Fire-footed rope squirrels (Funisciurus pyrropus) are a reservoir host of monkeypox virus (Orthopoxvirus monkeypox) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Biological Sciences - Article Fire-footed rope squirrels ( Funisciurus pyrropus ) are a reservoir host of monkeypox virus ( Orthopoxvirus monkeypox ) Fabian Leendertz, Carme Riutord-Fe, Jasmin Schlotterbeck, Lorenzo Lagostina, and 17 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6322223/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 11 Feb, 2026 Read the published version in Nature → Version 1 posted You are reading this latest preprint version Abstract Mpox, caused by the monkeypox virus (MPXV; Orthopoxvirus monkeypox ), is on the rise in West and Central Africa. Most outbreaks are short-lived, but MPXV has recently caused larger epidemics driven by sustained human-to-human transmission. It is widely accepted that mpox outbreaks originate in zoonotic events. African rodents, especially squirrels, are suspected to be involved in MPXV emergence, but no formal link to human or nonhuman primate outbreaks has been established. Here, we describe an outbreak of MPXV in a group of wild sooty mangabeys ( Cercocebus atys ) in Taï National Park (Côte d’Ivoire). The outbreak affected one third of the group between January and April 2023, killing four infants. To track its origin, we analysed rodents and wildlife carcasses from the region. We identified a MPXV-infected fire-footed rope squirrel ( Funisciurus pyrropus ), found dead 3 km from the mangabey territory 12 weeks before the outbreak. MPXV genomes from the squirrel and the mangabey were identical. To establish a potential link between these species, we investigated the diet of these mangabeys. We found one video record of consumption of the same squirrel species in 2014. In addition, we performed metabarcoding analyses of faecal samples collected from mangabeys in the four months prior to the outbreak, which identified two faecal samples containing the DNA of the fire-footed rope squirrel. One of these samples was also the first positive for MPXV in the mangabey group. This represents an exceptionally rare case of direct detection of an interspecies transmission event, made possible only by long-term health monitoring. Our findings strongly suggest rope squirrels were the source of the MPXV outbreak in mangabeys. Since squirrels and nonhuman primates are hunted, traded, and consumed by humans in West and Central Africa, exposure to these animals is likely responsible for at least a fraction of human mpox outbreaks. Biological sciences/Microbiology/Virology/Viral transmission Health sciences/Diseases/Infectious diseases/Viral infection Biological sciences/Ecology/Ecological epidemiology Biological sciences/Microbiology/Infectious-disease diagnostics Biological sciences/Microbiology/Pathogens Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Main The recent emergence of MPXV lineages characterized by human-to-human transmission through sexual networks has led the WHO to declare public health emergencies of international concern in 2022 1 and 2024 2 . Efforts were immediately scaled up in endemic African countries to reinforce mpox surveillance systems. Concurrently, sustained human-to-human transmission was shown to leave a distinct signature in MPXV genomes under the form of APOBEC3-induced mutations, providing a potent tool to determine how much of MPXV evolution happened in humans 3 . Building on these two pillars, recent genomic surveillance data from the Democratic Republic of Congo (DRC) and the Republic of Congo clearly showed that MPXV diversity mostly reflects numerous, independent zoonotic spillovers 4,5 . Importantly, epidemiological data from the DRC suggest that these spillovers have increased in frequency from 2010 to 2024, a period during which the national surveillance system has been relatively stable 6 . Although African rodents have long been considered a possible reservoir for MPXV 7,8 , formal proof to support this assumption is lacking. Ascertaining the animal sources of zoonotic agents is indeed a notoriously difficult task 9 . In the case of MPXV, achieving this task is critical, since it would lead to better management of the risk of spillover to humans, and thereby provide a lever to prevent subsequent outbreaks fueled by human-to-human transmission. Captive nonhuman primates (NHP) are famously associated with the discovery of MPXV 10 , which resulted in the misleading naming of the virus. More recently, long-term health monitoring at the Taï Chimpanzee Project 11 (TCP) in Taï National Park (TNP), Côte d’Ivoire, revealed that MPXV also affects wild NHP, opening a window into the ecology of this virus. We detected MPXV in a dead sooty mangabey (hereafter mangabey; Cercocebus atys ) in 2012 12 , and later identified three independent MPXV outbreaks in 2017 and 2018 that hit distinct groups of western chimpanzees ( Pan troglodytes verus ) living in the same forest 13 . While these investigations provided insights into different clinical presentations and described viral genomic diversity in this area, the source of these outbreaks remains unknown. In late January 2023, we started observing clinical signs compatible with MPXV infection in several infants from the habituated mangabey group of TCP, which consisted of 80 individuals at that time (Fig. 1). Nearly 30% of the group developed skin lesions over the following 12 weeks. Making use of TCP’s longitudinal non-invasive sample collection started in the early 2010s 14 , along with the systematic carcass monitoring 15,16 , and rodent sampling efforts in and around TNP, we conducted an outbreak investigation that included an extensive search for a potential source of infection. On January 27 th 2023, an infant mangabey developed red macular lesions on the forehead, back of the head, chest and legs (Fig. 2A), accompanied by the onset of lethargy and anorexia. Lesions quickly spread to the entire body and the individual died within 48 hours, on January 29 th . By early March, five other infants developed similar lesions alongside lethargy, anorexia, and lymphadenopathy. Macular skin lesions progressed to papulo-pustular stages, and three of these infants died. A milder form of the disease, consisting of either a diffuse rash with only ~5-20 skin lesions (Fig. 2B), or fewer isolated lesions appearing in a single part of the body (e.g. face, limbs or tail, Fig. 2C), affected 20 other mangabeys of all age groups (Extended Data Fig. 1). In all affected animals, papulo-pustular lesions evolved to crusts and ultimately scabs (Extended Data Fig. 2). Overall, the disease swept through the group until the end of April 2023, resulting in 26 out of 80 (32.5%) mangabeys developing at least one visible skin lesion, and four deaths. Trained veterinarians wearing a complete set of personal protective equipment and following strict biosafety protocols performed on-site necropsies on three out of the four infants. The body of the fourth infant was never found. To confirm infection with MPXV, we first tested necropsy samples from the three infants and identified viral DNA in all major organs (Supplementary Table 1). We then performed a group-wide outbreak investigation by analyzing 170 faecal samples collected from the mangabeys during the outbreak window, defined as the period in which clinical signs were visible in the group (Extended Data Fig. 3 and Supplementary Table 2). We detected MPXV DNA in 36 faecal samples collected from 19 individuals (7 symptomatic and 12 asymptomatic, Fig. 3). Of these 19, 14 were mothers of symptomatic babies, and only six of them developed lesions (Supplementary Table 3). We did not detect MPXV in 89 faecal samples collected after clinical signs resolved. These findings show that MPXV caused disease in a large proportion of this group and may have infected an even larger pool of individuals subclinically, consistent with earlier observations in chimpanzees from TNP 13 . To reconstruct viral genomes and determine their relationships with MPXVs that previously emerged in this area, we applied hybridization capture coupled to high-throughput sequencing to both necropsy and faecal samples. This allowed us to assemble two complete genomes, from a necropsy sample collected on January 31 st 2023 (371x average depth of coverage) and a fecal sample collected on February 12 th 2023 (22x). The two genomes were identical, and maximum-likelihood phylogenetic analyses placed them within the genetic diversity of clade IIa viruses, as close relatives to the other MPXVs from TNP (Fig. 4). This suggests that this outbreak was the result of a transmission event involving the same local reservoir(s). Multiple species of squirrels ( Funisciurus sp., Heliosciurus sp.) and other rodents, such as Gambian pouched rats ( Cricetomys gambianus ) and African dormice ( Graphiurus sp.) are suspected to be involved in the sylvatic maintenance of MPXV (reviewed in ref 8 ). To investigate whether squirrels or other small terrestrial mammals could be a source of MPXV infection for the TNP non-human primates, we tested rodents and shrews trapped (n=694) or found dead (n=10) inside and around TNP between 2019 and 2024 (Supplementary Tables 4 and 5). We identified one MPXV-positive fire-footed rope squirrel found dead on November 3 rd 2022 – 12 weeks before the onset of the outbreak in the mangabeys, and approximately 3 km south of their territory (Extended Data Fig. 4). Due to the opportunistic nature of our sampling, we could not determine whether the squirrel died of MPXV infection or due to other causes (e.g. predation; necropsy report available in the Supplementary Information). All organs from the squirrel (n=15), as well as oral and nasal swabs, contained high viral loads, and we were able to isolate viable MPXV from the skin, lung, spleen and liver of the animal (Supplementary Table 5). We also sequenced the complete genome of this virus (114x from samples, 20x from the lung isolate) and found it to be identical to the MPXV genomes derived from the mangabey samples. Since the isolation of MPXV from a Thomas’s rope squirrel ( Funisciurus anerythrus ) in 1978 17 , only relatively weak evidence has accumulated supporting African squirrels as natural hosts of MPXV 7,18,19 . Our findings considerably reinforce the hypothesis that fire-footed rope squirrels are natural hosts of MPXV. The exact same genomic MPXV variant was circulating in the local squirrel population in the weeks preceding the outbreak in the mangabeys, a first hint that squirrels may have served as the reservoir host. We then aimed at refining a plausible scenario of MPXV emergence. For this, we first tested 114 faecal samples collected from the mangabey group in the 16 weeks before the outbreak. We identified 10/114 MPXV positive faecal samples (detection rate 8.8%; 95% CI 4.8-15.9). MPXV DNA was present in faecal samples of seven mangabeys that were asymptomatic at the time of detection, including the mother of the first infant to show clinical signs (Fig. 3). Importantly, the three earliest positive samples were consecutively obtained from the same individual, on December 6 th , 9 th and 18 th , 2022. Collectively, these results suggest that MPXV entered the group via this plausible index case and then circulated undetected in the group for nearly two months. Mangabeys are known to hunt small mammals, including in TNP. Reviewing available long-term behavioural data, we found a video recording from 2025 showing a mangabey catching a squirrel (Supplementary Video 1), and an older video from 2014 showing a mangabey feeding on a clearly identifiable fire-footed rope squirrel (Fig. 5 and Supplementary Video 2). To explore whether a fire-footed rope squirrel hunt may have been the source of this outbreak, we analyzed the mangabey diet before the outbreak by searching for prey DNA in the 78 earliest faecal samples of our collection (Supplementary Table 2). Using mammal-generic metabarcoding, we identified DNA sequences perfectly matching the mitogenome of the TNP fire-footed rope squirrel in two faecal samples (Supplementary Information). This demonstrates that these squirrels are not only part of the mangabey diet, but that group members fed on this species on at least two distinct occasions in the weeks before the outbreak. Even more strikingly, we found that one of the two samples containing squirrel DNA was also the first MPXV-positive faecal sample of the suspected index case (Fig. 3). The co-detection of squirrel and MPXV DNA in this faecal sample strongly hints at an exceptional case of real-time detection of a cross-species transmission event, which subsequently led to the group-wide MPXV outbreak. Based on all the accumulated evidence, we conclude that fire-footed rope squirrels serve as a reservoir of MPXV for wild nonhuman primates in TNP. Bushmeat remains an important source of protein in sub-Saharan Africa, including Côte d’Ivoire. In many regions, the recent decline of large-bodied mammals due to habitat destruction and hunting has induced a shift in consumption towards smaller animals, especially rodents 20, 21-23 . A study conducted in the villages bordering TNP has shown that while primates remain the most hunted taxa, rodents are also commonly traded and consumed 24 . Although larger rodents such as the giant pouched rat ( Cricetomys sp.) and the marsh cane rat ( Thryonomys swinderianus ) are more frequently seen on markets, multiple species of squirrels are also sold and consumed, in both rural and urban areas 25 (unpublished data from N.Y.N., H.K. and S.G.-B.). It is also worth noting that, contrary to nonhuman primates who mainly rely on intact forest ecosystems, squirrels can thrive in fragmented habitats and plantations close to villages 26 . Upon re-analyzing a mammal-generic metabarcoding dataset derived from carrion flies collected along a gradient from pristine forest to the surrounding villages at the same site 27 , we only detected fire-footed rope squirrels in secondary forests and plantations, suggesting a higher presence of this species in these habitats (Supplementary Table 6). In such areas squirrels are commonly trapped by the local population, including children, and directly consumed (personal communication, N.Y.N. and S.G.