-sEV miR−125b−5p(−) administration partially reduced GSH levels (Figure. 8F). Additionally, 4-HNE immunofluorescence staining revealed that sEV miR−125b−5p(−) treatment elevated the 4-HNE expression compared with MSC-sEVs and MSC-EV miR−NC groups. Thus, miR-125b-5p was engaged in the effects of MSC-sEVs on ferroptosis in DR. Discussion The sharp increase of the incidence of diabetes and severe complications such as diabetic retinopathy has led to increased concern in recent years. Retinal vascular dysfunction involving progressive endothelial cell injury and cell loss are vital factors in DR pathogenesis[ 28 , 29 ]. However, the underlying mechanisms are still unclear. Ferroptosis has been reported to contribute to DR[ 21 ]. In the present study, we examined ferroptosis in STZ-induced DR and confirmed that MSC-sEVs could protect vascular endothelial function and maintain BRB stability. Furthermore, we revealed that miR-125b-5p was abundant in MSC-sEVs and inhibited endothelial cell ferroptosis by targeting P53. Ferroptosis has been identified as a newly recognized form of programmed cell death. Ferroptotic cells are characterized by dysfunctional mitochondria, which exhibit small volumes, increased membrane density, mitochondrial shrinkage, and crest loss[ 30 , 31 ]. The Xc − cystine/glutamate antiporter system reduces cystine uptake and glutathione (GSH) generation. The system Xc-GSH-GPX4 axis and lipid metabolism are involved in ferroptosis[ 12 , 32 ]. Recently, many studies have revealed that ferroptosis occurs in endothelial cells. It is reported that ferroptosis occurred in pulmonary microvascular endothelial cells and that Keap1/Nrf2/GPX4 signaling regulated this process[ 33 ]. ZnONPs induced lipid peroxidation in ECs, and the ferrostatin-1 (lipid-ROS scavenger) and the DFO (iron chelator) could alleviate ZnONP-stimulated ferroptosis in ECs[ 34 ]. High glucose and its metabolic products induce oxidative stress and iron overload, which trigger ferroptosis[ 35 , 36 ]. Liu et al. revealed that high glucose activated ferroptosis in hRECs and that the ZFAS1/miR-7-5p/ACSL4 signaling was responsible for this process. Our study demonstrated that AGEs could trigger ferroptosis in HRMECs. AGE-treated HRMECs exhibited smaller mitochondria, decreased mitochondrial ridges, disrupted outer mitochondrial membranes, and increased membrane density. AGEs also induced oxidative stress, iron accumulation, and Xc − system inhibition in HRMECs. The above data reveal that ferroptosis is essential for AGE-induced endothelial damage in DR. MSC-sEVs are crucial for cellular communication and promote tissue repair and regeneration while regulating inflammation and ferroptosis[ 37 – 39 ]. Liu et al. demonstrated that MSC-sEVs could protect against acute liver injury by suppressing ferroptosis. MSC-sEVs can reduce inflammation and ferroptosis to rescue cartilage injury in osteoarthritis. MSC-sEVs can also promote wound healing by stimulating proliferation and migration and suppressing ferroptosis in human umbilical vein endothelial cells. In our study, we verified that intravitreal injection of MSC-sEVs suppressed the expression of the lipid peroxidation product 4-HNE. MSC-sEV injection also increased GSH, SLC7A11, and GPX4 levels. Treatment with MSC-sEVs normalized retinal histology, reduced vascular leakage and accelerated the recovery of avascular capillaries in the retina. In vitro experiments revealed that MSC-sEVs protected HRMECs from ferroptosis, as evidenced by the restoration of mitochondrial structure, the reduction in lipid ROS and ferrous ion levels, and the recovery of the Xc − system. These in vitro findings and the effects of MSC-sEVs in vivo indicated that MSC-sEVs could be used to treat DR by preventing ferroptosis in endothelial cells. MicroRNAs serve as the primary means of cellular communication mediated by sEVs. To identify the underlying mechanism by which MSC-sEVs inhibit ferroptosis in DR, we investigated that miR-125b-5p was abundance in MSC-sEVs and exerted protective effects by ameliorating ferroptosis in DR. In the findings of this study, we revealed that transfecting the miR-125b-5p inhibitor into MSC-sEVs decreased the therapeutic efficacy of MSC-sEVs both in vivo and in vitro. The miR-125b-5p inhibitor rescued the expression of 4-HNE, GSH, SLC7A11 and GPX4 in STZ-induced rats. Downregulating miR-125b-5p in MSC-sEVs reversed the changes in lipid ROS, SLC7A11, and GPX4 protein levels in AGEs-induced HRMECs. However, further investigations are essential to uncover whether there are other microRNAs or alternative targets of miR-125b-5p that may confer beneficial effects, elucidating the potential contribution of diverse microRNAs originating from MSC-sEVs in DR. P53, which is an upstream modulator of SLC7A11, inhibits cysteine absorption to suppress SLC7A11 and initiate ferroptosis[ 18 ]. Therefore, inhibiting P53 to upregulate SLC7A11/GPX4 and mitigate ferroptosis serves as a strategy to impede the progression of DR. Bioinformatics analysis and high glucose–induced HRMECs exhibited a substantial rise in P53 expression when compared to the control group[ 40 ]. Consistent with these findings, P53 was upregulated in AGE-treated HRMECs and STZ-induced rats. Given that P53 is a target gene of miR-125b-5p, as confirmed by the luciferase reporter assay, we hypothesize that miR-125b-5p inhibits p53 and thus inhibits ferroptosis. In vitro, MSC-sEVs treatment inhibited AGEs-induced P53 activation and increased ferrous ion levels in HRMECs. However, these effects were dampened by treatment with the miR-125b-5p mimic and were reversed by P53 overexpression in HRMECs. The results indicated that MSC-sEVs could reduce ferroptosis by partly relying on the deactivation of p53 through miR-125b-5p. Conclusion In summary, our study revealed the efficacy role of MSC-sEVs in the maintenance of vascular endothelial function, and the delivery of sEVs carrying miR-125b-5p prevented endothelial cell ferroptosis, thereby protecting the BRB (Figure. 9). The outcomes of our research could pinpoint a promising focus for therapeutic intervention in the treatment of DR. Abbreviations MSCs mesenchymal stem cells DR diabetic retinopathy AGEs advanced glycation end products BRB blood–retina barrier sEVs small extracellular vesicles ECs endothelial cells STZ streptozotocin ROS reactive oxygen species GPX4 glutathione peroxidase 4 SLC7A11 solute carrier family 7, member 11 TEM transmission electron microscope HE Hematoxylin-eosin 4 HNE 4-hydroxynonenal GSH glutathione IB4 isolectin-B4 HRMEC Human retina microvascular endothelial cell Declarations Acknowledgements Not Application Author contributions TJ made contributions to experimental work, generating original drafts and organizing data; CY made contributions to the methodology, reviewed and edited the manuscript; XJ contributed to the methodology; YG played a role in providing financial support for the acquisition and supervision; HZ was involved in the conceptualization and design of the project, while XZ offered financial support and gave final approval for the manuscript. Funding Funding was provided by the National Natural Science Foundation of China. (NSFC) (grant no. 81970062, 81770061 to GY) Availability of data and materials The corresponding authors will provide access to all data upon reasonable request. Competing interests The authors have no declared competing interests. Consent for publication All authors agreed to publish. Author details 1 Department of Ophthalmology, Nanjing Drum Tower Hospital, Affiliated Hospital of Medical School, Nanjing University, Nanjing 210029, China. References Yau JW, Rogers SL, Kawasaki R, Lamoureux EL, Kowalski JW, Bek T, et al. Global prevalence and major risk factors of diabetic retinopathy. Diabetes Care. 2012;35:556–64. Wang W, Lo ACY. Diabetic Retinopathy: Pathophysiology and Treatments. Int J Mol Sci. 2018; 19. Zheng Y, He M, Congdon N. The worldwide epidemic of diabetic retinopathy. Indian J Ophthalmol. 2012;60:428–31. Zhang Y, Xie Y, Hao Z, Zhou P, Wang P, Fang S, et al. Umbilical Mesenchymal Stem Cell-Derived Exosome-Encapsulated Hydrogels Accelerate Bone Repair by Enhancing Angiogenesis. ACS Appl Mater Interfaces. 2021;13:18472–87. Ocansey DKW, Zhang L, Wang Y, Yan Y, Qian H, Zhang X, et al. Exosome-mediated effects and applications in inflammatory bowel disease. Biol Rev Camb Philos Soc. 2020;95:1287–307. Yu Z, Teng Y, Yang J, Yang L. The role of exosomes in adult neurogenesis: implications for neurodegenerative diseases. Neural Regen Res. 2024;19:282–8. van Niel G, D' Angelo G, Raposo G. Shedding light on the cell biology of extracellular vesicles. Nat Rev Mol Cell Biol. 2018;19:213–28. Zhao H, Shang Q, Pan Z, Bai Y, Li Z, Zhang H, et al. Exosomes From Adipose-Derived Stem Cells Attenuate Adipose Inflammation and obesity through polarizing M2 macrophages and beiging in white adipose tissue. Diabetes. 2018;67:235–47. Safwat A, Sabry D, Ragiae A, Amer E, Mahmoud RH, Shamardan RM. Adipose mesenchymal stem cells-derived exosomes attenuate retina degeneration of streptozotocin-induced diabetes in rabbits. J Circ Biomark. 2018;7:1849454418807827. Valadi H, Ekström K, Bossios A, Sjöstrand M, Lee JJ, Lötvall JO. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat Cell Biol. 2007;9:654–9. Dabrowska S, Andrzejewska A, Strzemecki D, Muraca M, Janowski M, Lukomska B. Human bone marrow mesenchymal stem cell-derived extracellular vesicles attenuate neuroinflammation evoked by focal brain injury in rats. J Neuroinflammation. 2019;16:019–1602. Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell. 2012;149:1060–72. Cao JY, Dixon SJ. Mechanisms of ferroptosis. Cell Mol Life Sci. 2016;73:2195–209. Forcina GC, Dixon SJ. GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis. Proteomics. 2019; 19. Ye Y, Chen A, Li L, Liang Q, Wang S, Dong Q, et al. Repression of the antiporter SLC7A11/glutathione/glutathione peroxidase 4 axis drives ferroptosis of vascular smooth muscle cells to facilitate vascular calcification. Kidney Int. 2022;102:1259–75. Chen Y, Guo X, Zeng Y, Mo X, Hong S, He H, et al. Oxidative stress induces mitochondrial iron overload and ferroptotic cell death. Sci Rep. 2023;13:023–42760. Lo M, Wang YZ, Gout PW. The x(c)- cystine/glutamate antiporter: a potential target for therapy of cancer and other diseases. J Cell Physiol. 2008;215:593–602. Jiang L, Kon N, Li T, Wang SJ, Su T, Hibshoosh H, et al. -Ferroptosis as a p53-mediated activity during tumour suppression. Nature. 2015;520:57–62. Zhang W, Wang Y, Kong Y. Exosomes Derived From Mesenchymal Stem Cells Modulate miR-126 to Ameliorate hyperglycemia-induced retinal inflammation via targeting HMGB1. Invest Ophthalmol Vis Sci. 2019;60:294–303. Tong J, Chen F, Du W, Zhu J, Xie Z. TGF-β1 Induces Human Tenon's Fibroblasts Fibrosis via miR-200b and Its Suppression of PTEN Signaling. Curr Eye Res. 2019;44:360–7. Shao J, Bai Z, Zhang L, Zhang F. Ferrostatin-1 alleviates tissue and cell damage in diabetic retinopathy by improving the antioxidant capacity of the Xc- -GPX4 system. Cell Death Discov. 2022;8:022–1141. Li X, Liao J, Su X, Li W, Bi Z, Wang J, et al. Human urine-derived stem cells protect against renal ischemia/reperfusion injury in a rat model via exosomal miR-146a-5p which targets IRAK1. Theranostics. 2020;10:9561–78. Wang W, Zheng Y, Wang M, Yan M, Jiang J, Li Z. Exosomes derived miR-126 attenuates oxidative stress and apoptosis from ischemia and reperfusion injury by targeting ERRFI1. Gene. 2019;690:75–80. Lin L, Chen X, Sun X, Xiao B, Li J, Liu J, et al. MiR-125b-5p is targeted by curcumin to regulate the cellular antioxidant capacity. Free Radic Res. 2022;56:640–50. Wang X, Yang J, Li H, Mu H, Zeng L, Cai S et al. miR-484 mediates oxidative stress-induced ovarian dysfunction and promotes granulosa cell apoptosis via SESN2 downregulation. Redox Biol. 2023; 62. D' Onofrio N, Prattichizzo F, Martino E, Anastasio C, Mele L, La Grotta R et al. MiR-27b attenuates mitochondrial oxidative stress and inflammation in endothelial cells. Redox Biol. 2023; 62. Liu HY, Yu LF, Zhou TG, Wang YD, Sun DH, Chen HR, et al. Lipopolysaccharide-stimulated bone marrow mesenchymal stem cells-derived exosomes inhibit H2O2-induced cardiomyocyte inflammation and oxidative stress via regulating miR-181a-5p/ATF2 axis. Eur Rev Med Pharmacol Sci. 2020;24:10069–77. Liu C, Sun W, Zhu T, Shi S, Zhang J, Wang J et al. Glia maturation factor-β induces ferroptosis by impairing chaperone-mediated autophagic degradation of ACSL4 in early diabetic retinopathy. Redox Biol. 2022; 52. Zhang J, Qiu Q, Wang H, Chen C, Luo D. TRIM46 contributes to high glucose-induced ferroptosis and cell growth inhibition in human retinal capillary endothelial cells by facilitating GPX4 ubiquitination. Exp Cell Res. 2021; 407. Stockwell BR, Jiang X. The Chemistry and Biology of Ferroptosis. Cell Chem Biol. 2020;27:365–75. Conrad M, Pratt DA. The chemical basis of ferroptosis. Nat Chem Biol. 2019;15:1137–47. Li J, Cao F, Yin HL, Huang ZJ, Lin ZT, Mao N, et al. Ferroptosis: past, present and future. Cell Death Dis. 2020;11:020–2298. Shen K, Wang X, Wang Y, Jia Y, Zhang Y, Wang K et al. miR-125b-5p in adipose derived stem cells exosome alleviates pulmonary microvascular endothelial cells ferroptosis via Keap1/Nrf2/GPX4 in sepsis lung injury. Redox Biol. 2023; 62. Lambert AJ, Brand MD. Reactive oxygen species production by mitochondria. Methods Mol Biol. 2009;554:165–81. Lin Y, Shen X, Ke Y, Lan C, Chen X, Liang B et al. Activation of osteoblast ferroptosis via the METTL3/ASK1-p38 signaling pathway in high glucose and high fat (HGHF)-induced diabetic bone loss. Faseb J. 2022; 36. Liu Y, Zhang Z, Yang J, Wang J, Wu Y, Zhu R, et al. lncRNA ZFAS1 Positively Facilitates Endothelial Ferroptosis via miR-7-5p/ACSL4 Axis in Diabetic Retinopathy. Oxid Med Cell Longev. 2022;31:9004738. Lin F, Chen W, Zhou J, Zhu J, Yao Q, Feng B, et al. Mesenchymal stem cells protect against ferroptosis via exosome-mediated stabilization of SLC7A11 in acute liver injury. Cell Death Dis. 2022;13:022–4708. Wang C, Zhou H, Wu R, Guo Y, Gong L, Fu K et al. - Mesenchymal stem cell-derived exosomes and non-coding RNAs: Regulatory and therapeutic role in liver diseases. Biomed Pharmacother. 2023; 157. Nie W, Huang X, Zhao L, Wang T, Zhang D, Xu T et al. -Exosomal miR-17-92 derived from human mesenchymal stem cells promotes wound healing by enhancing angiogenesis an inhibiting endothelial cell ferroptosis. Tissue Cell. 2023; 83. Liu J, Li X, Cheng Y, Liu K, Zou H, You Z. Identification of potential ferroptosis-related biomarkers and a pharmacological compound in diabetic retinopathy based on machine learning and molecular docking. Front Endocrinol. 2022; 13. Additional Declarations No competing interests reported. Supplementary Files FigureS1.pdf FigureS2.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4001751","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":275976777,"identity":"3d1eb8b5-b8d5-4228-9cf0-bd09f76dc3b6","order_by":0,"name":"Jun Tong","email":"","orcid":"","institution":"Nanjing Drum Tower Hospital, Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Jun","middleName":"","lastName":"Tong","suffix":""},{"id":275976778,"identity":"e1c0893e-69ee-49d1-ba85-ae16bdd1d15d","order_by":1,"name":"Yueqin Chen","email":"","orcid":"","institution":"Nanjing Drum Tower Hospital, Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Yueqin","middleName":"","lastName":"Chen","suffix":""},{"id":275976779,"identity":"f2d2571a-13a0-42cb-ab8d-55b45a8cc272","order_by":2,"name":"Jinjin Xiang","email":"","orcid":"","institution":"The First Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Jinjin","middleName":"","lastName":"Xiang","suffix":""},{"id":275976780,"identity":"9703a936-9326-4d7b-a1c4-aa5a3aedb079","order_by":3,"name":"Genhong Yao","email":"","orcid":"","institution":"Nanjing Drum Tower Hospital, Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Genhong","middleName":"","lastName":"Yao","suffix":""},{"id":275976781,"identity":"11b18443-e279-43cd-b214-e915fe0ded0d","order_by":4,"name":"Zhenping Huang","email":"","orcid":"","institution":"Nanjing General Hospital of Nanjing Military Command","correspondingAuthor":false,"prefix":"","firstName":"Zhenping","middleName":"","lastName":"Huang","suffix":""},{"id":275976782,"identity":"2bfb7a47-eff5-48d2-8b95-d7978607b2b1","order_by":5,"name":"Zhenggao Xie","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuklEQVRIie3QoQ7CMBCA4TZLimmYvQRCX2FkL8CjHGpqvhJC0pkls1M8ARp9TW3fAINCT84QmENycyT0Uyfuz6UVIkl+FAn72qhFQ3OSmJVLHXHGGemy/Rl2BW/bdJctDVFVDgSK0V4ZB/oH+t7q2q2OJNt4+55kECjoCLVbE2bSMRIF/hCerqgUYMFLdH6iIB0iPwFQ6NtIWzd9sme9xXSxHEZLxjSNv4+WkQjAz0yM/UnO3EuSJPljb7ZHP6eKFaOGAAAAAElFTkSuQmCC","orcid":"","institution":"Nanjing Drum Tower Hospital, Nanjing University","correspondingAuthor":true,"prefix":"","firstName":"Zhenggao","middleName":"","lastName":"Xie","suffix":""}],"badges":[],"createdAt":"2024-03-01 02:22:03","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4001751/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4001751/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":52087935,"identity":"9a7e03fc-3986-41a2-8f41-781d42319b4b","added_by":"auto","created_at":"2024-03-06 13:05:48","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1477273,"visible":true,"origin":"","legend":"\u003cp\u003eCharacterization and labeling of MSC-sEVs. (A) The ultrastructure of MSC-sEVs was observed by transmission electron microscopy. Scale bar, 100 nm. (B) Nanoparticle tracking analysis of sEVs. (C) Positive expression of CD63, CD81 in sEVs was determined using flow cytometry. (D) Fluorescence images showing the absorption of DiD-labeled sEVs by HRMECs. Scale bar, 30 µm.\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-4001751/v1/4d9e9891d7f21a2189bb4e4f.png"},{"id":52087936,"identity":"86eb3290-8518-4e8e-8d34-35c998aa824b","added_by":"auto","created_at":"2024-03-06 13:05:48","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3533754,"visible":true,"origin":"","legend":"\u003cp\u003eMSC-sEV administration mitigates diabetic retinopathy in STZ-induced rats. (A) Images of retinas stained with HE. Scale bar, 20 µm. (B) Microvascular permeability was evaluated in flat-mounted retinas by Evans blue fluorescence staining, Scale bar, 200 µm. (C) Quantification of Evans blue levels in the retina. (D) Images of staining for collagen IV and IB4; scale bar, 50 μm. (E) Quantification of acellular capillaries of retinas. White arrow: acellular capillaries. The number of acellular capillaries per section in each group. n=6, Data were shown as means ± SD. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01,***\u003cem\u003eP\u003c/em\u003e \u0026lt;0 .001. NFL, nerve fiber layer; IPL, inner plexiform layer; OPL, outer plexiform layer; GCL, ganglion cell layer; INL, inner nuclear layer; ONL, \u003ca href=\"https://www.so.com/link?m=bWYl+S1UFgFyZ8XXH3tEhHjwOgnI+D704AJcto010gRi7pnRfqv2hyaS+Gn+lFFZYgKvqpaUnm5UNWnKhvMaZXnOIuI31ax2jFrJFxZ+drCD4tRK6CTWGNkainikG1fzXME9ShWbyNA6+c26Jvnnoh/I8oddhI4KDmtRf8Tuvem0UGEjP7blUS1PMGPIoHpWjLqs7mtwgqqmVLNkMKrYkDfijci4ogJQwP2XJqNXyTNNZscD8SEUeKTHi9Vrxtfg8H9lcLg==\" target=\"_blank\"\u003eouter nuclear layer\u003c/a\u003e.\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-4001751/v1/ef3a33d59fdfdb7f0c4afbda.png"},{"id":52087243,"identity":"3300aa25-5ac0-4e60-ba07-b6879c5fb0b4","added_by":"auto","created_at":"2024-03-06 12:57:48","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1582254,"visible":true,"origin":"","legend":"\u003cp\u003eMSC-sEVs attenuate ferroptosis in the retinas of STZ-induced rats. (A) Images of frozen retinal sections showing DiD-labeled MSC-sEV uptake in vivo. (B) Flow chart of treatment regime and timeline for the in vivo rat models. (C) Representative immunofluorescence images showing the activation of 4-HNE in retinas and (D) the corresponding quantification of the fluorescence intensity in each group. (E) GSH levels of the retinas in each group (n=6). (F) Western blotting of SLC7A11 and GPX4 levels in the retinas (n=3, six retinas from six rats and two retinas in each group). (G, H) Relative quantification of the protein levels was calculated. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01,***\u003cem\u003eP\u003c/em\u003e \u0026lt;0 .001.\u003c/p\u003e","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-4001751/v1/75a395a31dccc16cd556f2bb.png"},{"id":52087960,"identity":"be4ee6ce-2965-417b-8ef2-239bdcb6e9b6","added_by":"auto","created_at":"2024-03-06 13:05:49","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2346837,"visible":true,"origin":"","legend":"\u003cp\u003eMSC-sEVs protect HRMECs from AGEs-induced ferroptosis. (A) Mitochondrial structure was determined by TEM; scale bar: 1.0 μm. (B) C11-BODIPY staining showed a significant increase in lipid peroxidation in HRMECs following AGE treatment, while MSC-sEVs decreased the increase in lipid peroxidation induced by AGEs. (C) The quantification of the fluorescence intensity ratio (n=4). (D) Ferrous ion levels were examined by FerroOrange staining, and (E) the corresponding quantification was performed (n=4). (F) The protein levels of SLC7A11 and GPX4 in HRMECs were determined by Western blotting. (G, H) The relative quantification of the protein levels were evaluated (n=3).\u003c/p\u003e","description":"","filename":"Fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-4001751/v1/a6ad6c3583e71877fbed7de3.png"},{"id":52087249,"identity":"26cab690-726e-426c-ba52-e70a067658c7","added_by":"auto","created_at":"2024-03-06 12:57:48","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1026823,"visible":true,"origin":"","legend":"\u003cp\u003eMiR-125b-5p is abundance in MSC-sEVs and mitigates ferroptosis in HRMECs. (A) The top 20 miRNAs in MSC-sEVs according to miRNA sequencing analysis. (B) Proportion of miRNAs among the total reads of miRNAs. (C) MiRNAs abundant in MSC-sEVs and the main miRNAs involved in oxidative stress. (D) The relative levels of miR-125b-5p in the retina was carried out by qRT‒PCR (n=4). (E) The levels of SLC7A11 and GPX4 in HRMECs transfected with the miR-125b-5p mimic or the negative control confirmed by Western blotting. (F, G) Relative SLC7A11 and GPX4 protein levels were quantified (n=3). (H) Uptake of Did-labeled sEV\u003csup\u003emiR-125b-5p(−) \u003c/sup\u003eby HRMECs was presented. Scale bar = 30 µm.\u003c/p\u003e","description":"","filename":"Fig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-4001751/v1/0be611a3cfa2602564f7ada7.png"},{"id":52087252,"identity":"ed6d77c2-ac83-40a9-9c26-81c81390f2df","added_by":"auto","created_at":"2024-03-06 12:57:49","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1781668,"visible":true,"origin":"","legend":"\u003cp\u003eMSC-sEVs mitigate ferroptosis by delivering miR-125b-5p. (A) The 3ʹ UTR sequence of the P53 gene, the binding site for miR-125b-5p, and the corresponding mutated (MUT) sequence. (B) Luciferase reporter gene assay used to validate P53 as a target gene of miR-125b-5p (n=3). (C, D) Western blotting of P53 protein levels in HRMECs transfected with the miR-125b-5p mimic or the negative control (n=3). (E) Relative miR-125b-5p levels in MSC-sEVs transfected with the miR-125b-5p inhibitor sEV\u003csup\u003emiR-125b-5p(−)\u003c/sup\u003e or sEV\u003csup\u003emiR-NC\u003c/sup\u003e were determined by qRT‒PCR (n=4). (F) Western blotting on P53, SLC7A11, and GPX4 for each group, with (G-I) subsequent relative quantification of protein levels. (J, K) C11-BODIPY staining showed that the increase in lipid ROS in HRMECs treated with MSC-sEVs was reversed by sEV\u003csup\u003emiR-125b-5p(-)\u003c/sup\u003e treatment (n=3).\u003c/p\u003e","description":"","filename":"Fig.6.png","url":"https://assets-eu.researchsquare.com/files/rs-4001751/v1/b0ecf34bdf7c9db0b47b9d5f.png"},{"id":52087251,"identity":"62f6d296-afea-4022-ac77-37320b5b41cc","added_by":"auto","created_at":"2024-03-06 12:57:49","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1281198,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOverexpression of P53 reversed the inhibitory effect of miR-125b-5p on ferroptosis in HRMECs. (A) \u003c/strong\u003eFerroOrange staining showing ferrous ion levels in each group and (B) the corresponding quantification(n=4). (C) P53, SLC7A11, and GPX4 levels were determined by western blotting. (D-F) the corresponding quantification of Figure 7C (n=3).\u003c/p\u003e","description":"","filename":"Fig.7.png","url":"https://assets-eu.researchsquare.com/files/rs-4001751/v1/2c738382a656023e85a89ccd.png"},{"id":52087253,"identity":"bc5a7d8b-d64c-477a-9589-9c043781c9a3","added_by":"auto","created_at":"2024-03-06 12:57:49","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1335790,"visible":true,"origin":"","legend":"\u003cp\u003emiR-125b-5p inhibition mitigates the efficacy of MSC-sEVs in STZ-induced rats. (A) Relative miR-125b-5p levels in retinas of each group were determined by qRT‒PCR (n=4). (B) Western blotting for levels of P53, SLC7A11, and GPX4in each group, (C-E) Corresponding densitometric quantification of P53, SLC7A11, and GPX4 levels was evaluated (n=3). (F) GSH levels in retinas of each group (n=6). (G) Representative images of 4-HNE in the retinas and (H) corresponding quantification of fluorescence intensity ratio were analyzed.\u003c/p\u003e","description":"","filename":"Fig.8.png","url":"https://assets-eu.researchsquare.com/files/rs-4001751/v1/fa9345790265bd9fd4ef957c.png"},{"id":52087254,"identity":"8e25f9b4-7734-43b5-a484-31c4b4530f53","added_by":"auto","created_at":"2024-03-06 12:57:49","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":780760,"visible":true,"origin":"","legend":"\u003cp\u003eGraphic abstract illustrates the potential therapeuticeffect of the MSC-sEVs on vascular endothelial function maintenanceand that the delivery of sEVs carrying miR-125b-5p could prevent endothelial cell ferroptosis by inhibiting P53, thereby protecting the BRB.\u003c/p\u003e","description":"","filename":"GraphicalAbstract.png","url":"https://assets-eu.researchsquare.com/files/rs-4001751/v1/f400c8ca30062df59321c03f.png"},{"id":53322266,"identity":"d2b64c06-e133-470a-85d5-d9a0736f9e96","added_by":"auto","created_at":"2024-03-24 03:37:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5325744,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4001751/v1/fa4754e8-5a29-44af-b19e-3f08b4a73b0e.pdf"},{"id":52087246,"identity":"89882328-0c54-41f3-ad3e-928787ff11a3","added_by":"auto","created_at":"2024-03-06 12:57:48","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":252402,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4001751/v1/29982311819352aea0915566.pdf"},{"id":52087245,"identity":"171cc961-646f-42c7-891c-ecba8c7dc54e","added_by":"auto","created_at":"2024-03-06 12:57:48","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":100927,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4001751/v1/38801e9a9c74afcf06a46f0e.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Mesenchymal Stem Cell-derived Exosomal miR-125b-5p Suppressed Retinal Microvascular Endothelial Cell Ferroptosis by Targeting P53 in Diabetic Retinopathy","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDiabetic retinopathy (DR) is recognized as a vision-threatening complication of diabetes, resulting in blindness among working people[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The pathogenesis of DR involves microvascular defects, neuronal dysfunction, and blood‒retinal barrier breakdown, which are responsible for vision loss[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. It is expected that there will be 191\u0026nbsp;million DR suffers by 2040 globally, causing detrimental effects on individuals, families, and society[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The occurrence and progression of DR are so subtle that it is difficult to detect and assess visual impairment. The optimal time to diagnose and treat DR patients is easily missed in the clinic. Thus, further investigation into the pathogenesis of DR and identifying novel biomarkers is urgently required.