Impact of Methotrexate upon transdifferentiation and metabolic bioenergetics of neutrophils

preprint OA: closed
Full text JSON View at publisher
AI-generated deep summary by claude@2026-06, 2026-06-24 · read from full text

This paper investigated how methotrexate (MTX) affects ex vivo human neutrophil transdifferentiation and metabolic bioenergetics, using neutrophils from healthy donors treated with MTX ± the pro-oxidant stimulus PMA. The authors measured ROS, activation markers (CD83, HLA-DR), myeloperoxidase, apoptosis (Annexin V, caspase 3, Bcl-2), and assessed oxygen consumption and glycolytic function with an extracellular flux analyzer, along with metabolic gene expression by qPCR. MTX alone did not change ROS or oxygen consumption, but under PMA-induced oxidative stress it synergistically increased ROS, CD83/HLA-DR expression, and myeloperoxidase, alongside increased apoptosis and reduced Bcl-2, while glycolytic mechanisms remained largely unchanged. The study is a small, non-clinical ex vivo preprint with limited donor numbers and focuses on acute drug effects in isolated neutrophils rather than in vivo disease biology. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Full text 159,236 characters · extracted from preprint-html · click to expand
Impact of Methotrexate upon transdifferentiation and metabolic bioenergetics of neutrophils | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Impact of Methotrexate upon transdifferentiation and metabolic bioenergetics of neutrophils Aniruddha Bagchi, Shilpa Sengupta, Parasar Ghosh, Alakendu Ghosh, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9362152/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 8 You are reading this latest preprint version Abstract Background Rheumatoid arthritis (RA) is associated with inflammation, oxidative stress along with infiltration of immune cells (~ 90% neutrophils) into inflamed joints. Neutrophils have demonstrated the ability to transdifferentiate into ‘neutrophil-dendritic cell hybrids’ or N-DCs, acquire antigen presenting properties (HLA-DR/CD80/CD86) and demonstrated oxidative stress. Classical neutrophils rely mainly on glycolysis, but the metabolic bioenergetics of N-DCs remains poorly defined. Accordingly, this study aimed to assess the impact of methotrexate (MTX), upon transdifferentiation and the metabolic bioenergetics of neutrophils. Methods The ex-vivo effect of MTX on neutrophils sourced from healthy controls was studied (+/- PMA) in terms of CD83 + , HLA-DR + , generation of ROS, activation (myeloperoxidase) and status of apoptosis (Annexin V, Caspase 3 and Bcl-2) by flow cytometry, while the bioenergetics was assessed using Agilent XFp analyser and expression of key metabolic regulatory enzymes by real time PCR. Results In neutrophils, MTX failed to impact on generation of ROS; however, following induction of a pro-oxidant milieu by PMA, MTX demonstrated a synergistic enhancement in the generation of ROS, increased %CD83 high /HLA-DR high and myeloperoxidase, elevated apoptosis (Annexin V, Caspase 3) along with downregulation of Bcl-2. MTX per se did not alter the oxygen consumption rate (OCR), whereas following PMA-induced oxidative stress, MTX enhanced OCR, glycolytic mechanisms remaining unaltered. Conclusions MTX, the gold standard for treatment of RA did not alter the redox status of neutrophils, but in a pro-oxidant milieu, MTX facilitated transdifferentiation and activation of neutrophils, altered their apoptotic and metabolic bioenergetics status, indicative of an adverse bystander effect. Metabolic bioenergetics Methotrexate Neutrophils Oxidative stress Rheumatoid Arthritis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Rheumatoid arthritis (RA) is a chronic, systemic, inflammatory, autoimmune disorder that mostly affects the peripheral joints i.e. synovial joints leading to destruction of cartilage and bone [Radu and Bungau 2021 ]. Approximately, 0.5-1% of the global population is affected by RA, along with a female predominance [Ashai and Harvey 2020 ]. The pathogenesis of RA is associated with infiltration of immune cells (~ 90% neutrophils) into the sites of inflammation and accompanied by a predominantly pro-inflammatory and pro-oxidant milieu that perpetuates a vicious cycle. Oxidative stress is associated with an intricate cross talk between immune responses and generation of endogenous/exogenous antigens, that results in disease sustenance [Kundu et al. 2012 ; Datta et al. 2014 ; Bagchi et al. 2022 ]. The neutrophil-derived ROS, reactive nitrogen species (RNS) and granule proteases have been strongly implicated in chronic damage and destruction of host tissues, attributed to formation of neo-antigens (e.g. citrullinated histones, cyclic citrullinated peptides or CCP) along with irreversible damage to proteins, lipids and DNA along with bone and cartilage damage [Jing et al. 2023 ; Pradhan et al. 2019 ]. Although ROS is considered as a host-defense mechanism of neutrophils [Mocsai 2013; Kruger et al. 2015 ], it is also a crucial second messenger that determines cell differentiation, maturation, and can cause functional alteration of signaling molecules [Reczek and Chandel 2015]. In the synovial fluid (SF) of patients with RA, a subpopulation of accumulated neutrophils demonstrated the ability to transdifferentiate into neutrophil-dendritic cell hybrids or N-DCs and acquired antigen presenting properties [Bagchi et al. 2022 ]. Additionally, as compared to canonical neutrophils, these N-DCs demonstrated substantial generation of ROS, potentially contributing to the oxidative stress within synovial joints, and by sustaining the vicious cycle facilitates disease progression [Bagchi et al. 2022 ]. The first-line disease-modifying anti-rheumatic drug (DMARD) for the treatment of RA is methotrexate (MTX), a stable derivative of aminopterin [Bedoui et al. 2019 ]. Chronic administration of MTX in patients with RA is associated with hepatotoxicity, which varies from mild hepatitis and cholestasis to acute liver failure and cirrhosis [Pradhan et al. 2023 ]. In animal models of RA, this MTX mediated hepatic damage was attributed to oxidative stress and was mitigated by the intervention of antioxidants like epigallocatechin 3-gallate, allylpyrocatechol etc. [Pradhan et al. 2023 , De et al. 2017 ]. Furthermore, long-term administration of MTX caused inhibition of free radical scavengers i.e. superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx), and thereby by compromising the redox homeostasis caused oxidative stress [Pradhan et al. 2023 , Herman et al. 2005 , Phillips et al. 2003]. Accordingly, this study was aimed at evaluating the effect of MTX on neutrophils, in a pro-oxidant milieu, in terms of activation, trans-differentiation, and antigen presenting properties, apoptotic status and metabolic bioenergetics. Materials and methods Reagents All reagents were obtained from BD Biosciences (San Jose, CA, USA) except 5-(and-6)-carboxy-2’,7’-dichlorodihydrofluorescein diacetate, acetyl ester [CM-H 2 DCFDA] (Invitrogen, Carlsbad, CA, USA), Phorbol 12-myristate 13-acetate or PMA and Methotrexate (Sigma Aldrich, India), Granulocyte seperating media 1119 and Lymphocyte seperating media 1077 (HiMedia, Mumbai, India). cDNA Reverse Transcription kit, SYBR Green qPCR Master Mix were obstained from Applied Biosystems (Grand Island, NY, USA), TRIzol reagent (Ambion, Austin, TX, USA) and Cell-Tak™ from Corning® (Tewksbury, MA, USA). For the mitochondrial and glycolytic studies by Extracellular Flux analyzer, XFp Flux pack and XF DMEM medium were obtained from Agilent Technologies (Santa Clara, CA, USA). The study protocol received prior approval from the Institutional Ethics Committee of IPGME&R, Kolkata; written informed consent was obtained from all participants. Generation of reactive oxygen species in neutrophils Neutrophils were isolated from peripheral blood using HiSep 1077 and GranuloSep GSM 1119 according to manufacturer’s instructions. Briefly, a double gradient was formed by layering an equal volume of HiSep LSM 1077 and GranuloSep 1119 to which blood was carefully layered. Following centrifugation (3000 rpm, 30 min, RT), neutrophils present at the HiSep LSM 1077/ GranuloSep GSM 1119 interphase layer were collected, washed twice in phosphate buffer saline (0.02 M, pH 7.4, PBS), resuspended in 2 ml of PBS, and cell viability (> 95%) confirmed using trypan blue. Initially, the non-toxic concentration of MTX, was estimated in isolated neutrophils (5x10 5 cells/ml) sourced from peripheral blood of healthy donors (n = 5), that after incubation with MTX (0–20 µM, 1hr, 37 ○ C in dark) were washed in PBS, resuspended in 400 µl of PBS, surface stained with propidium iodide (0.01 µg/ml) and acquired in a flow cytometer. The frequency of PI + neutrophils was measured to assess cytotoxicity. The generation of ROS was measured in neutrophils isolated from peripheral blood of healthy controls (n = 5) using, a chloromethyl derivative of 5-(and-6)-carboxy-2’,7’-dichlorodihydrofluorescein diacetate, acetyl ester or CM-H 2 DCFDA [ 5 ]. Briefly, neutrophils (5x10 5 cells/ml), following pretreatment with MTX (2.5–10.0 µM, 1hr, 37 ○ C in dark) ± PMA (1 µg/ml, 15 min, 37 ○ C in dark) were washed and incubated with CM-H 2 DCFDA (2 µM, 30 min, 37 ○ C in dark); following two washes with PBS they were resuspended in 400 µl of PBS, and acquired in a flow cytometer [ 5 ]. Measurement of intracellular myeloperoxidase (MPO) Neutrophils (5x10 5 cells/ml) sourced from peripheral blood of healthy controls (n = 5) were treated with MTX (2.5–10.0 µM, 1hr, 37ºC in dark) ± PMA (1 µg/ml, 15 min, 37ºC in dark). Cells were then fixed and permeabilized with 100 µl of cytofix-perm buffer (BD Biosciences, San Jose, CA, USA) for 20 min. at RT in dark. Cells were then washed, resuspended in perm-wash buffer (100 µl), incubated with MPO-PE (30 min, RT in dark) and after two washes in PBS, resuspended in PBS and acquired in a flow cytometer. Immunophenotyping of neutrophils The frequency of CD83 and HLA-DR was measured in neutrophils sourced from peripheral blood of healthy controls (n = 5) by flow cytometry. Neutrophils (5x10 5 cells/ml) were treated with MTX (2.5–10.0 µM, 1hr, 37 ○ C in dark), surface stained with CD83-PE and HLA-DR-PerCP, incubated for 30 min, RT in dark and following three washes with PBS resuspended in 400 µl of PBS and acquired in a flow cytometer. Analysis of apoptosis by phosphatidylserine externalization To assess the apoptotic status of neutrophils, isolated neutrophils (5x10 5 cells/ml) were treated with MTX (2.5 or 5 µM, 1hr, 37 º C in dark) and/or PMA (1 µg/ml, 15 min, 37 º C in dark). Following centrifugation (5000 rpm, 10 min), and after two washes in PBS, cells were resuspended in annexin V binding buffer [10 mM HEPES/ NaOH (pH 7.4), 140 mM NaCl, 2.5 mM CaCl 2 ] and incubated for 20 min. Annexin V-FITC was added according to the manufacturers’ instructions and incubated for 30 min, RT in dark. Finally, after two washes with PBS, cells were resuspended in PBS and acquired in a flow cytometer. Status of pro-apoptotic Caspase 3 and anti-apoptotic Bcl-2 Neutrophils (5x10 5 cells/ml) sourced from peripheral blood of healthy controls (n = 5) were treated with MTX (2.5 and 5 µM, 1hr, 37 ○ C in dark) and/or PMA (1 µg/ml, 15 min, 37 ○ C in dark). Neutrophils were initially surface stained with CD66b-FITC and incubated (30 min, RT in dark), then fixed and permeabilized with 100 µl of cytofix-perm buffer (BD Biosciences, San Jose, CA, USA) for 20 min. at RT in dark. Cells were resuspended in Perm-wash buffer (100 µl) and incubated with Caspase 3 or Bcl-2 for 30 min (RT in dark); after two washes with PBS, resuspended in PBS and acquired in a flow cytometer. Flow cytometry Cells were gated based on characteristic linear forward and side scatter morphological gating of neutrophils (events: 5000); Cells were acquired in a BD Accuri™ C6 Plus (BD Biosciences, San Jose, CA, USA) and the fluorescence measured on a biexponential scale using BD Accuri™ C6 Plus analysing software. Frequency and expression (in terms of Geometric mean fluorescence channel, GMFC,) was evaluated in c6 Plus software (BD Biosciences, San Jose, CA, USA). Impact of MTX on bioenergetics of neutrophils Real-time measurements of mitochondrial respiration or oxidative phosphorylation (OXPHOS) and cellular glycolytic activity of neutrophils were performed using Seahorse Metabolic Analyzer XFp (Agilent Technologies, Santa Clara, CA, USA) in terms of their oxygen consumption rate (OCR, pmol/min) and extracellular acidification rate (ECAR, mpH/min) respectively, as per manufacturer’s instructions [Grudzinska et al. 2023; sarkar et al. 2022 ]. The glycolytic activities were assessed in neutrophils incubated with MTX (2.5 µM) and/or PMA (1.0 µg/ml) along with glucose (10 mM), oligomycin (10 µM), and 2-deoxyglucose (2-DG, 50 mM). Data was analysed using Seahorse Wave software, version 2.6.1, along with the XF Mito/Glycolysis stress test report generator (Agilent Technologies, Santa Clara, CA, USA). Similarly, freshly isolated neutrophils from peripheral blood of healthy controls (n = 3), were seeded (1x10 6 cells/180 µl/well), and their mitochondrial respiration assessed in cells incubated with MTX and/or PMA along with classical inhibitors, oligomycin (10 µM), carbonyl cyanidep- trifluoromethoxyphenylhydrazone (FCCP, 2 µM) and rotenone-antimycin A (Rot + AA, 1 µM each). mRNA expression of glycolytic and OXPHOS markers Neutrophils sourced from healthy controls were treated with MTX (2.5 µM, 1 hr, 37 ○ C) and/or PMA (1.0 µg/ml, 15 min, 37 ○ C), followed by isolation of total RNA by the Trizol method, and concentration measured in a NanodropTM One/OneC Microvolume UV-Vis Spectrophotometer (Thermo Fischer Scientific, MA, USA), and converted to single-stranded cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™, MA, USA), according to the manufacturer's instructions. cDNA (1 µg for a 20 µl reaction) for detection of amplicons was done using gene specific primers (sourced from NCBI Primer-BLAST, https://www.ncbi.nlm.nih.gov/tools/primer-blast ) whose specificity was confirmed by UCSC In-Silico PCR for human-specific genes ( i ) HK2 and LDHA (for glycolysis) along with ( ii ) PDK1, SDHA and ATP synthase ( for OXPHOS), Table 1 . Table 1 Primers used in this study Primers Primer Sequence (5’-3’) Glycolytic genes HK2 ( Hexokinase 2 ) Forward CGCCTGTGAATCGGAGAGGT Reverse GTCAAGGCGCTAACTTCGGC LDHA ( Lactate dehydrogenase ) Forward AAGCTGTCATGGGTGGGTCC Reverse CGGGAAACCATTCCATCCTACTG TCA cycle and Oxidative Phosphorylation genes PDK1 ( Pyruvate kinase dehydrogenase ) Forward TGTGGCTTCTCTAGCGGGAC Reverse GAGAAGCGCGCGTAGAAGTC SDHA ( Succinate dehydrogenase ) Forward GATCTTCCTGACTCAGCCTTC Reverse GAGACCCTGTCCCTACAATTAC ATP synthase Forward AAGGTGGGGTAAGGCCAAGC Reverse GCCTACAACTTGGGCAAAGGC Statistical analysis Data was checked for normality using by the Shapiro-Wilk test; for parametric data, an unpaired t-test or one-way ANOVA was done followed by post-hoc Tukey’s multiple comparison, and for nonparametric data, Mann-Whitney or Kruskal-Wallis test was done, followed by post-hoc Dunn’s multiple comparison, using GraphPad Prism software, version 8.2, (GraphPad Prism software Inc, La Jolla, CA, USA); p < 0.05 was considered as statistically significant. Results Impact of MTX on generation of reactive oxygen species (ROS) in neutrophils To assess the non-toxic dose of MTX, neutrophils (5x10 5 cells/ml) were initially pretreated with MTX (0-20 μM, 1 hr, 37 o C), surface stained with Propidium iodide (0.01 µg/ml), and the frequency of PI + neutrophils assessed by flow cytometry. At baseline, the frequency of PI + neutrophils was 1.35(1.30-1.46)% and remained unchanged with MTX (0.625, 1.25, 2.5. 