-B.). Both subsistence hunting and bushmeat hunting, trade and consumption may result in MPXV transmission to humans. Research on the ecology, habitat use and population dynamics of fire-footed rope squirrels, as well as the dynamics of MPXV infections in these populations and their interactions with humans, will be key to assessing spillover risks from this species. Efforts aimed at identifying other small mammal species that may serve as natural hosts and reservoirs should also be continued, since the involvement of several host species is possible 28 . At the same time, MPXV genomic surveillance in humans in endemic areas remains the most abundant source of information on this virus’ diversity in its reservoir(s). For example, we observed that genomes published from human mpox cases caused by clade IIa MPXVs in Côte d’Ivoire in 2024, including two from a town ~80 km north of our study site, were not closely related to the ones circulating in TNP wildlife (Fig. 4). This confirms a large strain diversity, even at small spatial scales, and perhaps suggests geographic structure and evolution in distinct hosts, though further studies are needed to test this hypothesis conclusively. Importantly, a better understanding of MPXV ecology will inform local authorities in charge of public health, animal health, as well as protected areas and natural resources, and help them develop programs to assess and mitigate spillover risk. This might include campaigns to raise awareness about the general risks linked to bushmeat and initiatives to co-design measures specifically aimed at reducing contact with squirrels through subsistence hunting. The example of TNP shows (1) the direct link between a rodent reservoir and a spillover host and (2) that both may be sources of human infections, suggesting a focus on squirrel consumption alone would be misguided. This study underscores the high value of long-term wildlife health monitoring 29,30 . While challenging to fund and implement, such projects have a unique ability to unveil interspecies transmission and zoonotic emergence in complex environments, and ultimately offer crucial insights for global public health. Declarations Research was conducted under research permit numbers: 006/MESRS/DGRI (TCP 2022-2025), 461/MINEDD/OIPR/DT, 020/MESRS/DGRI and 007/ MESRS/DGRI (small terrestrial mammal trapping Acknowledgements We thank the Ministère de l’Enseignement Supérieur et de la Recherche Scientifique, the Ministère de Eaux et Fôrets in Ivory Coast and the Office Ivoirien des Parcs et Réserves for permitting the study. We are grateful to the Centre Suisse de Recherches Scientifiques en Côte d’Ivoire and the staff members of the Taï Chimpanzee Project for their support. We thank all primatologists, research assistants, field assistants, and veterinarians who collected samples for the Taï Chimpanzee project over the years. We acknowledge the contribution of Arsène Mossoun, Valere Kouakou Kouamé, Emmanuel Kemin Diané, Privat Gnabro Hugues, Assemian Krou Hermann, Koukou Youl Sie, Mathurin Yao Koffi, Michèle Djê bi Tah, Fabrice Fernand Logoué, Kamilla Anna Pléh, Jonas Steiner, and Olivia Dimov to the small mammal trapping in TNP. We are grateful to Manon Digoin Danzin for providing the video of the managbey catching a squirrel in TNP. This work was supported by the German Research Council Project LE1813/11-1 and LE1813/14-1 (Great Ape Health in Tropical Africa), the ARCUS Foundation grant G-PGM-2107-3516, the BIODIV-AFREID Project LE1813/17-1, the Heinrich Böll Stiftung PhD stipend to J.S., the Evolution of Brain Connectivity Project of the Max Planck Society (M.IF.EVAN8103). Research was conducted under research permit numbers: 006/MESRS/DGRI (TCP 2022-2025), 461/MINEDD/OIPR/DT, 020/MESRS/DGRI and 007/ MESRS/DGRI (small terrestrial mammal trapping). Contributions Data and samples from the outbreak were collected by C.R.-F., A.L.-M and the TCP field assistants and research assistants. Data and samples from the rodents in TNP were collected by L.L., L.K., J.S., M.J.S.J. and H.R.H. The field investigations as well as diagnostic and research activities were coordinated by S.C.-S., A.D., L.V.P. and F.H.L. Molecular laboratory analyses were performed by C.R.-F, J.S., H.R.H., L.L., A.D. and L.V.P. Diet analyses were performed by C.R.-F and J.F.G. Virus isolation experiments and sequencing of the isolates were conducted by J.S., D.H., S.C., and coordinated by M.B. N.Y.N., H.K. and S.G.B. provided information on bushmeat consumption in Côte d’Ivoire. R.M.W., C.C., A.D. and F.H.L coordinated the mangabey field work and provided the behavioural data. J.F.G., A.M. and R.M.W provided the video. The data were analysed by C.R.-F., J.S., L.V.P. and S.C.-S. and the manuscript was drafted by C.R.-F., J.S., S.C.-S., L.V.P and F.H.L. The manuscript was revised and approved by all authors. Competing interests The authors declare no competing interests. Additional information Supplementary Information is available for this paper. Corresponding author Correspondence and requests for materials should be addressed to Livia V. Patrono and Fabian H. Leendertz. Data availablity All sequences generated in this study are currently being submitted to the European Nucleotide Archive. Accession numbers will be provided before publication. In the meantime, we provide provisional access to all materials on Zenodo (https://zenodo.org/records/15111982). References WHO. (https://www.who.int/europe/news/item/23-07-2022-who-director-general-declares-the-ongoing-monkeypox-outbreak-a-public-health-event-of-international-concern, 2022). WHO. (https://www.who.int/news/item/14-08-2024-who-director-general-declares-mpox-outbreak-a-public-health-emergency-of-international-concern, 2024). O'Toole, Á. et al. APOBEC3 deaminase editing in mpox virus as evidence for sustained human transmission since at least 2016. Science 382 , 595-600 (2023). https://doi.org:10.1126/science.adg8116 Kinganda-Lusamaki, E. et al. Clade I mpox virus genomic diversity in the Democratic Republic of the Congo, 2018-2024: Predominance of zoonotic transmission. Cell 188 , 4-14 (2024). https://doi.org:10.1016/j.cell.2024.10.017 Yinda, C. K. et al. Genetic sequencing analysis of monkeypox virus clade I in Republic of the Congo: a cross-sectional, descriptive study. Lancet (2024). https://doi.org:10.1016/S0140-6736(24)02188-3 Bangwen, E. et al. Suspected and confirmed mpox cases in DR Congo: a retrospective analysis of national epidemiological and laboratory surveillance data, 2010-23. Lancet 405 , 408-419 (2025). https://doi.org:10.1016/S0140-6736(24)02669-2 Hutson, C. L. et al. Monkeypox zoonotic associations: insights from laboratory evaluation of animals associated with the multi-state US outbreak. Am J Trop Med Hyg 76 , 757-768 (2007). Falendysz, E. A., Lopera, J. G., Rocke, T. E. & Osorio, J. E. Monkeypox Virus in Animals: Current Knowledge of Viral Transmission and Pathogenesis in Wild Animal Reservoirs and Captive Animal Models. Viruses 15 (2023). https://doi.org:10.3390/v15040905 Haydon, D. T., Cleaveland, S., Taylor, L. H. & Laurenson, M. K. Identifying reservoirs of infection: a conceptual and practical challenge. Emerg Infect Dis 8 , 1468-1473 (2002). https://doi.org:10.3201/eid0812.010317 Magnus, P. v., Andersen, E. K., Petersen, K. B. & Birch-Andersen, A. A POX-LIKE DISEASE IN CYNOMOLGUS MONKEYS. Acta Pathologica Microbiologica Scandinavica 46 , 156-176 (1959). https://doi.org:https://doi.org/10.1111/j.1699-0463.1959.tb00328.x Wittig, R. M. in Encyclopedia of Animal Cognition and Behavior (eds Jennifer Vonk & Todd Shackelford) 1-7 (Springer International Publishing, 2017). Radonic, A. et al. Fatal monkeypox in wild-living sooty mangabey, Cote d'Ivoire, 2012. Emerg Infect Dis 20 , 1009-1011 (2014). https://doi.org:10.3201/eid2006.13-1329 Patrono, L. V. et al. Monkeypox virus emergence in wild chimpanzees reveals distinct clinical outcomes and viral diversity. Nat Microbiol 5 , 955-965 (2020). https://doi.org:10.1038/s41564-020-0706-0 Wittig, R. & Boesch, C. in The Chimpanzees of the Taï Forest: 40 Years of Research (eds Christophe Boesch & Roman Wittig) 44-57 (Cambridge University Press, 2019). Hoffmann, C. et al. Persistent anthrax as a major driver of wildlife mortality in a tropical rainforest. Nature 548 , 82-86 (2017). https://doi.org:10.1038/nature23309 Leendertz, F. H. et al. Pathogens as drivers of population declines: The importance of systematic monitoring in great apes and other threatened mammals. Biological Conservation 131 , 325-337 (2006). https://doi.org:10.1016/j.biocon.2006.05.002 Khodakevich, L., Jezek, Z. & Kinzanzka, K. Isolation of monkeypox virus from wild squirrel infected in nature. Lancet 1 , 98-99 (1986). https://doi.org:10.1016/s0140-6736(86)90748-8 Tiee, M. S., Harrigan, R. J., Thomassen, H. A. & Smith, T. B. Ghosts of infections past: using archival samples to understand a century of monkeypox virus prevalence among host communities across space and time. R Soc Open Sci 5 , 171089 (2018). https://doi.org:10.1098/rsos.171089 Curaudeau, M. et al. Identifying the Most Probable Mammal Reservoir Hosts for Monkeypox Virus Based on Ecological Niche Comparisons. Viruses 15 (2023). https://doi.org:10.3390/v15030727 Duda, R. et al. A time of decline: An eco-anthropological and ethnohistorical investigation of mpox in the Central African Republic. PLOS Glob Public Health 4 , e0002937 (2024). https://doi.org:10.1371/journal.pgph.0002937 Gonedelé Bi, S. et al. Bushmeat hunting around a remnant coastal rainforest in Côte d'Ivoire. Oryx 51 , 418-427 (2017). https://doi.org:10.1017/S0030605315001453 Gonedelé-Bi, S. et al. Year-round longitudinal monitoring of a bushmeat market in central-western Côte d’Ivoire: Implication for wildlife conservation. Journal for Nature Conservation 70 , 126297 (2022). https://doi.org:https://doi.org/10.1016/j.jnc.2022.126297 FA, J. E. & BROWN, D. Impacts of hunting on mammals in African tropical moist forests: a review and synthesis. Mammal Review 39 , 231-264 (2009). https://doi.org:https://doi.org/10.1111/j.1365-2907.2009.00149.x Bachmann, M. E. et al. Saving rodents, losing primates—Why we need tailored bushmeat management strategies. People and Nature 2 , 889-902 (2020). https://doi.org:https://doi.org/10.1002/pan3.10119 Gossé, K. J. et al. DNA-typing surveillance of the bushmeat in Côte d'Ivoire: a multi-faceted tool for wildlife trade management in West Africa. Conservation Genetics 23 , 1073-1088 (2022). https://doi.org:10.1007/s10592-022-01474-2 Cassola, F. The IUCN Red List of Threatened Species , (2016). Jahan, M. et al. Fly iDNA suggests strict reliance of the causative agent of sylvatic anthrax on rainforest ecosystems. Environmental DNA 6 , e401 (2024). https://doi.org:https://doi.org/10.1002/edn3.401 Reynolds, M. G. et al. A silent enzootic of an orthopoxvirus in Ghana, West Africa: evidence for multi-species involvement in the absence of widespread human disease. Am J Trop Med Hyg 82 , 746-754 (2010). https://doi.org:10.4269/ajtmh.2010.09-0716 Petrone, M. E., Holmes, E. C. & Harvey, E. Through an ecological lens: An ecosystem-based approach to zoonotic risk assessment: An ecosystem-based approach to zoonotic risk assessment. EMBO Rep 24 , e56578 (2023). https://doi.org:10.15252/embr.202256578 Gogarten, J. F. et al. An ounce of prevention is better : Monitoring wildlife health as a tool for pandemic prevention. EMBO Rep 25 , 2819-2831 (2024). https://doi.org:10.1038/s44319-024-00156-z Methods Health monitoring and sampling. Taï National Park (TNP), Ivory Coast, is the largest remaining primary rainforest in Western Africa. Its wild populations of non-human primates (NHP) have been studied by the Taï Chimpanzee Project (TCP) since 1979 31 . TCP established a veterinary programme from 2001 onwards 13 . This veterinary programme conducts wildlife mortality surveillance and health monitoring of the four neighbouring groups of chimpanzees and one group of sooty mangabeys that are habituated to human observers. The mangabey group (named the Audrenisrou group) was habituated in November 2012 32 , and at the time of the outbreak consisted of about 80 individuals. The habituated groups are followed daily by trained field assistants and research staff. Names are given to each habituated individual. Newborns are given a temporary name indicating that they are the infant (BB) of a certain individual (e.g. BB-Atacama indicates the newborn of Atacama). Behavioural data, as well as faecal and urine samples, are routinely collected from all the adults of the group. Faecal samples are collected with a plastic spatula right after defecation occurs and stored in 2 mL cryotubes. Urine is collected with fine Pasteur pipettes from underlying vegetation once the animals urinate from a higher position, and is stored in 2 mL cryotubes. These samples are preserved in liquid nitrogen in the field, transported to Germany in dry ice and then stored at -80°C until further analysis. When clinical signs are observed in the groups, observations and sampling are intensified. During this MPXV outbreak faecal samples were collected in both dry 2 mL cryotubes and in cryotubes containing nucleic acid preserving (NAP) buffer from most individuals of the group belonging to all age categories (infants, juveniles, subadults and adults), and from both symptomatic and asymptomatic individuals. Faecal samples are difficult to collect from infants, therefore the number of these samples is lower than other age classes. It is also important to note that in 2022 a significant number of male juveniles immigrated to the Audrenisrou group, and many births occurred, leading to an increase in the total population to 80 individuals. To obtain an overview of viral DNA shedding in the mangabey group, we tested faecal samples from three key time periods: from four months prior to the first observations of clinical signs (October 1 st 2022 - January 26 th 2023), during the outbreak (January 27 th 2023 - April 26 th 2023), and up to four months after the last symptoms were observed (April 27 th 2023 - August 24 th 2023). A total of 444 faecal samples were tested for MPXV, including those from just before (n = 114), during (n = 170) and after (n = 89) the mpox outbreak in the mangabey group. Details are provided in Supplementary Table 2. The veterinary team of TCP also performs necropsies on all animals found dead within the research area. Necropsies are done by trained veterinarians wearing full personal protective equipment. All used materials are incinerated or disinfected with 1% sodium hypochlorite solution and the carcasses are buried, according to the World Health Organization guidelines. Samples are collected from all inner organs when carcass decomposition is not too advanced, and stored in 2 mL cryotubes, both empty and filled with NAP buffer. The cryotubes are then preserved in liquid nitrogen in the field, transported to Germany in dry ice, and stored at -80°C until further analysis. In this study we included 88 necropsy samples from 23 carcasses representing 11 species (and 4 species for which taxonomic assignment was not possible) collected between 2019 and 2024. Further details are provided in Supplementary Tables 1 and 5. Small terrestrial mammal trapping inside and around TNP. Rodents and shrews were trapped using Sherman, Havahart-style or 0.5 m cage traps and were anesthetized using a combination of Ketamine (mouse dose 50 mg/Kg, rats dose 35 mg/Kg, Medistar®) and Xylazine (mouse dose 5 mg/Kg, rat dose 3,5 mg/Kg, WDT®) intramuscularly. Once anesthetized, the animals were measured, weighted and sampled. After sampling, the animals were marked and placed in an individual box until full recovery was observed. Anesthetized animals were monitored closely and in some cases Antisedan (5 mg/Kg, Vetoquinol®) was administered intramuscularly to facilitate recovery. Saline solution was sometimes applied as a subcutaneous infusion to prevent dehydration and applied on the eyes to prevent from drying. After recovery, the animals were released where they were caught. From July to November 2021 and March to April 2023, 173 rodents were trapped within the territory of the mangabey group. From these two field missions, we collected 167 oral swabs, 167 rectal swabs, 23 nasal swabs, 133 faecal samples and 39 samples from skin lesions. Eight individuals died in the trap or succumbed to anaesthetisation, and one was euthanized because of signs of extreme weakness. In these cases, necropsies were performed and samples were collected from all major organs. All samples were stored in 2 mL cryotubes dry or with NAP buffer, frozen in liquid nitrogen in the field, transported in dry ice to Germany and then kept at -80°C. From these trapping missions, a total of 553 samples, including different tissues and swabs were tested for orthopoxviruses (OPV). We also made use of samples originating from a broader initiative aimed at characterizing the biodiversity of small mammals and related pathogens along a gradient spanning from three villages bordering TNP on the West to the pristine forest in the immediate vicinity of the sooty mangabey territory. We set traps along three parallel transects of ~9 km covering distinct environments: (i) anthropic/domestic (inside houses), (ii) at the village periphery, (iii) at the edge between cultivated fields and the national park, and (iv) in the pristine forest of the national park. Sampling was performed from July to September 2021 and April to May 2022. In total, 521 rodents and shrews were trapped and sampled (as mentioned above), of which 79 were euthanised and underwent a full necropsy. Oral and rectal swabs were stored in 2 mL tubes with NAP buffer at room temperature until transport to Abidjan where they were stored at -20°C. Necropsy samples were stored in 2 mL cryotubes and immediately frozen in liquid nitrogen. Samples were transported to Germany on dry ice and