\u003c/p\u003e \u003cp\u003eMesenchymal stem cells (MSCs) provide an approach for treating neurodegenerative disease through the secretion of many bioactive constituents, including extracellular vesicles (EVs), which are associated with angiogenesis, inflammation, and neurogenesis[\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Small extracellular vesicles (sEVs), which are known as exosomes, are EVs ranging in diameter from 30 to 150 nm that derive from the invagination of endosomal membranes and are essential components of paracrine secretion[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Compared to stem cells, EVs have less immunogenicity and better circulatory stability, which makes them extremely promising for use in biotherapy. For instance, EVs isolated from MSCs can aid neurovascular remodeling and restore neurological function in diabetic complications[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Additionally, the abundant microRNAs in EVs mitigate the damage to neurological function induced by hypoxia and ischemia[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFerroptosis, which is a new type of programmed cell death that differs from apoptosis, is characterized by high iron-dependent lipid peroxidation. The loss of selective permeability in cell membranes results from lipid peroxide buildup[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The glutathione peroxidase 4 (GPX4) enzyme is an essential component in preventing peroxidation damage to the cell membrane, which may protect the cell from oxidative stress. The antioxidant glutathione is depleted during ferroptosis, leading to GPX4 failure and fatal accumulation of lipid peroxides[\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. It have been reported that P53 can regulate solute carrier family 7, member\u0026ensp;11\u0026ensp;(SLC7A11) to aggravate ferroptosis by preventing the absorption of cysteine. The defective mutant P53 restores SLC7A11 expression and ameliorates ferroptosis[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. As a result, addressing P53/SLC7A11 signaling might be a therapeutic approach for reversing ferroptosis.\u003c/p\u003e \u003cp\u003eIn this study, we investigated whether MSCs-sEVs could mitigate ferroptosis and explored the underlying mechanisms of MSCs-sEVs in STZ-induced rats. Our results showed that EVs containing miRNA-125b-5p alleviated ferroptosis in diabetic retinopathy by inhibiting P53. This study offers novel insight into the mechanisms by which MSCs-sEVs can treat DR.\u003c/p\u003e"},{"header":"Methods and Materials","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eHuman umbilical cord MSCs were obtained from Nanjing Drum Tower Hospital\u0026rsquo;s Rheumatology and Immunology Department. MSCs (3 to 5 generations) were cultured in Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM)/F12 containing 10% fetal bovine serum (FBS) (Bio-Channel Biotechnology, Nanjing, China). The human retina microvascular endothelial cells (HRMECs) used in this study were obtained from the Ophthalmology Department of Nanjing Jinling Hospital. HRMECs were cultured and passaged every 3\u0026ndash;4 days in endothelial cell medium. The HRMECs (2 to 5 generations) were used in further studies.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCell transfection and coculture\u003c/h2\u003e \u003cp\u003eTo inhibit the level of miR-125b-5p in MSC-sEVs, lentivirus that carried miR-125b-5p inhibitor and negative control (UCACAAGUUAGGGUCUCAGGGA, CAGUACUUUUGUGUAGUACAA) were transfected into MSCs, respectively, following the manufacturer\u0026rsquo;s protocol (GeneChem, Shanghai, China). The P53 overexpression plasmid (General Biol., Anhui, China) and the control plasmid were transfected into HRMECs using Lipo3000 (Invitrogen, Waltham, MA, USA). AGEs (ab51995, Abcam, USA) were applied to simulate the diabetic microenvironment. HRMECs were cocultured in a medium containing 200 \u0026micro;g/mL AGEs and MSC-sEVs (sEV, sEV\u003csup\u003emiR\u0026minus;125b\u0026minus;5p(\u0026minus;)\u003c/sup\u003e and sEV\u003csup\u003emiR\u0026minus;NC\u003c/sup\u003e) for 48 hours. HRMECs with or without P53-OE were transfected with either the miR-125b-5p mimic or its corresponding negative control. The treated HRMECs were then stimulated with 200 \u0026micro;g/mL AGEs for another 48 h and collected for further analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eIsolation and identification of MSC-sEVs\u003c/h2\u003e \u003cp\u003eMSCs were cultured until they reached 70%-80% confluence. Then, 5% exosome-free FBS was added to the flask, and MSCs were cultured for another 48 hours. MSC-sEVs were extracted from the MSCs supernatant using differential centrifugation as previously described[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The morphological characteristics of MSC-sEVs were determined using TEM (Hitachi HT7800, Tokyo, Japan). The diameter and quality of the MSC-sEVs were estimated using nanoparticle tracking analysis (NTA). Flow cytometry was also applied to determine the surface biomarkers of MSC-sEVs.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eLabeling and uptake of MSC-sEVs\u003c/h2\u003e \u003cp\u003eDid solution (abcam, Cambridge, UK) was used to fluorescently label MSC-sEVs. The removal of excess dye was centrifugated at 100,000\u0026times;g. Did-labeled sEVs were cocultured with HRMECs for 24 h. The cells fixed and stained with DAPI. The absorption of MSC-sEVs by the HRMECs was captured by laser confocal microscopy. To assess the uptake of sEVs in vivo, Did-labeled MSC-sEVs were intravitreally injected. 24 hours after the injection, frozen sections of the eyes were examined. The retinal sections were incubated with Isolectin-B4 overnight and stained with DAPI. The confocal microscope was used for image acquirement.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eEstablishment and treatment of the DR rat model\u003c/h2\u003e \u003cp\u003e All procedures for rat experiments were approved by the Institutional Ethics Committee of Nanjing Drum Tower Hospital, Medical School of Nanjing University and by the Rules for the Care and Use of Laboratory Animals formulated by the National Institutes of Health.\u003c/p\u003e \u003cp\u003eAfter adaptive feeding, 8-week-old male rats (weight 200\u0026thinsp;\u0026plusmn;\u0026thinsp;20 g) were intraperitoneally administered 60 mg/kg streptozotocin (STZ). 3 days later, glucose levels of rats\u0026thinsp;\u0026gt;\u0026thinsp;16.7 mmol/L were included in the diabetes group. Rats were divided into groups through the utilization of a computer-based random order generator. Rats in the control group were administered citrate-buffered saline. Diabetic rats received an intravitreal injection of 5 \u0026micro;l of PBS, MSC-sEVs, MSC-sEV\u003csup\u003emiR\u0026minus;NC\u003c/sup\u003e, or MSC-sEV\u003csup\u003emiR\u0026minus;125b\u0026minus;5p(\u0026minus;)\u003c/sup\u003e. 1.5 \u0026times; 10\u003csup\u003e9\u003c/sup\u003e sEVs were suspended in 5 \u0026micro;L of PBS for intravitreal injections. Injections procedures did not incorporate a blinding method. The tissues were collected for further analysis 4 weeks after injections.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eHematoxylin-eosin staining\u003c/h2\u003e \u003cp\u003eThe eyes were preserved in 4% paraformaldehyde, then treated with a 30% sucrose solution to remove water content. Tissues were embedded in paraffin, followed by slicing into 5-\u0026micro;m-thick sections. The sections were stained using hematoxylin\u0026ndash;eosin (H\u0026amp;E), and pictures were taken using an FSX100 microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eRetinal Vascular Permeability Assay\u003c/h2\u003e \u003cp\u003eThe treated rats were femoral vein injection of 30 mg/mL Evans blue (EB) dye (Sigma, CA, USA) to assess the disruption of the BRB. The dye was injected into the femoral vein of the rats at 45 mg/kg. After 2 hours, the retinas were removed and examined. The tissues were homogenized in a trichloroacetic acid and ethanol solution, incubated for 24 h at 60\u0026deg;C, and then centrifugated at 10,000 \u0026times; g for 15min. Following the collection of the supernatant, we gauged the absorbance using a microplate reader (Bio-Tek, Elx800, USA) at wavelengths of 620 nm and 740 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence Staining\u003c/h2\u003e \u003cp\u003eFor immunofluorescence labeling of 4-HNE, slices were fixed and permeabilized. After being blocked with 3% BSA in 1\u0026times; PBS, the slices were incubated with rabbit anti-4-HNE antibodies (1:200; Abcam, Cambridge, UK) overnight at 4\u0026deg;C. The sections were incubated with donkey anti-rabbit IgG H\u0026amp;L (Alexa Fluor 555, 1:500; Invitrogen, USA) for 2 h. The sections were counterstained with DAPI and observed.