Advancing Dengue Virus Surveillance: A Rapid Multiplexed One-Step RT-PCR assay for Comprehensive Diagnosis and Serotype Identification | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Advancing Dengue Virus Surveillance: A Rapid Multiplexed One-Step RT-PCR assay for Comprehensive Diagnosis and Serotype Identification Mayank Gangwar, Alka Shukla, Digvijay Singh, Ashish Singh, Pradyot Prakash, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4134363/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Managing dengue effectively is crucial due to four virus serotypes causing varying infection severities. Dengue fever has becoming more prevalent. Cases of haemorrhagic fever place a significant cost on society and its survivors. This study analyses prevalent serotypes during an endemic situation for severity and community transmission. During a dengue outbreak in 2022, 514 samples were included in this study, and various diagnostic tests were employed. Dengue viral NS1 antigen gene, IgM antibody detection were executed using ELISA tests, while dengue RT-PCR for molecular confirmation using single-tube dengue multiplex RT-PCR assays to detect the presence of viral RNA and determine the infecting serotype. Data suggested that 108 were highly positive for dengue viral NS1Ag. Sensitivity and specificity of single-tube RT-PCR for dengue were found to be 79.41 and 100% respectively. Among the samples tested with the dengue Multiplex Real-Time PCR assay, 50.60% (n=41) were positive with DENV-2 being the most prevalent serotype followed by DENV-1 (32.10%, n=26) and DENV-3 (12.3%, n= 10). Dengue fever is a global health challenge, especially in India. Serotyping identifies circulating serotypes. RT-PCR multiplexing assay can be a promising molecular diagnostic method, proving highly sensitive, specific, and rapid. It holds great promise for swift and reliable dengue virus detection and serotyping, enhancing future identification of cases for vaccine development. Biological sciences/Microbiology Biological sciences/Microbiology/Clinical microbiology Health sciences/Diseases/Infectious diseases/Viral infection Dengue Serotype Multiplex Real-Time PCR TaqMan probe Dengue viral NS1 antigen gene Figures Figure 1 Figure 2 1. Introduction Dengue is a well-recognized vector-borne infectious disease exceedingly endemic to tropical and sub-tropical in many countries and is progressively spreading to the entire world (Khetarpal & Khanna et al., 2016 ; Chen & Vasilakis et al., 2011). This infection, takes hold of approximately 390 million people annually across the globe, out of which 96 million present with clinical symptoms (Kalita et al., 2020). Last few years have witnessed a great surge in the number of dengue positive cases along with invasion of new areas (Jentes et al., 2016 ; Wilder-Smith et al., 2017 ). Factors that have contributed to worldwide rapid transmission of this infection include urbanization, inclined international travelling, less effective measures to control vector spread, etc. (Gubler et al., 2006). Dengue includes various symptoms like mild fever, dengue haemorrhagic fever (DHF), rashes to life-threatening sickness like dengue shock syndrome (DSS) (Murphy & Whitehea et al., 2011). Over many years, the worldwide pervasiveness of dengue has expanded especially, mostly due to fluctuation in hereditary variety, geological beginning and dissemination of various serotypes of the infection. The frequent transmitter of this virus is believed to be female Aedes mosquitoes. The infectious causative agent belongs to the flavivirus genus also recognized as Dengue Virus (Simmons et al., 2012 ). Unlike the other members within the mentioned Flaviviridae family, each of which constitutes a monotypic species, some reported dengue serotypes, namely DENV 1–4. DENV-2 has been reported to be more prevailing serotype in our country followed by DENV-3 and − 4. Whereas few studies have reported DENV-3 to be more commonly found followed by DENV-2 type (Mustafa et al., 2015 ). Multiple DENV serotypes may be responsible for various episodes of mild to severe illness. At the moment, there is no commercially viable anti-dengue medication or preventive vaccine to tackle this widely rising public health concern (Gupta et al., 2012 ). The high prevalence of DENV serotypes that casing clinical manifestations poses a significant threat to local residents (Chakravarti et al., 2012 ). Most recent couple of years have seen an extraordinary flood in the quantity of dengue positive cases alongside attack of new regions. Factors that have added to overall fast transmission of this disease incorporate urbanization, slanted global voyaging, less powerful measures to control vector spread, and so on. Dengue contamination has a range of clinical side effects going from gentle fever, rashes to hazardous infection such as dengue shock condition and DHF. The regular transmitter of this infection is accepted to be female Aedes mosquitoes (Mustafa et al., 2015 ; Gupta et al., 2012 ; Chakravarti et al., 2012 ). To mitigate dengue risk and prepare for the upcoming vaccine, monitor virus types in diverse regions. Ongoing surveillance will provide baseline data on prevalent DENV serotypes, aiding early detection of circulation shifts and outbreak prediction. The study examined DENV serotypes in south-eastern Uttar Pradesh, India, using VRDL surveillance samples. 2. Material and Methods 2.1. Sample collection and study subjects Suspected case samples were received in the VRDL (biosafety level II laboratory), Department of Microbiology, IMS, BHU, Varanasi (UP), India. This study uses blood samples obtained from hospitals and adjacent districts for routine surveillance. The majority of the sample were received from District Malaria Officer, District Jaunpur, Government of Uttar Pradesh, India. The Institutional Ethics Committee (Dean/2022/IEC/3255) accepted the study design. The study protocol confirm that relevant guidelines and regulations were used in experiments. Individual written informed consent was not required in this retrospective study. This laboratory is a DHR-approved viral testing laboratory. The study includes 514 dengue suspected cases over a period of 6 months i.e. July to December 2022.The samples were selected on the basis of duration and outbreak situation as reported from the authorities irrespective of the age and associated factors. All suspected patients were expected to submit a complete case report form (CRF) filled out by their doctors, as well as blood samples. According to the CRF, the majority of the patients had fever, abdominal pain, and vomiting, and all were positive in the dengue strip test. Serum was extracted from blood samples and used to diagnose dengue. All serum samples were stored at -80ºC. 2.2. Serological Analysis (DENV viral NS1 antigen and IgM detection) Dengue NS1 antigen was used to determine using enzyme-linked immunosorbent assay (ELISA) (J. Mitra & Co. Pvt. Ltd, India). Dengue IgM-ELISA kit (version 2.4, NIV, Pune, India) was used to detect dengue IgM antibodies. The ELISA approach was carried out in accordance with the instruction manual provided by the manufacturer with the kit. The results were classified as reactive, equivocal, or non-reactive (Kumar et al., 2020 ). The equivocal samples were excluded from further investigation. 2.3. RNA extraction All collected samples underwent real-time RT-PCR analysis using extracted RNA (QIAamp Viral RNA Mini Kit), employing a column-based RNA extraction method. The entire process adhered to biosafety protocols and was carried out within a biosafety cabinet, ensuring compliance with the laboratory biosafety guidelines. 