then stored at -80°C (necropsies) or -20°C (swabs in NAP buffer). From this sample set, we tested 521 oral swabs, 257 rectal swabs, and different organs from the 79 necropsies. In toto , 1035 samples from different tissues and swabs were tested for OPV. Details regarding the sampled animals are provided in Supplementary Table 4. DNA extraction and orthopoxvirus DNA detection. Nucleic acids were extracted from 40 mg of faecal matter using the GeneMATRIX Stool DNA Purification Kit (Roboklon, Poland). For the necropsy samples, 20 mg of tissue were used for DNA extraction with the DNeasy Blood and Tissue kit (Qiagen, Germany) or QIAamp Viral RNA Mini Kit (Qiagen). Nucleic acids from virus isolates were extracted using the NucleoMag VET Kit (Macherey-Nagel, Germany) and with the RNAdvance Tissue Kit (Beckman Coulter, USA). DNA extracted from faecal and necropsy samples (excluding rodents) was tested for MPXV in duplicates with a TaqMan Real-time quantitative PCR (qPCR) targeting G2R loci of monkeypoxviruses 33 . Rodent DNA extracts (including the DNA extracts from trapped rodents and necropsies) were tested in duplicate for orthopoxviruses using a TaqMan Real-time PCR targeting the P4A gene 34 and the positive extracts were tested with the MPXV qPCR mentioned above. A confirmatory PCR targeting a 270-bp fragment of the hemagglutinin (HA) gene of OPVs 35 was performed for all the extracts that had weakly positive results in the MPXV or OPV qPCRs. Virus isolation. Virus isolation was attempted from 13 faecal samples (12 from the mangabeys, 1 from the fire-footed rope squirrel), 13 tissue samples, and maggots from two necropsies. Skin, lung, and spleen were tested for each mangabey necropsy, as well as a maggot from one individual. The squirrel samples tested encompassed skin, lung, spleen, liver, faeces, and maggots. The samples were added to cell culture medium with 10% foetal bovine serum supplemented with penicillin/streptomycin (Gibco, USA) and gentamicin/amphotericin (Gibco), bead homogenised on a bead ruptor, and incubated over night at 8°C. Sample homogenate was filtered through a 0.8µm pore membrane to remove larger particles and potential contaminating bacteria. The filtrate was added to confluent layers of MA-104 cells, and cultivated with the aforementioned antibiotic-supplemented medium in 12.5cm² rectangular canted neck cell culture flasks. Cell cultures were passaged after three days. If a cytopathic effect was visible, cells were passaged further to increase the viral titre for shotgun sequencing. Hybridization capture and high-throughput sequencing. Illumina-compatible dual index libraries were generated from up to 1000 ng of DNA extracts from necropsies and four mangabey faecal samples (details provided in Supplementary Tables 1, 2 and 5). Faecal samples were selected based on viral copy number. DNA was fragmented in 50 µl of low EDTA-TE buffer using a Covaris ME220 Focused-ultrasonicator (Covaris, USA) set for a target fragment-size of 350bp (settings: treatment duration 45 s, peak power 50, duty factor 20%, 1000 cycles per burst, average power 10, temperature 20 °C). Libraries were built from the fragmented DNA using the NEBNext Ultra II DNA kit following the manufacturer’s recommendations. After the adapter ligation, a 300 – 400 bp size selection using MagSi magnetic beads (Carl Roth, Germany) was performed where the input was higher than 50 ng of total DNA. Quantification of the final libraries was performed using the Kapa HiFi Library Quantification Kit (Roche, Switzerland) or the NEBNext Library Quant Kit for Illumina (New England Biolabs, USA). Libraries were stored at -20°C until further use. All libraries underwent MPXV target enrichment through in-solution hybridization capture with a previously described orthopoxvirus bait set 10 . We used myBaits® RNA baits following the myBaits® Sequence Enrichment for Targeted Sequencing protocol (Version 5.0; Daicel Arbor Biosciences) and applied 2 successive rounds of 24h hybridization capture. Additionally, one round of 24h 65°C hybridization capture targeting the mitochondrial genome of rodents was performed on a library of the squirrel spleen. To design these custom baits, all complete mitochondrial genomes of rodents available on GenBank were accessed and redundancies were reduced by clustering genomes using CD-HIT30 at a minimum of 88% sequence identity. Final bait design was based on the resulting 239 accession numbers. For capture, only a quarter of the recommended bait quantity was used. Following each round of capture, the hybridized library pools were amplified using the KAPA HotStart Library Amplification Kit (Roche) to obtain a minimum of 200 ng total DNA per library pool. After final quantification using the Kapa HiFi Library Quantification Kit (Roche) or the NEBNext Library Quant Kit for Illumina, the enriched pools were diluted to the recommended concentrations. Sequencing was performed on a MiniSeq platform (Illumina, USA) using the V3 chemistry (MiniSeq High output Kit for 75 or 150 cycles). For whole genome sequencing of MPXV from cell cultures, we generated libraries from isolates from two mangabey skin samples and from the squirrel lung using the Rapid-Barcoding Kit V14 (Oxford Nanopore Technologies, United Kingdom) and sequenced them directly on a PromethION 2 solo platform (Oxford Nanopore Technologies) using R10.4.1 PromethION flow cells. Basecaller v4.3.0 was set to super-accurate basecalling v4.3.0, 400 bps. Sequencing data analyses. Reads from different tissues of the same individual were merged to improve viral genome coverage. Raw sequencing reads were quality-filtered using trimmomatic v0.39 36 using the settings: LEADING:30 TRAILING:30 SLIDINGWINDOW:4:30 MINLEN:30. Filtered reads were then mapped to the most recent MPXV genome from TNP (GenBank accession number MN346702) using BWA MEM v0.7.17-r1188 37 . Mapped reads were sorted and duplicates removed using SortSam and MarkDuplicates by Picard v2.13.3 (http://broadinstitute.github.io/picard/). In parallel, paired reads were mapped to the reference genome in Geneious Prime 2023.1.2 (https://www.geneious.com) using default settings to improve coverage of inverted terminal repeats regions of the MPXV genome. Consensus sequences were generated from the reference based mapping pipeline and the Geneious mapper and checked manually for concordance. Base calling was set to a minimum of 20 reads and 95% agreement. For samples where we obtained a shallow coverage, consensus sequences were called when two or more reads were present. Nearly complete viral genomes (excluding the ITRs) used for phylogenetic analyses were assembles from the reference based mapping. The complete mitochondrial genome of the squirrel was de-novo assembled from quality-filtered reads using SPAdes v3.13.0 38 . Oxford Nanopore reads were quality trimmed using BBDUK with the following settings: qtrim=rl trimq=6 minlength=50 ordered=t qin=33 (BBMap - Bushnell B. - sourceforge.net/projects/bbmap) and de novo assembled using Flye v2.9.2 39 (flags --nano-hq; --genome-size 200k). The entire dataset was then re-mapped against the initially generated sequence through Minimap2 v2.17 40 (ONT mode; including secondary alignments; maximum secondary alignments per read = 5; minimum secondary to primary alignment ratio = 0.8). Phylogenetic analyses. A dataset representing the current known MPXV clade IIa diversity was assembled from publicly available data on GenBank and GISAID 41 . For identical sequences originating from the same outbreak only one representative genome was selected. We also included partial genomes from Côte d’Ivoire and Liberia from 2024. After evaluating the Côte d’Ivoire sequences through Nextclade v3.12.036 42 quality control (https://clades.nextstrain.org/), we identified three high quality genomes, which we included in our analysis. Furthermore, two genomes of lower quality were added due to their origin in geographic proximity to TNP. This dataset plus one representative MPXV genome per species from the TNP 2022/2023 outbreak (n=28) were aligned using MAFFT v7.505n 43 . Gblocks v0.91b was run in SeaView v5 on stringent settings to not allow for many continuous nonconserved positions 44 . Identical sites, ambiguities and gaps were removed in Geneious, so only variable sites were included in phylogenetic analysis (534 bases). The best fitting model of nucleotide evolution was identified using Modelfinder 45 with ascertainment bias correction as implemented in IQ-TREE v1.6.12 46,47 . A maximum likelihood phylogeny was reconstructed on IQ-TREE and branch robustness was assessed by ultrafast bootstrapp (1000 replicates) 48 . The best-fitting root of the resulting tree was identified in TempEst v1.5.3 49 and further tree visualisation and editing was done in iTOL v7.1 (https://itol.embl.de/) 50 . Diet analysis. The mangabey’s diet was analysed using a metabarcoding approach. The faecal samples used in this particular study (n=78) were collected just before the mpox outbreak started in the mangabey group (01.10.2022-30.12.2022). We used the Tagsteady protocol 7 . A first PCR assay targeting a 130bp fragment of the 16S mitochondrial DNA was performed with tagged 16S mam1 (16Smam1 5′‐CGGTTGGGGTGACCTCGGA‐3′) and 16S mam2 (5′‐GCTGTTATCCCTAGGGTAACT‐3′) primers to identify each sample individually. This PCR was performed with the addition of human blocking primer (16Smam_blkhum 5′‐CGGTTGGGGCG ACCTCGGAGCAGAACCC-3’) to reduce the amplification of contaminant human DNA. A total volume of 25 ul was used for each reaction, which included 2 ul of DNA template. The cycling parameters were set as follows: 95°C for 10 min, 35 cycles of 95°C for 12 s, 59°C for 30 s, 70°C for 25 s, and 72°C for 7 min. Subsequently, we generated three pools comprising all positive samples together with the positive and negative controls from the same PCR plate (three plates with one replicate each; 262 amplicons in total). After end repair, we indexed the pools by ligation with Illumina full-length Y-adapters that carried dual matching indexes (P5-P7) 51 . The indexed pools were sequenced on an Illumina iSeq 100 System. To analyse the resulting reads, we first assembled a reference database from the EMBL collection of vertebrate sequences (downloaded on July 10 th , 2024) on which we performed an in-silico PCR with the OBItools (v3.0.1b21) ecopcr command, allowing up to three mismatches between the primer and the reference sequences. We sorted the reads generated from the diet analysis to their respective PCR replicate using their 5’ nucleotide tags using OBItools and removed primer sequences. Paired-end reads were then merged using the OBItools Illuminapairedend command keeping only reads with >0.8 alignment quality score and a length >80bp. Sequence variants were then collapsed with the obiclean command, but retaining a count of their appearance in each PCR replicate. We then compared the resulting aligned reads with our reference database to try to assign taxons by using the OBItools ecotag command. To consider a wildlife species detection event genuine, we required that at least two of the three replicates contained at least two times the maximum number of reads assigned a taxonomy in the negative controls. We also used Geneious to competitively map the trimmed reads to the mitogenome we generated from the squirrel spleen, as well as a human (NC_012920), chimpanzee (KU308547), and mangabey (NC_028592) mitogenomes. Re-analyses of fly data. To investigate the distribution of fire-footed rope squirrels and sooty mangabeys along a local ecological gradient, we reanalysed a recently published mammal metabarcoding dataset derived from fly DNA 27 . To do this, we applied the same bioinformatics approaches used for faecal diet analyses to the 100 datasets (25 from the forest, 50 from the edge, 25 from villages) produced by this study (doi: 10.5281/zenodo.7688127). Methods references 31 Boesch, C. & Boesch-Achermann, H. The chimpanzees of the Taï Forest: Behavioural ecology and evolution . (Oxford university press, 2000). 32 Gogarten, J. F. et al. Factors influencing bacterial microbiome composition in a wild non-human primate community in Taï National Park, Côte d’Ivoire. The ISME journal 12 , 2559-2574 (2018). 33 Li, Y., Zhao, H., Wilkins, K., Hughes, C. & Damon, I. K. Real-time PCR assays for the specific detection of monkeypox virus West African and Congo Basin strain DNA. Journal of virological methods 169 , 223-227 (2010). 34 Schroeder, K. & Nitsche, A. Multicolour, multiplex real-time PCR assay for the detection of human-pathogenic poxviruses. Molecular and cellular probes 24 , 110-113 (2010). 35 Kurth, A. et al. Rat-to-elephant-to-human transmission of cowpox virus. Emerging infectious diseases 14 , 670 (2008). 36 Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30 , 2114-2120 (2014). 37 Li, H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv preprint arXiv:1303.3997 (2013). 38 Prjibelski, A., Antipov, D., Meleshko, D., Lapidus, A. & Korobeynikov, A. Using SPAdes de novo assembler. Current protocols in bioinformatics 70 , e102 (2020). 39 Kolmogorov, M., Yuan, J., Lin, Y. & Pevzner, P. A. Assembly of long, error-prone reads using repeat graphs. Nature Biotechnology 37 , 540-546 (2019). https://doi.org:10.1038/s41587-019-0072-8 40 Li, H. Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics 34 , 3094-3100 (2018). https://doi.org:10.1093/bioinformatics/bty191 41 Khare, S. et al. GISAID’s role in pandemic response. China CDC weekly 3 , 1049 (2021). 42 Aksamentov, I., Roemer, C., Hodcroft, E. B., & Neher, R. A. Nextclade: clade assignment, mutation calling and quality control for viral genomes. Journal of Open Source Software 6 , 3773 (2021). 43 Katoh, K. & Standley, D. M. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular biology and evolution 30 , 772-780 (2013). 44 Gouy, M., Tannier, E., Comte, N. & Parsons, D. P. in Multiple Sequence Alignment: Methods and Protocols (ed Kazutaka Katoh) 241-260 (Springer US, 2021). 45 Kalyaanamoorthy, S., Minh, B. Q., Wong, T. K. F., von Haeseler, A. & Jermiin, L. S. ModelFinder: fast model selection for accurate phylogenetic estimates . Vol. 14 (2017). 46 Trifinopoulos, J., Nguyen, L.-T., von Haeseler, A. & Minh, B. Q. W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Research 44 , W232-W235 (2016). https://doi.org:10.1093/nar/gkw256 47 Nguyen, L. T., Schmidt, H. A., von Haeseler, A. & Bui, M. Q. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Molecular biology and evolution 32 , 268-274 (2015). 48 Hoang, D. T., Chernomor, O., von Haeseler, A., Minh, B. Q. & Vinh, L. S. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Molecular Biology and Evolution 35 , 518-522 (2017). https://doi.org:10.1093/molbev/msx281 49 Rambaut, A., Lam, T. T., Max Carvalho, L. & Pybus, O. G. Exploring the temporal structure of heterochronous sequences using TempEst (formerly Path-O-Gen). Virus Evolution 2 (2016). https://doi.org:10.1093/ve/vew007 50 Letunic, I. & Bork, P. Interactive Tree of Life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Research 52 , W78-W82 (2024). https://doi.org:10.1093/nar/gkae268 51 Carøe, C. & Bohmann, K. Tagsteady: A metabarcoding library preparation protocol to avoid false assignment of sequences to samples. Molecular Ecology Resources 20 , 1620-1631 (2020). Additional Declarations There is NO Competing Interest. Supplementary Files RiutordExtendedDataFigure1.jpg Extended data Extended Data Fig. 1: Degrees of rash severity associated with MPXV infection in the sooty mangabey ( Cercocebus atys ) and MPXV DNA detection in asymptomatic individuals. The numbers in brackets following the age categories indicate the number of individuals per age category. The numbers under each severity group correspond to the number of mangabeys that showed this symptomatology. The last column represents the number of asymptomatic individuals in which MPXV DNA was found in their faecal samples. RiutordExtendedDataFigure2.jpg Extended Data Fig. 2: Evolution of MPXV-induced cutaneous rash in an infant of sooty mangabey ( Cercocebus atys ). Day 1 refers to the first day that researchers observed symptoms in this individual. a A localized rash is present on the face (lesions are indicated with arrows). b Multiple maculo-papular lesions appear in most parts of the body. c Some lesions have progressed to vesicles, and a few have advanced to pustules. d The lesions have formed crusts. e An enlarged lymphnode is visible on the left side of the neck. f The infant has recovered and scars are visible. Photo credits: TCP/Carme Riutord-Fe. RiutordExtendedDataFigure3.jpg Extended Data Fig. 3: Summary of faecal samples and MPXV DNA detection before, during and after the appearance of clinical signs associated with MPXV infection in the sooty mangabey ( Cercocebus atys ) group. RiutordExtendedDataFigure4.jpg Extended Data Fig. 4: Carcass of the fire-footed rope squirrel ( Funisciurus pyrropus ) found dead in TNP. Shown is the carcass of the fire.footed rope squirrel as it was found on November 3 rd 2022 in TNP. Photo credit: TCP/Carme Riutord-Fe. RiutordSupplementaryInformationTables16.xlsx Supplementary Tables 1-6 SupplementaryInformationGuide.docx Supplementary Information Guide RiutordSupplementaryVideo1.mov Supplementary Video 1 RiutordSupplementaryVideo2.mov Supplementary Video 2 Cite Share Download PDF Status: Published Journal Publication published 11 Feb, 2026 Read the published version in Nature → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6322223","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Biological Sciences - Article","associatedPublications":[],"authors":[{"id":435540676,"identity":"3fa858a6-e15a-4605-89d6-0acc00f75654","order_by":0,"name":"Fabian Leendertz","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABSElEQVRIie2QP0vDQBTAXxGS5dmsF6r9DCeBQKGQr3JS6JTo2rEgxKWlaz5KB4cXD+xyOkcstCJ0qmIXqVDBS6PiSenscL/hjnt3v/fnACyWf4jbRyC9H5UHVi4egxrV+tuIA6K8JUNBqhT8Ujj4mX6jFcQ9ChgKL34rsENxb3N6HwN67jAvVlebKHi4oOv7cRsjj5z5vDeF+qRvKHgm8qEC9Ad3nVa24Afh9EbIRHV1FXK5UAvwlVEmgpjTYQrIizhsIHEnLGIuk1Qi1kZv7DSVulVhVPGWPP/QSjRbho0NcQyy89dKOQCnUmZzQ2E657YKw7ABxBlnMVSK860U5vjsRcjjlCFTcdAaUMBZ0S0b07MorQgl0Vd/Gkvk6jltN71LdVKsqRl5WefxKdERd0SOv+7JZn1i/nIF2xH7ybrnzmKxWCy7+QSFcHxM3M0/tQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-2169-7375","institution":"Helmholtz Institute for One Health, Helmholtz Center for Infection Research","correspondingAuthor":true,"prefix":"","firstName":"Fabian","middleName":"","lastName":"Leendertz","suffix":""},{"id":435540677,"identity":"5057b885-d91c-443a-9d5b-3e4eaf537b2e","order_by":1,"name":"Carme Riutord-Fe","email":"","orcid":"","institution":"Helmholtz Institute for One Health, Helmholtz Center for Infection Research","correspondingAuthor":false,"prefix":"","firstName":"Carme","middleName":"","lastName":"Riutord-Fe","suffix":""},{"id":435540678,"identity":"8ca9b377-0544-4538-92f0-2657f7d7e7df","order_by":2,"name":"Jasmin Schlotterbeck","email":"","orcid":"","institution":"Helmholtz Institute for One Health, Helmholtz Center for Infection Research","correspondingAuthor":false,"prefix":"","firstName":"Jasmin","middleName":"","lastName":"Schlotterbeck","suffix":""},{"id":435540679,"identity":"2c9a6b2e-0a83-4327-9fba-f48c7405ecf5","order_by":3,"name":"Lorenzo Lagostina","email":"","orcid":"https://orcid.org/0000-0002-6661-705X","institution":"Helmholtz Institute for One Health, Helmholtz Center for Infection Research","correspondingAuthor":false,"prefix":"","firstName":"Lorenzo","middleName":"","lastName":"Lagostina","suffix":""},{"id":435540680,"identity":"539b4b7f-a542-4ea0-884c-49d42ad007a6","order_by":4,"name":"Leonce Kouadio","email":"","orcid":"https://orcid.org/0000-0003-1819-3333","institution":"Tai Chimpanzee Project, Centre Suisse de Recherches Scientifiques en Côte d'Ivoire","correspondingAuthor":false,"prefix":"","firstName":"Leonce","middleName":"","lastName":"Kouadio","suffix":""},{"id":435540681,"identity":"3e1494c7-56ab-4203-93c7-59041b17ae0d","order_by":5,"name":"Harriet Herridge","email":"","orcid":"","institution":"Helmholtz Institute for One Health, Helmholtz Center for Infection Research","correspondingAuthor":false,"prefix":"","firstName":"Harriet","middleName":"","lastName":"Herridge","suffix":""},{"id":435540682,"identity":"326e108d-c5fa-48d0-b4b2-a568b9e76e9a","order_by":6,"name":"Moritz Jochum","email":"","orcid":"","institution":"Helmholtz Institute for One Health, Helmholtz Center for Infection Research","correspondingAuthor":false,"prefix":"","firstName":"Moritz","middleName":"","lastName":"Jochum","suffix":""},{"id":435540683,"identity":"01ddd245-3128-43c2-87db-90ee94590bce","order_by":7,"name":"Nea Noma","email":"","orcid":"","institution":"Senckenberg Museum of Natural History, Senckenberg Society for Nature Research","correspondingAuthor":false,"prefix":"","firstName":"Nea","middleName":"","lastName":"Noma","suffix":""},{"id":435540684,"identity":"f69e6b48-a27a-4985-ac96-6c08fec420bf","order_by":8,"name":"Ane López-Morales","email":"","orcid":"","institution":"Tai Chimpanzee Project, Centre Suisse de Recherches Scientifiques en Côte d’Ivoire","correspondingAuthor":false,"prefix":"","firstName":"Ane","middleName":"","lastName":"López-Morales","suffix":""},{"id":435540685,"identity":"68167f4f-cf0a-4ff5-b029-3a264969650d","order_by":9,"name":"Donata Hoffmann","email":"","orcid":"https://orcid.org/0000-0003-4552-031X","institution":"Friedrich Loeffler Institute","correspondingAuthor":false,"prefix":"","firstName":"Donata","middleName":"","lastName":"Hoffmann","suffix":""},{"id":435540686,"identity":"f77b900c-d988-4d9a-be94-354046df4256","order_by":10,"name":"Sten Calvelage","email":"","orcid":"","institution":"Friedrich Loeffler Institute","correspondingAuthor":false,"prefix":"","firstName":"Sten","middleName":"","lastName":"Calvelage","suffix":""},{"id":435540687,"identity":"babd535c-1b18-404e-93cf-307e3edebe95","order_by":11,"name":"Hjalmar Kühl","email":"","orcid":"","institution":"Senckenberg Museum for Natural History Görlitz, Senckenberg-Member of the Leibniz Association","correspondingAuthor":false,"prefix":"","firstName":"Hjalmar","middleName":"","lastName":"Kühl","suffix":""},{"id":435540688,"identity":"72a08150-614e-4099-8385-5da1c714a5eb","order_by":12,"name":"Alexander Mielke","email":"","orcid":"","institution":"Tai Chimpanzee Project, Centre Suisse de Recherches Scientifiques en Côte d’Ivoire","correspondingAuthor":false,"prefix":"","firstName":"Alexander","middleName":"","lastName":"Mielke","suffix":""},{"id":435540689,"identity":"e84b66f8-3569-4f86-b017-c781620e3d9e","order_by":13,"name":"Catherine Crockford","email":"","orcid":"","institution":"French National Centre for Scientific Research","correspondingAuthor":false,"prefix":"","firstName":"Catherine","middleName":"","lastName":"Crockford","suffix":""},{"id":435540690,"identity":"3ca26df4-ff73-4c5f-bb70-61f6a5cee387","order_by":14,"name":"Roman Wittig","email":"","orcid":"","institution":"Tai Chimpanzee Project, Centre Suisse de Recherches Scientifiques en Côte d’Ivoire","correspondingAuthor":false,"prefix":"","firstName":"Roman","middleName":"","lastName":"Wittig","suffix":""},{"id":435540691,"identity":"86ed2a3a-fb16-4b87-b4e9-6c05dc3fcd75","order_by":15,"name":"Martin Beer","email":"","orcid":"https://orcid.org/0000-0002-0598-5254","institution":"Friedrich-Loeffler-Institute","correspondingAuthor":false,"prefix":"","firstName":"Martin","middleName":"","lastName":"Beer","suffix":""},{"id":435540692,"identity":"818e07e9-5f19-4658-b676-d3e17d7d5a1e","order_by":16,"name":"Gonedelé Sery Ernest","email":"","orcid":"","institution":"UFR Biosciences, Université Félix Houphouët Boigny","correspondingAuthor":false,"prefix":"","firstName":"Gonedelé","middleName":"Sery","lastName":"Ernest","suffix":""},{"id":435540693,"identity":"fdd93955-ba3e-4c0e-8aad-7dc5a99b0e01","order_by":17,"name":"Jan Gogarten","email":"","orcid":"","institution":"Helmholtz Institute for One Health, Helmholtz Center for Infection Research","correspondingAuthor":false,"prefix":"","firstName":"Jan","middleName":"","lastName":"Gogarten","suffix":""},{"id":435540694,"identity":"757d8c64-04eb-4727-8288-ef575a947323","order_by":18,"name":"Sébastien Calvignac-Spencer","email":"","orcid":"https://orcid.org/0000-0003-4834-0509","institution":"HIOH","correspondingAuthor":false,"prefix":"","firstName":"Sébastien","middleName":"","lastName":"Calvignac-Spencer","suffix":""},{"id":435540695,"identity":"5a59ef16-d301-4c8a-9d01-1a9e54c5bb0c","order_by":19,"name":"Ariane Dux","email":"","orcid":"","institution":"Robert Koch Institute","correspondingAuthor":false,"prefix":"","firstName":"Ariane","middleName":"","lastName":"Dux","suffix":""},{"id":435540696,"identity":"436eb2d5-0082-4f11-9f90-882fa5c7f6b1","order_by":20,"name":"Livia Patrono","email":"","orcid":"","institution":"Helmholtz Institute for One Health, Helmholtz Center for Infection Research","correspondingAuthor":false,"prefix":"","firstName":"Livia","middleName":"","lastName":"Patrono","suffix":""}],"badges":[],"createdAt":"2025-03-27 16:26:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6322223/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6322223/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41586-025-10086-y","type":"published","date":"2026-02-11T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":80129361,"identity":"be10efc7-97f1-4b2c-8370-bf88f8114eb8","added_by":"auto","created_at":"2025-04-08 08:56:35","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":338124,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFire-footed rope squirrel (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eFunisciurus pyrropus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e) range and map of the sooty mangabey (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCercocebus atys\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e) territory in TNP. a \u003c/strong\u003eDistribution of the fire-footed rope squirrel in Africa (light blue) according to IUCN redlist and the location of Taï National Park within Côte d’Ivoire for reference (green). \u003cstrong\u003eb\u003c/strong\u003eHome range of the habituated sooty mangabey group at TCP, approximated as the 95% minimum convex polygon (MCP) in black dashed line of the mangabey movements tracked over the period of one year (blue). The squirrel icon represents the location of the necropsy of the fire-footed rope squirrel which was positive for MPXV.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6322223/v1/d39625297b1de6903d2d1adb.png"},{"id":80130048,"identity":"11e0e203-d552-4dee-add5-ca2a3a64529f","added_by":"auto","created_at":"2025-04-08 09:04:35","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":580511,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDifferent degrees of maculo-pustular rash associated to MPXV infection in three sooty mangabeys (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCercocebus atys\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e). a \u003c/strong\u003eSevere maculo-pustular rash (\u0026gt;20 lesions) spread all over the body. \u003cstrong\u003eb \u003c/strong\u003eModerate maculo-pustular rash (5-20 lesions) localized on the head. \u003cstrong\u003ec \u003c/strong\u003eMild maculo-pustular rash (1-5 lesions) localized on the neck. White arrows point at the observed skin lesions. Photo credit: TCP/Carme Riutord-Fe.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6322223/v1/daf9f49091716f2c87138ff5.png"},{"id":80129365,"identity":"90e507e3-ceb8-43be-a95e-d50e62e0c4a1","added_by":"auto","created_at":"2025-04-08 08:56:35","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":238934,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDetection of MPXV DNA and of fire-footed rope squirrel (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eFunisciurus pyrropus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e) DNA in sooty mangabey (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCercocebus atys\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e) faeces\u003c/strong\u003e. Each line represents a different individual. Filled circles represent virus-positive samples, empty circles represent virus-negative samples. The solid red circle indicates the detection of squirrel DNA in a sample that was also MPXV positive, while the unfilled red circle represents the detection of squirrel DNA in a sample that was MPXV negative. Vertical grey shadowing indicates the period in which clinical signs were observed in the mangabey group. For each individual, the purple horizontal shadowing indicates the period during which clinical signs were observed.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6322223/v1/255eba33113df8637c3a6902.png"},{"id":80129364,"identity":"2b9d9792-e2ee-462b-b899-fa3b090f1ee2","added_by":"auto","created_at":"2025-04-08 08:56:35","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":187723,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMaximum likelihood phylogeny of clade IIa MPXVs.\u003c/strong\u003e Genomes retrieved from the sooty mangabey (\u003cem\u003eCercocebus atys\u003c/em\u003e) outbreak and the fire-footed rope squirrel (\u003cem\u003eFunisciurus pyrropus\u003c/em\u003e) are shown in blue. The scale bar represents substitutions per variable site. Bootstrap support of the inner branches is indicated by colour (grey is \u0026lt; 0.90; black is ≥ 0.90).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6322223/v1/d98a5df310b137fb7ea45584.png"},{"id":80130049,"identity":"cd8f6f2a-e8d9-4321-a68b-24a29266bc9d","added_by":"auto","created_at":"2025-04-08 09:04:36","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":926305,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSooty mangabey (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCercocebus atys\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e) eating a fire-footed rope squirrel (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eFunisciurus pyrropus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e) in TNP.\u003c/strong\u003e This adult female was observed eating a squirrel on December 9\u003csup\u003eth\u003c/sup\u003e 2014. Photo credit: TCP/Alexander Mielke\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6322223/v1/1f5c323a3fa58d3bbe41dcf3.png"},{"id":102488513,"identity":"62e55857-6aee-45e1-9319-f95ba7cf4a30","added_by":"auto","created_at":"2026-02-12 08:14:39","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3894971,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6322223/v1/d2ce78d0-7015-4a49-b9a3-374d603df705.pdf"},{"id":80129360,"identity":"6e8fcb5f-4b98-4d90-a433-56d8cc1a9fb9","added_by":"auto","created_at":"2025-04-08 08:56:35","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":22200,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExtended data\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExtended Data Fig. 1: Degrees of rash severity associated with MPXV infection in the sooty mangabey (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCercocebus atys\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e) and MPXV DNA detection in asymptomatic individuals. \u003c/strong\u003eThe numbers in brackets following the age categories indicate the number of individuals per age category. The numbers under each severity group correspond to the number of mangabeys that showed this symptomatology. The last column represents the number of asymptomatic individuals in which MPXV DNA was found in their faecal samples.\u003c/p\u003e","description":"","filename":"RiutordExtendedDataFigure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6322223/v1/82c8ac252a01599d8afb7e76.jpg"},{"id":80129367,"identity":"bb73b67e-3563-4518-90a0-77924152aced","added_by":"auto","created_at":"2025-04-08 08:56:35","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":136738,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExtended Data Fig. 2: Evolution of MPXV-induced cutaneous rash in an infant of sooty mangabey (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCercocebus atys\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e). \u003c/strong\u003eDay 1 refers to the first day that researchers observed symptoms in this individual. \u003cstrong\u003ea\u003c/strong\u003e A localized rash is present on the face (lesions are indicated with arrows). \u003cstrong\u003eb\u003c/strong\u003e Multiple maculo-papular lesions appear in most parts of the body. \u003cstrong\u003ec\u003c/strong\u003e Some lesions have progressed to vesicles, and a few have advanced to pustules. \u003cstrong\u003ed \u003c/strong\u003eThe lesions have formed crusts. \u003cstrong\u003ee\u003c/strong\u003e An enlarged lymphnode is visible on the left side of the neck. \u003cstrong\u003ef\u003c/strong\u003e The infant has recovered and scars are visible. Photo credits: TCP/Carme Riutord-Fe.