\u003c/p\u003e \u003cp\u003eFor retinal flat mount immunofluorescence analysis, the eyes were fixed, dissected under a microscope, permeabilized with 2.5% Triton X-100, blocked with 3% BSA, incubated overnight with rabbit anti-collagen IV antibodies, and then incubated with corresponding fluorescent secondary antibody or isolectin B4 (IB4; 1:2000; Invitrogen). The samples were stained with DAPI, and captured under a confocal microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eqRT‒PCR\u003c/h2\u003e \u003cp\u003eThe miRNAs were extracted using TRIzol reagent. cDNA synthesis were used a First Strand cDNA Synthesis Kit (Vazyme Biotech, Nanjing, China). The stem-loop reverse-transcription (RT) primer was miR-125b-5p: 5\u0026rsquo; -GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGGGAC-3\u0026rsquo;. qRT‒PCR was performed using a miRNA Universal SYBR Master Mix kit. Forward primer: miR-125b-5p: 5ʹ-CGCGAGTGTTCAATCCCAGA-3ʹ. The data were normalized to the endogenous control U6. For determining the relative expression levels, we employed the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eWestern Blot\u003c/h2\u003e \u003cp\u003eThe treated cells and tissues were lysed with RIPA buffer (NCM Biotech Co., Ltd., China) and subjected to western blotting as described previously[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Antibodies against P53, SLC7A11 (1:1000; ABclonal, China), GPX4 (1:5000; Abcam, Cambridge, UK), and GAPDH (1:5000; ABclonal, China) were used followed the manufacturer's protocals.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eMiRNA sequencing of MSC-sEVs\u003c/h2\u003e \u003cp\u003eMiRNA library construction were carried out by Echo Biotech (Beijing, China). Sequencing libraries were created and samples were tagged with index codes to facilitate the identification of sequences. Unique molecular indexs (UMIs)-specific RT primers were created to measure miRNA levels. The sample, indexed through the acBot Cluster Generation System, was organized into clusters. After the clusters were created, paired-end reads were produced. An Illumina NovaSeq 6000 platform were used for the library preparations and sequenceing.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eDual-Luciferase Reporter Assay\u003c/h2\u003e \u003cp\u003ePrediction of miR-125b-5p binding site in P53 3'UTR by miRanda database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003ca href=\"http://www.microrna.org/microrna/home.do\" target=\"_blank\"\u003ewww.microrna.org/microrna/home.do\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.microrna.org/microrna/home.do\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The sequences that matched the 3\u0026prime;-UTR of P53 mRNA and miR-125b-5p binding sequence that contained the wild-type (WT) or mutated (MUT) were cloned into the control reporter vector (Promega, USA) to generate the pGL3-WT-P53 and pGL3-MUT-P53. MiR-125b-5p mimic or negative control was transfected into 293T cells and then cotransfected with pGL3-WT-P53 or pGL3-MUT-P53 3\u0026prime;-UTR. A luciferase assay kit (Promega, WI, USA) determined the Luciferase activity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eFerrous ions and lipid ROS detection\u003c/h2\u003e \u003cp\u003eThe levels of total intracellular lipid ROS and ferrous ions in HRMECs were fluorescently determined using C11-BODIPY581/591 (5 \u0026micro;M, Invitrogen) and FerroOrange (10 \u0026micro;M, DOJINDO, Japan), respectively. HRMECs were cultured in antibiotic- and serum-free medium containing the C11-BODIPY solution for 20 min at 37\u0026deg;C and then subjected to FerroOrange staining at 37\u0026deg;C for 30 min. The intracellular ferrous ions and lipid ROS fluorescence were imaged under a confocal microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eTransmission electron microscopy (TEM) detection\u003c/h2\u003e \u003cp\u003eHMRECs were fixed in 2.5% glutaraldehyde phosphate (Science Services), scraped, and collected. HMRECs were fixed in fresh glutaraldehyde for 2 h and then stored at 4\u0026deg;C. Subsequently, the cells were fixed with 1% osmic acid for 2 h. The cells were dehydrated, permeabilized, polymerized, and cut into 70-nm-thick sections. The samples were stained with uranium‒lead double stain. The samples were then observed by TEM.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation is displayed based on data obtained from at least three independent experiments. Statistical analysis was conducted using GraphPad Prism 9.3.1. \u003cem\u003eP\u003c/em\u003e values were calculated via Student\u0026rsquo;s t-test for two-group comparisons. For more than two-group comparisons, one-way ANOVA was used. Differences with a \u003cem\u003eP\u003c/em\u003e value below 0.05 were deemed statistical significance.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eCharacterization and identification of MSC-sEVs\u003c/h2\u003e \u003cp\u003eThe collected MSC supernatant were subjected to ultracentrifugation to extract sEVs. MSC-sEVs were determined using transmission electron microscopy (TEM), NanoSight, and flow cytometry. TEM observation of the isolated vesicles revealed a uniform spherical shape with a double-layer membrane structure (Figure. 1A). The NanoSight results showed that the MSCs-sEVs had an average of 131.8 nm diameters, which was in keeping with the essential characteristics of EVs (Figure. 1B). The expression of CD63 and CD81 in sEVs, two well-known exosome molecular markers, was validated by flow cytometry (Figure. 1C). Thus, these characterizations showed that the particles collected from MSC-derived supernatants in this study were sEVs. Furthermore, as shown in Figure. 1D, Did-labeled MSCs-sEVs could be absorbed by HRMECs.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMSC-sEVs administration attenuated diabetic retinopathy\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo investigate whether sEVs derived from MSCs could ameliorate diabetic retinopathy, we used hematoxylin-eosin (HE) staining to assess the structural morphology of retinal cells derived from rats. As shown in Figure. 1A, the tissues of the normal retina were clear and intact, and the cells were arranged in distinct layers with complete morphology. Rats in the sEVs group showed better structure improvements than those in the DR group, and the tissues were characterized by unclear layering, loosely and disordered arrangements of cells. Microvascular permeability was evaluated by Evans blue dye staining. Dye leakage was observed in the retinas of STZ-induced rat, but little Evans blue leakage was detected in the MSC-sEV-treated group (Figure. 2B, C). We next conducted double staining for collagen IV, which is an indicator of the basal membrane, and isolectin-B4 (IB4), which is a marker of retinal endothelial cells. The results showed that there were more acellular capillaries in diabetic retinas than in control retinas, and MSCs-sEVs reduced the number of acellular capillaries (Figure. 2D, E). These experiments suggested that MSC-sEVs treatment could attenuate diabetic retinopathy.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMSC-sEVs inhibited ferroptosis in the retinas of STZ-induced rats\u003c/b\u003e \u003c/p\u003e \u003cp\u003ePrevious studies have revealed ferroptosis is associated with the progression of diabetic retinopathy[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. To investigate whether ferroptosis was attenuated by MSC-sEV injection, we examined Did-labeled MSC-sEVs and found that some of the MSC-sEVs were colocalized with IB-4-stained endothelial cells (ECs) (Figure. 3A). Then, we measured the levels of 4-hydroxynonenal (4-HNE), a lipid peroxidation product, using immunofluorescence staining. 4-HNE was more reactive in the DR group, and the effects were attenuated in MSC-sEV-treated rats (Figure. 3B, C). Subsequently, we detected the levels of glutathione (GSH), which is a bioactive substance involved in antioxidant defense that protects cells from ferroptosis. GSH levels in the DR group were reduced, and MSC-sEVs reversed the change in GSH levels (Figure. 3D). WB was used to analyze the levels of SLC7A11 and GPX4, which are two ferroptosis-related markers. The levles of SLC7A11 and GPX4 was suppressed in the DR group but was upregulated by MSC-sEVs administration (Figure. 3F-H). These data demonstrated that MSC-sEVs inhibited ferroptosis in the retinas of STZ-induced rats\u003c/p\u003e \u003cp\u003e \u003cb\u003eMSC-sEVs protect HRMECs from AGE-induced ferroptosis\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe cultured HRMECs in 200 \u0026micro;g/ml AGEs for 48 h to mimic ferroptosis associated with diabetic retinopathy. As shown in Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e, Cells underwent treatment with different concentrations of AGEs (0, 50, 100, 200, 400 \u0026micro;g/mL) for 48h. The results of the CCK-8 assay indicated a dose-dependent reduced cell activity, which was confirmed by the expression of the markers of ferroptosis-SLC7A11 and GPX4. AGEs-treated HRMECs exhibited small volumes, increased membrane density, mitochondrial shrinkage, and crest loss. Treatment of these cells with MSCs-sEVs restored mitochondrial morphology (Figure. 4A). The levels of detrimental oxidative stress products, including lipid reactive oxygen species (lipid-ROS), in HRMECs, were measured using C11-BODIPY \u003csup\u003e581/591\u003c/sup\u003e. Nonoxidized cells were labeled with red fluorescence and oxidized cells were labeled with green fluorescence. AGEs increased lipid-ROS levels, whereas MSC-sEVs reduced lipid-ROS levels compared to cells treated with AGEs alone (Figure. 