5.0 and 10 µM) being 1.47(1.11-1.68)%, 1.69(1.61-1.76)%, 2.01(1.81-2.08)%, 1.90(1.75-2.07)% and 2.74(2.39-2.94)% respectively ( S1, A i-vi, B ). However, MTX (20 µM) increased the PI positivity to 22.96(19.01-25.17)%, p<0.01 ( S1, A vii, B ); accordingly, the maximum conc. of MTX used was 10 µM. In terms of generation of ROS, based on CMDCF fluorescence, neutrophils were pretreated with MTX in the presence of PMA, an established pro-oxidant. The cell population was subdivided into ROS low ( R1 ) and ROS high generating neutrophils ( R2 ). MTX (2.5- 10.0 µM) failed to increase the generation of ROS [frequencies being 1.25(0.74-1.71)%, 1.40(0.58-1.93)%, 1.63(1.16-2.15)% and 1.39(0.95-1.73)% respectively], Fig. 1A, C . However, when oxidative stress was induced by PMA, the frequency of R2 significantly increased to 53.86(51.88-58.22)%, p<0.001, Fig. 1B, which following the addition of MTX (2.5-10 µM) increased further to [71.30 (66.36-78.88)%, p<0.01, Fig. 1B ii, C ], [83.50(79.09-86.45)%, p<0.001, Fig. 1B iii, C ] and [87.37(84.88-90.75)%, p<0.001, Fig. 1B iv, C ] respectively . In terms of expression or GMFC of CMDCF in neutrophils from healthy controls, the baseline GMFC of 5717(4772-6972) was comparable with neutrophils treated with MTX (2.5, 5 and 10 µM), being 5235(4867-6722), 6599(5192-7062) and 6787(5616-7117) respectively ( Fig. 1D i-iii ). The addition of PMA enhanced the generation of ROS by 14.06-fold to 58925(53825-62613), p<0.01, which following the addition of MTX (2.5, 5 and 10 µM) increased further to 81871(76289-92063), p<0.01; 101210(97468-107979), p<0.001 and 130221(117020-140035)%, p<0.001 respectively, Fig. 1D iv . Status of myeloperoxidase (MPO) in neutrophils As oxidative stress is associated with activation of neutrophils, the impact of MTX in terms of MPO was assessed. The baseline frequency of MPO + in neutrophils was 5.90(5.13-8.12)%, and remained unchanged with MTX (2.5, 5 and 10 µM), being 12.40(9.27)%, 14.70(11.97-15.24)% and 18.74(16.74-21.51)% respectively Fig. 2A, C . In the presence of PMA, the MPO positivity was significantly enhanced to 33.29(30.27-39.97)%, p<0.001, and with the inclusion of MTX (2.5, 5.0 and 10.0 µM), was further enhanced to 41.50(39.09-46.39)%, p<0.05, 63.74(58.17-66.93)%, p<0.001 and 84.75(77.59-94.39)%, p<0.001 respectively, Fig. 2B, C . Status of CD83 and HLA-DR in neutrophils Oxidative stress in neutrophils is associated with their transdifferentiation into neutrophil-dendritic cell hybrids or N-DCs, features being increased expression of CD83 and HLA-DR [Bagchi et al. 2022]. To assess the impact, if any, of MTX upon transdifferentiation, the frequencies of CD83 and HLA-DR were measured in neutrophils by initially gating them as CD83 low ( R3 ) and CD83 high ( R4 ) populations. The baseline frequency of CD83 positivity was 0.97(0.51-1.44)%; with the addition of MTX (2.5-10 μM), the CD83 positivity remained unchanged at 2.90(2.44-4.15)%, 1.97(0.82-2.75)% and 2.90(2.60-3.45)% respectively, ( Fig. 3 A, C) . In PMA treated neutrophils, the frequency of CD83 was significantly enhanced to 23.37(20.79-28.47)%, p<0.001, and with co-incubation with increasing doses of MTX (2.5-10 µM) further increased, , the frequencies being 53.24(47.14-61.55)%, p<0.01, 71.90(67.13-78.54)%, p<0.001 and 84.68(82.75-87.69)%, p<0.001 respectively, Fig. 3 B, C . Similarly, in terms of HLA-DR, neutrophils were gated as HLA-DR low ( R5 ) and HLA-DR high ( R6 ) populations. The baseline frequency of HLA-DR high neutrophils [0.60(0.20-0.95)%], was unchanged by MTX (2.5, 5.0 and 10.0 µM), frequencies being 0.80(0.57-1.15)%, 0.59(0.45-1.07)% and 0.69(0.39-1.07)%, respectively Fig. 3 D, F . The addition of PMA led to an increased frequency of HLA-DR to 26.10 (21.43-30.17)%, and with addition of MTX (2.5, 5 and 10 µM), progressively increased to 49.87(41.24-53.65)%, p<0.01,62.70(58.50-69.99)% and 70.20(66.42-75.90)%, p<0.001, respectively, Fig. 3 E, F . Status of apoptotic markers in neutrophils As oxidative stress is associated with apoptosis, the impact of MTX upon the apoptotic status of isolated neutrophils sourced from healthy controls was measured in terms of the frequency of annexin V + along with a pro-apoptotic marker, caspase 3 and an anti-apoptotic marker Bcl-2. The baseline frequency of annexin V in neutrophils was 15.50(12.41-18.63), which was unaffected by MTX (2.5 and 5.0 µM), frequencies being 18.70(16.51-20.04)% and 39.30(21.99-45.99)% respectively ( Fig. 4 A, Di) . The addition of PMA caused a significant enhancement in the frequency of annexin V to 55.30(49.11-58.92)%, and with MTX (2.5 and 5.0 µM) increased further to 63.90(61.20-68.20)%, p<0.05 and 87.73(84.25-91.54)%, p<0.001, respectively ( Fig. 4 A, Di) . Similarly, the baseline status of caspase 3 in neutrophils was [(10.60(7.60-13.52)%, Fig. 4 Bi ]; MTX (2.5 and 5.0 µM), had no impact, frequencies being 12.23(8.38-13.42)% and 14.20(8.85-18.26)%, respectively ( Fig. 4 B iii, Dii) . The addition of PMA significantly elevated the frequency of caspase 3 to 28.30(25.87-33.56)%, that increased further with addition of MTX (2.5 and 5.0 µM) to 69.85(59.28-85.53)%, p<0.001 and 85.63(81.32-89.96)%, p<0.001, respectively ( Fig. 4 B iv-vi & Dii) . In terms of Bcl-2, the baseline frequency of Bcl-2 + neutrophils of 40.70(36.04-44.28)% remained unchanged with the addition of MTX ( Fig. 4 C i-iii ), frequencies being 29.27(26.50-32.45)% and 27.35(23.06-28.76)% (Fig. 4 Diii) . Following induction of oxidative stress by PMA, the frequency of Bcl-2 was significantly downregulated to 19.45(17.51-20.77)%, p<0.01, and co-incubation with MTX (2.5 and 5.0 µM) further decreased the Bcl-2 frequency to 15.63(14.04-17.09)%, p<0.05 and 13.30(11.72-14.53)%, respectively ( Fig. 4 C iv-vi & Diii) .' Status of glycolytic activity in neutrophils Glucose is converted to pyruvate, and then to lactate in the cytoplasm, or to CO 2 and H 2 O in the mitochondria, resulting in a net production of protons; its extrusion into the extracellular medium translates into acidification of the medium, and is measured in terms of the extracellular acidification rate (ECAR), to represent the proportion of glycolysis. To assess specificity, saturating concentration of glucose (10 mM) and 2-DG (50 mM) were used along with oligomycin (10 µM). In terms of non-glycolytic acidification in neutrophils, as compared to baseline, MTX (2.5 µM) had no impact, being 60.25(55.29-69.27) vs. 58.27(57.13-63.29) mPH/min . The induction of oxidative stress by PMA had no impact, neither did the addition of MTX ( Fig. 5A i, ii) ; The non-glycolytic acidification in the presence of MTX (2.5 μM) was comparable with baseline being 62.39(59.29-67.61) vs. 61.79(60.13-63.79) mPH/min respectively ( Fig. 5A i, ii) . A similar trend was observed with regard to their glycolytic status and glycolytic capacity ( Fig. 5A i, iii, iv, Table 2A ). This was substantiated by evaluating the status of hexokinase 2 ( HK2 ) and Lactate dehydrogenase ( LDH ); irrespective of the treatment, the glycolytic status remained unaltered ( Fig. 5B i, ii, Table 2C) . Table 2A: Effect of MTX on status of glycolysis (mPH/min) in neutrophils *Non-glycolytic acidification *Glycolysis *Glycolytic capacity Baseline 60.25(55.29-69.27) 30.37(27.77-33.29) 47.29(40.79-53.27) MTX (2.5 mM) 58.27(57.13-63.29) 30.73(28.21-37.21) 42.33(37.29-43.27) PMA (1.0 62.39(59.29-67.61) 50.27(47.29-53.01) 58.29(57.29-60.23) MTX+PMA 61.79(60.13-63.79) 60.31(58.97-65.37) 67.27(63.78-68.31) Neutrophils were incubated with MTX (2.5 mM) and PMA (1.0 µg/ml) and the status of glycolysis (mPH/min) measured in neutrophils as described in Materials and methods, and data is stated as *median (IQR). Table 2B: Effect of MTX on status of oxidative phosphorylation in neutrophils @ Basal Respiration @ ATP Production @ Spare Respiratory Capacity @ Acute Response Baseline 16.39 (11.67-21.03) 40.38 (36.93-50.61) 25.37 (21.73-30.27) 8.13 (7.05-12.23) MTX 16.83 (15.69-22.04) 45.29 (30.37-47.29) 27.79 (22.11-34.25) 9.07 (5.12-12.23) PMA 210 (192.20-232.30)*** 190.60 (179.80-201.70)*** 223.20 (210.40-243.1)*** 124.9 (101.2-135.10)* MTX+ PMA 301.60 (289.30-351.30)*** # 311.01 (290.80-320.80)*** # 359.30 (310.8-370.80)*** # 450.80 (430.30-482.90)*** ## Neutrophils were incubated with MTX (2.5 mM) and PMA (1.0 µg/ml)and the status of oxidative phosphorylation was evaluated in neutrophils as described in Materials and methods; data is stated as @ median (IQR). *p<0.05, **p<0.01, ***p<0.001 as compared to baseline; # p<0.01, ## p<0.001 as compared to PMA. Table 2C: Effect of MTX in neutrophils on glycolysis and oxidative phosphorylation regulatory genes 2^ -ΔΔCt @ HK2 @ LDH @ PDK1 @ SDH @ ATP Synthase Baseline 2.17 (1.67-3.40) 2.91 (1.52-3.05) 10.61 (6.81-11.89) 5.41 (4.04-11.01) 16.31 (11.88-18.29) MTX 2.30 (1.37-2.78) 2.71 (1.85-3.50) 9.52 (6.74-11.74) 11.79 (7.25-23.12) 17.91 (15.92-21.35) PMA 1.05 (0.06-1.10) 2.34 (1.43-3.47) 2.61 (1.76-3.83) ** 101.2 (54.35-304.30) ** 66.76 (54.74-70.81) ** # MTX+ PMA 0.10 (0.00-0.28) * 2.37 (1.97-4.15) 0.97 (0.10-1.29) *** 3104 (1848-4541) ***# 249.60 (205.7-270) *** Neutrophils were incubated with MTX (2.5 mM) and PMA (1.0 µg/ml) and the expression of glycolysis and oxidative phosphorylation regulatory genes were measured as described in Materials and methods; data is stated as @ median (IQR); *p<0.05, **p<0.01, ***p<0.001 as compared to baseline; # p<0.01 as compared to PMA. Status of mitochondrial bioenergetics in neutrophils Mitochondrial respiration or oxidative phosphorylation (OXPHOS) was measured using Seahorse XFp extracellular flux analyzer in terms of OCR, wherein the consumption of oxygen occurs by reduction through transfer of electrons in the electron transport chain (ETC). The quantitative changes in the OCR are triggered by oligomycin (inhibiting oxidative phosphorylation by targeting ATP synthase), FCCP (an uncoupler) along with Rot+AA (blockers of complex I and III respectively). In terms of basal respiration in neutrophils, MTX (2.5 µM) did not have any impact, being 16.39 (11.67-21.03) vs. 16.83(15.69-22.04) pmoles/min at baseline [ Fig. 6A i, iv] . However, PMA significantly enhanced the basal respiration to 210(192.20-232.30) pmoles/min, p<0.001, and with addition of MTX, was further increased to 301.60(289.30-351.30) pmoles/min, p<0.01 ( Fig. 6A ii-iv) . The scenario was similar with regard to ATP production, spare respiratory capacity and acute response ( Fig. 6A v-vii, Table 2B). To assess the specificity of oxidative stress in terms of their potential to drive towards OXPHOS, impact of a lower dose of PMA (0.5 µg/ml) along with MTX was assessed, which demonstrated a comparable acute response in the presence of MTX ± PMA ( Fig. 6B, C) . To substantiate the altered energy phenotype of neutrophils by PMA and MTX, the status of regulatory enzymes was assessed in terms of their gene expression. The status of PDK1 , succinate dehydrogenase ( SDH ) and ATP synthase was measured as markers of oxidative phosphorylation. MTX alone had no impact whereas PMA significantly induced the expression of SDH and ATP Synthase. ( Fig. 6D ) However, when oxidative stress was induced by PMA, the addition of MTX synergistically facilitated further enhancement in the expression of OXPHOS related genes, PDK1 , SDH and ATP synthase ( Fig. 6D i-iii, Table 2C) . Discussion RA is a chronic, systemic, inflammatory autoimmune disorder, resulting in progressive joint damage and deformity. The pathogenesis of RA is intricately regulated by a cascade of immune cells [including neutrophils, T and B lymphocytes, macrophages, dendritic cells (DCs), fibroblast-like synoviocytes (FLS) etc.] along with a wide array of inflammatory mediators, wherein oxidative stress consistently plays a crucial role in the initiation and progression [Bagchi et al. 2022 , Pradhan et al. 2019 ]. Elevated levels of ROS along with a compromised antioxidant defense system contributed to the perpetuation of inflammatory responses and joint destruction in patients with RA and a collagen induced arthritis (CIA) model of RA [Datta et al. 2014 ; De et al. 2017 ], endorsing that targeted therapies for redox stress and associated cell signaling pathways may have a beneficial impact for treatment of RA. MTX has the potential to disrupt the redox balance in neutrophils via impacting on their antioxidant defense and ROS scavenging mechanisms [Kaudal et al. 2020]. However, studies regarding the effect of MTX on generation of ROS are contradictory, as depending on the concentration of MTX, duration of exposure, and the inflammatory environment, it can show features of being a pro- or an antioxidant [Phillips et al. 2003]. In cancer cell lines, MTX enhanced the redox imbalance through enhanced release of H 2 O 2 by neutrophils, monocytes, and T lymphocytes, potentially facilitating chemotherapy and causing cytotoxicity [Bedoui et al. 2019 ; Phillips et al. 2003; Gressier et al. 1994 ]. Conversely, in patients with RA, low-dose MTX (10–15 mg/week) within circulating neutrophils down-regulated the generation of ROS [Kaudal et al. 2020]. However, most studies till date have been conducted in peripheral blood, and not in the synovial joints which is the main disease focus [Dogru et al. 2019 ]. Given the predominance of oxidative stress, a pro-inflammatory milieu and an overwhelming presence of neutrophil within the inflamed synovial joint, an ex-vivo approach was employed to assess the potential of MTX in modulating generation of ROS. In neutrophils, MTX failed to impact on the generation of ROS; however, when oxidative stress was induced by PMA, MTX synergistically facilitated additional generation of ROS (Fig. 1 ), suggesting that the impact of MTX is dependent upon the presence of a pro-inflammatory, pro-oxidant microenvironment (Fig. 1 ). Therefore, as SF has a pro-oxidant milieu [Bagchi et al. 2022 ; Kundu et al. 2011 ], it can be proposed that MTX in RA patients have the propensity to have a disease sustaining effect. In fungal infections, Neutrophil-DC hybrids compared to canonical neutrophils displayed a higher expression of pattern recognition receptors, enhanced phagocytosis, and heightened production of ROS with prominent NETosis, substantiating the intricate association of oxidative stress, phenotypic plasticity and altered functionalities [Fites et al. 2018]. Oxidative stress is intricately associated with the activation of neutrophils, whose key marker of activation is myeloperoxidase (MPO), which is sequestered within azurophilic granules, and plays a pivotal role in the generation of ROS and reactive nitrogen species/RNS [Ndrepepa 2019 ; Glennon et al. 2018]. MTX did not alter the status of MPO in neutrophils, but in the presence of PMA, MTX synergistically enhanced MPO secretion (Fig. 2 ), suggesting that under oxidative stress, MTX had the potential to trigger an oxidative burst, that could in turn activate the downstream NETosis signaling pathways, an established contributor in the pathogenesis of RA [Sur Chowdhury et al. 2014 ]. In patients with RA, neutrophils traditionally viewed as short-lived terminally differentiated cells, can transdifferentiate to neutrophil-dendritic cell hybrids or N-DCs, thereby acquiring the expression of CD83 and MHC class II [Bagchi et al. 2022 , Iking-Konert et al. 2001 ]. These N-DCs can be activated by T cell-derived cytokines, thus potentially perpetuating local inflammation and tissue damage, and forging a link between innate and adaptive immune responses [Iking-Konert et al. 2005 ]. This priming of neutrophils and their subsequent activation triggers a wide array of phenotypic changes beyond just increased generation of ROS, as for e.g. co-stimulation (CD80, CD86) and enhanced cell adhesion properties (ICAM, VCAM) [Bagchi et al. 2022 ]. Moreover, transdifferentiated neutrophils demonstrated an enhanced generation of ROS, potentially capable of causing a higher degree of oxidative damage in the inflamed joints [Bagchi et al. 2022 ]. Although MTX per se did not induce transdifferentiation in neutrophils, creation of an oxidative milieu by addition of PMA led to MTX enhancing the propensity for transdifferentiation, enhanced antigen presentation, thus perpetuating a detrimental cycle, Fig. 3 . This clinical simulation demonstrated that MTX under the influence of the microenvironment has the potential to have a disease promoting role. Neutrophils, being the first line of defense, play a crucial role in innate immune responses against invading pathogens, and undergo apoptosis, necessary for rapid resolution of inflammation and restoration of tissue homeostasis. [Mccracken and Allen 2014; Giese et al. 2019]. Apoptosis of neutrophils is tightly regulated by a complex network of intracellular signaling pathways involving various pro-apoptotic factors [Mccracken and Allen 2014; Giese et al. 2019, Dejas et al. 2023 ; Geering et al. 2011]. In autoimmune disorders like RA, Inflammatory bowel disease (IBD), psoriatic arthritis, neutrophils can become apoptosis-resistant and survive longer within the localized pro-inflammatory microenvironment [Fresneda et al. 2021; Brannigan et al. 2000]. The synovium of RA patients expresses higher levels of the Bcl-2 family's anti-apoptotic proteins, Mcl-1 and Bcl-2, suggesting delayed apoptosis [Carrington et al. 2021; Chen et al. 2021 ]. In contrast, in systemic lupus, leukocytes demonstrated an accelerated apoptosis and impaired clearance of apoptotic debris, facilitating formation of auto-antigens that can promote disease progression [Munoz et al. 2008]. In patients with psoriasis, MTX increased the generation of ROS, induced oxidative stress, and enhanced apoptosis through caspase-3 activation [Elango et al. 2014 ]. It has been previously demonstrated that MTX did not directly induce apoptosis of neutrophils but rather ’primed‘ them for enhanced apoptosis via a JNK-dependent mechanism [Spurlock et al. 2011]. In this study, MTX did not impact on the apoptotic status of neutrophils; however, in a pro-oxidant milieu, as induced by PMA, MTX synergistically enhanced the frequency of pro-apoptotic annexin V and caspase 3, along with downregulation of anti-apoptotic Bcl-2, Fig. 4 . Taken together, in a pro-oxidant milieu, MTX demonstrated the potential to enhance cellular apoptosis, which could translate into enhanced release of cellular contents and formation of neo-antigens. Neutrophils are the most critical immune cell in the initial stages of RA pathogenesis, by virtue of their ability to generate huge amounts of ROS and reactive nitrogen species (RNS), through the activation of NOX2 and iNOS-derived NO respectively, leading to cartilage and bone damage in patients with RA [Mangal et al. 2021]. Additionally, the pro-oxidant milieu could trigger neutrophils to secrete degradative enzymes, pro-inflammatory cytokines and formation of neutrophil extracellular traps or NETs [Mangal et al. 2021, Chen et al. 2018 ]. In terms of effector functions i.e. phagocytosis, NETosis etc., neutrophils primarily rely on glycolysis and the pentose phosphate pathway (PPP) as their major sources of energy [Rodriguez et al. 2015, Gaber et al. 2017 ]. In neutrophils, the by-product of PPP is NADPH, a necessary substrate for NADPH oxidase, which facilitates enhanced generation of ROS [Rodriguez et al. 2015, Gaber et al. 2017 ]. However, oxygen consumption rate or OCR (a measure of oxidative phosphorylation) is also linked with the generation of RO, as; in an ex-vivo study, during PMA induced oxidative burst and neutrophil activation, the neutrophils demonstrated an upregulation of oxidative phosphorylation measured in terms of oxygen consumption rate [Grudzinska et al. 2023]. Additionally, during acute inflammation/infections, neutrophils rely on glycolysis and PPP to facilitate the production of the MPO, translating into enhanced antimicrobial functions [Kumar et al. 2019; Hawkins et al. 2021]. However, in chronic inflammation, as in RA, there is a sustained generation of ROS and neutrophils switch to utilizing oxidative phosphorylation (OXPHOS) and PPP for their effector functions [Schuurman et al. 2023; Thind et al. 2024]. This scenario was replicated with the addition of MTX (2.5 µM) as it did not alter the glycolytic phenotype (Fig. 5 ) , but when co-incubated with PMA, MTX synergistically drove neutrophils towards OXPHOS, Fig. 6 [Chacko et al. 2013; Injarabian et al. 2019 ]. Conclusions MTX in a pro-oxidant environment augmented generation of ROS, enhanced transdifferentiation, promoted apoptosis, and shifted the bioenergetics towards mitochondrial oxidative phosphorylation. Therefore, it may be proposed that anti-oxidants be included into the chemotherapeutic regimen, with a view towards preserving the immunomodulatory properties of MTX but curb its ability to enhance disease progression. Declarations Competing Interests : None. Author Contribution Designed research: AB, MC; Conducted research: AB, SSG, MC; Provided essential reagents/materials: MC, AG, PG; Data analysis: AB, SSG; Funding acquisition: MC; Supervision and validation: AG, PG, MC; Manuscript writing & primary responsibility for final content: AB, SSG, MC. Acknowledgement MC is recipient of a JC Bose grant (ANRF/JBG/2025/000445/HAA), Govt. of India; AB was a recipient of a Senior Research Fellowship from ICMR, Govt. of India. Technical support was provided by Multidisciplinary Research Unit (MRU), Department of Health Research (DHR), Govt. of India (Grant Number: V.25011/611/2016-HR). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Data Availability All data supporting the findings of this study are available within the paper and its Supplementary Information. References Ashai S, Harvey NC (2020) Rheumatoid arthritis and bone health. Clin Med (Lond) 20:565–567. 10.7861/clinmed.20.6.rabh Bagchi A, Ghosh P, Ghosh A, Chatterjee M (2022) Role of oxidative stress in induction of trans-differentiation of neutrophils in patients with rheumatoid arthritis. Free Radic Res 56:290–302. 10.1080/10715762.2022.2089567 Bedoui Y, Guillot X, Sélambarom J et al (2019) Methotrexate an old drug with new tricks. Int J Mol Sci 20:5023. 10.3390/ijms20205023 Brannigan Ae O, Pr, Hurley H et al (2000) Neutrophil apoptosis is delayed in patients with inflammatory bowel disease. Shock 13:361–366. 10.1097/00024382-200005000-00003 Carrington Em, Louis C, Kratina T et al (2021) BCL-XL antagonism selectively reduces neutrophil life span within inflamed tissues without causing neutropenia. Blood Adv 5:2550–2562. 10.1182/bloodadvances.2020004139 Bk C, Pa K, Ravi S et al (2013) Methods for defining distinct bioenergetic profiles in platelets, lymphocytes, monocytes, and neutrophils, and the oxidative burst from human blood. Lab Invest 93:690–700. 10.1038/labinvest.2013.53 Chen D, Chen C, Xiao X, Huang Z, Huang X, Yao W (2021) TNF-α Induces Neutrophil Apoptosis Delay and Promotes Intestinal Ischemia-Reperfusion-Induced Lung Injury through Activating JNK/foxo3a Pathway. Oxid Med Cell Longev 8302831. 10.1155/2021/8302831 Chen W, Wang Q, Ke Y, Lin J (2018) Neutrophil function in an inflammatory milieu of rheumatoid arthritis. J Immunol Res 8549329. 10.1155/2018/8549329 Conway R, Carey J (2017) Risk of liver disease in methotrexate treated patients. World J Hepatol 9:1092–1100. 10.4254/wjh.v9.i26.1092 Datta S, Kundu S, Ghosh P, De S, Ghosh A, Chatterjee M (2014) Correlation of oxidant status with oxidative tissue damage in patients with rheumatoid arthritis. Clin Rheumatol 33:1557–1564. 10.1007/s10067-014-2597-z De S, Manna A, Kundu S et al (2017) Allylpyrocatechol attenuates collagen-induced arthritis via attenuation of oxidative stress secondary to modulation of the MAPK, JAK/STAT, and Nrf2/HO-1 pathways. J Pharmacol Exp Ther 360:249–259. 10.1124/jpet.116.238444 Dejas L, Santoni K, Meunier E, Lamkanfi M (2023) Regulated cell death in neutrophils: From apoptosis to netosis and pyroptosis. Semin Immunol 70:101849. 10.1016/j.smim.2023.101849 Dogru A, Naziroglu M, Cig B (2019) Modulator role of infliximab and methotrexate through the transient receptor potential melastatin 2 (TRPM2) channel in neutrophils of patients with rheumatoid arthritis: a pilot study. Arch Med Sci 15:1415–1424. 10.5114/aoms.2018.79485 Elango T, Dayalan H, Gnanaraj P, Malligarjunan H, Subramanian S (2014) Impact of methotrexate on oxidative stress and apoptosis markers in psoriatic patients. Clin Exp Med 14:431–437. 10.1007/s10238-013-0252-7 Fites Js, Gui M, Kernien, Jf et al (2018) An unappreciated role for neutrophil-DC hybrids in immunity to invasive fungal infections. Plos Pathog 14:e1007073. 10.1371/journal.ppat.1007073 Fresneda Alarcon M, Mclaren Z, Wright H (2021) Neutrophils in the Pathogenesis of Rheumatoid Arthritis and Systemic Lupus Erythematosus: Same Foe Different M.O. Front Immunol 12:649693. 10.3389/fimmu.2021.649693 Gaber T, Strehl C, Buttgereit F (2017) Metabolic regulation of inflammation. Nat Rev Rheumatol 13:267–279. 10.1038/nrrheum.2017.37 Geering B, Simon H (2011) Peculiarities of cell death mechanisms in neutrophils. Cell Death Differ 18:1457–1469. 10.1038/cdd.2011.75 Ma G, Le H, Huttenlocher A (2019) Neutrophil plasticity in the tumor microenvironment. Blood 133:2159–2167. 10.1182/blood-2018-11-844548 Glennon-Alty L, Hackett Ap C, Ea W Hl (2018) Neutrophils and redox stress in the pathogenesis of autoimmune disease. Free Radic Biol Med 125:25–35. 10.1016/j.freeradbiomed.2018.03.049 Gressier B, Lebegue S, Brunet C et al (1994) Pro-oxidant properties of methotrexate: evaluation and prevention by an anti-oxidant drug. Pharmazie 49:679–681 Grudzinska Fs, Jasper A, Sapey E et al (2023) Real-time assessment of neutrophil metabolism and oxidative burst using extracellular flux analysis. Front Immunol 14:1083072. 10.3389/fimmu.2023.1083072 Hawkins Cl D Mj (2021) Role of myeloperoxidase and oxidant formation in the extracellular environment in inflammation-induced tissue damage. Free Radic Biol Med 172:633–651. 10.1016/j.freeradbiomed.2021.07.007 Herman S, Zurgil N, Deutsch M (2005) Low dose methotrexate induces apoptosis with reactive oxygen species involvement in T lymphocytic cell lines to a greater extent than in monocytic lines. Inflamm Res 54:273–280. 10.1007/s00011-005-1355-8 Iking-Konert C, Csekö C, Wagner C, Stegmaier S, Andrassy K, Hänsch G (2001) Transdifferentiation of polymorphonuclear neutrophils: acquisition of CD83 and other functional characteristics of dendritic cells. J Mol Med (Berl) 79:464–474. 10.1007/s001090100237 Iking-Konert C, Ostendorf B, Sander O et al (2005) Transdifferentiation of polymorphonuclear neutrophils to dendritic-like cells at the site of inflammation in rheumatoid arthritis: evidence for activation by T cells. Ann Rheum Dis 64:1436–1442. 10.1136/ard.2004.034132 Injarabian L, Devin A, Ransac S, Marteyn B (2019) Neutrophil Metabolic Shift during their Lifecycle: Impact on their Survival and Activation. Int J Mol Sci 21:287. 10.3390/ijms21010287 Jing W, Liu C, Su C et al (2023) Role of reactive oxygen species and mitochondrial damage in rheumatoid arthritis and targeted drugs. Front Immunol 14:1107670. 10.3389/fimmu.2023.1107670 Kaundal U, Khullar A, Leishangthem B et al (2020) The effect of methotrexate on neutrophil reactive oxygen species and CD177 expression in rheumatoid arthritis. Clin Exp Rheumatol 39:479–486. 10.55563/clinexprheumatol/4h5onh Kruger P, Saffarzadeh M, Weber An et al (2015) Neutrophils: Between host defence, immune modulation, and tissue injury. Plos Pathog 11:e1004651. 10.1371/journal.ppat.1004651 Kumar S, Dikshit M (2019) Metabolic Insight of Neutrophils in Health and Disease. Front Immunol 10:2099. 10.3389/fimmu.2019.02099 Kundu S, Bala A, Ghosh P et al (2011) Attenuation of oxidative stress by allylpyrocatechol in synovial cellular infiltrate of patients with Rheumatoid Arthritis. Free Radic Res 45:518–526. 10.3109/10715762.2011.555480 Kundu S, Ghosh P, Datta S, Ghosh A, Chattopadhyay S, Chatterjee M (2012) Oxidative stress as a potential biomarker for determining disease activity in patients with rheumatoid arthritis. Free Radic Res 46:1482–1489. 10.3109/10715762.2012.727991 Mangal Jl, Basu N, Wu Hj A Ap (2021) Immunometabolism: an emerging target for immunotherapies to treat rheumatoid arthritis. Immunometabolism 3:e210032. 10.20900/immunometab20210032 Mccracken, Jm, Allen La (2014) Regulation of human neutrophil apoptosis and lifespan in health and disease. J Cell Death 7:15–23. 10.4137/JCD.S11038 Mócsai A (2013) Diverse novel functions of neutrophils in immunity, inflammation, and beyond. J Exp Med 210:1283–1299. 10.1084/jem.20122220 Van Munoz Le C, Franz S, Berden J, Herrmann M, Van Der Vlag J (2008) Apoptosis in the pathogenesis of systemic lupus erythematosus. Lupus 17:371–375. 10.1177/0961203308089990 Ndrepepa G (2019) Myeloperoxidase - A bridge linking inflammation and oxidative stress with cardiovascular disease. Clin Chim Acta 493:36–51. 10.1016/j.cca.2019.02.022 Dc P, Kj W, Hr G (2003) The anti-inflammatory actions of methotrexate are critically dependent upon the production of reactive oxygen species. Br J Pharmacol 138:501–511. 10.1038/sj.bjp.0705054 Pradhan A, Bagchi A, De S et al (2019) Role of redox imbalance and cytokines in mediating oxidative damage and disease progression of patients with rheumatoid arthritis. Free Radic Res 53:768–779. 10.1080/10715762.2019.1629586 Pradhan A, Sengupta S, Sengupta R, Chatterjee M (2023) Attenuation of methotrexate induced hepatotoxicity by epigallocatechin 3-gallate. Drug Chem Toxicol 46:717–725. 10.1080/01480545.2022.2085738 Radu AF, Bungau SG (2021) Management of Rheumatoid Arthritis: An Overview. Cells 10:2857. 10.3390/cells10112857 Reczek Cr C, Ns (2015) ROS-dependent signal transduction. Curr Opin Cell Biol 33:8–13. 10.1016/j.ceb.2014.09.010 Rodríguez-Espinosa O, Rojas-Espinosa O, Moreno-Altamirano, Mm López Villegas Eo, Sánchez-García Fj (2015) Metabolic requirements for neutrophil extracellular traps formation. Immunology 145:213–224. 10.1111/imm.12437 Sarkar D, De Sarkar S, Gille L, Chatterjee M (2022) Ascaridole exerts the leishmanicidal activity by inhibiting parasite glycolysis. Phytomedicine 103:154221. 10.1016/j.phymed.2022.154221 Schuurman Ar B, Jm M, Eha et al (2023) Inflammatory and glycolytic programs underpin a primed blood neutrophil state in patients with pneumonia. Iscience 26:107181. 10.1016/j.isci.2023.107181 Spurlock Cf, Zt A, Jt T et al (2011) Increased sensitivity to apoptosis induced by methotrexate is mediated by JNK. Arthritis Rheum 63:2606–2616. 10.1002/art.30457 . 3 Sur Chowdhury C, Giaglis S, Walker Ua, Buser A, Hahn S, Hasler P (2014) Enhanced neutrophil extracellular trap generation in rheumatoid arthritis: analysis of underlying signal transduction pathways and potential diagnostic utility. Arthritis Res Ther 16:R122. 10.1186/ar4579 Thind Mk U, Hh, Glogauer M et al (2024) A metabolic perspective of the neutrophil life cycle: new avenues in immunometabolism. Front Immunol 14:1334205. 10.3389/fimmu.2023.1334205 Additional Declarations No competing interests reported. Supplementary Files Supplementary1.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 29 Apr, 2026 Reviews received at journal 29 Apr, 2026 Reviewers agreed at journal 20 Apr, 2026 Reviewers agreed at journal 15 Apr, 2026 Reviewers invited by journal 14 Apr, 2026 Editor assigned by journal 12 Apr, 2026 Submission checks completed at journal 12 Apr, 2026 First submitted to journal 08 Apr, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9362152","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":626032680,"identity":"dab9a459-f3f7-4f37-8fbe-d54b48cec01e","order_by":0,"name":"Aniruddha Bagchi","email":"","orcid":"","institution":"Institute of Post Graduate Medical Education and Research","correspondingAuthor":false,"prefix":"","firstName":"Aniruddha","middleName":"","lastName":"Bagchi","suffix":""},{"id":626032681,"identity":"c058e91b-b311-4ccc-b649-6c347de142cc","order_by":1,"name":"Shilpa Sengupta","email":"","orcid":"","institution":"Institute of Post Graduate Medical Education and Research","correspondingAuthor":false,"prefix":"","firstName":"Shilpa","middleName":"","lastName":"Sengupta","suffix":""},{"id":626032682,"identity":"ae1c2a3c-7a58-4138-94d7-ce546bfe9ccf","order_by":2,"name":"Parasar Ghosh","email":"","orcid":"","institution":"Institute of Post Graduate Medical Education and Research","correspondingAuthor":false,"prefix":"","firstName":"Parasar","middleName":"","lastName":"Ghosh","suffix":""},{"id":626032683,"identity":"c3d6365c-c99c-4aec-a17b-a2c1cdff4c1a","order_by":3,"name":"Alakendu Ghosh","email":"","orcid":"","institution":"Institute of Post Graduate Medical Education and Research","correspondingAuthor":false,"prefix":"","firstName":"Alakendu","middleName":"","lastName":"Ghosh","suffix":""},{"id":626032686,"identity":"828ce91b-0798-4c96-9989-77c610dd76d1","order_by":4,"name":"Mitali Chatterjee","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvklEQVRIiWNgGAWjYBACNnYgkcDAIAfiHHhAlBZmBsYGoBZjsJYEoqwBaQFSiSCCgSgtfMzMzx88zLFLnx92+CHQFjs53QaCDmMzbEjclpy78XaaAVBLsrHZAYJaGEBaDuRunJ0A0nIAyCaohf0jSEu64ez0D8Rq4QHbkiAvnUO0LTyFM4B+MdwgnVNwIMGACL/It7dv+Phzm528/Oz0zR8+VNjJEdQCBwZglQbEKgdb10CK6lEwCkbBKBhRAABS1kNJ2T5riQAAAABJRU5ErkJggg==","orcid":"","institution":"Institute of Post Graduate Medical Education and Research","correspondingAuthor":true,"prefix":"","firstName":"Mitali","middleName":"","lastName":"Chatterjee","suffix":""}],"badges":[],"createdAt":"2026-04-09 02:24:47","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9362152/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9362152/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":107706556,"identity":"ad6aea48-56bc-4fc4-8512-38d2bffc2474","added_by":"auto","created_at":"2026-04-24 09:18:20","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":320122,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImpact of MTX and PMA upon generation of ROS in neutrophils\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA: \u003c/strong\u003eRepresentative frequency plots demonstrating the proportion of ROS\u003csup\u003ehigh\u003c/sup\u003e generating neutrophils (\u003cstrong\u003eR2\u003c/strong\u003e) in the absence (\u003cstrong\u003ei\u003c/strong\u003e) and presence of MTX, 2.5 µM (\u003cstrong\u003eii\u003c/strong\u003e), 5 µM (\u003cstrong\u003eiii\u003c/strong\u003e), 10 µM (\u003cstrong\u003eiv\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eB:\u003c/strong\u003e Representative frequency plots demonstrating the proportion of ROS\u003csup\u003ehigh\u003c/sup\u003e generating neutrophils (\u003cstrong\u003eR2\u003c/strong\u003e) treated with PMA (\u003cstrong\u003ei\u003c/strong\u003e), PMA+MTX 2.5 µM (\u003cstrong\u003eii\u003c/strong\u003e), PMA+MTX 5 µM (\u003cstrong\u003eiii\u003c/strong\u003e) and PMA+MTX 10 µM (\u003cstrong\u003eiv\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eC\u003c/strong\u003e. Scatter plots demonstrating the frequency of ROS\u003csup\u003ehigh\u003c/sup\u003e generating neutrophils (\u003cstrong\u003eR2\u003c/strong\u003e) treated with MTX ± PMA. Data are indicated in median (IQR).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eD i-iii\u003c/strong\u003e. Representative histogram plots depicting the GMFC of CMDCF in neutrophils treated with MTX (± PMA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eiv\u003c/strong\u003e. Scatter plots demonstrating the GMFC of CMDCF in neutrophils treated with MTX± PMA. Data are indicated in median (IQR).\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-9362152/v1/aef8273bc1c80affbfb5c48e.png"},{"id":107572399,"identity":"b98c6f74-ceaf-43c3-86b1-2fd1d26050c7","added_by":"auto","created_at":"2026-04-22 18:46:55","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":256206,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImpact of MTX and PMA on the status of MPO in neutrophils (n=5; 5x10\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e5\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e cells/ml)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA i-iv:\u003c/strong\u003e Representative frequency plots demonstrating the proportion of MPO\u003csup\u003e+\u003c/sup\u003e neutrophils (5x10\u003csup\u003e5\u003c/sup\u003e cells/ml, \u003cstrong\u003ei\u003c/strong\u003e) treated with MTX 2.5 µM (\u003cstrong\u003eii\u003c/strong\u003e), 5 µM (\u003cstrong\u003eiii\u003c/strong\u003e), 10 µM (\u003cstrong\u003eiv\u003c/strong\u003e)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eB i-iv\u003c/strong\u003e: Representative frequency plots demonstrating the proportion of MPO\u003csup\u003e+ \u003c/sup\u003eneutrophils (5x10\u003csup\u003e5\u003c/sup\u003e cells/ml, i) treated with PMA (\u003cstrong\u003ei\u003c/strong\u003e) in the presence of MTX 2.5 µM (\u003cstrong\u003eii\u003c/strong\u003e), 5 µM (\u003cstrong\u003eiii\u003c/strong\u003e), 10 µM (\u003cstrong\u003eiv\u003c/strong\u003e),\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eC\u003c/strong\u003e. Scatter plots demonstrating the frequency of MPO\u003csup\u003e+\u003c/sup\u003e neutrophils treated with MTX ± PMA. Data are indicated in median (IQR).