2.4. RT-PCR reaction system and its detailed parameters One-step RT-PCR based serotype identification (for dengue serotypes 1, 2, 3, and 4) of Dengue Virus Kit from TRUPCR® (Version 1.0) was used in this study. The reaction system includes a master-mix solution containing a hot-start DNA polymerase reaction buffer dNTPs, MgCl 2 and stabilisers, a reverse transcriptase enzyme mix, and dengue primer probe combinations. The experiments were conducted in 25 L reaction mixtures including 10 L template RNA. Two test tubes with different DENV primer probe mixes-1 and mix-2 must be prepared for one sample. DENV primer probe mix-1 identifies dengue virus and serotype-1, whereas DENV primer probe mix-2 detects dengue virus serotypes 1, 2, and 4. The reaction system included a 10 L master mix, 0.35 L enzyme mix, and 4.65 L DENV primer probe mix-1 or mix 2 as well as a 10 L extracted RNA sample for a total volume of 25 L. Dengue probes were labelled with DENV-FAM reporter, DENV-1-HEX reporter, DENV-2-FAM reporter, DENV-3-HEX reporter, and DENV-4-Tex Red/ROX reporter. CDC dengue RT-PCR primer set for references are DENV-1F-CAATGGATGACAACAGAAGAYATG, DENV-1R-TCCATCCATGGGTTTTCCTCTAT, DENV-2F-GCAGAAACACAACATGGAACRATAGT, DENV-2R-TGATGTAGCTGTCTCCRAATGG, DENV-3F- ATGGAATGTGTGGGAGGTGG, DENV-3R-GGCTTTCTATCCARTAGCCCATG, DENV-4R- GCAGATCTCTGGAAAAATGAACCA, and DENV-4F- GAGAATCTCTTCACCAACCCYTG. Thermocycling/temperature parameters i.e. reverse transcription at 50°C for 20 min followed by 94°C for 10 min. The PCR cycle for inactivation at 94°C for 15 s, trailed by 45 cycles at 55°C for 45 s, and annealing at 72°C for 15 s. The data were analyzed using Bio-Rad CFX Maestro 1.1 software Version 4.1.2 (Bio-Rad Laboratories © ). Each run includes negative and positive controls, with significant relative fluorescence units (RFU). 2.5. Dengue serotyping using RT-PCR assay Furthermore, all of the samples chosen for the study were processed for RT-PCR using the TRUPCR® DENV kit (3B BlackBio Biotech India Ltd.), which includes the detection of Dengue-specific RNA using the FAM/Green reporter as well as the four distinct serotypes DENV 1–4 according to the standard protocol (Mun et al., 2019 ). 2.6. Statistical analysis Statistical software (Sigma-Plot Version 11.0) was used to analyse the results in terms of means and SEM. Furthermore, the Student 't' test was used to compare frequency, percentage, and mean values. The p > 0.05 level was considered as significant values. 3. Results and Discussion The study includes 514 suspected samples, out of the 514, DENV IgM ELISA positive samples (n = 230) were excluded from the study. In addition, IgM equivocal samples which were found to be 86 were further excluded from the molecular investigation. Thus, a total of 198 dengue IgM ELISA negative samples were tested for dengue viral NS1 antigen test. Out of 198, a total of 108 samples were reported with high OD i.e. dengue viral antigen NS1 ELISA positive, while 35 samples were found to be equivocal and 55 were dengue viral antigen NS1 ELISA negative. A total of 108 positive dengue viral antigen NS1 ELISA samples with high OD and 42 dengue viral antigen NS1 negatives samples (to check the specificity of RT-PCR) were selected for dengue genotyping using RT-PCR. 3.1. Comparison of dengue viral NS1 antigen detection and real-time RT-PCR Out of 150 samples selected for RT-PCR on the basis of dengue viral antigen NS1 detection, 80out of 108 (74.04%) were found to be positive for dengue RT-PCR and 28 out of 108 (25.9%) were not detected using dengue RT-PCR primers. Thus, the overall efficiency of dengue viral antigen NS1 detection using RT-PCR was found to be 74.04%. The dengue RT-PCR sensitivity and specificity reported was 79.41 and 100% respectively, and the positive predictive values and negative predictive values were reported as 100 and 63% respectively (Table 1 ). Table 1 Comparison of dengue viral antigen NS1 detection and real time RT-PCR with respect to sensitivity and specificity Dengue viral NS1 antigen detection Real Time RT-PCR Total Concordance % Dis-concordance % PPV % NPV Positive Negative Positive 80 28 108 79.41 20.59 100 63 Negative 0 42 42 Total 80 70 150 PPV: Positive Predictive values; RT-PCR: Real-time PCR; NPV: Negative Predictive Values 3.2. Dengue serotyping using multiplex chain reaction Dengue multiplexing of total 150 samples were carried out and for initial screening, however 80 samples were screened for four distinct serotypes DENV 1–4 serotyping using RT-PCR. The RT-PCR amplification curves are presented in Fig. 1 (A-D). One-step master mix of dengue specific primers and dengue serotypes 1–4 were analysed in two tubes. First set of primers identified and analysed the presence of dengue specific samples, internal controls, and dengue serotype 1 (Fig. 1 A and 1 B). However, second set of master mix tube will identify the presence of dengue serotype 2–4 in the samples (Fig. 1 C and 1 D). We found no DENV-4 (n = 0) in the total positive RT-PCR DENV positive samples, but DENV-2 was the prevalent serotype, accounting for 50.60% of the total (n = 41), followed by DENV-1 (32.10% (n = 26), and DENV-3 was detected in 12.3% (n = 10) of the total cases. Figure 2 summarises the frequency circulation of DENV 1–4 virus. Thus, overall data suggested that DENV-4 was not detected throughout the study suggesting the absence of DENV-4 strain in eastern region of Uttar Pradesh, India. On the other hand, DENV-2 infected cases were predominant in the study samples from eastern region of Uttar Pradesh, India. However, in addition to the above findings, a total of 6 DENV positive RT-PCR samples were found to be undetected in all the 4 serotypes, which may suggest the presence of some new mutated serotype. These samples required whole genome sequencing to confirm the DENV serotypes. Discussions The term Arbovirus is derived from the Arthropod-Borne Virus, which positions a noteworthy threat to public health due to periodic epidemics in throughout world (Weaver & Reisen et al., 2010; Guzmán et al., 2010; Lindenbach et al., 2007 ). The last two decades have seen a meteoric rise in Arboviral Infections, of which DENV is a component. DENV is a Flaviviridae virus with single-stranded linear and monopartite RNA. The envelope, membrane, and capsid are the three structural components of the DENV genome along with seven non-structural proteins. DENV contains four different serotypes (DENV 1–4), which share 60–80% homology (Mackenzie et al., 2004 ; Bhatt et al., 2013 ). Clinically, the condition is defined as a hemorrhagic fever, and WHO amended its categorization guidelines from the previous guideline given in 1997 in 2009. The current guideline divides patients into three major groups based on clinical manifestations to facilitate better patient triage, particularly during a disease outbreak, and to provide consistency in case management. From 1968 to 2013, the state of Uttar Pradesh in northern India conducted dengue studies involving several dengue serotypes (Agarwal et al., 1999 ; Chaturvedi et al., 1970 ; Chaturvedi et al., 1974 ; Pandey et al., 2012 ; Chaturvedi et al., 1972 ). Data suggest presence of all serotypes of dengue in the selected area. Many recent studies suggested that mainly serotype 1, 2, & 3 were mainly co-circulated each of the 4 years (Khan & Khan et al., 2017 ; Khan & Lodhi et al.,2011; Kumar et al., 2001 ) while the DENV-4 was not detected at all. Our study results are well supported with the previous findings, with highest prevalence rate of DENV-2 in the tested population followed by DENV-1 then DENV-3. Dengue virus serotypes exhibit a diverse range of genotypes. For instance, in DENV-1, the predominant genotypes were identified as I and V. Within DENV-2, genotype IV comprised two prominent lineages. Additionally, DENV-3 predominantly exhibited genotype III, while DENV-4 was mainly associated with genotype I in various Indian states (Singh et al., 2016 ; Kumar et al., 2019 ). DENV-1 (type I) reported in Himachal Pradesh, Maharashtra, and Gujarat. Introducing a new variant to areas may cause larger epidemics. Ongoing monitoring is crucial due to limited circulation in some states, as transmission to non-widespread regions could lead to explosive outbreaks (Cecilia