\u003c/p\u003e","description":"","filename":"RiutordExtendedDataFigure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6322223/v1/660849b488cc9740d40285c0.jpg"},{"id":80129362,"identity":"6c8f8762-7f7b-49b5-b67f-d8a2696b7ae6","added_by":"auto","created_at":"2025-04-08 08:56:35","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":26933,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExtended Data Fig. 3: Summary of faecal samples and MPXV DNA detection before, during and after the appearance of clinical signs associated with MPXV infection in the sooty mangabey (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCercocebus atys\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e) group.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"RiutordExtendedDataFigure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6322223/v1/7f5ae998cff16d9ad9f93a1e.jpg"},{"id":80129366,"identity":"bbedc7a3-e802-4100-b313-0cb6b43eb9e1","added_by":"auto","created_at":"2025-04-08 08:56:35","extension":"jpg","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":1028990,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExtended Data Fig. 4: Carcass of the fire-footed rope squirrel (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eFunisciurus pyrropus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e) found dead in TNP\u003c/strong\u003e. Shown is the carcass of the fire.footed rope squirrel as it was found on November 3\u003csup\u003erd\u003c/sup\u003e 2022 in TNP. Photo credit: TCP/Carme Riutord-Fe.\u003c/p\u003e","description":"","filename":"RiutordExtendedDataFigure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6322223/v1/52fe3599115dcc5463ff5b40.jpg"},{"id":80129371,"identity":"0fa3a042-00b3-4d77-914b-b97f682f4b92","added_by":"auto","created_at":"2025-04-08 08:56:36","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":204465,"visible":true,"origin":"","legend":"Supplementary Tables 1-6","description":"","filename":"RiutordSupplementaryInformationTables16.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6322223/v1/2c04e2cb836a2c98e25f7615.xlsx"},{"id":80129370,"identity":"e377269e-19df-4180-a753-94140d305144","added_by":"auto","created_at":"2025-04-08 08:56:36","extension":"docx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":1072913,"visible":true,"origin":"","legend":"Supplementary Information Guide","description":"","filename":"SupplementaryInformationGuide.docx","url":"https://assets-eu.researchsquare.com/files/rs-6322223/v1/e4457a46162d8fa836e77bca.docx"},{"id":80129372,"identity":"ef348fbb-70d4-4809-b88f-e3bf00e571cf","added_by":"auto","created_at":"2025-04-08 08:56:36","extension":"mov","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":29037571,"visible":true,"origin":"","legend":"Supplementary Video 1","description":"","filename":"RiutordSupplementaryVideo1.mov","url":"https://assets-eu.researchsquare.com/files/rs-6322223/v1/7177bc793f4f6e41f3c28b3a.mov"},{"id":80129373,"identity":"e3602136-3a7e-44e6-8a42-8e310157b95e","added_by":"auto","created_at":"2025-04-08 08:56:37","extension":"mov","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":73785604,"visible":true,"origin":"","legend":"Supplementary Video 2","description":"","filename":"RiutordSupplementaryVideo2.mov","url":"https://assets-eu.researchsquare.com/files/rs-6322223/v1/ba6cfa5f8e55961bc9e5ee6e.mov"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Fire-footed rope squirrels (\u003ci\u003eFunisciurus pyrropus\u003c/i\u003e) are a reservoir host of monkeypox virus (\u003ci\u003eOrthopoxvirus monkeypox\u003c/i\u003e)","fulltext":[{"header":"Main","content":"\u003cp\u003eThe recent emergence of MPXV lineages characterized by human-to-human transmission through sexual networks has led the WHO to declare public health emergencies of international concern in 2022\u003csup\u003e1\u003c/sup\u003e and 2024\u003csup\u003e2\u003c/sup\u003e. Efforts were immediately scaled up in endemic African countries to reinforce mpox surveillance systems. Concurrently, sustained human-to-human transmission was shown to leave a distinct signature in MPXV genomes under the form of APOBEC3-induced mutations, providing a potent tool to determine how much of MPXV evolution happened in humans\u003csup\u003e3\u003c/sup\u003e. Building on these two pillars, recent genomic surveillance data from the Democratic Republic of Congo (DRC) and the Republic of Congo clearly showed that MPXV diversity mostly reflects numerous, independent zoonotic spillovers\u003csup\u003e4,5\u003c/sup\u003e. Importantly, epidemiological data from the DRC suggest that these spillovers have increased in frequency from 2010 to 2024, a period during which the national surveillance system has been relatively stable\u003csup\u003e6\u003c/sup\u003e. Although African rodents have long been considered a possible reservoir for MPXV\u003csup\u003e7,8\u003c/sup\u003e, formal proof to support this assumption is lacking. Ascertaining the animal sources of zoonotic agents is indeed a notoriously difficult task\u003csup\u003e9\u003c/sup\u003e. In the case of MPXV, achieving this task is critical, since it would lead to better management of the risk of spillover to humans, and thereby provide a lever to prevent subsequent outbreaks fueled by human-to-human transmission.\u003c/p\u003e\n\u003cp\u003eCaptive nonhuman primates (NHP) are famously associated with the discovery of MPXV\u003csup\u003e10\u003c/sup\u003e, which resulted in the misleading naming of the virus. More recently, long-term health monitoring at the Taï Chimpanzee Project\u003csup\u003e11\u003c/sup\u003e (TCP) in Taï National Park (TNP), Côte d’Ivoire, revealed that MPXV also affects wild NHP, opening a window into the ecology of this virus. We detected MPXV in a dead sooty mangabey (hereafter mangabey; \u003cem\u003eCercocebus atys\u003c/em\u003e) in 2012\u003csup\u003e12\u003c/sup\u003e, and later identified three independent MPXV outbreaks in 2017 and 2018 that hit distinct groups of western chimpanzees (\u003cem\u003ePan troglodytes verus\u003c/em\u003e) living in the same forest\u003csup\u003e13\u003c/sup\u003e. While these investigations provided insights into different clinical presentations and described viral genomic diversity in this area, the source of these outbreaks remains unknown. In late January 2023, we started observing clinical signs compatible with MPXV infection in several infants from the habituated mangabey group of TCP, which consisted of 80 individuals at that time (Fig. 1). Nearly 30% of the group developed skin lesions over the following 12 weeks. Making use of TCP’s longitudinal non-invasive sample collection started in the early 2010s\u003csup\u003e14\u003c/sup\u003e, along with the systematic carcass monitoring\u003csup\u003e15,16\u003c/sup\u003e, and rodent sampling efforts in and around TNP, we conducted an outbreak investigation that included an extensive search for a potential source of infection.\u003c/p\u003e\n\u003cp\u003eOn January 27\u003csup\u003eth\u003c/sup\u003e 2023, an infant mangabey developed red macular lesions on the forehead, back of the head, chest and legs (Fig. 2A), accompanied by the onset of lethargy and anorexia. Lesions quickly spread to the entire body and the individual died within 48 hours, on January 29\u003csup\u003eth\u003c/sup\u003e. By early March, five other infants developed similar lesions alongside lethargy, anorexia, and lymphadenopathy. Macular skin lesions progressed to papulo-pustular stages, and three of these infants died. A milder form of the disease, consisting of either a diffuse rash with only ~5-20 skin lesions (Fig. 2B), or fewer isolated lesions appearing in a single part of the body (e.g. face, limbs or tail, Fig. 2C), affected 20 other mangabeys of all age groups (Extended Data Fig. 1). In all affected animals, papulo-pustular lesions evolved to crusts and ultimately scabs (Extended Data Fig. 2). Overall, the disease swept through the group until the end of April 2023, resulting in 26 out of 80 (32.5%) mangabeys developing at least one visible skin lesion, and four deaths. Trained veterinarians wearing a complete set of personal protective equipment and following strict biosafety protocols performed on-site necropsies on three out of the four infants. The body of the fourth infant was never found.\u003c/p\u003e\n\u003cp\u003eTo confirm infection with MPXV, we first tested necropsy samples from the three infants and identified viral DNA in all major organs (Supplementary Table 1). We then performed a group-wide outbreak investigation by analyzing 170 faecal samples collected from the mangabeys during the outbreak window, defined as the period in which clinical signs were visible in the group (Extended Data Fig. 3 and Supplementary Table 2). We detected MPXV DNA in 36 faecal samples collected from 19 individuals (7 symptomatic and 12 asymptomatic, Fig. 3). Of these 19, 14 were mothers of symptomatic babies, and only six of them developed lesions (Supplementary Table 3). We did not detect MPXV in 89 faecal samples collected after clinical signs resolved. These findings show that MPXV caused disease in a large proportion of this group and may have infected an even larger pool of individuals subclinically, consistent with earlier observations in chimpanzees from TNP\u003csup\u003e13\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eTo reconstruct viral genomes and determine their relationships with MPXVs that previously emerged in this area, we applied hybridization capture coupled to high-throughput sequencing to both necropsy and faecal samples. This allowed us to assemble two complete genomes, from a necropsy sample collected on January 31\u003csup\u003est\u003c/sup\u003e 2023 (371x average depth of coverage) and a fecal sample collected on February 12\u003csup\u003eth\u003c/sup\u003e 2023 (22x). The two genomes were identical, and maximum-likelihood phylogenetic analyses placed them within the genetic diversity of clade IIa viruses, as close relatives to the other MPXVs from TNP (Fig. 4). This suggests that this outbreak was the result of a transmission event involving the same local reservoir(s).\u003c/p\u003e\n\u003cp\u003eMultiple species of squirrels (\u003cem\u003eFunisciurus\u0026nbsp;\u003c/em\u003esp., \u003cem\u003eHeliosciurus\u0026nbsp;\u003c/em\u003esp.) and other rodents, such as Gambian pouched rats (\u003cem\u003eCricetomys gambianus\u003c/em\u003e) and African dormice (\u003cem\u003eGraphiurus\u003c/em\u003e sp.) are suspected to be involved in the sylvatic maintenance of MPXV (reviewed in ref\u003csup\u003e8\u003c/sup\u003e). To investigate whether squirrels or other small terrestrial mammals could be a source of MPXV infection for the TNP non-human primates, we tested rodents and shrews trapped (n=694) or found dead (n=10) inside and around TNP between 2019 and 2024 (Supplementary Tables 4 and 5). We identified one MPXV-positive fire-footed rope squirrel found dead on November 3\u003csup\u003erd\u003c/sup\u003e 2022 – 12 weeks before the onset of the outbreak in the mangabeys, and approximately 3 km south of their territory (Extended Data Fig. 4). Due to the opportunistic nature of our sampling, we could not determine whether the squirrel died of MPXV infection or due to other causes (e.g. predation; necropsy report available in the Supplementary Information). All organs from the squirrel (n=15), as well as oral and nasal swabs, contained high viral loads, and we were able to isolate viable MPXV from the skin, lung, spleen and liver of the animal (Supplementary Table 5). We also sequenced the complete genome of this virus (114x from samples, 20x from the lung isolate) and found it to be identical to the MPXV genomes derived from the mangabey samples. Since the isolation of MPXV from a Thomas’s rope squirrel (\u003cem\u003eFunisciurus anerythrus\u003c/em\u003e) in 1978\u003csup\u003e17\u003c/sup\u003e, only relatively weak evidence has accumulated supporting African squirrels as natural hosts of MPXV\u003csup\u003e7,18,19\u003c/sup\u003e. Our findings considerably reinforce the hypothesis that fire-footed rope squirrels are natural hosts of MPXV. The exact same genomic MPXV variant was circulating in the local squirrel population in the weeks preceding the outbreak in the mangabeys, a first hint that squirrels may have served as the reservoir host.\u003c/p\u003e\n\u003cp\u003eWe then aimed at refining a plausible scenario of MPXV emergence. For this, we first tested 114 faecal samples collected from the mangabey group in the 16 weeks before the outbreak. We identified 10/114 MPXV positive faecal samples (detection rate 8.8%; 95% CI 4.8-15.9). MPXV DNA was present in faecal samples of seven mangabeys that were asymptomatic at the time of detection, including the mother of the first infant to show clinical signs (Fig. 3). Importantly, the three earliest positive samples were consecutively obtained from the same individual, on December 6\u003csup\u003eth\u003c/sup\u003e, 9\u003csup\u003eth\u003c/sup\u003e and 18\u003csup\u003eth\u003c/sup\u003e, 2022. Collectively, these results suggest that MPXV entered the group via this plausible index case and then circulated undetected in the group for nearly two months.\u003c/p\u003e\n\u003cp\u003eMangabeys are known to hunt small mammals, including in TNP. Reviewing available long-term behavioural data, we found a video recording from 2025 showing a mangabey catching a squirrel (Supplementary Video 1), and an older video from 2014 showing a mangabey feeding on a clearly identifiable fire-footed rope squirrel (Fig. 5 and Supplementary Video 2). To explore whether a fire-footed rope squirrel hunt may have been the source of this outbreak, we analyzed the mangabey diet before the outbreak by searching for prey DNA in the 78 earliest faecal samples of our collection (Supplementary Table 2). Using mammal-generic metabarcoding, we identified DNA sequences perfectly matching the mitogenome of the TNP fire-footed rope squirrel in two faecal samples (Supplementary Information). This demonstrates that these squirrels are not only part of the mangabey diet, but that group members fed on this species on at least two distinct occasions in the weeks before the outbreak. Even more strikingly, we found that one of the two samples containing squirrel DNA was also the first MPXV-positive faecal sample of the suspected index case (Fig. 3). The co-detection of squirrel and MPXV DNA in this faecal sample strongly hints at an exceptional case of real-time detection of a cross-species transmission event, which subsequently led to the group-wide MPXV outbreak. Based on all the accumulated evidence, we conclude that fire-footed rope squirrels serve as a reservoir of MPXV for wild nonhuman primates in TNP.\u003c/p\u003e\n\u003cp\u003eBushmeat remains an important source of protein in sub-Saharan Africa, including Côte d’Ivoire. In many regions, the recent decline of large-bodied mammals due to habitat destruction and hunting has induced a shift in consumption towards smaller animals, especially rodents\u003csup\u003e20,\u0026nbsp;21-23\u003c/sup\u003e. A study conducted in the villages bordering TNP has shown that while primates remain the most hunted taxa, rodents are also commonly traded and consumed\u003csup\u003e24\u003c/sup\u003e. Although larger rodents such as the giant pouched rat (\u003cem\u003eCricetomys\u0026nbsp;\u003c/em\u003esp.) and the marsh cane rat (\u003cem\u003eThryonomys swinderianus\u003c/em\u003e) are more frequently seen on markets, multiple species of squirrels are also sold and consumed, in both rural and urban areas\u003csup\u003e25\u003c/sup\u003e (unpublished data from N.Y.N., H.K. and S.G.