\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-9362152/v1/108f58c2a07ad3f5551ab2d0.png"},{"id":107706116,"identity":"44fa982c-119f-46e9-9245-717c832402e9","added_by":"auto","created_at":"2026-04-24 09:17:27","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":414389,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImpact of MTX and PMA on the status of CD83 and HLA-DR in neutrophils\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA i-iv\u003c/strong\u003e: Representative frequency plots demonstrating the proportion of CD83\u003csup\u003ehigh\u003c/sup\u003e neutrophils (n=5; 5x10\u003csup\u003e5\u003c/sup\u003e cells/ml) (\u003cstrong\u003ei\u003c/strong\u003e), treated with MTX, 2.5 µM (\u003cstrong\u003eii\u003c/strong\u003e), 5 µM (\u003cstrong\u003eiii\u003c/strong\u003e) or 10 µM (\u003cstrong\u003eiv\u003c/strong\u003e)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eB i-iv\u003c/strong\u003e Representative frequency plots demonstrating the proportion of CD83\u003csup\u003ehigh\u003c/sup\u003e neutrophils treated with PMA (\u003cstrong\u003ei)\u003c/strong\u003e and MTX, 2.5 µM (\u003cstrong\u003eii\u003c/strong\u003e), MTX, 5 µM (\u003cstrong\u003eiii\u003c/strong\u003e) or MTX, 10 µM (\u003cstrong\u003eiv\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eC\u003c/strong\u003e. Scatter plots demonstrating the frequency of CD83\u003csup\u003ehigh\u003c/sup\u003e neutrophils treated with MTX ± PMA. Data are indicated in median (IQR).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDi-iv\u003c/strong\u003e: Representative frequency plots demonstrating the proportion of HLA-DR\u003csup\u003ehigh\u003c/sup\u003e in neutrophils (5x10\u003csup\u003e5\u003c/sup\u003e cells/ml, \u003cstrong\u003ei\u003c/strong\u003e) treated with MTX, 2.5 µM (\u003cstrong\u003eii\u003c/strong\u003e), 5 µM (\u003cstrong\u003eiii\u003c/strong\u003e), 10 µM (\u003cstrong\u003eiv\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eE i-iv\u003c/strong\u003e Representative frequency plots demonstrating the proportion of HLA-DR\u003csup\u003ehigh\u003c/sup\u003e neutrophils (5x10\u003csup\u003e5\u003c/sup\u003e cells/ml) treated with PMA, (\u003cstrong\u003ei\u003c/strong\u003e) and MTX, 2.5 µM (\u003cstrong\u003eii\u003c/strong\u003e), MTX, 5 µM (\u003cstrong\u003eiii\u003c/strong\u003e) or MTX, 10 µM (\u003cstrong\u003eiv\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e. Scatter plots demonstrate the frequency of HLA-DR\u003csup\u003ehigh\u003c/sup\u003e neutrophils treated with MTX ± PMA. Data are indicated in median (IQR).\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-9362152/v1/98f70b4b92230c4aa5f1620c.png"},{"id":107706419,"identity":"1c4d5f94-29b3-4dd1-8054-965227a014d6","added_by":"auto","created_at":"2026-04-24 09:18:05","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":502990,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of MTX and PMA on the status of apoptosis in neutrophils\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA i-vi\u003c/strong\u003e: Representative frequency plots demonstrating the proportion of Annexin V\u003csup\u003e+\u003c/sup\u003e neutrophils (n=5; 5x10\u003csup\u003e5\u003c/sup\u003e cells/ml\u003cstrong\u003e i\u003c/strong\u003e) treated with MTX, 2.5 µM (\u003cstrong\u003eii\u003c/strong\u003e), 5 µM (\u003cstrong\u003eiii\u003c/strong\u003e), or with PMA (\u003cstrong\u003eiv\u003c/strong\u003e), PMA + MTX 2.5 µM (\u003cstrong\u003ev\u003c/strong\u003e) and PMA+MTX 5 µM (\u003cstrong\u003evi\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eB i-vi. \u003c/strong\u003eRepresentative frequency plots demonstrating the proportion of Caspase 3\u003csup\u003e+\u003c/sup\u003e neutrophils (\u003cstrong\u003ei\u003c/strong\u003e) treated with MTX 2.5 µM (\u003cstrong\u003eii\u003c/strong\u003e), 5 µM (\u003cstrong\u003eiii\u003c/strong\u003e), PMA (\u003cstrong\u003eiv\u003c/strong\u003e), PMA+MTX 2.5 µM (\u003cstrong\u003ev\u003c/strong\u003e) and PMA+MTX 5 µM (\u003cstrong\u003evi\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eC i-vi.\u003c/strong\u003e Representative frequency plots demonstrating the proportion of Anti-apoptotic Bcl-2\u003csup\u003e+\u003c/sup\u003e neutrophils (\u003cstrong\u003ei\u003c/strong\u003e) treated with MTX, 2.5 µM (\u003cstrong\u003eii\u003c/strong\u003e), 5 µM (\u003cstrong\u003eiii\u003c/strong\u003e), PMA (\u003cstrong\u003eiv\u003c/strong\u003e), PMA+MTX 2.5 µM (\u003cstrong\u003ev\u003c/strong\u003e) and PMA+MTX 5 µM (\u003cstrong\u003evi\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eD i-iii\u003c/strong\u003e. Scatter plots demonstrating the frequency of Annexin V\u003csup\u003e+\u003c/sup\u003e (\u003cstrong\u003ei\u003c/strong\u003e), Caspase 3\u003csup\u003e+\u003c/sup\u003e (\u003cstrong\u003eii\u003c/strong\u003e), Bcl-2\u003csup\u003e+ \u003c/sup\u003e(\u003cstrong\u003eiii\u003c/strong\u003e) neutrophils treated with MTX ± PMA. Data are indicated in median (IQR).\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-9362152/v1/f2272414830c1ff254b047ac.png"},{"id":107706082,"identity":"b1261c5a-fe28-4038-8431-55b8d70815d5","added_by":"auto","created_at":"2026-04-24 09:17:20","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":351567,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImpact of MTX and PMA upon glycolysis in neutrophils\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAi. \u003c/strong\u003eRepresentative plots of extracellular acidification rate or glycolysis in neutrophils (1x10\u003csup\u003e6\u003c/sup\u003e cells/ml, n = 3) treated with MTX, PMA or MTX+PMA along with untreated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAii-iv\u003c/strong\u003e: Bar diagrams demonstrating the levels of non-glycolytic acidification (\u003cstrong\u003eii\u003c/strong\u003e), glycolysis status (\u003cstrong\u003eiii\u003c/strong\u003e) and glycolytic capacity (\u003cstrong\u003eiv\u003c/strong\u003e). Each experiment was done thrice in duplicate. Data are indicated in median (IQR).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBi,ii\u003c/strong\u003e:\u0026nbsp; Bar diagram demonstrating the gene level expression of glycolysis regulatory enzymes i.e. Hexokinase or \u003cem\u003eHK2\u003c/em\u003e (\u003cstrong\u003ei\u003c/strong\u003e) and Lactate dehydrogenase \u003cem\u003eLDH\u003c/em\u003e (\u003cstrong\u003eii\u003c/strong\u003e) in neutrophils treated with MTX ± PMA. Each experiment was done thrice in duplicates and data are indicated in median (IQR).\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-9362152/v1/122700efba45011b054e9455.png"},{"id":107572403,"identity":"11462a4b-6829-40a6-b288-377e83122493","added_by":"auto","created_at":"2026-04-22 18:46:55","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":427519,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImpact of MTX and PMA upon oxidative phosphorylation in neutrophils:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAi-iii. \u003c/strong\u003eRepresentative plots of oxygen consumption rate (OCR) or oxidative phosphorylation in neutrophils (1x10\u003csup\u003e6\u003c/sup\u003e cells/ml, n= 3) treated with MTX (\u003cstrong\u003ei\u003c/strong\u003e), PMA (\u003cstrong\u003eii\u003c/strong\u003e) or MTX+PMA (\u003cstrong\u003eiii\u003c/strong\u003e) along with untreated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA iv-vii\u003c/strong\u003e: Bar diagrams demonstrating the levels of basal respiration (\u003cstrong\u003eiv\u003c/strong\u003e), ATP production (\u003cstrong\u003ev\u003c/strong\u003e), Spare respiratory capacity (\u003cstrong\u003evi\u003c/strong\u003e) and acute response (\u003cstrong\u003evii\u003c/strong\u003e). Each experiment was done thrice in duplicate. Data are indicated in median(IQR).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eB\u003c/strong\u003e. Representative plot of oxygen consumption rate (OCR) or oxidative phosphorylation in neutrophils treated with MTX (\u003cstrong\u003ei\u003c/strong\u003e), lower dose of PMA i.e. 0.5 µg/ml (\u003cstrong\u003eii\u003c/strong\u003e) or MTX+PMA (\u003cstrong\u003eiii\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eC\u003c/strong\u003e. Bar diagrams demonstrating the levels of acute response in neutrophils treated with MTX± PMA. The experiments were done thrice in duplicates. Data are indicated in median (IQR).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDi-iii\u003c/strong\u003e:\u0026nbsp; Bar diagram demonstrating the gene level expression of oxidative phosphorylation regulatory enzymes i.e. Pyruvate dehydrogenase kinase or \u003cem\u003ePDK1\u003c/em\u003e (\u003cstrong\u003ei\u003c/strong\u003e), Succinate dehydrogenase or \u003cem\u003eSDHA\u003c/em\u003e (\u003cstrong\u003eii\u003c/strong\u003e), \u003cem\u003eATP synthase\u003c/em\u003e (\u003cstrong\u003eiii\u003c/strong\u003e) in neutrophils treated with MTX ± PMA. Each experiment was done thrice in duplicates and data are indicated in median(IQR).\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-9362152/v1/d0a37b3d340174630debf183.png"},{"id":108181151,"identity":"24fe89b9-cd16-4223-af0a-d1662dd9948e","added_by":"auto","created_at":"2026-04-30 08:57:54","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2452881,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9362152/v1/154c392d-35c6-41c6-9584-3f7eb66b53cf.pdf"},{"id":107572397,"identity":"8309ef1a-ac72-40b3-95f6-7ca956f2e379","added_by":"auto","created_at":"2026-04-22 18:46:55","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":312584,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementary1.docx","url":"https://assets-eu.researchsquare.com/files/rs-9362152/v1/2335b129ab1e5ee3d8882d0a.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Impact of Methotrexate upon transdifferentiation and metabolic bioenergetics of neutrophils","fulltext":[{"header":"Introduction","content":"\u003cp\u003eRheumatoid arthritis (RA) is a chronic, systemic, inflammatory, autoimmune disorder that mostly affects the peripheral joints i.e. synovial joints leading to destruction of cartilage and bone [Radu and Bungau \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2021\u003c/span\u003e]. Approximately, 0.5-1% of the global population is affected by RA, along with a female predominance [Ashai and Harvey \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e]. The pathogenesis of RA is associated with infiltration of immune cells (~\u0026thinsp;90% neutrophils) into the sites of inflammation and accompanied by a predominantly pro-inflammatory and pro-oxidant milieu that perpetuates a vicious cycle. Oxidative stress is associated with an intricate cross talk between immune responses and generation of endogenous/exogenous antigens, that results in disease sustenance [Kundu et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Datta et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Bagchi et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe neutrophil-derived ROS, reactive nitrogen species (RNS) and granule proteases have been strongly implicated in chronic damage and destruction of host tissues, attributed to formation of neo-antigens (e.g. citrullinated histones, cyclic citrullinated peptides or CCP) along with irreversible damage to proteins, lipids and DNA along with bone and cartilage damage [Jing et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Pradhan et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2019\u003c/span\u003e]. Although ROS is considered as a host-defense mechanism of neutrophils [Mocsai 2013; Kruger et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2015\u003c/span\u003e], it is also a crucial second messenger that determines cell differentiation, maturation, and can cause functional alteration of signaling molecules [Reczek and Chandel 2015]. In the synovial fluid (SF) of patients with RA, a subpopulation of accumulated neutrophils demonstrated the ability to transdifferentiate into neutrophil-dendritic cell hybrids or N-DCs and acquired antigen presenting properties [Bagchi et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e]. Additionally, as compared to canonical neutrophils, these N-DCs demonstrated substantial generation of ROS, potentially contributing to the oxidative stress within synovial joints, and by sustaining the vicious cycle facilitates disease progression [Bagchi et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe first-line disease-modifying anti-rheumatic drug (DMARD) for the treatment of RA is methotrexate (MTX), a stable derivative of aminopterin [Bedoui et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e]. Chronic administration of MTX in patients with RA is associated with hepatotoxicity, which varies from mild hepatitis and cholestasis to acute liver failure and cirrhosis [Pradhan et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2023\u003c/span\u003e]. In animal models of RA, this MTX mediated hepatic damage was attributed to oxidative stress and was mitigated by the intervention of antioxidants like epigallocatechin 3-gallate, allylpyrocatechol etc. [Pradhan et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, De et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2017\u003c/span\u003e]. Furthermore, long-term administration of MTX caused inhibition of free radical scavengers i.e. superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx), and thereby by compromising the redox homeostasis caused oxidative stress [Pradhan et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, Herman et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2005\u003c/span\u003e, Phillips et al. 2003]. Accordingly, this study was aimed at evaluating the effect of MTX on neutrophils, in a pro-oxidant milieu, in terms of activation, trans-differentiation, and antigen presenting properties, apoptotic status and metabolic bioenergetics.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eReagents\u003c/h2\u003e \u003cp\u003eAll reagents were obtained from BD Biosciences (San Jose, CA, USA) except 5-(and-6)-carboxy-2\u0026rsquo;,7\u0026rsquo;-dichlorodihydrofluorescein diacetate, acetyl ester [CM-H\u003csub\u003e2\u003c/sub\u003eDCFDA] (Invitrogen, Carlsbad, CA, USA), Phorbol 12-myristate 13-acetate or PMA and Methotrexate (Sigma Aldrich, India), Granulocyte seperating media 1119 and Lymphocyte seperating media 1077 (HiMedia, Mumbai, India). cDNA Reverse Transcription kit, SYBR Green qPCR Master Mix were obstained from Applied Biosystems (Grand Island, NY, USA), TRIzol reagent (Ambion, Austin, TX, USA) and Cell-Tak\u0026trade; from Corning\u0026reg; (Tewksbury, MA, USA). For the mitochondrial and glycolytic studies by Extracellular Flux analyzer, XFp Flux pack and XF DMEM medium were obtained from Agilent Technologies (Santa Clara, CA, USA). The study protocol received prior approval from the Institutional Ethics Committee of IPGME\u0026amp;R, Kolkata; written informed consent was obtained from all participants.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eGeneration of reactive oxygen species in neutrophils\u003c/h3\u003e\n\u003cp\u003eNeutrophils were isolated from peripheral blood using HiSep 1077 and GranuloSep GSM 1119 according to manufacturer\u0026rsquo;s instructions. Briefly, a double gradient was formed by layering an equal volume of HiSep LSM 1077 and GranuloSep 1119 to which blood was carefully layered. Following centrifugation (3000 rpm, 30 min, RT), neutrophils present at the HiSep LSM 1077/ GranuloSep GSM 1119 interphase layer were collected, washed twice in phosphate buffer saline (0.02 M, pH 7.4, PBS), resuspended in 2 ml of PBS, and cell viability (\u0026gt;\u0026thinsp;95%) confirmed using trypan blue.\u003c/p\u003e \u003cp\u003eInitially, the non-toxic concentration of MTX, was estimated in isolated neutrophils (5x10\u003csup\u003e5\u003c/sup\u003e cells/ml) sourced from peripheral blood of healthy donors (n\u0026thinsp;=\u0026thinsp;5), that after incubation with MTX (0\u0026ndash;20 \u0026micro;M, 1hr, 37\u003csup\u003e○\u003c/sup\u003eC in dark) were washed in PBS, resuspended in 400 \u0026micro;l of PBS, surface stained with propidium iodide (0.01 \u0026micro;g/ml) and acquired in a flow cytometer. The frequency of PI\u003csup\u003e+\u003c/sup\u003e neutrophils was measured to assess cytotoxicity.\u003c/p\u003e \u003cp\u003eThe generation of ROS was measured in neutrophils isolated from peripheral blood of healthy controls (n\u0026thinsp;=\u0026thinsp;5) using, a chloromethyl derivative of 5-(and-6)-carboxy-2\u0026rsquo;,7\u0026rsquo;-dichlorodihydrofluorescein diacetate, acetyl ester or CM-H\u003csub\u003e2\u003c/sub\u003eDCFDA [\u003cb\u003e5\u003c/b\u003e]. Briefly, neutrophils (5x10\u003csup\u003e5\u003c/sup\u003e cells/ml), following pretreatment with MTX (2.5\u0026ndash;10.0 \u0026micro;M, 1hr, 37\u003csup\u003e○\u003c/sup\u003eC in dark)\u0026thinsp;\u0026plusmn;\u0026thinsp;PMA (1 \u0026micro;g/ml, 15 min, 37\u003csup\u003e○\u003c/sup\u003eC in dark) were washed and incubated with CM-H\u003csub\u003e2\u003c/sub\u003eDCFDA (2 \u0026micro;M, 30 min, 37\u003csup\u003e○\u003c/sup\u003eC in dark); following two washes with PBS they were resuspended in 400 \u0026micro;l of PBS, and acquired in a flow cytometer [\u003cb\u003e5\u003c/b\u003e].