et al., 2017 ; Patil et al., 2018 ). Early detection of these variants may contribute the nature of genotypic variation and clinical implications. DENV-2 (Genotype V) having a wide geographical distribution and including majority of Indian population reported from northern India. However, DENV-2 (Genotype-IV) is also prevalent in southern India such as Kerala, Chennai, Tamil Nadu. The reason was possibly the presence of a conserved amino acid T102 sequence. However, DENV-3 reported in Western and Northern India (Patil et al., 2018 ). Conversely, DENV-4, the least prevalent serotype in these areas, was a major type in Tamil Nadu (Sharmila et al., 2019 ; Murugesan et al., 2020 ; Rajesh et al., 2020 ). In Uttar Pradesh, our study found no samples positive for DENV-4, possibly due to a shortage of samples. Our data indicates the presence of 6 DENV positive samples with unknown serotypes in the tested DENV 1–4. It can be the some other flavivirus strain, which required further whole genome sequencing. Some sort of viral natural selection, or genetic recombination leads to the evolution of new serotype. However, the promising Chimerivax tetravalent vaccination clinical trials have recently been halted. The eventual discovery of novel serotypes and other sylvatic strains could stymie progress for the development of dengue vaccine. Integrated Vector Management is critical for long-term dengue management that required diagnosis of various sylvatic dengue strains (Islam et al., 2020 ). Many researchers worldwide reported the above data (Rajesh et al., 2020 ; Sharmila et al., 2019 ; Murugesan et al., 2020 ). The recent findings in Uttar Pradesh lay the groundwork for future investigation. Valuable data can be acquired and utilised to anticipate DENV outbreaks by undertaking continual genetic monitoring. This database can serve as a valuable tool in anticipating and preparing for future outbreaks. To gain a comprehensive understanding of the circulating serotypes and any changes in dominance, further studies are necessary. Therefore, continued surveillance of DENV in the state is warranted. Conclusion In conclusion, dengue cases have been increased across almost all states in the country. It can be due to some specific dengue genotype that may lead to an increase in coinfections that require more clinical data for proper analysis. Multiplex RT-PCR can be more sensitive than conventional methods such as ELISA, RAPID or PCR, in detecting Dengue virus infections. The newly developed dengue serotype-specific molecular assays can be a useful tool in identifying the dengue serotyping, with no observed unspecific reactions even when multiple serotypes are circulating. Dengue specific serotypes were found to be more reliable making this one-step reaction mix a cost-effective, quick and easy tool for dengue serotyping. Declarations Acknowledgments The authors thankful to DHR, ICMR, New Delhi, India, to establish viral laboratory network under Scheme 5066. Funding Declaration The authors declared that the present research work is not supported or funded from any external source. Data availability The original data contributions is provided within the manuscript. Conflict of Interest The authors declared no conflict of interest. References A Murugesan, D Aridoss, S Senthilkumar, L Sivathanu, R Sekar, EM Shankar, et al. Molecular diversity of dengue virus serotypes 1–4 during an outbreak of acute dengue virus infection in Theni. India. Indian J Med Microbiol, 38 (2020), pp. 401–408. Agarwal R, Kapoor S, Nagar R, Misra A, Tandon R, Mathur A, Misra S, Dhole TN. A clinical study of the patients with dengue hemorrhagic fever during the epidemic of 1996 at Lucknow, India. Southeast Asian Journal of Tropical Medicine and Public Health. 1999;30(4):735–40. Bhatt S, Gething PW, Brady OJ, et al. The global distribution and burden of dengue. Nature. 2013;496(7446):504–507. doi: 10.1038/nature12060 Chakravarti A, Matlani M, Kashyap B, Kumar A. Awareness of changing trends in epidemiology of dengue fever is essential for epidemiological surveillance. Indian J Med Microbiol2012;30:222–6. Chaturvedi UC, Mathur A, Chandra A. A study of pathological changes in liver in dengue fever. In Proceedings of the annual meeting of the National Academy of Sciences, India (Vol. 44, pp. 156–166). 1974. Chaturvedi UC, Mathur A, Chandra A. A study of virological and serological features of dengue infection in north India. Indian Journal of Medical Research. 1972;60(7):1048–58. Chaturvedi UC, Mathur A, Chandra A. Study of clinical and biochemical profile of dengue fever in north India. In Proceedings of the annual meeting of the National Academy of Sciences, India (Vol. 40, pp. 153–165). 1970. Chen R., Vasilakis N. Dengue-Quo Tu et Quo Vadis? Viruses. 2011;3(9):1562–1608. D Cecilia, JA Patil, MB Kakade, A Walimbe, K Alagarasu, B Anukumar, et al. Emergence of the Asian genotype of DENV-1 in South India Virology, 510 (2017), pp. 40–45. doi: 10.3390/v3091562 . Gubler D. J. Dengue/dengue haemorrhagic fever: history and current status. Novartis Foundation Symposium. 2006; 277:3–16. doi: 10.1002/0470058005.ch2 . Gupta N, Srivastava S, Jain A, Chautevedi UC. Dengue in India. Indian J Med Res 2012; 136:373–90. Guzman MG, Halstead SB, Artsob H, et al. Dengue: a continuing global threat. Nat Rev Microbiol. 2010;8(12 Suppl):S7-S16. doi: 10.1038/nrmicro2460 Islam A, M Abdullah, A Tazeen, IH Naqvi, SN Kazim, A Ahmed, et al. Circulation of dengue virus serotypes in hyperendemic region of New Delhi, India during 2011–2017. J Infect Public Health, 13 (2020), pp. 1912–1919. JA Patil, K Alagarasu, MB Kakade, AM More, KA Gadekar, SM Jadhav, et al. Emergence of dengue virus type 1 and type 3 as dominant serotypes during 2017 in Pune and Nashik regions of Maharashtra, Western India. Infect Genet Evol, 66 (2018), pp. 272–283. Jentes ES, Lash RR, Johansson MA, Sharp TM, Henry R, Brady OJ, et al. Evidence- based risk assessment and communication: a new global dengue-risk map for travellers and clinicians. J Travel Med 2016;23 Kalita JM, Aggarwal A, Yedale K, Gadepalli R, Nag VL. A 5-year study of dengue seropositivity among suspected cases attending a teaching hospital of North-Western region of India. J Med Virol. 2021;93(6):3338–3343. doi: 10.1002/jmv.26592 . Khan J, Khan I, Amin I, Rahman S, Qureshi J, Khan TA. Dengue virus in Pakistan: historical perspective and current epidemic potential. Virol J. 2017;14(1):20. doi: 10.1186/s12985-017-0698-7 Khan M, Lodhi MS, Khalid B, et al. Serotype and genotype analysis of dengue virus by sequencing followed by phylogenetic analysis using samples from three mini outbreaks-2007-2009 in Pakistan. Virol J. 2011;8:143. doi: 10.1186/1743-422X-8-143 Khetarpal N, Khanna I. Dengue Fever: Causes, Complications, and Vaccine Strategies. JImmunol Res. 2016; 2016:6803098. doi: 10.1155/2016/6803098 . Kumar A, Sharma SK, Padbidri VS, et al. An outbreak of dengue fever in rural areas of Northern India. J Commun Dis. 2001;33(4):274–281. Kumar M, Verma RK, Mishra B. Prevalence of Dengue Fever in Western Uttar Pradesh, India: A Gender-Based Study. Int J Appl Basic Med Res. 2020;10(1):8–11. doi: 10.4103/ijabmr.IJABMR_337_18 Kumar NP, Jayakumar PR, George K, et al. Genetic characterization of dengue virus serotypes causing concurrent infection in an outbreak in Ernakulam, Kerala, South India. Indian J Med Res. 2019;150(1):66–71. doi: 10.4103/ijmr.IJMR_2173_16 Lindenbach BD, Thiel HJ, Rice CM. Flaviviridae: The Viruses and Their Replication. In: Knipe DM, Howley PM, eds. Fields Virology. 5th ed. Philadelphia, PA: Lippincott Williams & Wilkins; 2007:1101–1152. Mackenzie JS, Gubler DJ, Petersen LR. Emerging flaviviruses: the spread and resurgence of Japanese encephalitis, West Nile and dengue viruses. Nat Med. 2004;10(12 Suppl):S98-S109. doi: 10.1038/nm1144 Mun MJ, Bae JY, Kim JH, et al. One-step multiplex real-time RT-PCR for detection and typing of dengue virus. Mol Cell Probes. 