-B.). It is also worth noting that, contrary to nonhuman primates who mainly rely on intact forest ecosystems, squirrels can thrive in fragmented habitats and plantations close to villages\u003csup\u003e26\u003c/sup\u003e. Upon re-analyzing a mammal-generic metabarcoding dataset derived from carrion flies collected along a gradient from pristine forest to the surrounding villages at the same site\u003csup\u003e27\u003c/sup\u003e, we only detected fire-footed rope squirrels in secondary forests and plantations, suggesting a higher presence of this species in these habitats (Supplementary Table 6). In such areas squirrels are commonly trapped by the local population, including children, and directly consumed (personal communication, N.Y.N. and S.G.-B.). Both subsistence hunting and bushmeat hunting, trade and consumption may result in MPXV transmission to humans.\u003c/p\u003e\n\u003cp\u003eResearch on the ecology, habitat use and population dynamics of fire-footed rope squirrels, as well as the dynamics of MPXV infections in these populations and their interactions with humans, will be key to assessing spillover risks from this species. Efforts aimed at identifying other small mammal species that may serve as natural hosts and reservoirs should also be continued, since the involvement of several host species is possible\u003csup\u003e28\u003c/sup\u003e. At the same time, MPXV genomic surveillance in humans in endemic areas remains the most abundant source of information on this virus’ diversity in its reservoir(s). For example, we observed that genomes published from human mpox cases caused by clade IIa MPXVs in Côte d’Ivoire in 2024, including two from a town ~80 km north of our study site, were not closely related to the ones circulating in TNP wildlife (Fig. 4). This confirms a large strain diversity, even at small spatial scales, and perhaps suggests geographic structure and evolution in distinct hosts, though further studies are needed to test this hypothesis conclusively. Importantly, a better understanding of MPXV ecology will inform local authorities in charge of public health, animal health, as well as protected areas and natural resources, and help them develop programs to assess and mitigate spillover risk. This might include campaigns to raise awareness about the general risks linked to bushmeat and initiatives to co-design measures specifically aimed at reducing contact with squirrels through subsistence hunting. The example of TNP shows (1) the direct link between a rodent reservoir and a spillover host and (2) that both may be sources of human infections, suggesting a focus on squirrel consumption alone would be misguided.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis study underscores the high value of long-term wildlife health monitoring\u003csup\u003e29,30\u003c/sup\u003e. While challenging to fund and implement, such projects have a unique ability to unveil interspecies transmission and zoonotic emergence in complex environments, and ultimately offer crucial insights for global public health.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eResearch was conducted under research permit numbers: 006/MESRS/DGRI (TCP 2022-2025), 461/MINEDD/OIPR/DT, 020/MESRS/DGRI and 007/ MESRS/DGRI (small terrestrial mammal trapping\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank the Minist\u0026egrave;re de l\u0026rsquo;Enseignement Sup\u0026eacute;rieur et de la Recherche Scientifique, the Minist\u0026egrave;re de Eaux et F\u0026ocirc;rets in Ivory Coast and the Office Ivoirien des Parcs et R\u0026eacute;serves for permitting the study. We are grateful to the Centre Suisse de Recherches Scientifiques en C\u0026ocirc;te d\u0026rsquo;Ivoire and the staff members of the Ta\u0026iuml; Chimpanzee Project for their support. We thank all primatologists, research assistants, field assistants, and veterinarians who collected samples for the Ta\u0026iuml; Chimpanzee project over the years. We acknowledge the contribution of Ars\u0026egrave;ne Mossoun, Valere Kouakou Kouam\u0026eacute;, Emmanuel Kemin Dian\u0026eacute;, Privat Gnabro Hugues, Assemian Krou Hermann, Koukou Youl Sie, Mathurin Yao Koffi, Mich\u0026egrave;le Dj\u0026ecirc; bi Tah, Fabrice Fernand Logou\u0026eacute;, Kamilla Anna Pl\u0026eacute;h, Jonas Steiner, and Olivia Dimov to the small mammal trapping in TNP. We are grateful to Manon Digoin Danzin for providing the video of the managbey catching a squirrel in TNP. This work was supported by the German Research Council Project LE1813/11-1 and LE1813/14-1 (Great Ape Health in Tropical Africa), the ARCUS Foundation grant G-PGM-2107-3516, the BIODIV-AFREID Project LE1813/17-1, the Heinrich B\u0026ouml;ll Stiftung PhD stipend to J.S., the Evolution of Brain Connectivity Project of the Max Planck Society (M.IF.EVAN8103). Research was conducted under research permit numbers: 006/MESRS/DGRI (TCP 2022-2025), 461/MINEDD/OIPR/DT, 020/MESRS/DGRI and 007/ MESRS/DGRI (small terrestrial mammal trapping).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData and samples from the outbreak were collected by C.R.-F., A.L.-M and the TCP field assistants and research assistants. Data and samples from the rodents in TNP were collected by L.L., L.K., J.S., M.J.S.J. \u0026nbsp;and H.R.H. The field investigations as well as diagnostic and research activities were coordinated by S.C.-S., A.D., L.V.P. and F.H.L. Molecular laboratory analyses were performed by C.R.-F, J.S., H.R.H., L.L., A.D. and L.V.P. Diet analyses were performed by C.R.-F and J.F.G. Virus isolation experiments and sequencing of the isolates were conducted by J.S., D.H., S.C., and coordinated by M.B. N.Y.N., H.K. and S.G.B. provided information on bushmeat consumption in C\u0026ocirc;te d\u0026rsquo;Ivoire. R.M.W., C.C., A.D. and F.H.L coordinated the mangabey field work and provided the behavioural data. J.F.G., A.M. and R.M.W provided the video. The data were analysed by C.R.-F., J.S., L.V.P. and S.C.-S. and the manuscript was drafted by C.R.-F., J.S., S.C.-S., L.V.P and F.H.L. The manuscript was revised and approved by all authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSupplementary Information is available for this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding author\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence and requests for materials should be addressed to Livia V. Patrono and Fabian H. Leendertz.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availablity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll sequences generated in this study are currently being submitted to the European Nucleotide Archive. Accession numbers will be provided before publication. In the meantime, we provide provisional access to all materials on Zenodo (https://zenodo.org/records/15111982).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eWHO. (https://www.who.int/europe/news/item/23-07-2022-who-director-general-declares-the-ongoing-monkeypox-outbreak-a-public-health-event-of-international-concern, 2022).\u003c/li\u003e\n\u003cli\u003eWHO. (https://www.who.int/news/item/14-08-2024-who-director-general-declares-mpox-outbreak-a-public-health-emergency-of-international-concern, 2024).\u003c/li\u003e\n\u003cli\u003eO\u0026apos;Toole, \u0026Aacute;.\u003cem\u003e et al.\u003c/em\u003e APOBEC3 deaminase editing in mpox virus as evidence for sustained human transmission since at least 2016. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e382\u003c/strong\u003e, 595-600 (2023). https://doi.org:10.1126/science.adg8116\u003c/li\u003e\n\u003cli\u003eKinganda-Lusamaki, E.\u003cem\u003e et al.\u003c/em\u003e Clade I mpox virus genomic diversity in the Democratic Republic of the Congo, 2018-2024: Predominance of zoonotic transmission. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e188\u003c/strong\u003e, 4-14 (2024). https://doi.org:10.1016/j.cell.2024.10.017\u003c/li\u003e\n\u003cli\u003eYinda, C. K.\u003cem\u003e et al.\u003c/em\u003e Genetic sequencing analysis of monkeypox virus clade I in Republic of the Congo: a cross-sectional, descriptive study. \u003cem\u003eLancet\u003c/em\u003e (2024). https://doi.org:10.1016/S0140-6736(24)02188-3\u003c/li\u003e\n\u003cli\u003eBangwen, E.\u003cem\u003e et al.\u003c/em\u003e Suspected and confirmed mpox cases in DR Congo: a retrospective analysis of national epidemiological and laboratory surveillance data, 2010-23. \u003cem\u003eLancet\u003c/em\u003e \u003cstrong\u003e405\u003c/strong\u003e, 408-419 (2025). https://doi.org:10.1016/S0140-6736(24)02669-2\u003c/li\u003e\n\u003cli\u003eHutson, C. L.\u003cem\u003e et al.\u003c/em\u003e Monkeypox zoonotic associations: insights from laboratory evaluation of animals associated with the multi-state US outbreak. \u003cem\u003eAm J Trop Med Hyg\u003c/em\u003e \u003cstrong\u003e76\u003c/strong\u003e, 757-768 (2007). \u003c/li\u003e\n\u003cli\u003eFalendysz, E. A., Lopera, J. G., Rocke, T. E. \u0026amp; Osorio, J. E. Monkeypox Virus in Animals: Current Knowledge of Viral Transmission and Pathogenesis in Wild Animal Reservoirs and Captive Animal Models. \u003cem\u003eViruses\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e (2023). https://doi.org:10.3390/v15040905\u003c/li\u003e\n\u003cli\u003eHaydon, D. T., Cleaveland, S., Taylor, L. H. \u0026amp; Laurenson, M. K. Identifying reservoirs of infection: a conceptual and practical challenge. \u003cem\u003eEmerg Infect Dis\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 1468-1473 (2002). https://doi.org:10.3201/eid0812.010317\u003c/li\u003e\n\u003cli\u003eMagnus, P. v., Andersen, E. K., Petersen, K. B. \u0026amp; Birch-Andersen, A. A POX-LIKE DISEASE IN CYNOMOLGUS MONKEYS. \u003cem\u003eActa Pathologica Microbiologica Scandinavica\u003c/em\u003e \u003cstrong\u003e46\u003c/strong\u003e, 156-176 (1959). https://doi.org:https://doi.org/10.1111/j.1699-0463.1959.tb00328.x\u003c/li\u003e\n\u003cli\u003eWittig, R. M. in \u003cem\u003eEncyclopedia of Animal Cognition and Behavior\u003c/em\u003e (eds Jennifer Vonk \u0026amp; Todd Shackelford) 1-7 (Springer International Publishing, 2017).\u003c/li\u003e\n\u003cli\u003eRadonic, A.\u003cem\u003e et al.\u003c/em\u003e Fatal monkeypox in wild-living sooty mangabey, Cote d\u0026apos;Ivoire, 2012. \u003cem\u003eEmerg Infect Dis\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 1009-1011 (2014). https://doi.org:10.3201/eid2006.13-1329\u003c/li\u003e\n\u003cli\u003ePatrono, L. V.\u003cem\u003e et al.\u003c/em\u003e Monkeypox virus emergence in wild chimpanzees reveals distinct clinical outcomes and viral diversity. \u003cem\u003eNat Microbiol\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 955-965 (2020). https://doi.org:10.1038/s41564-020-0706-0\u003c/li\u003e\n\u003cli\u003eWittig, R. \u0026amp; Boesch, C. in \u003cem\u003eThe Chimpanzees of the Ta\u0026iuml; Forest: 40 Years of Research\u003c/em\u003e (eds Christophe Boesch \u0026amp; Roman Wittig) 44-57 (Cambridge University Press, 2019).\u003c/li\u003e\n\u003cli\u003eHoffmann, C.\u003cem\u003e et al.\u003c/em\u003e Persistent anthrax as a major driver of wildlife mortality in a tropical rainforest. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e548\u003c/strong\u003e, 82-86 (2017). https://doi.org:10.1038/nature23309\u003c/li\u003e\n\u003cli\u003eLeendertz, F. H.\u003cem\u003e et al.\u003c/em\u003e Pathogens as drivers of population declines: The importance of systematic monitoring in great apes and other threatened mammals. \u003cem\u003eBiological Conservation\u003c/em\u003e \u003cstrong\u003e131\u003c/strong\u003e, 325-337 (2006). https://doi.org:10.1016/j.biocon.2006.05.002\u003c/li\u003e\n\u003cli\u003eKhodakevich, L., Jezek, Z. \u0026amp; Kinzanzka, K. Isolation of monkeypox virus from wild squirrel infected in nature. \u003cem\u003eLancet\u003c/em\u003e \u003cstrong\u003e1\u003c/strong\u003e, 98-99 (1986). https://doi.org:10.1016/s0140-6736(86)90748-8\u003c/li\u003e\n\u003cli\u003eTiee, M. S., Harrigan, R. J., Thomassen, H. A. \u0026amp; Smith, T. B. Ghosts of infections past: using archival samples to understand a century of monkeypox virus prevalence among host communities across space and time. \u003cem\u003eR Soc Open Sci\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 171089 (2018). https://doi.org:10.1098/rsos.171089\u003c/li\u003e\n\u003cli\u003eCuraudeau, M.\u003cem\u003e et al.\u003c/em\u003e Identifying the Most Probable Mammal Reservoir Hosts for Monkeypox Virus Based on Ecological Niche Comparisons. \u003cem\u003eViruses\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e (2023). https://doi.org:10.3390/v15030727\u003c/li\u003e\n\u003cli\u003eDuda, R.\u003cem\u003e et al.\u003c/em\u003e A time of decline: An eco-anthropological and ethnohistorical investigation of mpox in the Central African Republic. \u003cem\u003ePLOS Glob Public Health\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, e0002937 (2024). https://doi.org:10.1371/journal.pgph.0002937\u003c/li\u003e\n\u003cli\u003eGonedel\u0026eacute; Bi, S.\u003cem\u003e et al.\u003c/em\u003e Bushmeat hunting around a remnant coastal rainforest in C\u0026ocirc;te d\u0026apos;Ivoire. \u003cem\u003eOryx\u003c/em\u003e \u003cstrong\u003e51\u003c/strong\u003e, 418-427 (2017). https://doi.org:10.1017/S0030605315001453\u003c/li\u003e\n\u003cli\u003eGonedel\u0026eacute;-Bi, S.\u003cem\u003e et al.\u003c/em\u003e Year-round longitudinal monitoring of a bushmeat market in central-western C\u0026ocirc;te d\u0026rsquo;Ivoire: Implication for wildlife conservation. \u003cem\u003eJournal for Nature Conservation\u003c/em\u003e \u003cstrong\u003e70\u003c/strong\u003e, 126297 (2022). https://doi.org:https://doi.org/10.1016/j.jnc.2022.126297\u003c/li\u003e\n\u003cli\u003eFA, J. E. \u0026amp; BROWN, D. Impacts of hunting on mammals in African tropical moist forests: a review and synthesis. \u003cem\u003eMammal Review\u003c/em\u003e \u003cstrong\u003e39\u003c/strong\u003e, 231-264 (2009). https://doi.org:https://doi.org/10.1111/j.1365-2907.2009.00149.x\u003c/li\u003e\n\u003cli\u003eBachmann, M. E.\u003cem\u003e et al.\u003c/em\u003e Saving rodents, losing primates\u0026mdash;Why we need tailored bushmeat management strategies. \u003cem\u003ePeople and Nature\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 889-902 (2020). https://doi.org:https://doi.org/10.1002/pan3.10119\u003c/li\u003e\n\u003cli\u003eGoss\u0026eacute;, K. J.\u003cem\u003e et al.\u003c/em\u003e DNA-typing surveillance of the bushmeat in C\u0026ocirc;te d\u0026apos;Ivoire: a multi-faceted tool for wildlife trade management in West Africa. \u003cem\u003eConservation Genetics\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 1073-1088 (2022). https://doi.org:10.1007/s10592-022-01474-2\u003c/li\u003e\n\u003cli\u003eCassola, F. \u003cem\u003eThe IUCN Red List of Threatened Species\u003c/em\u003e, (2016).\u003c/li\u003e\n\u003cli\u003eJahan, M.\u003cem\u003e et al.\u003c/em\u003e Fly iDNA suggests strict reliance of the causative agent of sylvatic anthrax on rainforest ecosystems. \u003cem\u003eEnvironmental DNA\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, e401 (2024). https://doi.org:https://doi.org/10.1002/edn3.401\u003c/li\u003e\n\u003cli\u003eReynolds, M. G.\u003cem\u003e et al.\u003c/em\u003e A silent enzootic of an orthopoxvirus in Ghana, West Africa: evidence for multi-species involvement in the absence of widespread human disease. \u003cem\u003eAm J Trop Med Hyg\u003c/em\u003e \u003cstrong\u003e82\u003c/strong\u003e, 746-754 (2010). https://doi.org:10.4269/ajtmh.2010.09-0716\u003c/li\u003e\n\u003cli\u003ePetrone, M. E., Holmes, E. C. \u0026amp; Harvey, E. Through an ecological lens: An ecosystem-based approach to zoonotic risk assessment: An ecosystem-based approach to zoonotic risk assessment. \u003cem\u003eEMBO Rep\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, e56578 (2023). https://doi.org:10.15252/embr.202256578\u003c/li\u003e\n\u003cli\u003eGogarten, J. F.