\u003c/p\u003e\n\u003ch3\u003eMeasurement of intracellular myeloperoxidase (MPO)\u003c/h3\u003e\n\u003cp\u003eNeutrophils (5x10\u003csup\u003e5\u003c/sup\u003e cells/ml) sourced from peripheral blood of healthy controls (n\u0026thinsp;=\u0026thinsp;5) were treated with MTX (2.5\u0026ndash;10.0 \u0026micro;M, 1hr, 37\u0026ordm;C in dark)\u0026thinsp;\u0026plusmn;\u0026thinsp;PMA (1 \u0026micro;g/ml, 15 min, 37\u0026ordm;C in dark). Cells were then fixed and permeabilized with 100 \u0026micro;l of cytofix-perm buffer (BD Biosciences, San Jose, CA, USA) for 20 min. at RT in dark. Cells were then washed, resuspended in perm-wash buffer (100 \u0026micro;l), incubated with MPO-PE (30 min, RT in dark) and after two washes in PBS, resuspended in PBS and acquired in a flow cytometer.\u003c/p\u003e\n\u003ch3\u003eImmunophenotyping of neutrophils\u003c/h3\u003e\n\u003cp\u003eThe frequency of CD83 and HLA-DR was measured in neutrophils sourced from peripheral blood of healthy controls (n\u0026thinsp;=\u0026thinsp;5) by flow cytometry. Neutrophils (5x10\u003csup\u003e5\u003c/sup\u003e cells/ml) were treated with MTX (2.5\u0026ndash;10.0 \u0026micro;M, 1hr, 37\u003csup\u003e○\u003c/sup\u003eC in dark), surface stained with CD83-PE and HLA-DR-PerCP, incubated for 30 min, RT in dark and following three washes with PBS resuspended in 400 \u0026micro;l of PBS and acquired in a flow cytometer.\u003c/p\u003e\n\u003ch3\u003eAnalysis of apoptosis by phosphatidylserine externalization\u003c/h3\u003e\n\u003cp\u003eTo assess the apoptotic status of neutrophils, isolated neutrophils (5x10\u003csup\u003e5\u003c/sup\u003e cells/ml) were treated with MTX (2.5 or 5 \u0026micro;M, 1hr, 37\u003csup\u003e\u0026ordm;\u003c/sup\u003eC in dark) and/or PMA (1 \u0026micro;g/ml, 15 min, 37\u003csup\u003e\u0026ordm;\u003c/sup\u003eC in dark). Following centrifugation (5000 rpm, 10 min), and after two washes in PBS, cells were resuspended in annexin V binding buffer [10 mM HEPES/ NaOH (pH 7.4), 140 mM NaCl, 2.5 mM CaCl\u003csub\u003e2\u003c/sub\u003e] and incubated for 20 min. Annexin V-FITC was added according to the manufacturers\u0026rsquo; instructions and incubated for 30 min, RT in dark. Finally, after two washes with PBS, cells were resuspended in PBS and acquired in a flow cytometer.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eStatus of pro-apoptotic Caspase 3 and anti-apoptotic Bcl-2\u003c/h2\u003e \u003cp\u003eNeutrophils (5x10\u003csup\u003e5\u003c/sup\u003e cells/ml) sourced from peripheral blood of healthy controls (n\u0026thinsp;=\u0026thinsp;5) were treated with MTX (2.5 and 5 \u0026micro;M, 1hr, 37\u003csup\u003e○\u003c/sup\u003eC in dark) and/or PMA (1 \u0026micro;g/ml, 15 min, 37\u003csup\u003e○\u003c/sup\u003eC in dark). Neutrophils were initially surface stained with CD66b-FITC and incubated (30 min, RT in dark), then fixed and permeabilized with 100 \u0026micro;l of cytofix-perm buffer (BD Biosciences, San Jose, CA, USA) for 20 min. at RT in dark. Cells were resuspended in Perm-wash buffer (100 \u0026micro;l) and incubated with Caspase 3 or Bcl-2 for 30 min (RT in dark); after two washes with PBS, resuspended in PBS and acquired in a flow cytometer.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eFlow cytometry\u003c/h3\u003e\n\u003cp\u003eCells were gated based on characteristic linear forward and side scatter morphological gating of neutrophils (events: 5000); Cells were acquired in a BD Accuri\u0026trade; C6 Plus\u0026ensp;(BD Biosciences, San Jose, CA, USA) and the fluorescence measured on a biexponential scale using BD Accuri\u0026trade; C6 Plus analysing software. Frequency and expression (in terms of Geometric mean fluorescence channel, GMFC,) was evaluated in c6 Plus software (BD Biosciences, San Jose, CA, USA).\u003c/p\u003e\n\u003ch3\u003eImpact of MTX on bioenergetics of neutrophils\u003c/h3\u003e\n\u003cp\u003eReal-time measurements of mitochondrial respiration or oxidative phosphorylation (OXPHOS) and cellular glycolytic activity of neutrophils were performed using Seahorse Metabolic Analyzer XFp (Agilent Technologies, Santa Clara, CA, USA) in terms of their oxygen consumption rate (OCR, pmol/min) and extracellular acidification rate (ECAR, mpH/min) respectively, as per manufacturer\u0026rsquo;s instructions [Grudzinska et al. 2023; sarkar et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2022\u003c/span\u003e]. The glycolytic activities were assessed in neutrophils incubated with MTX (2.5 \u0026micro;M) and/or PMA (1.0 \u0026micro;g/ml) along with glucose (10 mM), oligomycin (10 \u0026micro;M), and 2-deoxyglucose (2-DG, 50 mM). Data was analysed using Seahorse Wave software, version 2.6.1, along with the XF Mito/Glycolysis stress test report generator (Agilent Technologies, Santa Clara, CA, USA). Similarly, freshly isolated neutrophils from peripheral blood of healthy controls (n\u0026thinsp;=\u0026thinsp;3), were seeded (1x10\u003csup\u003e6\u003c/sup\u003e cells/180 \u0026micro;l/well), and their mitochondrial respiration assessed in cells incubated with MTX and/or PMA along with classical inhibitors, oligomycin (10 \u0026micro;M), carbonyl cyanidep- trifluoromethoxyphenylhydrazone (FCCP, 2 \u0026micro;M) and rotenone-antimycin A (Rot\u0026thinsp;+\u0026thinsp;AA, 1 \u0026micro;M each).\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003emRNA expression of glycolytic and OXPHOS markers\u003c/h2\u003e \u003cp\u003eNeutrophils sourced from healthy controls were treated with MTX (2.5 \u0026micro;M, 1 hr, 37\u003csup\u003e○\u003c/sup\u003eC) and/or PMA (1.0 \u0026micro;g/ml, 15 min, 37\u003csup\u003e○\u003c/sup\u003eC), followed by isolation of total RNA by the Trizol method, and concentration measured in a NanodropTM One/OneC Microvolume UV-Vis Spectrophotometer (Thermo Fischer Scientific, MA, USA), and converted to single-stranded cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems\u0026trade;, MA, USA), according to the manufacturer's instructions. cDNA (1 \u0026micro;g for a 20 \u0026micro;l reaction) for detection of amplicons was done using gene specific primers (sourced from NCBI Primer-BLAST, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/tools/primer-blast\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/tools/primer-blast\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) whose specificity was confirmed by UCSC In-Silico PCR for human-specific genes (\u003cb\u003ei\u003c/b\u003e) \u003cem\u003eHK2\u003c/em\u003e and \u003cem\u003eLDHA\u003c/em\u003e (for glycolysis) along with (\u003cb\u003eii\u003c/b\u003e) \u003cem\u003ePDK1, SDHA\u003c/em\u003e and \u003cem\u003eATP synthase (\u003c/em\u003efor OXPHOS), Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimers\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePrimer Sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cb\u003eGlycolytic genes\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eHK2\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(\u003c/b\u003e\u003cb\u003eHexokinase 2\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGCCTGTGAATCGGAGAGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGTCAAGGCGCTAACTTCGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eLDHA\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(\u003c/b\u003e\u003cb\u003eLactate dehydrogenase\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAAGCTGTCATGGGTGGGTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGGGAAACCATTCCATCCTACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"5\" rowspan=\"6\"\u003e \u003cp\u003e\u003cb\u003eTCA cycle and\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003eOxidative\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003ePhosphorylation\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003egenes\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003ePDK1\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(\u003c/b\u003e\u003cb\u003ePyruvate kinase\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003edehydrogenase\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGTGGCTTCTCTAGCGGGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGAGAAGCGCGCGTAGAAGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eSDHA\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(\u003c/b\u003e\u003cb\u003eSuccinate dehydrogenase\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGATCTTCCTGACTCAGCCTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGAGACCCTGTCCCTACAATTAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eATP synthase\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAAGGTGGGGTAAGGCCAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCCTACAACTTGGGCAAAGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData was checked for normality using by the Shapiro-Wilk test; for parametric data, an unpaired t-test or one-way ANOVA was done followed by post-hoc Tukey\u0026rsquo;s multiple comparison, and for nonparametric data, Mann-Whitney or Kruskal-Wallis test was done, followed by post-hoc Dunn\u0026rsquo;s multiple comparison, using GraphPad Prism software, version 8.2, (GraphPad Prism software Inc, La Jolla, CA, USA); p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered as statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eImpact of MTX on generation of reactive oxygen species (ROS) in neutrophils\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo assess the non-toxic dose of MTX, neutrophils (5x10\u003csup\u003e5\u003c/sup\u003e cells/ml) were initially pretreated with MTX (0-20 \u0026mu;M, 1 hr, 37\u003csup\u003eo\u003c/sup\u003eC), surface stained with Propidium iodide (0.01 \u0026micro;g/ml), and the frequency of PI\u003csup\u003e+\u0026nbsp;\u003c/sup\u003eneutrophils assessed by flow cytometry. At baseline, the frequency of PI\u003csup\u003e+\u003c/sup\u003e neutrophils was 1.35(1.30-1.46)% and remained unchanged with MTX (0.625, 1.25, 2.5. 5.0 and 10 \u0026micro;M) being 1.47(1.11-1.68)%, 1.69(1.61-1.76)%, 2.01(1.81-2.08)%, 1.90(1.75-2.07)% and 2.74(2.39-2.94)% \u0026nbsp; respectively (\u003cstrong\u003eS1,\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eA i-vi, B\u003c/strong\u003e). However, MTX (20 \u0026micro;M) increased the PI positivity to 22.96(19.01-25.17)%, p\u0026lt;0.01 (\u003cstrong\u003eS1,\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eA vii, B\u003c/strong\u003e); accordingly, the maximum conc. of MTX used was 10 \u0026micro;M. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn terms of generation of ROS, based on CMDCF fluorescence, neutrophils were pretreated with MTX in the presence of PMA, an established pro-oxidant. The cell population was subdivided into ROS\u003csup\u003elow\u003c/sup\u003e (\u003cstrong\u003eR1\u003c/strong\u003e) and ROS\u003csup\u003ehigh\u0026nbsp;\u003c/sup\u003egenerating neutrophils (\u003cstrong\u003eR2\u003c/strong\u003e). MTX (2.5- 10.0 \u0026micro;M) failed to increase the generation of ROS [frequencies being 1.25(0.74-1.71)%, 1.40(0.58-1.93)%, 1.63(1.16-2.15)% and 1.39(0.95-1.73)% respectively], \u003cstrong\u003eFig. 1A, C\u003c/strong\u003e. However, when oxidative stress was induced by PMA, the frequency of \u003cstrong\u003eR2\u003c/strong\u003e significantly increased to 53.86(51.88-58.22)%, p\u0026lt;0.001, \u003cstrong\u003eFig. 1B,\u0026nbsp;\u003c/strong\u003ewhich following the addition of MTX (2.5-10 \u0026micro;M) increased further to [71.30 (66.36-78.88)%, p\u0026lt;0.01, \u003cstrong\u003eFig. 1B\u003c/strong\u003e \u003cstrong\u003eii, C\u003c/strong\u003e], [83.50(79.09-86.45)%, p\u0026lt;0.001, \u003cstrong\u003eFig. 1B\u003c/strong\u003e \u003cstrong\u003eiii, C\u003c/strong\u003e] and [87.37(84.88-90.75)%, p\u0026lt;0.001, \u003cstrong\u003eFig. 1B iv, C\u003c/strong\u003e] respectively\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn terms of expression or GMFC of CMDCF in neutrophils from healthy controls, the baseline GMFC of 5717(4772-6972) was comparable with neutrophils treated with MTX (2.5, 5 and 10 \u0026micro;M), being 5235(4867-6722), 6599(5192-7062) and 6787(5616-7117)\u0026nbsp;respectively (\u003cstrong\u003eFig. 1D i-iii\u003c/strong\u003e). The addition of PMA enhanced the generation of ROS by 14.06-fold to 58925(53825-62613), p\u0026lt;0.01, which following the addition of MTX (2.5, 5 and 10 \u0026micro;M) increased further to 81871(76289-92063), p\u0026lt;0.01; 101210(97468-107979), p\u0026lt;0.001 and 130221(117020-140035)%, p\u0026lt;0.001 respectively, \u003cstrong\u003eFig. 1D iv\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatus of myeloperoxidase (MPO) in neutrophils\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs oxidative stress is associated with activation of neutrophils, the impact of MTX in terms of MPO was assessed. The baseline frequency of MPO\u003csup\u003e+\u003c/sup\u003e in neutrophils was 5.90(5.13-8.12)%, and remained unchanged with MTX (2.5, 5 and 10 \u0026micro;M), being 12.40(9.27)%, 14.70(11.97-15.24)% and 18.74(16.74-21.51)% respectively \u003cstrong\u003eFig. 2A, C\u003c/strong\u003e. In the presence of PMA, the MPO positivity was significantly enhanced to 33.29(30.27-39.97)%, p\u0026lt;0.001, and with the inclusion of MTX (2.5, 5.0 and 10.0 \u0026micro;M), was further enhanced to 41.50(39.09-46.39)%, p\u0026lt;0.05, 63.74(58.17-66.93)%, p\u0026lt;0.001 and 84.75(77.59-94.39)%, p\u0026lt;0.001 respectively, \u003cstrong\u003eFig. 2B, C\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatus of CD83 and HLA-DR in neutrophils\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOxidative stress in neutrophils is associated with their transdifferentiation into neutrophil-dendritic cell hybrids or N-DCs, features being increased expression of CD83 and HLA-DR [Bagchi et al. 2022]. \u0026nbsp;To assess the impact, if any, of MTX upon transdifferentiation, the frequencies of CD83 and HLA-DR were measured in neutrophils by initially gating them as CD83\u003csup\u003elow\u0026nbsp;\u003c/sup\u003e(\u003cstrong\u003eR3\u003c/strong\u003e) and CD83\u003csup\u003ehigh\u003c/sup\u003e (\u003cstrong\u003eR4\u003c/strong\u003e) populations. The baseline frequency of CD83 positivity was 0.97(0.51-1.44)%; with the addition of MTX (2.5-10 \u0026mu;M), the CD83 positivity remained unchanged at 2.90(2.44-4.15)%, 1.97(0.82-2.75)% and 2.90(2.60-3.45)% respectively, (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e3\u003c/strong\u003e\u003cstrong\u003eA, C)\u003c/strong\u003e. In PMA treated neutrophils, the frequency of CD83 was significantly enhanced to 23.37(20.79-28.47)%, p\u0026lt;0.001, and with co-incubation with increasing doses of MTX (2.5-10 \u0026micro;M) further increased, , the frequencies being 53.24(47.14-61.55)%, p\u0026lt;0.01, 71.90(67.13-78.54)%, p\u0026lt;0.001 and 84.68(82.75-87.69)%, p\u0026lt;0.001 respectively, \u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e3\u003c/strong\u003e\u003cstrong\u003eB, C\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSimilarly, in terms of HLA-DR, neutrophils were gated as HLA-DR\u003csup\u003elow\u0026nbsp;\u003c/sup\u003e(\u003cstrong\u003eR5\u003c/strong\u003e) and HLA-DR\u003csup\u003ehigh\u003c/sup\u003e (\u003cstrong\u003eR6\u003c/strong\u003e) populations. The baseline frequency of HLA-DR\u003csup\u003ehigh\u003c/sup\u003e neutrophils [0.60(0.20-0.95)%], was unchanged by MTX (2.5, 5.0 and 10.0 \u0026micro;M), frequencies being 0.80(0.57-1.15)%, 0.59(0.45-1.07)% and 0.69(0.39-1.07)%, respectively \u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e3\u003c/strong\u003e\u003cstrong\u003eD, F\u003c/strong\u003e. The addition of PMA led to an increased frequency of HLA-DR to 26.10 (21.43-30.17)%, and with addition of MTX (2.5, 5 and 10 \u0026micro;M), progressively increased to 49.87(41.24-53.65)%, p\u0026lt;0.01,62.70(58.50-69.99)% and 70.20(66.42-75.90)%, p\u0026lt;0.001, respectively, \u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e3\u003c/strong\u003e\u003cstrong\u003eE, F\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatus of apoptotic markers in neutrophils\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs oxidative stress is associated with apoptosis, the impact of MTX upon the apoptotic status of isolated neutrophils sourced from healthy controls was measured in terms of the frequency of annexin V\u003csup\u003e+\u003c/sup\u003e along with a pro-apoptotic marker, caspase 3 and an anti-apoptotic marker Bcl-2. The baseline frequency of annexin V in neutrophils was 15.50(12.41-18.63), which was unaffected by MTX (2.5 and 5.0 \u0026micro;M), frequencies being 18.70(16.51-20.04)% and 39.30(21.99-45.99)% respectively (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003cstrong\u003eA, Di)\u003c/strong\u003e. The addition of PMA caused a significant enhancement in the frequency of annexin V to 55.30(49.11-58.92)%, and with MTX (2.5 and 5.0 \u0026micro;M)\u0026nbsp;increased further to 63.90(61.20-68.20)%, p\u0026lt;0.05 and 87.73(84.25-91.54)%, p\u0026lt;0.001, respectively (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003cstrong\u003eA, Di)\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSimilarly, the baseline status of caspase 3 in neutrophils was [(10.60(7.60-13.52)%, \u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003cstrong\u003eBi\u003c/strong\u003e]; MTX (2.5 and 5.0 \u0026micro;M), had no impact, frequencies being 12.23(8.38-13.42)% and 14.20(8.85-18.26)%, respectively (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003cstrong\u003eB iii, Dii)\u003c/strong\u003e. The addition of PMA significantly elevated the frequency of caspase 3 to 28.30(25.87-33.56)%, that increased further with addition of MTX (2.5 and 5.0 \u0026micro;M) to 69.85(59.28-85.53)%, p\u0026lt;0.001 and 85.63(81.32-89.96)%, p\u0026lt;0.001, respectively (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003cstrong\u003eB iv-vi \u0026amp; Dii)\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn terms of Bcl-2, the baseline frequency of Bcl-2\u003csup\u003e+\u003c/sup\u003e neutrophils of 40.70(36.04-44.28)% remained unchanged with the addition of MTX (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003cstrong\u003eC i-iii\u003c/strong\u003e), frequencies being 29.27(26.50-32.45)% and 27.35(23.06-28.76)%\u003cstrong\u003e\u0026nbsp;(Fig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;Diii)\u003c/strong\u003e. Following induction of oxidative stress by PMA, the frequency of Bcl-2 was significantly downregulated to 19.45(17.51-20.77)%, p\u0026lt;0.01, and co-incubation with MTX (2.5 and 5.0 \u0026micro;M) further decreased the Bcl-2 frequency to 15.63(14.04-17.09)%, p\u0026lt;0.05 and 13.30(11.72-14.53)%, respectively (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003cstrong\u003eC iv-vi \u0026amp; Diii)\u003c/strong\u003e.