2019;43:86–91. doi: 10.1016/j.mcp.2018.10.001 Murphy B. R., Whitehead S. S. Immune response to dengue virus and prospects for a vaccine. Annual Review of Immunology. 2011; 29:587–619. doi: 10.1146/annurev-immunol-031210-101315 . Mustafa MS, Rasotgi V, Jain S, Gupta V. Discovery of fifth serotype of dengue virus (DENV-5): A new public health dilemma in dengue control. Med J Armed Forces India. 2015;71(1):67–70. doi: 10.1016/j.mjafi.2014.09.011 . NT Rajesh, K Alagarasu, JA Patil, E Bharathi, A More, MB Kakade, et al. Serotype-specific differences in the laboratory parameters among hospitalized children with dengue and genetic diversity of dengue viruses circulating in Tamil Nadu, India during 2017. J Med Virol, 92 (2020), pp. 1013–1022. Pandey N, Jain A, Garg RK, Kumar R, Agrawal OP, Lakshmana Rao PV. Dengue fever in patients admitted in a tertiary care centre: clinical profile, outcome and impact on platelet count and serum electrolytes. Indian Journal of Medical Research. 2012;136(1):373–7. PF Sharmila, K Vanathy, B Rajamani, V Kaliaperumal, R. Dhodapkar. Emergence of dengue virus 4 as the predominant serotype during the outbreak of 2017 in South India. Indian J Med Microbiol, 37 (2019), pp. 393–400. Simmons, C. P., Farrar, J. J., van Vinh Chau, N. & Wills, B. Dengue. N. Engl. J. Med. 366, 1423–1432 (2012). Singh MP, Chadha MS, Chhabra M, et al. Molecular epidemiology of dengue viruses in India, 2014–2015. Am J Trop Med Hyg. 2016;95(2):462–467. doi: 10.4269/ajtmh.15-0817 Weaver SC, Reisen WK. Present and future arboviral threats. Antiviral Res. 2010;85(2):328–345. doi: 10.1016/j.antiviral.2009.10.008 Wilder-Smith A, Gubler DJ, Weaver SC, Monath TP, Heymann DL, Scott TW. Epidemic arboviral diseases: priorities for research and public health. Lancet Infect Dis. 2017; 17:101–6. World Health Organization. Dengue: Guidelines for Diagnosis, Treatment, Prevention and Control. WHO/HTM/NTD/DEN/2009.1 (World Health Organization, 2009). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4134363","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":300014133,"identity":"5565a6b5-0068-4dbf-8c3a-1a59dde2404c","order_by":0,"name":"Mayank Gangwar","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5ElEQVRIiWNgGAWjYNCCAyAiufEBkOThI0FLYrMBSAsbKVraJEAUQS267WcMPxecYUjc3p7YVvk1x06GjYH54aMbeLSYnckxlp5xgyFxzpmHbbdltyUDHcZmbJyDT8uBHANpng8MxhISiW23JbcxA7XwsEnj1XL+jfFvmJZiyW31RGi5kWMmzXODQQ6khfHjtsPEaHlWZs1zRkJOgudhszTjtuM8bMyE/HI+efNtnmM2PBLsyQc//txWbc/P3vzwMT4tDAwcoAgExwgDMw+YxKscBNgfwJmMPwiqHgWjYBSMgpEIADHxRW75V6v8AAAAAElFTkSuQmCC","orcid":"","institution":"Banaras Hindu University","correspondingAuthor":true,"prefix":"","firstName":"Mayank","middleName":"","lastName":"Gangwar","suffix":""},{"id":300014136,"identity":"cfaf2f4d-66d4-4be8-a065-18fe455b0de5","order_by":1,"name":"Alka Shukla","email":"","orcid":"","institution":"Banaras Hindu University","correspondingAuthor":false,"prefix":"","firstName":"Alka","middleName":"","lastName":"Shukla","suffix":""},{"id":300014141,"identity":"9d55167e-2566-447c-bbf1-d46dd92deb86","order_by":2,"name":"Digvijay Singh","email":"","orcid":"","institution":"Banaras Hindu University","correspondingAuthor":false,"prefix":"","firstName":"Digvijay","middleName":"","lastName":"Singh","suffix":""},{"id":300014146,"identity":"1eca96ee-352b-4ddb-b87b-2c861462496f","order_by":3,"name":"Ashish Singh","email":"","orcid":"","institution":"Banaras Hindu University","correspondingAuthor":false,"prefix":"","firstName":"Ashish","middleName":"","lastName":"Singh","suffix":""},{"id":300014151,"identity":"34963e31-f02f-4a74-b700-29e928b2ff99","order_by":4,"name":"Pradyot Prakash","email":"","orcid":"","institution":"Banaras Hindu University","correspondingAuthor":false,"prefix":"","firstName":"Pradyot","middleName":"","lastName":"Prakash","suffix":""},{"id":300014155,"identity":"e4d76d56-82c1-45f9-9f3b-17a337a1eb74","order_by":5,"name":"Gopal Nath","email":"","orcid":"","institution":"Banaras Hindu University","correspondingAuthor":false,"prefix":"","firstName":"Gopal","middleName":"","lastName":"Nath","suffix":""}],"badges":[],"createdAt":"2024-03-20 05:44:31","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4134363/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4134363/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":56281753,"identity":"651322fb-d232-4fc2-bee6-591ffd6ec356","added_by":"auto","created_at":"2024-05-10 21:19:44","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":375661,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eDENV 1-4 RT-PCR amplification of Dengue Virus using multiplexing RT-PCR one-step master mix assay (A) Amplification curves of Internal controls (IC) and dengue specific RNA, (B) Amplification curves of dengue serotype 1 along with IC and dengue specific primers, (C) Amplification curves of dengue serotype 2, and (D) Amplification curves of dengue serotype 3\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4134363/v1/1a3a9672ecec4328ebffd9ed.png"},{"id":56281865,"identity":"9e519422-2b62-4709-bc47-09f0065c3ce4","added_by":"auto","created_at":"2024-05-10 21:19:53","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":109414,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eDENV 1-4 frequency distribution of Dengue Virus using multiplexing RT-PCR\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4134363/v1/03acc7c952eea2eb34f9d70a.png"},{"id":57493181,"identity":"3bc27fb4-9840-4569-bb70-9e0de9f46a39","added_by":"auto","created_at":"2024-05-31 12:00:14","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":917560,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4134363/v1/aa9e5601-7a03-4770-a624-30ea144e032e.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Advancing Dengue Virus Surveillance: A Rapid Multiplexed One-Step RT-PCR assay for Comprehensive Diagnosis and Serotype Identification","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eDengue is a well-recognized vector-borne infectious disease exceedingly endemic to tropical and sub-tropical in many countries and is progressively spreading to the entire world (Khetarpal \u0026amp; Khanna et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Chen \u0026amp; Vasilakis et al., 2011). This infection, takes hold of approximately 390\u0026nbsp;million people annually across the globe, out of which 96\u0026nbsp;million present with clinical symptoms (Kalita et al., 2020). Last few years have witnessed a great surge in the number of dengue positive cases along with invasion of new areas (Jentes et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Wilder-Smith et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Factors that have contributed to worldwide rapid transmission of this infection include urbanization, inclined international travelling, less effective measures to control vector spread, etc. (Gubler et al., 2006). Dengue includes various symptoms like mild fever, dengue haemorrhagic fever (DHF), rashes to life-threatening sickness like dengue shock syndrome (DSS) (Murphy \u0026amp; Whitehea et al., 2011). Over many years, the worldwide pervasiveness of dengue has expanded especially, mostly due to fluctuation in hereditary variety, geological beginning and dissemination of various serotypes of the infection. The frequent transmitter of this virus is believed to be female Aedes mosquitoes. The infectious causative agent belongs to the flavivirus genus also recognized as Dengue Virus (Simmons et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Unlike the other members within the mentioned Flaviviridae family, each of which constitutes a monotypic species, some reported dengue serotypes, namely DENV 1\u0026ndash;4. DENV-2 has been reported to be more prevailing serotype in our country followed by DENV-3 and \u0026minus;\u0026thinsp;4. Whereas few studies have reported DENV-3 to be more commonly found followed by DENV-2 type (Mustafa et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMultiple DENV serotypes may be responsible