\u003cem\u003e et al.\u003c/em\u003e An ounce of prevention is better : Monitoring wildlife health as a tool for pandemic prevention. \u003cem\u003eEMBO Rep\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 2819-2831 (2024). https://doi.org:10.1038/s44319-024-00156-z\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eHealth monitoring and sampling.\u0026nbsp;\u003c/strong\u003eTa\u0026iuml; National Park (TNP), Ivory Coast, is the largest remaining primary rainforest in Western Africa. Its wild populations of non-human primates (NHP) have been studied by the Ta\u0026iuml; Chimpanzee Project (TCP) since 1979\u003csup\u003e31\u003c/sup\u003e. TCP established a veterinary programme from 2001 onwards\u003csup\u003e13\u003c/sup\u003e. This veterinary programme conducts wildlife mortality surveillance and health monitoring of the four neighbouring groups of chimpanzees and one group of sooty mangabeys that are habituated to human observers. The mangabey group (named the Audrenisrou group) was habituated in November 2012\u003csup\u003e32\u003c/sup\u003e, and at the time of the outbreak consisted of about 80 individuals. The habituated groups are followed daily by trained field assistants and research staff. Names are given to each habituated individual. Newborns are given a temporary name indicating that they are the infant (BB) of a certain individual (e.g. BB-Atacama indicates the newborn of Atacama). Behavioural data, as well as faecal and urine samples, are routinely collected from all the adults of the group. Faecal samples are collected with a plastic spatula right after defecation occurs and stored in 2 mL cryotubes. Urine is collected with fine Pasteur pipettes from underlying vegetation once the animals urinate from a higher position, and is stored in 2 mL cryotubes. These samples are preserved in liquid nitrogen in the field, transported to Germany in dry ice and then stored at -80\u0026deg;C until further analysis. When clinical signs are observed in the groups, observations and sampling are intensified. During this MPXV outbreak faecal samples were collected in both dry 2 mL cryotubes and in cryotubes containing nucleic acid preserving (NAP) buffer from most individuals of the group belonging to all age categories (infants, juveniles, subadults and adults), and from both symptomatic and asymptomatic individuals. Faecal samples are difficult to collect from infants, therefore the number of these samples is lower than other age classes. It is also important to note that in 2022 a significant number of male juveniles immigrated to the Audrenisrou group, and many births occurred, leading to an increase in the total population to 80 individuals. To obtain an overview of viral DNA shedding in the mangabey group, we tested faecal samples from three key time periods: from four months prior to the first observations of clinical signs (October 1\u003csup\u003est\u003c/sup\u003e 2022 - January 26\u003csup\u003eth\u003c/sup\u003e 2023), during the outbreak (January 27\u003csup\u003eth\u003c/sup\u003e 2023 - April 26\u003csup\u003eth\u003c/sup\u003e 2023), and up to four months after the last symptoms were observed (April 27\u003csup\u003eth\u003c/sup\u003e 2023 - August 24\u003csup\u003eth\u003c/sup\u003e 2023). A total of 444 faecal samples were tested for MPXV, including those from just before (n = 114), during (n = 170) and after (n = 89) the mpox outbreak in the mangabey group. Details are provided in Supplementary Table 2. The veterinary team of TCP also performs necropsies on all animals found dead within the research area. Necropsies are done by trained veterinarians wearing full personal protective equipment. All used materials are incinerated or disinfected with 1% sodium hypochlorite solution and the carcasses are buried, according to the World Health Organization guidelines. Samples are collected from all inner organs when carcass decomposition is not too advanced, and stored in 2 mL cryotubes, both empty and filled with NAP buffer. The cryotubes are then preserved in liquid nitrogen in the field, transported to Germany in dry ice, and stored at -80\u0026deg;C until further analysis. In this study we included 88 necropsy samples from 23 carcasses representing 11 species (and 4 species for which taxonomic assignment was not possible) collected between 2019 and 2024. Further details are provided in Supplementary Tables 1 and 5.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSmall terrestrial mammal trapping inside and around TNP.\u0026nbsp;\u003c/strong\u003eRodents and shrews were trapped using Sherman, Havahart-style or 0.5 m cage traps and were anesthetized using a combination of Ketamine (mouse dose 50 mg/Kg, rats dose 35 mg/Kg, Medistar\u0026reg;) and Xylazine (mouse dose 5 mg/Kg, rat dose 3,5 mg/Kg, WDT\u0026reg;) intramuscularly. Once anesthetized, the animals were measured, weighted and sampled. After sampling, the animals were marked and placed in an individual box until full recovery was observed. Anesthetized animals were monitored closely and in some cases Antisedan (5 mg/Kg, Vetoquinol\u0026reg;) was administered intramuscularly to facilitate recovery. Saline solution was sometimes applied as a subcutaneous infusion to prevent dehydration and applied on the eyes to prevent from drying. After recovery, the animals were released where they were caught. From July to November 2021 and March to April 2023, 173 rodents were trapped within the territory of the mangabey group. From these two field missions, we collected 167 oral swabs, 167 rectal swabs, 23 nasal swabs, 133 faecal samples and 39 samples from skin lesions. Eight individuals died in the trap or succumbed to anaesthetisation, and one was euthanized because of signs of extreme weakness. In these cases, necropsies were performed and samples were collected from all major organs. All samples were stored in 2 mL cryotubes dry or with NAP buffer, frozen in liquid nitrogen in the field, transported in dry ice to Germany and then kept at -80\u0026deg;C. From these trapping missions, a total of 553 samples, including different tissues and swabs were tested for orthopoxviruses (OPV). We also made use of samples originating from a broader initiative aimed at characterizing the biodiversity of small mammals and related pathogens\u0026nbsp;along a gradient spanning from three villages bordering TNP on the West to the pristine forest in the immediate vicinity of the sooty mangabey territory. We set traps along three parallel transects of ~9 km covering \u0026nbsp; distinct environments: (i) anthropic/domestic (inside houses), (ii) at the village periphery, (iii) at the edge between cultivated fields and the national park, and (iv) in the pristine forest of the national park. Sampling was performed\u0026nbsp;from July to September 2021 and April to May 2022.\u0026nbsp;In total, 521 rodents and shrews were trapped and sampled (as mentioned above), of which 79 were euthanised and underwent a full necropsy. Oral and rectal swabs were stored in\u0026nbsp;2 mL tubes with NAP buffer at room temperature until transport to Abidjan where they were stored at -20\u0026deg;C. Necropsy samples were stored in\u0026nbsp;2 mL cryotubes and immediately frozen in liquid nitrogen. Samples were transported to Germany on dry ice and then stored at -80\u0026deg;C (necropsies) or -20\u0026deg;C (swabs in NAP buffer). From this sample set, we tested 521 oral swabs, 257 rectal swabs, and different organs from the 79 necropsies.\u0026nbsp;\u003cem\u003eIn toto\u003c/em\u003e,\u0026nbsp;1035 samples from different tissues and swabs were tested for OPV. Details regarding the sampled animals are provided in Supplementary Table 4.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDNA extraction and orthopoxvirus DNA detection.\u0026nbsp;\u003c/strong\u003eNucleic acids were extracted from 40 mg of faecal matter using the GeneMATRIX Stool DNA Purification Kit (Roboklon, Poland). For the necropsy samples, 20 mg of tissue were used for DNA extraction with the DNeasy Blood and Tissue kit (Qiagen, Germany) or QIAamp Viral RNA Mini Kit (Qiagen). Nucleic acids from virus isolates were extracted using the NucleoMag VET Kit (Macherey-Nagel, Germany)\u0026nbsp;and with the RNAdvance Tissue Kit (Beckman Coulter, USA). DNA extracted from faecal and necropsy samples (excluding rodents) was tested for MPXV in duplicates with a TaqMan Real-time quantitative PCR (qPCR) targeting G2R loci of monkeypoxviruses\u003csup\u003e33\u003c/sup\u003e. Rodent DNA extracts (including the DNA extracts from trapped rodents and necropsies) were tested in duplicate for orthopoxviruses using a TaqMan Real-time PCR targeting the P4A gene\u003csup\u003e34\u003c/sup\u003e and the positive extracts were tested with the MPXV qPCR\u003csup\u003e\u0026nbsp;\u003c/sup\u003ementioned above. A confirmatory PCR targeting a 270-bp fragment of the hemagglutinin (HA) gene of OPVs\u003csup\u003e35\u003c/sup\u003e was performed for all the extracts that had weakly positive results in the MPXV or OPV qPCRs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVirus isolation.\u003c/strong\u003e Virus isolation was attempted from 13 faecal samples (12 from the mangabeys, 1 from the fire-footed rope squirrel), 13 tissue samples, and maggots from two necropsies. Skin, lung, and spleen were tested for each mangabey necropsy, as well as a maggot from one individual. The squirrel samples tested encompassed skin, lung, spleen, liver, faeces, and maggots. The samples were added to cell culture medium with 10% foetal bovine serum supplemented with penicillin/streptomycin (Gibco, USA) and gentamicin/amphotericin (Gibco), bead homogenised on a bead ruptor, and incubated over night at 8\u0026deg;C. Sample homogenate was filtered through a 0.8\u0026micro;m pore membrane to remove larger particles and potential contaminating bacteria. The filtrate was added to confluent layers of MA-104 cells, and cultivated with the aforementioned antibiotic-supplemented medium in 12.5cm\u0026sup2; rectangular canted neck cell culture flasks. Cell cultures were passaged after three days. If a cytopathic effect was visible, cells were passaged further to increase the viral titre for shotgun sequencing.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHybridization capture and high-throughput sequencing.\u0026nbsp;\u003c/strong\u003eIllumina-compatible dual index\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003elibraries were generated from up to 1000 ng of DNA extracts from necropsies and four mangabey faecal samples (details provided in Supplementary Tables 1, 2 and 5). Faecal samples were selected based on viral copy number. DNA was fragmented in 50 \u0026micro;l of low EDTA-TE buffer using a Covaris ME220 Focused-ultrasonicator (Covaris, USA) set for a target fragment-size of 350bp (settings: treatment duration 45 s, peak power 50, duty factor 20%, 1000 cycles per burst, average power 10, temperature 20 \u0026deg;C). Libraries were built from the fragmented DNA using the NEBNext Ultra II DNA kit following the manufacturer\u0026rsquo;s recommendations. After the adapter ligation, a 300 \u0026ndash; 400 bp size selection using MagSi magnetic beads (Carl Roth, Germany) was performed where the input was higher than 50 ng of total DNA. Quantification of the final libraries was performed using the Kapa HiFi Library Quantification Kit (Roche, Switzerland) or the NEBNext Library Quant Kit for Illumina (New England Biolabs, USA). Libraries were stored at -20\u0026deg;C until further use.\u0026nbsp;All libraries underwent MPXV target enrichment through in-solution hybridization capture with a previously described orthopoxvirus bait set\u003csup\u003e10\u003c/sup\u003e. We used myBaits\u0026reg; RNA baits following the myBaits\u0026reg; Sequence Enrichment for Targeted Sequencing protocol (Version 5.0; Daicel Arbor Biosciences) and applied 2 successive rounds of 24h hybridization capture. Additionally, one round of 24h 65\u0026deg;C hybridization capture targeting the mitochondrial genome of rodents was performed on a library of the squirrel spleen. To design these custom baits, all complete mitochondrial genomes of rodents available on GenBank were accessed and redundancies were reduced by clustering genomes using CD-HIT30 at a minimum of 88% sequence identity. Final bait design was based on the resulting 239 accession numbers. For capture, only a quarter of the recommended bait quantity was used. Following each round of capture, the hybridized library pools were amplified using the KAPA HotStart Library Amplification Kit (Roche) to obtain a minimum of 200 ng total DNA per library pool. After final quantification using the Kapa HiFi Library Quantification Kit (Roche) or the NEBNext Library Quant Kit for Illumina, the enriched pools were diluted to the recommended concentrations. Sequencing was performed on a MiniSeq platform (Illumina, USA) using the V3 chemistry (MiniSeq High output Kit for 75 or 150 cycles). For whole genome sequencing of MPXV from cell cultures, we generated libraries from isolates from two mangabey skin samples and from the squirrel lung using the Rapid-Barcoding Kit V14 (Oxford Nanopore Technologies, United Kingdom) and sequenced them directly on a PromethION 2 solo platform (Oxford Nanopore Technologies) using R10.4.1 PromethION flow cells. Basecaller v4.3.0 was set to super-accurate basecalling v4.3.0, 400 bps.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSequencing data analyses.\u0026nbsp;\u003c/strong\u003eReads from different tissues of the same individual were merged to improve viral genome coverage.\u0026nbsp;Raw sequencing reads were quality-filtered using trimmomatic v0.39\u003csup\u003e36\u003c/sup\u003e using the settings: LEADING:30 TRAILING:30 SLIDINGWINDOW:4:30 MINLEN:30. Filtered reads were then mapped to the most recent MPXV genome from TNP (GenBank accession number MN346702) using BWA MEM v0.7.17-r1188\u003csup\u003e37\u003c/sup\u003e. Mapped reads were sorted and duplicates removed using SortSam and MarkDuplicates by Picard v2.13.3 (http://broadinstitute.github.io/picard/). In parallel, paired reads were mapped to the reference genome in Geneious Prime 2023.1.2 (https://www.geneious.com) using default settings to improve coverage of inverted terminal repeats regions of the MPXV genome. Consensus sequences were generated from the reference based mapping pipeline and the Geneious mapper and checked manually for concordance. \u0026nbsp;Base calling was set to a minimum of 20 reads and 95% agreement. For samples where we obtained a shallow coverage, consensus sequences were called when two or more reads were present. Nearly complete viral genomes (excluding the ITRs) used for phylogenetic analyses were assembles from the reference based mapping. The complete mitochondrial genome of the squirrel was de-novo assembled from quality-filtered reads using SPAdes v3.13.0\u003csup\u003e38\u003c/sup\u003e. Oxford Nanopore reads were quality trimmed using BBDUK with the following settings: qtrim=rl trimq=6 minlength=50 ordered=t qin=33 (BBMap - Bushnell B. - sourceforge.net/projects/bbmap) and de novo assembled using Flye v2.9.2\u003csup\u003e39\u003c/sup\u003e (flags --nano-hq; --genome-size 200k). The entire dataset was then re-mapped against the initially generated sequence through Minimap2 v2.17\u003csup\u003e40\u003c/sup\u003e (ONT mode; including secondary alignments; maximum secondary alignments per read = 5; minimum secondary to primary alignment ratio = 0.8).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePhylogenetic analyses.