\u0026apos;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatus of glycolytic activity in neutrophils\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGlucose is converted to pyruvate, and then to lactate in the cytoplasm, or to CO\u003csub\u003e2\u003c/sub\u003e and H\u003csub\u003e2\u003c/sub\u003eO in the mitochondria, resulting in a net production of protons; its extrusion into the extracellular medium translates into acidification of the medium, and is measured in terms of the extracellular acidification rate (ECAR), to represent the proportion of glycolysis. To assess specificity, saturating concentration of glucose (10 mM) and 2-DG (50 mM) were used along with oligomycin (10 \u0026micro;M). In terms of non-glycolytic acidification in neutrophils, as compared to baseline, MTX (2.5 \u0026micro;M) had no impact, being 60.25(55.29-69.27) vs. 58.27(57.13-63.29) mPH/min\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003eThe induction of oxidative stress by PMA had no impact, neither did the addition of MTX (\u003cstrong\u003eFig. 5A i, ii)\u003c/strong\u003e; The non-glycolytic acidification in the presence of MTX (2.5 \u0026mu;M) was comparable with baseline being 62.39(59.29-67.61) vs. 61.79(60.13-63.79) mPH/min respectively (\u003cstrong\u003eFig. 5A i, ii)\u003c/strong\u003e. A similar trend was observed with regard to their glycolytic status and glycolytic capacity (\u003cstrong\u003eFig. 5A i, iii, iv, Table 2A\u003c/strong\u003e). This was substantiated by evaluating the status of hexokinase 2 (\u003cem\u003eHK2\u003c/em\u003e) and Lactate dehydrogenase (\u003cem\u003eLDH\u003c/em\u003e); irrespective of the treatment, the glycolytic status remained unaltered (\u003cstrong\u003eFig. 5B i, ii, Table 2C)\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2A: Effect of MTX on status of glycolysis (mPH/min) in neutrophils\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"586\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.0068%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 29.2517%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e*Non-glycolytic acidification\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24.4898%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e*Glycolysis\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 29.2517%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e*Glycolytic capacity\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.0068%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBaseline\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 29.2517%;\"\u003e\n \u003cp\u003e60.25(55.29-69.27)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24.4898%;\"\u003e\n \u003cp\u003e30.37(27.77-33.29)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 29.2517%;\"\u003e\n \u003cp\u003e47.29(40.79-53.27)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.0068%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMTX\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(2.5 mM)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 29.2517%;\"\u003e\n \u003cp\u003e58.27(57.13-63.29)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24.4898%;\"\u003e\n \u003cp\u003e30.73(28.21-37.21)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 29.2517%;\"\u003e\n \u003cp\u003e42.33(37.29-43.27)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.0068%;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePMA (1.0\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 29.2517%;\"\u003e\n \u003cp\u003e62.39(59.29-67.61)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24.4898%;\"\u003e\n \u003cp\u003e50.27(47.29-53.01)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 29.2517%;\"\u003e\n \u003cp\u003e58.29(57.29-60.23)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.0068%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMTX+PMA\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 29.2517%;\"\u003e\n \u003cp\u003e61.79(60.13-63.79)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24.4898%;\"\u003e\n \u003cp\u003e60.31(58.97-65.37)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 29.2517%;\"\u003e\n \u003cp\u003e67.27(63.78-68.31)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eNeutrophils were incubated with MTX (2.5 mM) and PMA (1.0 \u0026micro;g/ml) and the status of glycolysis (mPH/min) measured in neutrophils as described in Materials and methods, and data is stated as *median (IQR).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2B: Effect of MTX on status of oxidative phosphorylation in neutrophils\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"624\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2729%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.5457%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003csup\u003e@\u003c/sup\u003e\u003c/strong\u003e\u003cstrong\u003eBasal Respiration\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 21.6693%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003csup\u003e@\u003c/sup\u003e\u003c/strong\u003e\u003cstrong\u003eATP Production\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.114%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003csup\u003e@\u003c/sup\u003e\u003c/strong\u003e\u003cstrong\u003eSpare Respiratory Capacity\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24.3981%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003csup\u003e@\u003c/sup\u003e\u003c/strong\u003e\u003cstrong\u003eAcute Response\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2729%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBaseline\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.5457%;\"\u003e\n \u003cp\u003e16.39\u003c/p\u003e\n \u003cp\u003e(11.67-21.03)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 21.6693%;\"\u003e\n \u003cp\u003e40.38\u003c/p\u003e\n \u003cp\u003e(36.93-50.61)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.114%;\"\u003e\n \u003cp\u003e25.37\u003c/p\u003e\n \u003cp\u003e(21.73-30.27)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24.3981%;\"\u003e\n \u003cp\u003e8.13\u003c/p\u003e\n \u003cp\u003e(7.05-12.23)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2729%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMTX\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.5457%;\"\u003e\n \u003cp\u003e16.83\u003c/p\u003e\n \u003cp\u003e(15.69-22.04)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 21.6693%;\"\u003e\n \u003cp\u003e45.29\u003c/p\u003e\n \u003cp\u003e(30.37-47.29)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.114%;\"\u003e\n \u003cp\u003e27.79\u003c/p\u003e\n \u003cp\u003e(22.11-34.25)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24.3981%;\"\u003e\n \u003cp\u003e9.07\u003c/p\u003e\n \u003cp\u003e(5.12-12.23)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2729%;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePMA\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.5457%;\"\u003e\n \u003cp\u003e210\u003c/p\u003e\n \u003cp\u003e(192.20-232.30)***\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 21.6693%;\"\u003e\n \u003cp\u003e190.60\u003c/p\u003e\n \u003cp\u003e(179.80-201.70)***\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.114%;\"\u003e\n \u003cp\u003e223.20\u003c/p\u003e\n \u003cp\u003e(210.40-243.1)***\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24.3981%;\"\u003e\n \u003cp\u003e124.9\u003c/p\u003e\n \u003cp\u003e(101.2-135.10)*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2729%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMTX+\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003ePMA\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.5457%;\"\u003e\n \u003cp\u003e301.60\u003c/p\u003e\n \u003cp\u003e(289.30-351.30)***\u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 21.6693%;\"\u003e\n \u003cp\u003e311.01\u003c/p\u003e\n \u003cp\u003e(290.80-320.80)***\u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.114%;\"\u003e\n \u003cp\u003e359.30\u003c/p\u003e\n \u003cp\u003e(310.8-370.80)***\u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24.3981%;\"\u003e\n \u003cp\u003e450.80\u003c/p\u003e\n \u003cp\u003e(430.30-482.90)***\u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eNeutrophils were incubated with MTX (2.5 mM) and PMA (1.0 \u0026micro;g/ml)and the status of oxidative phosphorylation was evaluated in neutrophils as described in Materials and methods; data is stated as \u003cstrong\u003e\u003csup\u003e@\u003c/sup\u003e\u003c/strong\u003emedian (IQR). *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001 as compared to baseline; \u003csup\u003e#\u003c/sup\u003ep\u0026lt;0.01, \u003csup\u003e##\u003c/sup\u003ep\u0026lt;0.001 as compared to PMA.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2C: Effect of MTX in neutrophils on glycolysis and oxidative phosphorylation regulatory genes\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"637\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 11.0063%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e2^\u003csup\u003e-\u0026Delta;\u0026Delta;Ct\u0026nbsp;\u003c/sup\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003csup\u003e@\u003c/sup\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eHK2\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14.4654%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003csup\u003e@\u003c/sup\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eLDH\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.7673%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003csup\u003e@\u003c/sup\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003ePDK1\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.8113%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003csup\u003e@\u003c/sup\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eSDH\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.5975%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003csup\u003e@\u003c/sup\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eATP Synthase\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 11.0063%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBaseline\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003e2.17\u003c/p\u003e\n \u003cp\u003e(1.67-3.40)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14.4654%;\"\u003e\n \u003cp\u003e2.91\u003c/p\u003e\n \u003cp\u003e(1.52-3.05)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.7673%;\"\u003e\n \u003cp\u003e10.61\u003c/p\u003e\n \u003cp\u003e(6.81-11.89)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.8113%;\"\u003e\n \u003cp\u003e5.41\u003c/p\u003e\n \u003cp\u003e(4.04-11.01)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.5975%;\"\u003e\n \u003cp\u003e16.31\u003c/p\u003e\n \u003cp\u003e(11.88-18.29)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 11.0063%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMTX\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003e2.30\u003c/p\u003e\n \u003cp\u003e(1.37-2.78)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14.4654%;\"\u003e\n \u003cp\u003e2.71\u003c/p\u003e\n \u003cp\u003e(1.85-3.50)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.7673%;\"\u003e\n \u003cp\u003e9.52\u003c/p\u003e\n \u003cp\u003e(6.74-11.74)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.8113%;\"\u003e\n \u003cp\u003e11.79\u003c/p\u003e\n \u003cp\u003e(7.25-23.12)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.5975%;\"\u003e\n \u003cp\u003e17.91\u003c/p\u003e\n \u003cp\u003e(15.92-21.35)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 11.0063%;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePMA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003e1.05\u003c/p\u003e\n \u003cp\u003e(0.06-1.10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14.4654%;\"\u003e\n \u003cp\u003e2.34\u003c/p\u003e\n \u003cp\u003e(1.43-3.47)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.7673%;\"\u003e\n \u003cp\u003e2.61\u003c/p\u003e\n \u003cp\u003e(1.76-3.83)\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.8113%;\"\u003e\n \u003cp\u003e101.2\u003c/p\u003e\n \u003cp\u003e(54.35-304.30)\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.5975%;\"\u003e\n \u003cp\u003e66.76\u003c/p\u003e\n \u003cp\u003e(54.74-70.81)\u003csup\u003e** #\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 11.0063%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMTX+\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003ePMA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003e0.10\u003c/p\u003e\n \u003cp\u003e(0.00-0.28)\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14.4654%;\"\u003e\n \u003cp\u003e2.37\u003c/p\u003e\n \u003cp\u003e(1.97-4.15)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.7673%;\"\u003e\n \u003cp\u003e0.97\u003c/p\u003e\n \u003cp\u003e(0.10-1.29)\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.8113%;\"\u003e\n \u003cp\u003e3104\u003c/p\u003e\n \u003cp\u003e(1848-4541)\u003csup\u003e***#\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.5975%;\"\u003e\n \u003cp\u003e249.60\u003c/p\u003e\n \u003cp\u003e(205.7-270)\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eNeutrophils were incubated with MTX (2.5 mM) and PMA (1.0 \u0026micro;g/ml) and the expression of glycolysis and oxidative phosphorylation regulatory genes were measured as described in Materials and methods; data is stated as \u003cstrong\u003e\u003csup\u003e@\u003c/sup\u003e\u003c/strong\u003emedian (IQR);\u0026nbsp;*p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001 as compared to baseline;\u003csup\u003e#\u003c/sup\u003ep\u0026lt;0.01 as compared to PMA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatus of mitochondrial bioenergetics in neutrophils\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMitochondrial respiration or oxidative phosphorylation (OXPHOS) was measured using Seahorse XFp extracellular flux analyzer in terms of OCR, wherein the consumption of oxygen occurs by reduction through transfer of electrons in the electron transport chain (ETC). The quantitative changes in the OCR are triggered by oligomycin (inhibiting oxidative phosphorylation by targeting ATP synthase), FCCP (an uncoupler) along with Rot+AA (blockers of complex I and III respectively). In terms of basal respiration in neutrophils, MTX (2.5 \u0026micro;M) did not have any impact, being 16.39 (11.67-21.03) vs. 16.83(15.69-22.04) pmoles/min at baseline [\u003cstrong\u003eFig. 6A i, iv]\u003c/strong\u003e. However, PMA significantly enhanced the basal respiration to 210(192.20-232.30) pmoles/min, p\u0026lt;0.001, and with addition of MTX, was further increased to 301.60(289.30-351.30) pmoles/min, p\u0026lt;0.01 (\u003cstrong\u003eFig. 6A ii-iv)\u003c/strong\u003e. The scenario was similar with regard to ATP production, spare respiratory capacity and acute response (\u003cstrong\u003eFig. 6A v-vii, Table 2B).\u0026nbsp;\u003c/strong\u003eTo assess the specificity of oxidative stress in terms of their potential to drive towards OXPHOS, impact of a lower dose of PMA (0.5 \u0026micro;g/ml) along with MTX was assessed, which demonstrated a comparable acute response in the presence of MTX \u0026plusmn; PMA (\u003cstrong\u003eFig. 6B, C)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eTo substantiate the altered energy phenotype of neutrophils by PMA and MTX, the status of regulatory enzymes was assessed in terms of their gene expression. The status of \u003cem\u003ePDK1\u003c/em\u003e, succinate dehydrogenase (\u003cem\u003eSDH\u003c/em\u003e) and \u003cem\u003eATP synthase\u0026nbsp;\u003c/em\u003ewas measured as markers of oxidative phosphorylation. MTX alone had no impact whereas PMA significantly induced the expression of \u003cem\u003eSDH\u0026nbsp;\u003c/em\u003eand \u003cem\u003eATP Synthase.