for various episodes of mild to severe illness. At the moment, there is no commercially viable anti-dengue medication or preventive vaccine to tackle this widely rising public health concern (Gupta et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). The high prevalence of DENV serotypes that casing clinical manifestations poses a significant threat to local residents (Chakravarti et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMost recent couple of years have seen an extraordinary flood in the quantity of dengue positive cases alongside attack of new regions. Factors that have added to overall fast transmission of this disease incorporate urbanization, slanted global voyaging, less powerful measures to control vector spread, and so on. Dengue contamination has a range of clinical side effects going from gentle fever, rashes to hazardous infection such as dengue shock condition and DHF. The regular transmitter of this infection is accepted to be female Aedes mosquitoes (Mustafa et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Gupta et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Chakravarti et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTo mitigate dengue risk and prepare for the upcoming vaccine, monitor virus types in diverse regions. Ongoing surveillance will provide baseline data on prevalent DENV serotypes, aiding early detection of circulation shifts and outbreak prediction. The study examined DENV serotypes in south-eastern Uttar Pradesh, India, using VRDL surveillance samples.\u003c/p\u003e"},{"header":"2. Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Sample collection and study subjects\u003c/h2\u003e \u003cp\u003eSuspected case samples were received in the VRDL (biosafety level II laboratory), Department of Microbiology, IMS, BHU, Varanasi (UP), India. This study uses blood samples obtained from hospitals and adjacent districts for routine surveillance. The majority of the sample were received from District Malaria Officer, District Jaunpur, Government of Uttar Pradesh, India. The Institutional Ethics Committee (Dean/2022/IEC/3255) accepted the study design. The study protocol confirm that relevant guidelines and regulations were used in experiments.\u003c/p\u003e \u003cp\u003eIndividual written informed consent was not required in this retrospective study. This laboratory is a DHR-approved viral testing laboratory. The study includes 514 dengue suspected cases over a period of 6 months \u003cem\u003ei.e.\u003c/em\u003e July to December 2022.The samples were selected on the basis of duration and outbreak situation as reported from the authorities irrespective of the age and associated factors. All suspected patients were expected to submit a complete case report form (CRF) filled out by their doctors, as well as blood samples. According to the CRF, the majority of the patients had fever, abdominal pain, and vomiting, and all were positive in the dengue strip test. Serum was extracted from blood samples and used to diagnose dengue. All serum samples were stored at -80\u0026ordm;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Serological Analysis (DENV viral NS1 antigen and IgM detection)\u003c/h2\u003e \u003cp\u003eDengue NS1 antigen was used to determine using enzyme-linked immunosorbent assay (ELISA) (J. Mitra \u0026amp; Co. Pvt. Ltd, India). Dengue IgM-ELISA kit (version 2.4, NIV, Pune, India) was used to detect dengue IgM antibodies. The ELISA approach was carried out in accordance with the instruction manual provided by the manufacturer with the kit. The results were classified as reactive, equivocal, or non-reactive (Kumar et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The equivocal samples were excluded from further investigation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. RNA extraction\u003c/h2\u003e \u003cp\u003eAll collected samples underwent real-time RT-PCR analysis using extracted RNA (QIAamp Viral RNA Mini Kit), employing a column-based RNA extraction method. The entire process adhered to biosafety protocols and was carried out within a biosafety cabinet, ensuring compliance with the laboratory biosafety guidelines.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. RT-PCR reaction system and its detailed parameters\u003c/h2\u003e \u003cp\u003eOne-step RT-PCR based serotype identification (for dengue serotypes 1, 2, 3, and 4) of Dengue Virus Kit from TRUPCR\u0026reg; (Version 1.0) was used in this study. The reaction system includes a master-mix solution containing a hot-start DNA polymerase reaction buffer dNTPs, MgCl\u003csub\u003e2\u003c/sub\u003e and stabilisers, a reverse transcriptase enzyme mix, and dengue primer probe combinations. The experiments were conducted in 25 L reaction mixtures including 10 L template RNA. Two test tubes with different DENV primer probe mixes-1 and mix-2 must be prepared for one sample. DENV primer probe mix-1 identifies dengue virus and serotype-1, whereas DENV primer probe mix-2 detects dengue virus serotypes 1, 2, and 4. The reaction system included a 10 L master mix, 0.35 L enzyme mix, and 4.65 L DENV primer probe mix-1 or mix 2 as well as a 10 L extracted RNA sample for a total volume of 25 L. Dengue probes were labelled with DENV-FAM reporter, DENV-1-HEX reporter, DENV-2-FAM reporter, DENV-3-HEX reporter, and DENV-4-Tex Red/ROX reporter. CDC dengue RT-PCR primer set for references are DENV-1F-CAATGGATGACAACAGAAGAYATG, DENV-1R-TCCATCCATGGGTTTTCCTCTAT, DENV-2F-GCAGAAACACAACATGGAACRATAGT, DENV-2R-TGATGTAGCTGTCTCCRAATGG, DENV-3F- ATGGAATGTGTGGGAGGTGG, DENV-3R-GGCTTTCTATCCARTAGCCCATG, DENV-4R- GCAGATCTCTGGAAAAATGAACCA, and DENV-4F- GAGAATCTCTTCACCAACCCYTG. Thermocycling/temperature parameters i.e. reverse transcription at 50\u0026deg;C for 20 min followed by 94\u0026deg;C for 10 min. The PCR cycle for inactivation at 94\u0026deg;C for 15 s, trailed by 45 cycles at 55\u0026deg;C for 45 s, and annealing at 72\u0026deg;C for 15 s. The data were analyzed using Bio-Rad CFX Maestro 1.1 software Version 4.1.2 (Bio-Rad Laboratories\u003csup\u003e\u0026copy;\u003c/sup\u003e). Each run includes negative and positive controls, with significant relative fluorescence units (RFU).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Dengue serotyping using RT-PCR assay\u003c/h2\u003e \u003cp\u003eFurthermore, all of the samples chosen for the study were processed for RT-PCR using the TRUPCR\u0026reg; DENV kit (3B BlackBio Biotech India Ltd.), which includes the detection of Dengue-specific RNA using the FAM/Green reporter as well as the four distinct serotypes DENV 1\u0026ndash;4 according to the standard protocol (Mun et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Statistical analysis\u003c/h2\u003e \u003cp\u003eStatistical software (Sigma-Plot Version 11.0) was used to analyse the results in terms of means and SEM. Furthermore, the Student 't' test was used to compare frequency, percentage, and mean values. The p\u0026thinsp;\u0026gt;\u0026thinsp;0.05 level was considered as significant values.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results and Discussion","content":"\u003cp\u003eThe study includes 514 suspected samples, out of the 514, DENV IgM ELISA positive samples (n\u0026thinsp;=\u0026thinsp;230) were excluded from the study. In addition, IgM equivocal samples which were found to be 86 were further excluded from the molecular investigation. Thus, a total of 198 dengue IgM ELISA negative samples were tested for dengue viral NS1 antigen test. Out of 198, a total of 108 samples were reported with high OD \u003cem\u003ei.e.\u003c/em\u003e dengue viral antigen NS1 ELISA positive, while 35 samples were found to be equivocal and 55 were dengue viral antigen NS1 ELISA negative. A total of 108 positive dengue viral antigen NS1 ELISA samples with high OD and 42 dengue viral antigen NS1 negatives samples (to check the specificity of RT-PCR) were selected for dengue genotyping using RT-PCR.