\u003c/strong\u003e A dataset representing the current known MPXV clade IIa diversity was assembled from publicly available data on GenBank and GISAID\u003csup\u003e41\u003c/sup\u003e. For identical sequences originating from the same outbreak only one representative genome was selected. We also included partial genomes from C\u0026ocirc;te d\u0026rsquo;Ivoire and Liberia from 2024. After evaluating the C\u0026ocirc;te d\u0026rsquo;Ivoire sequences through Nextclade v3.12.036\u003csup\u003e42\u003c/sup\u003e quality control (https://clades.nextstrain.org/), we identified three high quality genomes, which we included in our analysis. Furthermore, two genomes of lower quality were added due to their origin in geographic proximity to TNP. This dataset plus one representative MPXV genome per species from the TNP 2022/2023 outbreak (n=28) were aligned using MAFFT v7.505n\u003csup\u003e43\u003c/sup\u003e. Gblocks v0.91b was run in SeaView v5 on stringent settings to not allow for many continuous nonconserved positions\u003csup\u003e44\u003c/sup\u003e. Identical sites, ambiguities and gaps were removed in Geneious, so only variable sites were included in phylogenetic analysis (534 bases). The best fitting model of nucleotide evolution was identified using Modelfinder\u003csup\u003e45\u003c/sup\u003e with ascertainment bias correction as implemented in IQ-TREE v1.6.12\u003csup\u003e46,47\u003c/sup\u003e. A maximum likelihood phylogeny was reconstructed on IQ-TREE and branch robustness was assessed by ultrafast bootstrapp (1000 replicates)\u003csup\u003e\u0026nbsp;48\u003c/sup\u003e. The best-fitting root of the resulting tree was identified in TempEst v1.5.3\u003csup\u003e49\u003c/sup\u003e and further tree visualisation and editing was done in iTOL v7.1 (https://itol.embl.de/)\u003csup\u003e50\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDiet analysis.\u0026nbsp;\u003c/strong\u003eThe mangabey\u0026rsquo;s diet was analysed using a metabarcoding approach. The faecal samples used in this particular study (n=78) were collected just before the mpox outbreak started in the mangabey group (01.10.2022-30.12.2022).\u0026nbsp;We used the Tagsteady protocol\u003csup\u003e7\u003c/sup\u003e. A\u0026nbsp;first PCR assay targeting a 130bp fragment of the 16S mitochondrial DNA was performed with tagged 16S mam1 (16Smam1 5\u0026prime;‐CGGTTGGGGTGACCTCGGA‐3\u0026prime;) and 16S mam2 (5\u0026prime;‐GCTGTTATCCCTAGGGTAACT‐3\u0026prime;) primers to identify each sample individually. This PCR was performed with the addition of human blocking primer (16Smam_blkhum 5\u0026prime;‐CGGTTGGGGCG ACCTCGGAGCAGAACCC-3\u0026rsquo;) to reduce the amplification of contaminant human DNA. A total volume of 25 ul was used for each reaction, which included 2 ul of DNA template.\u0026nbsp;The cycling parameters were set as follows: 95\u0026deg;C for 10 min, 35 cycles of 95\u0026deg;C for 12 s, 59\u0026deg;C for 30 s, 70\u0026deg;C for 25 s, and 72\u0026deg;C for 7 min.\u0026nbsp;Subsequently, we generated three pools comprising all positive samples together with the positive and negative controls from the same PCR plate (three plates with one replicate each; 262 amplicons in total). After end repair, we indexed the pools by ligation with Illumina full-length Y-adapters that carried dual matching indexes (P5-P7)\u003csup\u003e\u0026nbsp;51\u003c/sup\u003e. The indexed pools were sequenced on an Illumina iSeq 100 System.\u0026nbsp;To analyse the resulting reads, we first assembled a reference database from the EMBL collection of vertebrate sequences (downloaded on July 10\u003csup\u003eth\u003c/sup\u003e, 2024) on which we performed an in-silico PCR with the OBItools (v3.0.1b21) \u003cem\u003eecopcr\u003c/em\u003e command, allowing up to three mismatches between the primer and the reference sequences. We sorted the reads generated from the diet analysis to their respective PCR replicate using their 5\u0026rsquo; nucleotide tags using OBItools and removed primer sequences. Paired-end reads were then merged using the OBItools \u003cem\u003eIlluminapairedend\u003c/em\u003e command keeping only reads with \u0026gt;0.8 alignment quality score and a length \u0026gt;80bp. Sequence variants were then collapsed with the \u003cem\u003eobiclean\u003c/em\u003e command, but retaining a count of their appearance in each PCR replicate. We then compared the resulting aligned reads with our reference database to try to assign taxons by using the OBItools \u003cem\u003e\u003cu\u003eecotag\u003c/u\u003e\u003c/em\u003e command. To consider a wildlife species detection event genuine, we required that at least two of the three replicates contained at least two times the maximum number of reads assigned a taxonomy in the negative controls. We also used Geneious to competitively map the trimmed reads to the mitogenome we generated from the squirrel spleen, as well as a human (NC_012920), chimpanzee (KU308547), and mangabey (NC_028592) mitogenomes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRe-analyses of fly data.\u0026nbsp;\u003c/strong\u003eTo investigate the distribution of fire-footed rope squirrels and sooty mangabeys along a local ecological gradient, we reanalysed a recently published mammal metabarcoding dataset derived from fly DNA\u003csup\u003e27\u003c/sup\u003e. To do this, we applied the same bioinformatics approaches used for faecal diet analyses to the 100 datasets (25 from the forest, 50 from the edge, 25 from villages) produced by this study (doi: 10.5281/zenodo.7688127).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods references\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e31\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Boesch, C. \u0026amp; Boesch-Achermann, H. \u003cem\u003eThe chimpanzees of the Ta\u0026iuml; Forest: Behavioural ecology and evolution\u003c/em\u003e. \u0026nbsp;(Oxford university press, 2000).\u003c/p\u003e\n\u003cp\u003e32\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Gogarten, J. F.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Factors influencing bacterial microbiome composition in a wild non-human primate community in Ta\u0026iuml; National Park, C\u0026ocirc;te d\u0026rsquo;Ivoire. \u003cem\u003eThe ISME journal\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 2559-2574 (2018).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e33\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Li, Y., Zhao, H., Wilkins, K., Hughes, C. \u0026amp; Damon, I. K. Real-time PCR assays for the specific detection of monkeypox virus West African and Congo Basin strain DNA. \u003cem\u003eJournal of virological methods\u003c/em\u003e \u003cstrong\u003e169\u003c/strong\u003e, 223-227 (2010).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e34\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Schroeder, K. \u0026amp; Nitsche, A. Multicolour, multiplex real-time PCR assay for the detection of human-pathogenic poxviruses. \u003cem\u003eMolecular and cellular probes\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 110-113 (2010).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e35\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Kurth, A.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Rat-to-elephant-to-human transmission of cowpox virus. \u003cem\u003eEmerging infectious diseases\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 670 (2008).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e36\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Bolger, A. M., Lohse, M. \u0026amp; Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. \u003cem\u003eBioinformatics\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 2114-2120 (2014).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e37\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Li, H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. \u003cem\u003earXiv preprint arXiv:1303.3997\u003c/em\u003e (2013).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e38\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Prjibelski, A., Antipov, D., Meleshko, D., Lapidus, A. \u0026amp; Korobeynikov, A. Using SPAdes de novo assembler. \u003cem\u003eCurrent protocols in bioinformatics\u003c/em\u003e \u003cstrong\u003e70\u003c/strong\u003e, e102 (2020).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e39\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Kolmogorov, M., Yuan, J., Lin, Y. \u0026amp; Pevzner, P. A. Assembly of long, error-prone reads using repeat graphs. \u003cem\u003eNature Biotechnology\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e, 540-546 (2019). https://doi.org:10.1038/s41587-019-0072-8\u003c/p\u003e\n\u003cp\u003e40\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Li, H. Minimap2: pairwise alignment for nucleotide sequences. \u003cem\u003eBioinformatics\u003c/em\u003e \u003cstrong\u003e34\u003c/strong\u003e, 3094-3100 (2018). https://doi.org:10.1093/bioinformatics/bty191\u003c/p\u003e\n\u003cp\u003e41\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Khare, S.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e GISAID\u0026rsquo;s role in pandemic response. \u003cem\u003eChina CDC weekly\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 1049 (2021).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e42\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Aksamentov, I., Roemer, C., Hodcroft, E. B., \u0026amp; Neher, R. A. Nextclade: clade assignment, mutation calling and quality control for viral genomes. \u003cem\u003eJournal of Open Source Software\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 3773 (2021).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e43\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Katoh, K. \u0026amp; Standley, D. M. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. \u003cem\u003eMolecular biology and evolution\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 772-780 (2013).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e44\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Gouy, M., Tannier, E., Comte, N. \u0026amp; Parsons, D. P. in \u003cem\u003eMultiple Sequence Alignment: Methods and Protocols\u003c/em\u003e\u0026nbsp; \u0026nbsp;(ed Kazutaka Katoh) \u0026nbsp;241-260 (Springer US, 2021).\u003c/p\u003e\n\u003cp\u003e45\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Kalyaanamoorthy, S., Minh, B. Q., Wong, T. K. F., von Haeseler, A. \u0026amp; Jermiin, L. S. \u003cem\u003eModelFinder: fast model selection for accurate phylogenetic estimates\u003c/em\u003e. Vol. 14 (2017).\u003c/p\u003e\n\u003cp\u003e46\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Trifinopoulos, J., Nguyen, L.-T., von Haeseler, A. \u0026amp; Minh, B. Q. W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. \u003cem\u003eNucleic Acids Research\u003c/em\u003e \u003cstrong\u003e44\u003c/strong\u003e, W232-W235 (2016). https://doi.org:10.1093/nar/gkw256\u003c/p\u003e\n\u003cp\u003e47\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Nguyen, L. T., Schmidt, H. A., von Haeseler, A. \u0026amp; Bui, M. Q. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. \u003cem\u003eMolecular biology and evolution\u003c/em\u003e \u003cstrong\u003e32\u003c/strong\u003e, 268-274 (2015).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e48\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Hoang, D. T., Chernomor, O., von Haeseler, A., Minh, B. Q. \u0026amp; Vinh, L. S. UFBoot2: Improving the Ultrafast Bootstrap Approximation. \u003cem\u003eMolecular Biology and Evolution\u003c/em\u003e \u003cstrong\u003e35\u003c/strong\u003e, 518-522 (2017). https://doi.org:10.1093/molbev/msx281\u003c/p\u003e\n\u003cp\u003e49\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Rambaut, A., Lam, T. T., Max Carvalho, L. \u0026amp; Pybus, O. G. Exploring the temporal structure of heterochronous sequences using TempEst (formerly Path-O-Gen). \u003cem\u003eVirus Evolution\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e (2016). https://doi.org:10.1093/ve/vew007\u003c/p\u003e\n\u003cp\u003e50\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Letunic, I. \u0026amp; Bork, P. Interactive Tree of Life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool. \u003cem\u003eNucleic Acids Research\u003c/em\u003e \u003cstrong\u003e52\u003c/strong\u003e, W78-W82 (2024). https://doi.org:10.1093/nar/gkae268\u003c/p\u003e\n\u003cp\u003e51\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Car\u0026oslash;e, C. \u0026amp; Bohmann, K. Tagsteady: A metabarcoding library preparation protocol to avoid false assignment of sequences to samples. \u003cem\u003eMolecular Ecology Resources\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 1620-1631 (2020).\u0026nbsp;\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6322223/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6322223/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMpox, caused by the monkeypox virus (MPXV; \u003cem\u003eOrthopoxvirus monkeypox\u003c/em\u003e), is on the rise in West and Central Africa. Most outbreaks are short-lived, but MPXV has recently caused larger epidemics driven by sustained human-to-human transmission. It is widely accepted that mpox outbreaks originate in zoonotic events. African rodents, especially squirrels, are suspected to be involved in MPXV emergence, but no formal link to human or nonhuman primate outbreaks has been established. Here, we describe an outbreak of MPXV in a group of wild sooty mangabeys (\u003cem\u003eCercocebus atys\u003c/em\u003e) in Taï National Park (Côte d’Ivoire). The outbreak affected one third of the group between January and April 2023, killing four infants. To track its origin, we analysed rodents and wildlife carcasses from the region. We identified a MPXV-infected fire-footed rope squirrel (\u003cem\u003eFunisciurus pyrropus\u003c/em\u003e), found dead 3 km from the mangabey territory 12 weeks before the outbreak. MPXV genomes from the squirrel and the mangabey were identical. To establish a potential link between these species, we investigated the diet of these mangabeys. We found one video record of consumption of the same squirrel species in 2014. In addition, we performed metabarcoding analyses of faecal samples collected from mangabeys in the four months prior to the outbreak, which identified two faecal samples containing the DNA of the fire-footed rope squirrel. One of these samples was also the first positive for MPXV in the mangabey group. This represents an exceptionally rare case of direct detection of an interspecies transmission event, made possible only by long-term health monitoring. Our findings strongly suggest rope squirrels were the source of the MPXV outbreak in mangabeys. Since squirrels and nonhuman primates are hunted, traded, and consumed by humans in West and Central Africa, exposure to these animals is likely responsible for at least a fraction of human mpox outbreaks.\u003c/p\u003e","manuscriptTitle":"Fire-footed rope squirrels (Funisciurus pyrropus) are a reservoir host of monkeypox virus (Orthopoxvirus monkeypox)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-08 08:56:31","doi":"10.21203/rs.3.rs-6322223/v1","editorialEvents":[],"status":"published","journal":{"display":false,"email":"
[email protected]","identity":"nature","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"nature","sideBox":"Learn more about [Nature](http://www.nature.com/nature/)","snPcode":"","submissionUrl":"","title":"Nature","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"fba1d96d-4519-4c04-9597-e180235a5c92","owner":[],"postedDate":"April 8th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":46380587,"name":"Biological sciences/Microbiology/Virology/Viral transmission"},{"id":46380588,"name":"Health sciences/Diseases/Infectious diseases/Viral infection"},{"id":46380589,"name":"Biological sciences/Ecology/Ecological epidemiology"},{"id":46380590,"name":"Biological sciences/Microbiology/Infectious-disease diagnostics"},{"id":46380591,"name":"Biological sciences/Microbiology/Pathogens"}],"tags":[],"updatedAt":"2026-02-12T08:14:32+00:00","versionOfRecord":{"articleIdentity":"rs-6322223","link":"https://doi.org/10.1038/s41586-025-10086-y","journal":{"identity":"nature","isVorOnly":false,"title":"Nature"},"publishedOn":"2026-02-11 05:00:00","publishedOnDateReadable":"February 11th, 2026"},"versionCreatedAt":"2025-04-08 08:56:31","video":"","vorDoi":"10.1038/s41586-025-10086-y","vorDoiUrl":"https://doi.org/10.1038/s41586-025-10086-y","workflowStages":[]},"version":"v1","identity":"rs-6322223","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6322223","identity":"rs-6322223","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.