\u0026nbsp;\u003c/em\u003e(\u003cstrong\u003eFig. 6D\u003c/strong\u003e)\u003cem\u003e\u0026nbsp;\u003c/em\u003eHowever, when oxidative stress was induced by PMA, the addition of MTX synergistically facilitated further enhancement in the expression of OXPHOS related genes, \u003cem\u003ePDK1\u003c/em\u003e, \u003cem\u003eSDH\u003c/em\u003e and \u003cem\u003eATP synthase\u0026nbsp;\u003c/em\u003e(\u003cstrong\u003eFig. 6D i-iii, Table 2C)\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e \u003c/p\u003e \u003cp\u003eRA is a chronic, systemic, inflammatory autoimmune disorder, resulting in progressive joint damage and deformity. The pathogenesis of RA is intricately regulated by a cascade of immune cells [including neutrophils, T and B lymphocytes, macrophages, dendritic cells (DCs), fibroblast-like synoviocytes (FLS) etc.] along with a wide array of inflammatory mediators, wherein oxidative stress consistently plays a crucial role in the initiation and progression [Bagchi et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, Pradhan et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2019\u003c/span\u003e]. Elevated levels of ROS along with a compromised antioxidant defense system contributed to the perpetuation of inflammatory responses and joint destruction in patients with RA and a collagen induced arthritis (CIA) model of RA [Datta et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; De et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2017\u003c/span\u003e], endorsing that targeted therapies for redox stress and associated cell signaling pathways may have a beneficial impact for treatment of RA.\u003c/p\u003e \u003cp\u003eMTX has the potential to disrupt the redox balance in neutrophils via impacting on their antioxidant defense and ROS scavenging mechanisms [Kaudal et al. 2020]. However, studies regarding the effect of MTX on generation of ROS are contradictory, as depending on the concentration of MTX, duration of exposure, and the inflammatory environment, it can show features of being a pro- or an antioxidant [Phillips et al. 2003]. In cancer cell lines, MTX enhanced the redox imbalance through enhanced release of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e by neutrophils, monocytes, and T lymphocytes, potentially facilitating chemotherapy and causing cytotoxicity [Bedoui et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Phillips et al. 2003; Gressier et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e1994\u003c/span\u003e]. Conversely, in patients with RA, low-dose MTX (10\u0026ndash;15 mg/week) within circulating neutrophils down-regulated the generation of ROS [Kaudal et al. 2020].\u003c/p\u003e \u003cp\u003eHowever, most studies till date have been conducted in peripheral blood, and not in the synovial joints which is the main disease focus [Dogru et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2019\u003c/span\u003e]. Given the predominance of oxidative stress, a pro-inflammatory milieu and an overwhelming presence of neutrophil within the inflamed synovial joint, an \u003cem\u003eex-vivo\u003c/em\u003e approach was employed to assess the potential of MTX in modulating generation of ROS. In neutrophils, MTX failed to impact on the generation of ROS; however, when oxidative stress was induced by PMA, MTX synergistically facilitated additional generation of ROS (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), suggesting that the impact of MTX is dependent upon the presence of a pro-inflammatory, pro-oxidant microenvironment (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Therefore, as SF has a pro-oxidant milieu [Bagchi et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Kundu et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2011\u003c/span\u003e], it can be proposed that MTX in RA patients have the propensity to have a disease sustaining effect.\u003c/p\u003e \u003cp\u003eIn fungal infections, Neutrophil-DC hybrids compared to canonical neutrophils displayed a higher expression of pattern recognition receptors, enhanced phagocytosis, and heightened production of ROS with prominent NETosis, substantiating the intricate association of oxidative stress, phenotypic plasticity and altered functionalities [Fites et al. 2018]. Oxidative stress is intricately associated with the activation of neutrophils, whose key marker of activation is myeloperoxidase (MPO), which is sequestered within azurophilic granules, and plays a pivotal role in the generation of ROS and reactive nitrogen species/RNS [Ndrepepa \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Glennon et al. 2018]. MTX did not alter the status of MPO in neutrophils, but in the presence of PMA, MTX synergistically enhanced MPO secretion (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), suggesting that under oxidative stress, MTX had the potential to trigger an oxidative burst, that could in turn activate the downstream NETosis signaling pathways, an established contributor in the pathogenesis of RA [Sur Chowdhury et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2014\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn patients with RA, neutrophils traditionally viewed as short-lived terminally differentiated cells, can transdifferentiate to neutrophil-dendritic cell hybrids or N-DCs, thereby acquiring the expression of CD83 and MHC class II [Bagchi et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, Iking-Konert et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2001\u003c/span\u003e]. These N-DCs can be activated by T cell-derived cytokines, thus potentially perpetuating local inflammation and tissue damage, and forging a link between innate and adaptive immune responses [Iking-Konert et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2005\u003c/span\u003e]. This priming of neutrophils and their subsequent activation triggers a wide array of phenotypic changes beyond just increased generation of ROS, as for e.g. co-stimulation (CD80, CD86) and enhanced cell adhesion properties (ICAM, VCAM) [Bagchi et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e]. Moreover, transdifferentiated neutrophils demonstrated an enhanced generation of ROS, potentially capable of causing a higher degree of oxidative damage in the inflamed joints [Bagchi et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e]. Although MTX per se did not induce transdifferentiation in neutrophils, creation of an oxidative milieu by addition of PMA led to MTX enhancing the propensity for transdifferentiation, enhanced antigen presentation, thus perpetuating a detrimental cycle, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. This clinical simulation demonstrated that MTX under the influence of the microenvironment has the potential to have a disease promoting role.\u003c/p\u003e \u003cp\u003eNeutrophils, being the first line of defense, play a crucial role in innate immune responses against invading pathogens, and undergo apoptosis, necessary for rapid resolution of inflammation and restoration of tissue homeostasis. [Mccracken and Allen 2014; Giese et al. 2019]. Apoptosis of neutrophils is tightly regulated by a complex network of intracellular signaling pathways involving various pro-apoptotic factors [Mccracken and Allen 2014; Giese et al. 2019, Dejas et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Geering et al. 2011]. In autoimmune disorders like RA, Inflammatory bowel disease (IBD), psoriatic arthritis, neutrophils can become apoptosis-resistant and survive longer within the localized pro-inflammatory microenvironment [Fresneda et al. 2021; Brannigan et al. 2000]. The synovium of RA patients expresses higher levels of the Bcl-2 family's anti-apoptotic proteins, Mcl-1 and Bcl-2, suggesting delayed apoptosis [Carrington et al. 2021; Chen et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e]. In contrast, in systemic lupus, leukocytes demonstrated an accelerated apoptosis and impaired clearance of apoptotic debris, facilitating formation of auto-antigens that can promote disease progression [Munoz et al. 2008]. In patients with psoriasis, MTX increased the generation of ROS, induced oxidative stress, and enhanced apoptosis through caspase-3 activation [Elango et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2014\u003c/span\u003e]. It has been previously demonstrated that MTX did not directly induce apoptosis of neutrophils but rather \u0026rsquo;primed\u0026lsquo; them for enhanced apoptosis via a JNK-dependent mechanism [Spurlock et al. 2011]. In this study, MTX did not impact on the apoptotic status of neutrophils; however, in a pro-oxidant milieu, as induced by PMA, MTX synergistically enhanced the frequency of pro-apoptotic annexin V and caspase 3, along with downregulation of anti-apoptotic Bcl-2, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. Taken together, in a pro-oxidant milieu, MTX demonstrated the potential to enhance cellular apoptosis, which could translate into enhanced release of cellular contents and formation of neo-antigens.\u003c/p\u003e \u003cp\u003eNeutrophils are the most critical immune cell in the initial stages of RA pathogenesis, by virtue of their ability to generate huge amounts of ROS and reactive nitrogen species (RNS), through the activation of NOX2 and iNOS-derived NO respectively, leading to cartilage and bone damage in patients with RA [Mangal et al. 2021]. Additionally, the pro-oxidant milieu could trigger neutrophils to secrete degradative enzymes, pro-inflammatory cytokines and formation of neutrophil extracellular traps or NETs [Mangal et al. 2021, Chen et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2018\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn terms of effector functions i.e. phagocytosis, NETosis etc., neutrophils primarily rely on glycolysis and the pentose phosphate pathway (PPP) as their major sources of energy [Rodriguez et al. 2015, Gaber et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2017\u003c/span\u003e]. In neutrophils, the by-product of PPP is NADPH, a necessary substrate for NADPH oxidase, which facilitates enhanced generation of ROS [Rodriguez et al. 2015, Gaber et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2017\u003c/span\u003e]. However, oxygen consumption rate or OCR (a measure of oxidative phosphorylation) is also linked with the generation of RO, as; in an \u003cem\u003eex-vivo\u003c/em\u003e study, during PMA induced oxidative burst and neutrophil activation, the neutrophils demonstrated an upregulation of oxidative phosphorylation measured in terms of oxygen consumption rate [Grudzinska et al. 2023]. Additionally, during acute inflammation/infections, neutrophils rely on glycolysis and PPP to facilitate the production of the MPO, translating into enhanced antimicrobial functions [Kumar et al. 2019; Hawkins et al. 2021]. However, in chronic inflammation, as in RA, there is a sustained generation of ROS and neutrophils switch to utilizing oxidative phosphorylation (OXPHOS) and PPP for their effector functions [Schuurman et al. 2023; Thind et al. 2024]. This scenario was replicated with the addition of MTX (2.5 \u0026micro;M) as it did not alter the glycolytic phenotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e, but when co-incubated with PMA, MTX synergistically drove neutrophils towards OXPHOS, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e [Chacko et al. 2013; Injarabian et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2019\u003c/span\u003e].\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eMTX in a pro-oxidant environment augmented generation of ROS, enhanced transdifferentiation, promoted apoptosis, and shifted the bioenergetics towards mitochondrial oxidative phosphorylation. Therefore, it may be proposed that anti-oxidants be included into the chemotherapeutic regimen, with a view towards preserving the immunomodulatory properties of MTX but curb its ability to enhance disease progression.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003cstrong\u003e \u003cb\u003eCompeting Interests\u003c/b\u003e:\u003c/strong\u003e \u003cp\u003eNone.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eDesigned research: AB, MC; Conducted research: AB, SSG, MC; Provided essential reagents/materials: MC, AG, PG; Data analysis: AB, SSG; Funding acquisition: MC; Supervision and validation: AG, PG, MC; Manuscript writing \u0026amp; primary responsibility for final content: AB, SSG, MC.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eMC is recipient of a JC Bose grant (ANRF/JBG/2025/000445/HAA), Govt. of India; AB was a recipient of a Senior Research Fellowship from ICMR, Govt. of India. Technical support was provided by Multidisciplinary Research Unit (MRU), Department of Health Research (DHR), Govt. of India (Grant Number: V.25011/611/2016-HR). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eAll data supporting the findings of this study are available within the paper and its Supplementary Information.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAshai S, Harvey NC (2020) Rheumatoid arthritis and bone health. Clin Med (Lond) 20:565\u0026ndash;567. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.7861/clinmed.20.6.rabh\u003c/span\u003e\u003cspan address=\"10.7861/clinmed.20.6.rabh\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBagchi A, Ghosh P, Ghosh A, Chatterjee M (2022) Role of oxidative stress in induction of trans-differentiation of neutrophils in patients with rheumatoid arthritis. Free Radic Res 56:290\u0026ndash;302. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/10715762.2022.2089567\u003c/span\u003e\u003cspan address=\"10.1080/10715762.2022.2089567\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBedoui Y, Guillot X, S\u0026eacute;lambarom J et al (2019) Methotrexate an old drug with new tricks. Int J Mol Sci 20:5023. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms20205023\u003c/span\u003e\u003cspan address=\"10.3390/ijms20205023\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrannigan Ae O, Pr, Hurley H et al (2000) Neutrophil apoptosis is delayed in patients with inflammatory bowel disease. Shock 13:361\u0026ndash;366. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/00024382-200005000-00003\u003c/span\u003e\u003cspan address=\"10.1097/00024382-200005000-00003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarrington Em, Louis C, Kratina T et al (2021) BCL-XL antagonism selectively reduces neutrophil life span within inflamed tissues without causing neutropenia. Blood Adv 5:2550\u0026ndash;2562. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1182/bloodadvances.2020004139\u003c/span\u003e\u003cspan address=\"10.1182/bloodadvances.2020004139\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBk C, Pa K, Ravi S et al (2013) Methods for defining distinct bioenergetic profiles in platelets, lymphocytes, monocytes, and neutrophils, and the oxidative burst from human blood. Lab Invest 93:690\u0026ndash;700. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/labinvest.2013.53\u003c/span\u003e\u003cspan address=\"10.1038/labinvest.2013.53\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen D, Chen C, Xiao X, Huang Z, Huang X, Yao W (2021) TNF-α Induces Neutrophil Apoptosis Delay and Promotes Intestinal Ischemia-Reperfusion-Induced Lung Injury through Activating JNK/foxo3a Pathway. Oxid Med Cell Longev 8302831. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2021/8302831\u003c/span\u003e\u003cspan address=\"10.1155/2021/8302831\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen W, Wang Q, Ke Y, Lin J (2018) Neutrophil function in an inflammatory milieu of rheumatoid arthritis. J Immunol Res 8549329. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2018/8549329\u003c/span\u003e\u003cspan address=\"10.1155/2018/8549329\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eConway R, Carey J (2017) Risk of liver disease in methotrexate treated patients. World J Hepatol 9:1092\u0026ndash;1100. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4254/wjh.v9.i26.1092\u003c/span\u003e\u003cspan address=\"10.4254/wjh.v9.i26.1092\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDatta S, Kundu S, Ghosh P, De S, Ghosh A, Chatterjee M (2014) Correlation of oxidant status with oxidative tissue damage in patients with rheumatoid arthritis. Clin Rheumatol 33:1557\u0026ndash;1564. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10067-014-2597-z\u003c/span\u003e\u003cspan address=\"10.1007/s10067-014-2597-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe S, Manna A, Kundu S et al (2017) Allylpyrocatechol attenuates collagen-induced arthritis via attenuation of oxidative stress secondary to modulation of the MAPK, JAK/STAT, and Nrf2/HO-1 pathways. J Pharmacol Exp Ther 360:249\u0026ndash;259. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1124/jpet.116.238444\u003c/span\u003e\u003cspan address=\"10.1124/jpet.116.238444\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDejas L, Santoni K, Meunier E, Lamkanfi M (2023) Regulated cell death in neutrophils: From apoptosis to netosis and pyroptosis. Semin Immunol 70:101849. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.smim.2023.101849\u003c/span\u003e\u003cspan address=\"10.1016/j.smim.2023.101849\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDogru A, Naziroglu M, Cig B (2019) Modulator role of infliximab and methotrexate through the transient receptor potential melastatin 2 (TRPM2) channel in neutrophils of patients with rheumatoid arthritis: a pilot study. Arch Med Sci 15:1415\u0026ndash;1424. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5114/aoms.2018.79485\u003c/span\u003e\u003cspan address=\"10.5114/aoms.2018.79485\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElango T, Dayalan H, Gnanaraj P, Malligarjunan H, Subramanian S (2014) Impact of methotrexate on oxidative stress and apoptosis markers in psoriatic patients. Clin Exp Med 14:431\u0026ndash;437. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10238-013-0252-7\u003c/span\u003e\u003cspan address=\"10.1007/s10238-013-0252-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFites Js, Gui M, Kernien, Jf et al (2018) An unappreciated role for neutrophil-DC hybrids in immunity to invasive fungal infections. Plos Pathog 14:e1007073. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.ppat.1007073\u003c/span\u003e\u003cspan address=\"10.1371/journal.ppat.1007073\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFresneda Alarcon M, Mclaren Z, Wright H (2021) Neutrophils in the Pathogenesis of Rheumatoid Arthritis and Systemic Lupus Erythematosus: Same Foe Different M.O. Front Immunol 12:649693. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2021.649693\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2021.649693\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGaber T, Strehl C, Buttgereit F (2017) Metabolic regulation of inflammation. Nat Rev Rheumatol 13:267\u0026ndash;279. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrrheum.2017.37\u003c/span\u003e\u003cspan address=\"10.1038/nrrheum.2017.37\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeering B, Simon H (2011) Peculiarities of cell death mechanisms in neutrophils. Cell Death Differ 18:1457\u0026ndash;1469. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/cdd.2011.75\u003c/span\u003e\u003cspan address=\"10.1038/cdd.2011.75\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa G, Le H, Huttenlocher A (2019) Neutrophil plasticity in the tumor microenvironment. Blood 133:2159\u0026ndash;2167. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1182/blood-2018-11-844548\u003c/span\u003e\u003cspan address=\"10.1182/blood-2018-11-844548\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGlennon-Alty L, Hackett Ap C, Ea W Hl (2018) Neutrophils and redox stress in the pathogenesis of autoimmune disease. Free Radic Biol Med 125:25\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.freeradbiomed.2018.03.049\u003c/span\u003e\u003cspan address=\"10.1016/j.freeradbiomed.2018.03.049\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGressier B, Lebegue S, Brunet C et al (1994) Pro-oxidant properties of methotrexate: evaluation and prevention by an anti-oxidant drug. Pharmazie 49:679\u0026ndash;681\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrudzinska Fs, Jasper A, Sapey E et al (2023) Real-time assessment of neutrophil metabolism and oxidative burst using extracellular flux analysis. Front Immunol 14:1083072. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2023.1083072\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2023.1083072\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHawkins Cl D Mj (2021) Role of myeloperoxidase and oxidant formation in the extracellular environment in inflammation-induced tissue damage. Free Radic Biol Med 172:633\u0026ndash;651. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.freeradbiomed.2021.07.007\u003c/span\u003e\u003cspan address=\"10.1016/j.freeradbiomed.2021.07.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHerman S, Zurgil N, Deutsch M (2005) Low dose methotrexate induces apoptosis with reactive oxygen species involvement in T lymphocytic cell lines to a greater extent than in monocytic lines. Inflamm Res 54:273\u0026ndash;280. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00011-005-1355-8\u003c/span\u003e\u003cspan address=\"10.1007/s00011-005-1355-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIking-Konert C, Csek\u0026ouml; C, Wagner C, Stegmaier S, Andrassy K, H\u0026auml;nsch G (2001) Transdifferentiation of polymorphonuclear neutrophils: acquisition of CD83 and other functional characteristics of dendritic cells. J Mol Med (Berl) 79:464\u0026ndash;474. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s001090100237\u003c/span\u003e\u003cspan address=\"10.1007/s001090100237\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIking-Konert C, Ostendorf B, Sander O et al (2005) Transdifferentiation of polymorphonuclear neutrophils to dendritic-like cells at the site of inflammation in rheumatoid arthritis: evidence for activation by T cells. Ann Rheum Dis 64:1436\u0026ndash;1442. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1136/ard.2004.034132\u003c/span\u003e\u003cspan address=\"10.1136/ard.2004.034132\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eInjarabian L, Devin A, Ransac S, Marteyn B (2019) Neutrophil Metabolic Shift during their Lifecycle: Impact on their Survival and Activation. Int J Mol Sci 21:287. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms21010287\u003c/span\u003e\u003cspan address=\"10.3390/ijms21010287\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJing W, Liu C, Su C et al (2023) Role of reactive oxygen species and mitochondrial damage in rheumatoid arthritis and targeted drugs. Front Immunol 14:1107670. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2023.1107670\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2023.1107670\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaundal U, Khullar A, Leishangthem B et al (2020) The effect of methotrexate on neutrophil reactive oxygen species and CD177 expression in rheumatoid arthritis. Clin Exp Rheumatol 39:479\u0026ndash;486. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.55563/clinexprheumatol/4h5onh\u003c/span\u003e\u003cspan address=\"10.55563/clinexprheumatol/4h5onh\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKruger P, Saffarzadeh M, Weber An et al (2015) Neutrophils: Between host defence, immune modulation, and tissue injury. Plos Pathog 11:e1004651. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.ppat.1004651\u003c/span\u003e\u003cspan address=\"10.1371/journal.ppat.1004651\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar S, Dikshit M (2019) Metabolic Insight of Neutrophils in Health and Disease. Front Immunol 10:2099. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2019.02099\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2019.02099\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKundu S, Bala A, Ghosh P et al (2011) Attenuation of oxidative stress by allylpyrocatechol in synovial cellular infiltrate of patients with Rheumatoid Arthritis. Free Radic Res 45:518\u0026ndash;526. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3109/10715762.2011.555480\u003c/span\u003e\u003cspan address=\"10.3109/10715762.2011.555480\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKundu S, Ghosh P, Datta S, Ghosh A, Chattopadhyay S, Chatterjee M (2012) Oxidative stress as a potential biomarker for determining disease activity in patients with rheumatoid arthritis. Free Radic Res 46:1482\u0026ndash;1489. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3109/10715762.2012.727991\u003c/span\u003e\u003cspan address=\"10.3109/10715762.2012.727991\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMangal Jl, Basu N, Wu Hj A Ap (2021) Immunometabolism: an emerging target for immunotherapies to treat rheumatoid arthritis. Immunometabolism 3:e210032. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.20900/immunometab20210032\u003c/span\u003e\u003cspan address=\"10.20900/immunometab20210032\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMccracken, Jm, Allen La (2014) Regulation of human neutrophil apoptosis and lifespan in health and disease. J Cell Death 7:15\u0026ndash;23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4137/JCD.S11038\u003c/span\u003e\u003cspan address=\"10.4137/JCD.S11038\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM\u0026oacute;csai A (2013) Diverse novel functions of neutrophils in immunity, inflammation, and beyond. J Exp Med 210:1283\u0026ndash;1299. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1084/jem.20122220\u003c/span\u003e\u003cspan address=\"10.1084/jem.20122220\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Munoz Le C, Franz S, Berden J, Herrmann M, Van Der Vlag J (2008) Apoptosis in the pathogenesis of systemic lupus erythematosus. Lupus 17:371\u0026ndash;375. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1177/0961203308089990\u003c/span\u003e\u003cspan address=\"10.1177/0961203308089990\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNdrepepa G (2019) Myeloperoxidase - A bridge linking inflammation and oxidative stress with cardiovascular disease. Clin Chim Acta 493:36\u0026ndash;51. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cca.2019.02.022\u003c/span\u003e\u003cspan address=\"10.1016/j.cca.2019.02.022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDc P, Kj W, Hr G (2003) The anti-inflammatory actions of methotrexate are critically dependent upon the production of reactive oxygen species. Br J Pharmacol 138:501\u0026ndash;511. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/sj.bjp.0705054\u003c/span\u003e\u003cspan address=\"10.1038/sj.bjp.0705054\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePradhan A, Bagchi A, De S et al (2019) Role of redox imbalance and cytokines in mediating oxidative damage and disease progression of patients with rheumatoid arthritis. Free Radic Res 53:768\u0026ndash;779. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/10715762.2019.1629586\u003c/span\u003e\u003cspan address=\"10.1080/10715762.2019.1629586\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePradhan A, Sengupta S, Sengupta R, Chatterjee M (2023) Attenuation of methotrexate induced hepatotoxicity by epigallocatechin 3-gallate. Drug Chem Toxicol 46:717\u0026ndash;725. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/01480545.2022.2085738\u003c/span\u003e\u003cspan address=\"10.1080/01480545.2022.2085738\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRadu AF, Bungau SG (2021) Management of Rheumatoid Arthritis: An Overview. Cells 10:2857. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/cells10112857\u003c/span\u003e\u003cspan address=\"10.3390/cells10112857\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReczek Cr C, Ns (2015) ROS-dependent signal transduction. Curr Opin Cell Biol 33:8\u0026ndash;13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ceb.2014.09.010\u003c/span\u003e\u003cspan address=\"10.1016/j.ceb.2014.09.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodr\u0026iacute;guez-Espinosa O, Rojas-Espinosa O, Moreno-Altamirano, Mm L\u0026oacute;pez Villegas Eo, S\u0026aacute;nchez-Garc\u0026iacute;a Fj (2015) Metabolic requirements for neutrophil extracellular traps formation. Immunology 145:213\u0026ndash;224. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/imm.12437\u003c/span\u003e\u003cspan address=\"10.1111/imm.12437\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSarkar D, De Sarkar S, Gille L, Chatterjee M (2022) Ascaridole exerts the leishmanicidal activity by inhibiting parasite glycolysis. Phytomedicine 103:154221. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.phymed.2022.154221\u003c/span\u003e\u003cspan address=\"10.1016/j.phymed.2022.154221\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchuurman Ar B, Jm M, Eha et al (2023) Inflammatory and glycolytic programs underpin a primed blood neutrophil state in patients with pneumonia. Iscience 26:107181. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.isci.2023.107181\u003c/span\u003e\u003cspan address=\"10.1016/j.isci.2023.107181\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpurlock Cf, Zt A, Jt T et al (2011) Increased sensitivity to apoptosis induced by methotrexate is mediated by JNK. Arthritis Rheum 63:2606\u0026ndash;2616. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/art.30457\u003c/span\u003e\u003cspan address=\"10.1002/art.30457\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. 3\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSur Chowdhury C, Giaglis S, Walker Ua, Buser A, Hahn S, Hasler P (2014) Enhanced neutrophil extracellular trap generation in rheumatoid arthritis: analysis of underlying signal transduction pathways and potential diagnostic utility. Arthritis Res Ther 16:R122. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/ar4579\u003c/span\u003e\u003cspan address=\"10.1186/ar4579\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThind Mk U, Hh, Glogauer M et al (2024) A metabolic perspective of the neutrophil life cycle: new avenues in immunometabolism. Front Immunol 14:1334205. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2023.1334205\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2023.1334205\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-bioenergetics-and-biomembranes","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jobb","sideBox":"Learn more about [Journal of Bioenergetics and Biomembranes](http://link.springer.com/journal/10863)","snPcode":"10863","submissionUrl":"https://submission.nature.com/new-submission/10863/3","title":"Journal of Bioenergetics and Biomembranes","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Metabolic bioenergetics, Methotrexate, Neutrophils, Oxidative stress, Rheumatoid Arthritis","lastPublishedDoi":"10.21203/rs.3.rs-9362152/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9362152/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eRheumatoid arthritis (RA) is associated with inflammation, oxidative stress along with infiltration of immune cells (~\u0026thinsp;90% neutrophils) into inflamed joints. Neutrophils have demonstrated the ability to transdifferentiate into \u0026lsquo;neutrophil-dendritic cell hybrids\u0026rsquo; or N-DCs, acquire antigen presenting properties (HLA-DR/CD80/CD86) and demonstrated oxidative stress. Classical neutrophils rely mainly on glycolysis, but the metabolic bioenergetics of N-DCs remains poorly defined. Accordingly, this study aimed to assess the impact of methotrexate (MTX), upon transdifferentiation and the metabolic bioenergetics of neutrophils.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003eex-vivo\u003c/em\u003e effect of MTX on neutrophils sourced from healthy controls was studied (+/- PMA) in terms of CD83\u003csup\u003e+\u003c/sup\u003e, HLA-DR\u003csup\u003e+\u003c/sup\u003e, generation of ROS, activation (myeloperoxidase) and status of apoptosis (Annexin V, Caspase 3 and Bcl-2) by flow cytometry, while the bioenergetics was assessed using Agilent XFp analyser and expression of key metabolic regulatory enzymes by real time PCR.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eIn neutrophils, MTX failed to impact on generation of ROS; however, following induction of a pro-oxidant milieu by PMA, MTX demonstrated a synergistic enhancement in the generation of ROS, increased %CD83\u003csup\u003ehigh\u003c/sup\u003e/HLA-DR\u003csup\u003ehigh\u003c/sup\u003e and myeloperoxidase, elevated apoptosis (Annexin V, Caspase 3) along with downregulation of Bcl-2. MTX \u003cem\u003eper se\u003c/em\u003e did not alter the oxygen consumption rate (OCR), whereas following PMA-induced oxidative stress, MTX enhanced OCR, glycolytic mechanisms remaining unaltered.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eMTX, the gold standard for treatment of RA did not alter the redox status of neutrophils, but in a pro-oxidant milieu, MTX facilitated transdifferentiation and activation of neutrophils, altered their apoptotic and metabolic bioenergetics status, indicative of an adverse bystander effect.\u003c/p\u003e","manuscriptTitle":"Impact of Methotrexate upon transdifferentiation and metabolic bioenergetics of neutrophils","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-22 18:46:51","doi":"10.21203/rs.3.rs-9362152/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-04-29T11:42:59+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-29T07:51:15+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"281603341460524878698445164276818892000","date":"2026-04-20T06:41:32+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"197197843141930816111958976375214274643","date":"2026-04-15T06:19:03+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-04-15T01:59:30+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-04-12T22:59:38+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-04-12T22:59:27+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Bioenergetics and Biomembranes","date":"2026-04-09T02:12:45+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-bioenergetics-and-biomembranes","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jobb","sideBox":"Learn more about [Journal of Bioenergetics and Biomembranes](http://link.springer.com/journal/10863)","snPcode":"10863","submissionUrl":"https://submission.nature.com/new-submission/10863/3","title":"Journal of Bioenergetics and Biomembranes","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"57b85771-2aaf-4b28-8212-9bd36d544b65","owner":[],"postedDate":"April 22nd, 2026","published":true,"recentEditorialEvents":[{"type":"decision","content":"Revision requested","date":"2026-04-29T11:42:59+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-29T07:51:15+00:00","index":15,"fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-13T12:11:44+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-22 18:46:51","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9362152","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9362152","identity":"rs-9362152","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00