\u003c/p\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Comparison of dengue viral NS1 antigen detection and real-time RT-PCR\u003c/h2\u003e \u003cp\u003eOut of 150 samples selected for RT-PCR on the basis of dengue viral antigen NS1 detection, 80out of 108 (74.04%) were found to be positive for dengue RT-PCR and 28 out of 108 (25.9%) were not detected using dengue RT-PCR primers. Thus, the overall efficiency of dengue viral antigen NS1 detection using RT-PCR was found to be 74.04%. The dengue RT-PCR sensitivity and specificity reported was 79.41 and 100% respectively, and the positive predictive values and negative predictive values were reported as 100 and 63% respectively (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eComparison of dengue viral antigen NS1 detection and real time RT-PCR with respect to sensitivity and specificity\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDengue viral NS1 antigen detection\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eReal Time RT-PCR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eConcordance %\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDis-concordance %\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePPV\u003c/p\u003e \u003cp\u003e%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNPV\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e108\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e79.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e20.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e63\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e42\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e150\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"8\"\u003ePPV: Positive Predictive values; RT-PCR: Real-time PCR; NPV: Negative Predictive Values\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Dengue serotyping using multiplex chain reaction\u003c/h2\u003e \u003cp\u003eDengue multiplexing of total 150 samples were carried out and for initial screening, however 80 samples were screened for four distinct serotypes DENV 1\u0026ndash;4 serotyping using RT-PCR.\u003c/p\u003e \u003cp\u003eThe RT-PCR amplification curves are presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e (A-D). One-step master mix of dengue specific primers and dengue serotypes 1\u0026ndash;4 were analysed in two tubes. First set of primers identified and analysed the presence of dengue specific samples, internal controls, and dengue serotype 1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). However, second set of master mix tube will identify the presence of dengue serotype 2\u0026ndash;4 in the samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe found no DENV-4 (n\u0026thinsp;=\u0026thinsp;0) in the total positive RT-PCR DENV positive samples, but DENV-2 was the prevalent serotype, accounting for 50.60% of the total (n\u0026thinsp;=\u0026thinsp;41), followed by DENV-1 (32.10% (n\u0026thinsp;=\u0026thinsp;26), and DENV-3 was detected in 12.3% (n\u0026thinsp;=\u0026thinsp;10) of the total cases. Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e summarises the frequency circulation of DENV 1\u0026ndash;4 virus.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThus, overall data suggested that DENV-4 was not detected throughout the study suggesting the absence of DENV-4 strain in eastern region of Uttar Pradesh, India. On the other hand, DENV-2 infected cases were predominant in the study samples from eastern region of Uttar Pradesh, India. However, in addition to the above findings, a total of 6 DENV positive RT-PCR samples were found to be undetected in all the 4 serotypes, which may suggest the presence of some new mutated serotype. These samples required whole genome sequencing to confirm the DENV serotypes.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDiscussions\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe term Arbovirus is derived from the Arthropod-Borne Virus, which positions a noteworthy threat to public health due to periodic epidemics in throughout world (Weaver \u0026amp; Reisen et al., 2010; Guzm\u0026aacute;n et al., 2010; Lindenbach et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). The last two decades have seen a meteoric rise in Arboviral Infections, of which DENV is a component. DENV is a Flaviviridae virus with single-stranded linear and monopartite RNA. The envelope, membrane, and capsid are the three structural components of the DENV genome along with seven non-structural proteins. DENV contains four different serotypes (DENV 1\u0026ndash;4), which share 60\u0026ndash;80% homology (Mackenzie et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Bhatt et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e Clinically, the condition is defined as a hemorrhagic fever, and WHO amended its categorization guidelines from the previous guideline given in 1997 in 2009. The current guideline divides patients into three major groups based on clinical manifestations to facilitate better patient triage, particularly during a disease outbreak, and to provide consistency in case management.\u003c/p\u003e \u003cp\u003eFrom 1968 to 2013, the state of Uttar Pradesh in northern India conducted dengue studies involving several dengue serotypes (Agarwal et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Chaturvedi et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e1970\u003c/span\u003e; Chaturvedi et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e1974\u003c/span\u003e; Pandey et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Chaturvedi et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e1972\u003c/span\u003e). Data suggest presence of all serotypes of dengue in the selected area.\u003c/p\u003e \u003cp\u003eMany recent studies suggested that mainly serotype 1, 2, \u0026amp; 3 were mainly co-circulated each of the 4 years (Khan \u0026amp; Khan et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Khan \u0026amp; Lodhi et al.,2011; Kumar et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2001\u003c/span\u003e) while the DENV-4 was not detected at all. Our study results are well supported with the previous findings, with highest prevalence rate of DENV-2 in the tested population followed by DENV-1 then DENV-3. Dengue virus serotypes exhibit a diverse range of genotypes. For instance, in DENV-1, the predominant genotypes were identified as I and V. Within DENV-2, genotype IV comprised two prominent lineages. Additionally, DENV-3 predominantly exhibited genotype III, while DENV-4 was mainly associated with genotype I in various Indian states (Singh et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Kumar et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDENV-1 (type I) reported in Himachal Pradesh, Maharashtra, and Gujarat. Introducing a new variant to areas may cause larger epidemics. Ongoing monitoring is crucial due to limited circulation in some states, as transmission to non-widespread regions could lead to explosive outbreaks (Cecilia et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Patil et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Early detection of these variants may contribute the nature of genotypic variation and clinical implications.\u003c/p\u003e \u003cp\u003eDENV-2 (Genotype V) having a wide geographical distribution and including majority of Indian population reported from northern India. However, DENV-2 (Genotype-IV) is also prevalent in southern India such as Kerala, Chennai, Tamil Nadu. The reason was possibly the presence of a conserved amino acid T102 sequence. However, DENV-3 reported in Western and Northern India (Patil et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Conversely, DENV-4, the least prevalent serotype in these areas, was a major type in Tamil Nadu (Sharmila et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Murugesan et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Rajesh et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In Uttar Pradesh, our study found no samples positive for DENV-4, possibly due to a shortage of samples.