4B, C). FerroOrange was used to examine ferrous ions in cells. As shown in Figure. 4D and E, AGEs induced intense ferrous fluorescence, and this effect was strongly reversed by MSC-sEV administration. WB indicated the levels of SLC7A11 and GPX4 in HRMECs treated with AGEs were lower than the control group. However, when HRMECs were treated with MSC-sEVs, the levels of SLC7A11 and GPX4 were restored (Figure. 4F-H). Collectively, these findings suggested that MSC-sEVs protected HRMECs from AGE-induced ferroptosis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eMiR-125b-5p enrichment in MSC-sEVs suppresses ferroptosis\u003c/h2\u003e \u003cp\u003eWe next investigated the miRNAs expression in MSC-sEVs and the underlying mechanism of the therapeutic benefits of MSC-sEVs. MiRNAs in MSC-sEVs were detected by microarray analysis. MiRNA-seq revealed the top ten most enriched miRNAs: miR-125b-5p, miR-21-5p, miR-143-3p, let-7i-5p, miR-146a-5p, miR-125b-5p, miR-199b-3p, miR-16-5p, miR-221-3p and let-7c-5p (Figure.5A,B). We searched for miRNAs that were involved in oxidative stress (miR-181a-5p, miR-126, miR-146a-5p, miR-125b-5p, miR-484, and miR-27)[\u003cspan additionalcitationids=\"CR23 CR24 CR25 CR26\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. MiR-125b-5p and miR-146a-5p were candidates that were abundant in MSC-sEVs and were likely associated with ferroptosis (Figure. 5C). Subsequently, results of q-PCR showed that miR-125b-5p was downregulated in the DM group and was upregulated after MSC-sEVs administration (Figure. 5D). Treatment with MSC-sEVs did not increase the miR-146a-5p level in the retina of DR (Figure. S2). To determine the impact of miR-125b-5p on ferroptosis, the levels of SLC7A11 and GPX4 were examined using WB. WB showed that miR-125b-5p mimics increased the protein expression of SLC7A11 and GPX4 (Figure. 5E-G). These data illustrated that miR-125b-5p was enriched in EVs, could inhibit ferroptosis, and be absorbed by HRMECs.\u003c/p\u003e \u003cp\u003eWe next constructed miR-125b-5p-knockdown MSCs using a lentivirus-based method and the corresponding negative control. sEV\u003csup\u003emiR\u0026minus;125b\u0026minus;5p(\u0026minus;)\u003c/sup\u003e and sEV\u003csup\u003emiR\u0026minus;NC\u003c/sup\u003e were isolated from the corresponding MSCs supernatants. Confocal microscopy showed HRMECs internalizing MSC-sEVs' GFP-labeled miR-125b-5p (Figure. 5H).\u003c/p\u003e \u003cp\u003e \u003cb\u003eMSC-sEVs mitigate ferroptosis by inhibiting P53 via delivery of miR-125b-5p\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo further investigate the impacts of miR-125b-5p, the online database miRanda predicted that p53 may be the target by which miR-125b-5p regulates ferroptosis (Figure. 6A). Additionally, the luciferase reporter assay showed upregulation of miR-125b-5p lowered the activity of the luciferase reporter. (Figure. 6B). To further verify whether miR-125b-5p targets P53 in HRMECs, Western blotting of p53 in HRMECs treated with the miR-125b-5p mimic or its scrambled control was performed. The results revealed that P53 protein levels was decreased after transfection with the miR-125b-5p mimic (Figure. 6C). Subsequently, we investigated whether MSC-sEV-derived miR-125b-5p regulated ferroptosis. MSCs were infected with an LV-miR-125b-5p inhibitor or negative control, and MSC-sEV\u003csup\u003emiR\u0026minus;125b\u0026minus;5p(\u0026minus;)\u003c/sup\u003e and MSC-sEV\u003csup\u003emiR\u0026minus;NC\u003c/sup\u003e were extracted, respectively. As shown in Figure. 6D-G, the levels of P53 in AGE-treated HRMECs were significantly reduced by MSC-sEV and sEV\u003csup\u003emiR\u0026minus;NC\u003c/sup\u003e administration, and the expression levels of SLC7A11 and GPX4 were increased. Furthermore, the inhibition of P53 and activation of SLC7A11 and GPX4 were partially reversed by treatment with sEV\u003csup\u003emiR\u0026minus;125b\u0026minus;5p(\u0026minus;)\u003c/sup\u003e. C11-BODIPY\u003csup\u003e581/591\u003c/sup\u003e staining showed that MSC-sEVs and sEV\u003csup\u003emiR\u0026minus;NC\u003c/sup\u003e treatment lowered the levels of lipid-ROS than\u003c/p\u003e \u003cp\u003ein the AGEs group, and sEV\u003csup\u003emiR\u0026minus;125b\u0026minus;5p(\u0026minus;)\u003c/sup\u003e treatment reversed lipid-ROS levels in MSC-sEVs and sEV\u003csup\u003emiR\u0026minus;NC\u003c/sup\u003e-treated cells (Figure. 6H). Collectively, these findings suggested that MSC-sEVs mitigated ferroptosis via delivery of miR-125b-5p.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eOverexpression of P53 reverses the effects of miR-125b-5p on ferroptosis\u003c/h2\u003e \u003cp\u003eTo examine whether miR-125b-5p regulates ferroptosis by inhibiting P53, a rescue analysis was conducted. HRMEC was cotransfected with miR-125b-5p mimics and P53 overexpression plasmids and then treated with AGEs. The data revealed that overexpression of miR-125b-5p could reduce fluorescence intensity of FerroOrange in HRMECs, and this reduction was nullified by P53 overexpression (Figure. 7A, B). Moreover, overexpression of miR-125b-5p inhibited the protein levels of P53 and increase SLC7A11 and GPX4 expression, P53 overexpression in HRMECs reversed the protein levels. (Figure. 7C-F). Collectively, these experiments demonstrated that miR-125b-5p inhibited ferroptosis by inhibiting P53 and disinhibiting the SLC7A11/GPX4 signaling pathway.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eMiR-125b-5p inhibition alleviates the efficacy of MSC-sEVs on STZ-induced rats\u003c/h2\u003e \u003cp\u003eTo validate whether miR-125b-5p mediates the therapeutic benefits of MSC-sEVs on STZ-induced rats, MSC-EV\u003csup\u003emiR\u0026minus;NC\u003c/sup\u003e and MSC-sEV\u003csup\u003emiR\u0026minus;125b\u0026minus;5p(\u0026minus;)\u003c/sup\u003e were administered via intravitreal injection. The miR-125b-5p expression level in sEV\u003csup\u003emiR\u0026minus;125b\u0026minus;5p(\u0026minus;)\u003c/sup\u003e treated rats showed a noticeable decrease in expression compared to the sEV and sEV\u003csup\u003emiR\u0026minus;NC\u003c/sup\u003e treatment group (Figure. 8A). Consistent with the previous results, WB showed that inhibition of miR-125b-5p in MSC-sEVs was found to elevate P53 levels and diminish GPX4 and SLC7A11 levels in diabetic retinas (Figure.8B-E). The GSH levels were increased in the MSC-sEVs and MSC-EV\u003csup\u003emiR\u0026minus;NC\u003c/sup\u003e groups, and MSC-sEV\u003csup\u003emiR\u0026minus;125b\u0026minus;5p(\u0026minus;)\u003c/sup\u003e administration partially reduced GSH levels (Figure. 8F). Additionally, 4-HNE immunofluorescence staining revealed that sEV\u003csup\u003emiR\u0026minus;125b\u0026minus;5p(\u0026minus;)\u003c/sup\u003e treatment elevated the 4-HNE expression compared with MSC-sEVs and MSC-EV\u003csup\u003emiR\u0026minus;NC\u003c/sup\u003e groups. Thus, miR-125b-5p was engaged in the effects of MSC-sEVs on ferroptosis in DR.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe sharp increase of the incidence of diabetes and severe complications such as diabetic retinopathy has led to increased concern in recent years. Retinal vascular dysfunction involving progressive endothelial cell injury and cell loss are vital factors in DR pathogenesis[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. However, the underlying mechanisms are still unclear. Ferroptosis has been reported to contribute to DR[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In the present study, we examined ferroptosis in STZ-induced DR and confirmed that MSC-sEVs could protect vascular endothelial function and maintain BRB stability. Furthermore, we revealed that miR-125b-5p was abundant in MSC-sEVs and inhibited endothelial cell ferroptosis by targeting P53.\u003c/p\u003e \u003cp\u003eFerroptosis has been identified as a newly recognized form of programmed cell death. Ferroptotic cells are characterized by dysfunctional mitochondria, which exhibit small volumes, increased membrane density, mitochondrial shrinkage, and crest loss[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The Xc\u0026thinsp;\u0026minus;\u0026thinsp;cystine/glutamate antiporter system reduces cystine uptake and glutathione (GSH) generation. The system Xc-GSH-GPX4 axis and lipid metabolism are involved in ferroptosis[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Recently, many studies have revealed that ferroptosis occurs in endothelial cells. It is reported that ferroptosis occurred in pulmonary microvascular endothelial cells and that Keap1/Nrf2/GPX4 signaling regulated this process[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. ZnONPs induced lipid peroxidation in ECs, and the ferrostatin-1 (lipid-ROS scavenger) and the DFO (iron chelator) could alleviate ZnONP-stimulated ferroptosis in ECs[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. High glucose and its metabolic products induce oxidative stress and iron overload, which trigger ferroptosis[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Liu et al. revealed that high glucose activated ferroptosis in hRECs and that the ZFAS1/miR-7-5p/ACSL4 signaling was responsible for this process. Our study demonstrated that AGEs could trigger ferroptosis in HRMECs. AGE-treated HRMECs exhibited smaller mitochondria, decreased mitochondrial ridges, disrupted outer mitochondrial membranes, and increased membrane density. AGEs also induced oxidative stress, iron accumulation, and Xc\u0026thinsp;\u0026minus;\u0026thinsp;system inhibition in HRMECs. The above data reveal that ferroptosis is essential for AGE-induced endothelial damage in DR.