\u003c/p\u003e \u003cp\u003eOur data indicates the presence of 6 DENV positive samples with unknown serotypes in the tested DENV 1\u0026ndash;4. It can be the some other flavivirus strain, which required further whole genome sequencing. Some sort of viral natural selection, or genetic recombination leads to the evolution of new serotype. However, the promising Chimerivax tetravalent vaccination clinical trials have recently been halted. The eventual discovery of novel serotypes and other sylvatic strains could stymie progress for the development of dengue vaccine. Integrated Vector Management is critical for long-term dengue management that required diagnosis of various sylvatic dengue strains (Islam et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMany researchers worldwide reported the above data (Rajesh et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Sharmila et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Murugesan et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The recent findings in Uttar Pradesh lay the groundwork for future investigation. Valuable data can be acquired and utilised to anticipate DENV outbreaks by undertaking continual genetic monitoring. This database can serve as a valuable tool in anticipating and preparing for future outbreaks. To gain a comprehensive understanding of the circulating serotypes and any changes in dominance, further studies are necessary. Therefore, continued surveillance of DENV in the state is warranted.\u003c/p\u003e "},{"header":"Conclusion","content":" \u003cp\u003eIn conclusion, dengue cases have been increased across almost all states in the country. It can be due to some specific dengue genotype that may lead to an increase in coinfections that require more clinical data for proper analysis. Multiplex RT-PCR can be more sensitive than conventional methods such as ELISA, RAPID or PCR, in detecting Dengue virus infections. The newly developed dengue serotype-specific molecular assays can be a useful tool in identifying the dengue serotyping, with no observed unspecific reactions even when multiple serotypes are circulating. Dengue specific serotypes were found to be more reliable making this one-step reaction mix a cost-effective, quick and easy tool for dengue serotyping.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thankful to DHR, ICMR, New Delhi, India, to establish viral laboratory network under Scheme 5066.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declared that the present research work is not supported or funded from any external source.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe original data contributions is provided within the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declared no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eA Murugesan, D Aridoss, S Senthilkumar, L Sivathanu, R Sekar, EM Shankar, et al. Molecular diversity of dengue virus serotypes 1\u0026ndash;4 during an outbreak of acute dengue virus infection in Theni. India. Indian J Med Microbiol, 38 (2020), pp. 401\u0026ndash;408.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgarwal R, Kapoor S, Nagar R, Misra A, Tandon R, Mathur A, Misra S, Dhole TN. A clinical study of the patients with dengue hemorrhagic fever during the epidemic of 1996 at Lucknow, India. Southeast Asian Journal of Tropical Medicine and Public Health. 1999;30(4):735\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhatt S, Gething PW, Brady OJ, et al. The global distribution and burden of dengue. Nature. 2013;496(7446):504\u0026ndash;507. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nature12060\u003c/span\u003e\u003cspan address=\"10.1038/nature12060\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChakravarti A, Matlani M, Kashyap B, Kumar A. Awareness of changing trends in epidemiology of dengue fever is essential for epidemiological surveillance. Indian J Med Microbiol2012;30:222\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChaturvedi UC, Mathur A, Chandra A. A study of pathological changes in liver in dengue fever. In Proceedings of the annual meeting of the National Academy of Sciences, India (Vol. 44, pp. 156\u0026ndash;166). 1974.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChaturvedi UC, Mathur A, Chandra A. A study of virological and serological features of dengue infection in north India. Indian Journal of Medical Research. 1972;60(7):1048\u0026ndash;58.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChaturvedi UC, Mathur A, Chandra A. Study of clinical and biochemical profile of dengue fever in north India. In Proceedings of the annual meeting of the National Academy of Sciences, India (Vol. 40, pp. 153\u0026ndash;165). 1970.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen R., Vasilakis N. Dengue-Quo Tu et Quo Vadis? Viruses. 2011;3(9):1562\u0026ndash;1608.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD Cecilia, JA Patil, MB Kakade, A Walimbe, K Alagarasu, B Anukumar, et al. Emergence of the Asian genotype of DENV-1 in South India Virology, 510 (2017), pp. 40\u0026ndash;45. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/v3091562\u003c/span\u003e\u003cspan address=\"10.3390/v3091562\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGubler D. J. Dengue/dengue haemorrhagic fever: history and current status. Novartis Foundation Symposium. 2006; 277:3\u0026ndash;16. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/0470058005.ch2\u003c/span\u003e\u003cspan address=\"10.1002/0470058005.ch2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGupta N, Srivastava S, Jain A, Chautevedi UC. Dengue in India. Indian J Med Res 2012; 136:373\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuzman MG, Halstead SB, Artsob H, et al. Dengue: a continuing global threat. Nat Rev Microbiol. 2010;8(12 Suppl):S7-S16. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrmicro2460\u003c/span\u003e\u003cspan address=\"10.1038/nrmicro2460\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIslam A, M Abdullah, A Tazeen, IH Naqvi, SN Kazim, A Ahmed, et al. Circulation of dengue virus serotypes in hyperendemic region of New Delhi, India during 2011\u0026ndash;2017. J Infect Public Health, 13 (2020), pp. 1912\u0026ndash;1919.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJA Patil, K Alagarasu, MB Kakade, AM More, KA Gadekar, SM Jadhav, et al. Emergence of dengue virus type 1 and type 3 as dominant serotypes during 2017 in Pune and Nashik regions of Maharashtra, Western India. Infect Genet Evol, 66 (2018), pp. 272\u0026ndash;283.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJentes ES, Lash RR, Johansson MA, Sharp TM, Henry R, Brady OJ, et al. Evidence- based risk assessment and communication: a new global dengue-risk map for travellers and clinicians. J Travel Med 2016;23\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKalita JM, Aggarwal A, Yedale K, Gadepalli R, Nag VL. A 5-year study of dengue seropositivity among suspected cases attending a teaching hospital of North-Western region of India. J Med Virol. 2021;93(6):3338\u0026ndash;3343. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/jmv.26592\u003c/span\u003e\u003cspan address=\"10.1002/jmv.26592\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhan J, Khan I, Amin I, Rahman S, Qureshi J, Khan TA. Dengue virus in Pakistan: historical perspective and current epidemic potential. Virol J. 2017;14(1):20. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12985-017-0698-7\u003c/span\u003e\u003cspan address=\"10.1186/s12985-017-0698-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhan M, Lodhi MS, Khalid B, et al. Serotype and genotype analysis of dengue virus by sequencing followed by phylogenetic analysis using samples from three mini outbreaks-2007-2009 in Pakistan. Virol J. 2011;8:143. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1743-422X-8-143\u003c/span\u003e\u003cspan address=\"10.1186/1743-422X-8-143\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhetarpal N, Khanna I. Dengue Fever: Causes, Complications, and Vaccine Strategies. JImmunol Res. 2016; 2016:6803098. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2016/6803098\u003c/span\u003e\u003cspan address=\"10.1155/2016/6803098\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar A, Sharma SK, Padbidri VS, et al. An outbreak of dengue fever in rural areas of Northern India. J Commun Dis. 2001;33(4):274\u0026ndash;281.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar M, Verma RK, Mishra B. Prevalence of Dengue Fever in Western Uttar Pradesh, India: A Gender-Based Study. Int J Appl Basic Med Res. 2020;10(1):8\u0026ndash;11. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4103/ijabmr.IJABMR_337_18\u003c/span\u003e\u003cspan address=\"10.4103/ijabmr.IJABMR_337_18\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar NP, Jayakumar PR, George K, et al. Genetic characterization of dengue virus serotypes causing concurrent infection in an outbreak in Ernakulam, Kerala, South India. Indian J Med Res. 2019;150(1):66\u0026ndash;71. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4103/ijmr.IJMR_2173_16\u003c/span\u003e\u003cspan address=\"10.4103/ijmr.IJMR_2173_16\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLindenbach BD, Thiel HJ, Rice CM. Flaviviridae: The Viruses and Their Replication. In: Knipe DM, Howley PM, eds. Fields Virology. 5th ed. Philadelphia, PA: Lippincott Williams \u0026amp; Wilkins; 2007:1101\u0026ndash;1152.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMackenzie JS, Gubler DJ, Petersen LR. Emerging flaviviruses: the spread and resurgence of Japanese encephalitis, West Nile and dengue viruses. Nat Med. 2004;10(12 Suppl):S98-S109. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nm1144\u003c/span\u003e\u003cspan address=\"10.1038/nm1144\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMun MJ, Bae JY, Kim JH, et al. One-step multiplex real-time RT-PCR for detection and typing of dengue virus. Mol Cell Probes. 2019;43:86\u0026ndash;91. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.mcp.2018.10.001\u003c/span\u003e\u003cspan address=\"10.1016/j.mcp.2018.10.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurphy B. R., Whitehead S. S. Immune response to dengue virus and prospects for a vaccine. Annual Review of Immunology. 2011; 29:587\u0026ndash;619. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1146/annurev-immunol-031210-101315\u003c/span\u003e\u003cspan address=\"10.1146/annurev-immunol-031210-101315\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMustafa MS, Rasotgi V, Jain S, Gupta V. Discovery of fifth serotype of dengue virus (DENV-5): A new public health dilemma in dengue control. Med J Armed Forces India. 2015;71(1):67\u0026ndash;70. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.mjafi.2014.09.011\u003c/span\u003e\u003cspan address=\"10.1016/j.mjafi.2014.09.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNT Rajesh, K Alagarasu, JA Patil, E Bharathi, A More, MB Kakade, et al. Serotype-specific differences in the laboratory parameters among hospitalized children with dengue and genetic diversity of dengue viruses circulating in Tamil Nadu, India during 2017. J Med Virol, 92 (2020), pp. 1013\u0026ndash;1022.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePandey N, Jain A, Garg RK, Kumar R, Agrawal OP, Lakshmana Rao PV. Dengue fever in patients admitted in a tertiary care centre: clinical profile, outcome and impact on platelet count and serum electrolytes. Indian Journal of Medical Research. 2012;136(1):373\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePF Sharmila, K Vanathy, B Rajamani, V Kaliaperumal, R. Dhodapkar. Emergence of dengue virus 4 as the predominant serotype during the outbreak of 2017 in South India. Indian J Med Microbiol, 37 (2019), pp. 393\u0026ndash;400.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSimmons, C. P., Farrar, J. J., van Vinh Chau, N. \u0026amp; Wills, B. Dengue. N. Engl. J. Med. 366, 1423\u0026ndash;1432 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh MP, Chadha MS, Chhabra M, et al. Molecular epidemiology of dengue viruses in India, 2014\u0026ndash;2015. Am J Trop Med Hyg. 2016;95(2):462\u0026ndash;467. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4269/ajtmh.15-0817\u003c/span\u003e\u003cspan address=\"10.4269/ajtmh.15-0817\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeaver SC, Reisen WK. Present and future arboviral threats. Antiviral Res. 2010;85(2):328\u0026ndash;345. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.antiviral.2009.10.008\u003c/span\u003e\u003cspan address=\"10.1016/j.antiviral.2009.10.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilder-Smith A, Gubler DJ, Weaver SC, Monath TP, Heymann DL, Scott TW. Epidemic arboviral diseases: priorities for research and public health. Lancet Infect Dis. 2017; 17:101\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWorld Health Organization. Dengue: Guidelines for Diagnosis, Treatment, Prevention and Control. WHO/HTM/NTD/DEN/2009.1 (World Health Organization, 2009).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Dengue, Serotype, Multiplex Real-Time PCR, TaqMan probe, Dengue viral NS1 antigen gene","lastPublishedDoi":"10.21203/rs.3.rs-4134363/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4134363/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eManaging dengue effectively is crucial due to four virus serotypes causing varying infection severities. Dengue fever has becoming more prevalent. Cases of haemorrhagic fever place a significant cost on society and its survivors. This study analyses prevalent serotypes during an endemic situation for severity and community transmission.\u003c/p\u003e\n\u003cp\u003eDuring a dengue outbreak in 2022, 514 samples were included in this study, and various diagnostic tests were employed. Dengue viral NS1 antigen gene, IgM antibody detection were executed using ELISA tests, while dengue RT-PCR for molecular confirmation using single-tube dengue multiplex RT-PCR assays to detect the presence of viral RNA and determine the infecting serotype. Data suggested that 108 were highly positive for dengue viral NS1Ag. Sensitivity and specificity of single-tube RT-PCR for dengue were found to be 79.41 and 100% respectively. Among the samples tested with the dengue Multiplex Real-Time PCR assay, 50.60% (n=41) were positive with DENV-2 being the most prevalent serotype followed by DENV-1 (32.10%, n=26) and DENV-3 (12.3%, n= 10).\u003c/p\u003e\n\u003cp\u003eDengue fever is a global health challenge, especially in India. Serotyping identifies circulating serotypes. RT-PCR multiplexing assay can be a promising molecular diagnostic method, proving highly sensitive, specific, and rapid. It holds great promise for swift and reliable dengue virus detection and serotyping, enhancing future identification of cases for vaccine development.\u003c/p\u003e","manuscriptTitle":"Advancing Dengue Virus Surveillance: A Rapid Multiplexed One-Step RT-PCR assay for Comprehensive Diagnosis and Serotype Identification","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-10 21:01:16","doi":"10.21203/rs.3.rs-4134363/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0d2646c7-0ea4-4987-9490-e28fd09f9d9f","owner":[],"postedDate":"May 10th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":31653446,"name":"Biological sciences/Microbiology"},{"id":31653447,"name":"Biological sciences/Microbiology/Clinical microbiology"},{"id":31653448,"name":"Health sciences/Diseases/Infectious diseases/Viral infection"}],"tags":[],"updatedAt":"2024-05-31T11:52:07+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-10 21:01:16","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4134363","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4134363","identity":"rs-4134363","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.