\u003c/p\u003e \u003cp\u003eMSC-sEVs are crucial for cellular communication and promote tissue repair and regeneration while regulating inflammation and ferroptosis[\u003cspan additionalcitationids=\"CR38\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Liu et al. demonstrated that MSC-sEVs could protect against acute liver injury by suppressing ferroptosis. MSC-sEVs can reduce inflammation and ferroptosis to rescue cartilage injury in osteoarthritis. MSC-sEVs can also promote wound healing by stimulating proliferation and migration and suppressing ferroptosis in human umbilical vein endothelial cells. In our study, we verified that intravitreal injection of MSC-sEVs suppressed the expression of the lipid peroxidation product 4-HNE. MSC-sEV injection also increased GSH, SLC7A11, and GPX4 levels. Treatment with MSC-sEVs normalized retinal histology, reduced vascular leakage and accelerated the recovery of avascular capillaries in the retina. In vitro experiments revealed that MSC-sEVs protected HRMECs from ferroptosis, as evidenced by the restoration of mitochondrial structure, the reduction in lipid ROS and ferrous ion levels, and the recovery of the Xc\u0026thinsp;\u0026minus;\u0026thinsp;system. These in vitro findings and the effects of MSC-sEVs in vivo indicated that MSC-sEVs could be used to treat DR by preventing ferroptosis in endothelial cells.\u003c/p\u003e \u003cp\u003eMicroRNAs serve as the primary means of cellular communication mediated by sEVs. To identify the underlying mechanism by which MSC-sEVs inhibit ferroptosis in DR, we investigated that miR-125b-5p was abundance in MSC-sEVs and exerted protective effects by ameliorating ferroptosis in DR. In the findings of this study, we revealed that transfecting the miR-125b-5p inhibitor into MSC-sEVs decreased the therapeutic efficacy of MSC-sEVs both in vivo and in vitro. The miR-125b-5p inhibitor rescued the expression of 4-HNE, GSH, SLC7A11 and GPX4 in STZ-induced rats. Downregulating miR-125b-5p in MSC-sEVs reversed the changes in lipid ROS, SLC7A11, and GPX4 protein levels in AGEs-induced HRMECs. However, further investigations are essential to uncover whether there are other microRNAs or alternative targets of miR-125b-5p that may confer beneficial effects, elucidating the potential contribution of diverse microRNAs originating from MSC-sEVs in DR.\u003c/p\u003e \u003cp\u003eP53, which is an upstream modulator of SLC7A11, inhibits cysteine absorption to suppress SLC7A11 and initiate ferroptosis[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Therefore, inhibiting P53 to upregulate SLC7A11/GPX4 and mitigate ferroptosis serves as a strategy to impede the progression of DR. Bioinformatics analysis and high glucose\u0026ndash;induced HRMECs exhibited a substantial rise in P53 expression when compared to the control group[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Consistent with these findings, P53 was upregulated in AGE-treated HRMECs and STZ-induced rats. Given that P53 is a target gene of miR-125b-5p, as confirmed by the luciferase reporter assay, we hypothesize that miR-125b-5p inhibits p53 and thus inhibits ferroptosis. In vitro, MSC-sEVs treatment inhibited AGEs-induced P53 activation and increased ferrous ion levels in HRMECs. However, these effects were dampened by treatment with the miR-125b-5p mimic and were reversed by P53 overexpression in HRMECs. The results indicated that MSC-sEVs could reduce ferroptosis by partly relying on the deactivation of p53 through miR-125b-5p.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, our study revealed the efficacy role of MSC-sEVs in the maintenance of vascular endothelial function, and the delivery of sEVs carrying miR-125b-5p prevented endothelial cell ferroptosis, thereby protecting the BRB (Figure. 9). The outcomes of our research could pinpoint a promising focus for therapeutic intervention in the treatment of DR.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eMSCs\u0026nbsp; \u0026nbsp; \u0026nbsp;mesenchymal stem cells\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDR\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; \u0026nbsp;\u0026nbsp;diabetic retinopathy\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAGEs\u0026nbsp;\u0026nbsp;\u0026nbsp; \u0026nbsp;advanced glycation end products\u003c/p\u003e\n\u003cp\u003eBRB\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; \u0026nbsp;blood\u0026ndash;retina barrier\u0026nbsp;\u003c/p\u003e\n\u003cp\u003esEVs\u0026nbsp;\u0026nbsp;\u0026nbsp; \u0026nbsp;\u0026nbsp;small extracellular vesicles\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eECs\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;endothelial cells\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSTZ\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u0026nbsp;streptozotocin\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eROS \u0026nbsp; \u0026nbsp; \u0026nbsp;reactive oxygen species\u003c/p\u003e\n\u003cp\u003eGPX4 \u0026nbsp; \u0026nbsp; glutathione peroxidase 4\u003c/p\u003e\n\u003cp\u003eSLC7A11 \u0026nbsp;solute carrier family 7, member\u0026ensp;11\u0026ensp;\u003c/p\u003e\n\u003cp\u003eTEM \u0026nbsp; \u0026nbsp; \u0026nbsp;transmission electron microscope\u003c/p\u003e\n\u003cp\u003eHE \u0026nbsp; \u0026nbsp; \u0026nbsp; Hematoxylin-eosin\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e4 HNE \u0026nbsp; \u0026nbsp;4-hydroxynonenal\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eGSH \u0026nbsp; \u0026nbsp; \u0026nbsp;glutathione\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eIB4 \u0026nbsp; \u0026nbsp; \u0026nbsp; isolectin-B4\u003c/p\u003e\n\u003cp\u003eHRMEC \u0026nbsp; Human retina microvascular endothelial cell\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Application\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTJ made contributions to experimental work, generating original drafts and organizing data; CY made contributions to the methodology, reviewed and edited the manuscript; XJ contributed to the methodology; YG played a role in providing financial support for the acquisition and supervision; HZ was involved in the conceptualization and design of the project, while XZ offered financial support and gave final approval for the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFunding was provided by the National Natural Science Foundation of China. (NSFC) (grant no. 81970062, 81770061 to GY)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe corresponding authors will provide access to all data upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no declared competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors agreed to publish.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003eDepartment of Ophthalmology, Nanjing Drum Tower Hospital, Affiliated Hospital of Medical School, Nanjing University, Nanjing 210029, China.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eYau JW, Rogers SL, Kawasaki R, Lamoureux EL, Kowalski JW, Bek T, et al. Global prevalence and major risk factors of diabetic retinopathy. Diabetes Care. 2012;35:556\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang W, Lo ACY. Diabetic Retinopathy: Pathophysiology and Treatments. Int J Mol Sci. 2018; 19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng Y, He M, Congdon N. The worldwide epidemic of diabetic retinopathy. Indian J Ophthalmol. 2012;60:428\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Xie Y, Hao Z, Zhou P, Wang P, Fang S, et al. Umbilical Mesenchymal Stem Cell-Derived Exosome-Encapsulated Hydrogels Accelerate Bone Repair by Enhancing Angiogenesis. ACS Appl Mater Interfaces. 2021;13:18472\u0026ndash;87.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOcansey DKW, Zhang L, Wang Y, Yan Y, Qian H, Zhang X, et al. Exosome-mediated effects and applications in inflammatory bowel disease. Biol Rev Camb Philos Soc. 2020;95:1287\u0026ndash;307.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu Z, Teng Y, Yang J, Yang L. The role of exosomes in adult neurogenesis: implications for neurodegenerative diseases. Neural Regen Res. 2024;19:282\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan Niel G, D' Angelo G, Raposo G. Shedding light on the cell biology of extracellular vesicles. Nat Rev Mol Cell Biol. 2018;19:213\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao H, Shang Q, Pan Z, Bai Y, Li Z, Zhang H, et al. Exosomes From Adipose-Derived Stem Cells Attenuate Adipose Inflammation and obesity through polarizing M2 macrophages and beiging in white adipose tissue. Diabetes. 2018;67:235\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSafwat A, Sabry D, Ragiae A, Amer E, Mahmoud RH, Shamardan RM. Adipose mesenchymal stem cells-derived exosomes attenuate retina degeneration of streptozotocin-induced diabetes in rabbits. J Circ Biomark. 2018;7:1849454418807827.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eValadi H, Ekstr\u0026ouml;m K, Bossios A, Sj\u0026ouml;strand M, Lee JJ, L\u0026ouml;tvall JO. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat Cell Biol. 2007;9:654\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDabrowska S, Andrzejewska A, Strzemecki D, Muraca M, Janowski M, Lukomska B. Human bone marrow mesenchymal stem cell-derived extracellular vesicles attenuate neuroinflammation evoked by focal brain injury in rats. J Neuroinflammation. 2019;16:019\u0026ndash;1602.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell. 2012;149:1060\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao JY, Dixon SJ. Mechanisms of ferroptosis. Cell Mol Life Sci. 2016;73:2195\u0026ndash;209.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eForcina GC, Dixon SJ. GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis. Proteomics. 2019; 19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe Y, Chen A, Li L, Liang Q, Wang S, Dong Q, et al. Repression of the antiporter SLC7A11/glutathione/glutathione peroxidase 4 axis drives ferroptosis of vascular smooth muscle cells to facilitate vascular calcification. Kidney Int. 2022;102:1259\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y, Guo X, Zeng Y, Mo X, Hong S, He H, et al. Oxidative stress induces mitochondrial iron overload and ferroptotic cell death. Sci Rep. 2023;13:023\u0026ndash;42760.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLo M, Wang YZ, Gout PW. The x(c)- cystine/glutamate antiporter: a potential target for therapy of cancer and other diseases. J Cell Physiol. 2008;215:593\u0026ndash;602.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang L, Kon N, Li T, Wang SJ, Su T, Hibshoosh H, et al. -Ferroptosis as a p53-mediated activity during tumour suppression. Nature. 2015;520:57\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang W, Wang Y, Kong Y. Exosomes Derived From Mesenchymal Stem Cells Modulate miR-126 to Ameliorate hyperglycemia-induced retinal inflammation via targeting HMGB1. Invest Ophthalmol Vis Sci. 2019;60:294\u0026ndash;303.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTong J, Chen F, Du W, Zhu J, Xie Z. TGF-β1 Induces Human Tenon's Fibroblasts Fibrosis via miR-200b and Its Suppression of PTEN Signaling. Curr Eye Res. 2019;44:360\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShao J, Bai Z, Zhang L, Zhang F. Ferrostatin-1 alleviates tissue and cell damage in diabetic retinopathy by improving the antioxidant capacity of the Xc- -GPX4 system. Cell Death Discov. 2022;8:022\u0026ndash;1141.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X, Liao J, Su X, Li W, Bi Z, Wang J, et al. Human urine-derived stem cells protect against renal ischemia/reperfusion injury in a rat model via exosomal miR-146a-5p which targets IRAK1. Theranostics. 2020;10:9561\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang W, Zheng Y, Wang M, Yan M, Jiang J, Li Z. Exosomes derived miR-126 attenuates oxidative stress and apoptosis from ischemia and reperfusion injury by targeting ERRFI1. Gene. 2019;690:75\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin L, Chen X, Sun X, Xiao B, Li J, Liu J, et al. MiR-125b-5p is targeted by curcumin to regulate the cellular antioxidant capacity. Free Radic Res. 2022;56:640\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Yang J, Li H, Mu H, Zeng L, Cai S et al. miR-484 mediates oxidative stress-induced ovarian dysfunction and promotes granulosa cell apoptosis via SESN2 downregulation. Redox Biol. 2023; 62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD' Onofrio N, Prattichizzo F, Martino E, Anastasio C, Mele L, La Grotta R et al. MiR-27b attenuates mitochondrial oxidative stress and inflammation in endothelial cells. Redox Biol. 2023; 62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu HY, Yu LF, Zhou TG, Wang YD, Sun DH, Chen HR, et al. Lipopolysaccharide-stimulated bone marrow mesenchymal stem cells-derived exosomes inhibit H2O2-induced cardiomyocyte inflammation and oxidative stress via regulating miR-181a-5p/ATF2 axis. Eur Rev Med Pharmacol Sci. 2020;24:10069\u0026ndash;77.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu C, Sun W, Zhu T, Shi S, Zhang J, Wang J et al. Glia maturation factor-β induces ferroptosis by impairing chaperone-mediated autophagic degradation of ACSL4 in early\u0026ensp;diabetic\u0026ensp;retinopathy. Redox Biol. 2022; 52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang J, Qiu Q, Wang H, Chen C, Luo D. TRIM46 contributes to high glucose-induced ferroptosis and cell growth inhibition in human retinal capillary endothelial cells by facilitating GPX4 ubiquitination. Exp Cell Res. 2021; 407.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStockwell BR, Jiang X. The Chemistry and Biology of Ferroptosis. Cell Chem Biol. 2020;27:365\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eConrad M, Pratt DA. The chemical basis of ferroptosis. Nat Chem Biol. 2019;15:1137\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Cao F, Yin HL, Huang ZJ, Lin ZT, Mao N, et al. Ferroptosis: past, present and future. Cell Death Dis. 2020;11:020\u0026ndash;2298.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen K, Wang X, Wang Y, Jia Y, Zhang Y, Wang K et al. miR-125b-5p in adipose derived stem cells exosome alleviates pulmonary microvascular endothelial cells ferroptosis via Keap1/Nrf2/GPX4 in sepsis lung injury. Redox Biol. 2023; 62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLambert AJ, Brand MD. Reactive oxygen species production by mitochondria. Methods Mol Biol. 2009;554:165\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin Y, Shen X, Ke Y, Lan C, Chen X, Liang B et al. Activation of osteoblast ferroptosis via the METTL3/ASK1-p38 signaling pathway in high glucose and high fat (HGHF)-induced diabetic bone loss. Faseb J. 2022; 36.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Zhang Z, Yang J, Wang J, Wu Y, Zhu R, et al. lncRNA ZFAS1 Positively Facilitates Endothelial Ferroptosis via miR-7-5p/ACSL4 Axis in Diabetic Retinopathy. Oxid Med Cell Longev. 2022;31:9004738.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin F, Chen W, Zhou J, Zhu J, Yao Q, Feng B, et al. Mesenchymal stem cells protect against ferroptosis via exosome-mediated stabilization of SLC7A11 in acute liver injury. Cell Death Dis. 2022;13:022\u0026ndash;4708.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang C, Zhou H, Wu R, Guo Y, Gong L, Fu K et al. - Mesenchymal stem cell-derived exosomes and non-coding RNAs: Regulatory and therapeutic role in liver diseases. Biomed Pharmacother. 2023; 157.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNie W, Huang X, Zhao L, Wang T, Zhang D, Xu T et al. -Exosomal miR-17-92 derived from human mesenchymal stem cells promotes wound healing by enhancing angiogenesis an inhibiting\u0026ensp;endothelial\u0026ensp;cell\u0026ensp;ferroptosis. Tissue Cell. 2023; 83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu J, Li X, Cheng Y, Liu K, Zou H, You Z. Identification of potential ferroptosis-related biomarkers and a pharmacological compound in diabetic retinopathy based on machine learning and molecular docking. Front Endocrinol. 2022; 13.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"small extracellular vesicles, diabetic retinopathy, HRMEC, ferroptosis, miR-125b-5p","lastPublishedDoi":"10.21203/rs.3.rs-4001751/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4001751/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eProgressive endothelial cell injury of retinal vascular is a vital factor in diabetic retinopathy (DR) pathogenesis. Mesenchymal stromal cells-derived small extracellular vesicles (MSC-sEVs) showed beneficial effects on DR. However, the effects of MSC-sEVs in endothelial dysfunction of DR and the mechanism is still unclear. In this study, MSC-sEVs mitigated retinal blood-retina barrier(BRB) impairment in rats with streptozotocin (STZ)-induced DR by reducing ferroptosis \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e. MSC-sEVs miRNA sequencing analysis revealed that miR-125b-5p may mediate HRMEC ferroptosis and P53 as a downstream target based on dual-luciferase reporter assays. Silencing miR-125b-5p in MSC-sEVs reversed the therapeutic effects of MSC-sEVs on rats with DR and advanced glycation end products (AGE)-treated HRMECs. Additionally, overexpression of miR-125b-5p could diminish ferroptosis in HRMECs, and this effect could be effectively reversed by overexpressing P53. This study indicated the potential therapeutic effect of MSC-sEVs on vascular endothelial function maintenance and that the delivery of sEVs carrying miR-125b-5p could prevent endothelial cell ferroptosis by inhibiting P53, thereby protecting the BRB.\u003c/p\u003e","manuscriptTitle":"Mesenchymal Stem Cell-derived Exosomal miR-125b-5p Suppressed Retinal Microvascular Endothelial Cell Ferroptosis by Targeting P53 in Diabetic Retinopathy","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-06 12:57:43","doi":"10.21203/rs.3.rs-4001751/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4a343f3b-dedb-411d-b21d-568642b836ac","owner":[],"postedDate":"March 6th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-03-24T03:29:32+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-06 12:57:43","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4001751","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4001751","identity":"rs-4001751","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}