Role of UPP1 triggering TIM4-mediated efferocytosis and M2 polarization in alveolar macrophages to promote the resolution of inflammation in acute lung injury/acute respiratory distress syndrome | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Role of UPP1 triggering TIM4-mediated efferocytosis and M2 polarization in alveolar macrophages to promote the resolution of inflammation in acute lung injury/acute respiratory distress syndrome Yongheng Gao, Yifeng Wang, Xian Guo, Xinxin Wang, Ruoxuan Hei, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9171327/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Acute lung injury (ALI)/acute respiratory distress syndrome (ARDS) is associated with high mortality. Impaired efferocytosisof alveolar macrophages (AMs) is a key factor contributing to poor clinical outcomes, yet the molecular mechanisms regulating this process remain unclear. The efferocytosis in LPS-induced AMs and ALI/ARDS mice model were evaluated by flow cytometry and immunofluorescence staining. The expression levels of uridine phosphorylase 1 (UPP1), T-cell immunoglobulin and mucin domain containing 4 (TIM4) in AMs were both detected in in vivo and in vitro . In vitro , UPP1 knockdown/overexpression experiments were performed to evaluate changes of efferocytosis and macrophage polarization in LPS stimulated AMs. In vivo , UPP1 overexpression and TIM4 neutralizing antibody intervention were performed to observe the changes of efferocytosis, macrophage polarization, inflammation factors and the repair of lung injury. Efferocytosis was downregulated in LPS-induced ALI/ARDS animal models, whereas LPS stimulation led to the upregulation of efferocytosis in in vitro AMs. In-depth mechanistic investigations revealed that the LPS-induced enhancement of efferocytosis was positively correlated with the increased expression of UPP1. And UPP1 promoted the phosphorylation of STAT3, thereby upregulating TIM4 signaling to mediate the augmentation of efferocytosis. Further, UPP1 upregulation abrogated the inhibitory effect on efferocytosis in ALI/ARDS and mitigated lung injury. UPP1 regulates AMs efferocytosis and M2 polarization via the STAT3-TIM4 axis, promoting inflammatory resolution in ALI/ARDS. This study provides a novel therapeutic target for ALI/ARDS treatment. Biological sciences/Immunology/Inflammation/Acute inflammation Biological sciences/Immunology/Cell death and immune response acute lung injury acute respiratory distress syndrome alveolar macrophages efferocytosis macrophage polarization UPP1/TIM4/STAT3 axis rAAV gene therapy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) represent a spectrum of life-threatening acute respiratory failure characterized by diffuse alveolar epithelial and endothelial damage, non-cardiogenic pulmonary edema, and refractory hypoxemia 1,2 . As a major challenge in clinical critical care, ALI/ARDS affects over millions of patients annually in the world, with mortality rates ranging from 30% to 60%—and even exceeding 60% among critically ill patients with COVID-19-associated ARDS 3–5 . Despite decades of research, the only therapeutic intervention proven to improve survival is lung-protective mechanical ventilation, while pharmacologic therapies have failed to consistently translate into clinical benefits. This therapeutic stagnation is primarily attributed to an incomplete understanding of the complex pathophysiological mechanisms underlying ALI/ARDS, particularly the dysregulated inflammatory responses and impaired tissue repair processes that drive disease progression 2,6 . Macrophages, as central regulators of lung immunity, play a dual role in ALI/ARDS pathogenesis: initiating pro-inflammatory responses in the acute phase and mediating anti-inflammatory tissue repair in the resolution phase 7,8 . A key functional attribute of macrophages—efferocytosis (the phagocytic clearance of apoptotic cells)—has emerged as a potential linchpin in ALI/ARDS progression and resolution 9,10 . Efficient efferocytosis is critical to preventing secondary necrosis of apoptotic cells, which would otherwise release pro-inflammatory alarmins and perpetuate tissue damage 11 . Clinical evidence directly links defective efferocytosis to ARDS severity, namely that alveolar macrophages (AMs) from ARDS patients exhibit a significantly reduced efferocytosis index (7.6% vs. 22.7% in sepsis patients without ARDS), which correlates with increased alveolar neutrophil apoptosis and elevated levels of pro-inflammatory cytokines (e.g., IL-8, IL-1) 12 . In preclinical and clinical studies of ARDS, impaired efferocytosis is consistently associated with sustained inflammation and poor outcomes 13 , supporting the hypothesis that enhancing efferocytosis could mitigate ALI/ARDS pathology 12,14,15 . Despite the growing recognition of efferocytosis as a therapeutic target, critical gaps in knowledge persist, limiting the development of targeted interventions. Among these, one of the most critical problems is that the key molecular regulators governing macrophage efferocytosis in ALI/ARDS are not fully elucidated. While molecules such as MerTK, GAS6, and AXL have been implicated in efferocytosis in other contexts, their specific roles in ALI/ARDS-associated efferocytosis defects remain poorly characterized 16 . Are there any novel key molecules that mediate the efferocytosis process in ALI/ARDS and thereby affect this progress? Addressing these knowledge gaps is essential to advance our understanding of ALI/ARDS pathophysiology and develop novel therapeutic strategies. This study aims to synthesize current evidence on macrophage efferocytosis in ALI/ARDS, highlight unresolved questions regarding its temporal regulation and molecular mechanisms, and underscore the translational potential of targeting this process to improve patient outcomes. 2. Materials and methods 2.1. Single-cell RNA sequencing (scRNA-seq) analysis Data source: GSE264032 from the gene expression omnibus (GEO) database contains lung tissues from 3 mice. They were classified into the pulmonary group (the model constructed by intratracheal injection of LPS) with a mice, the extrapulmonary group (the models constructed by intraperitoneal injection of LPS) with a mice and the control group with a mice. Raw sequence reads in FASTQ format from 3 lung tissues were processed and aligned to the reference transcriptome (GCF_000001635.26_GRCm38.p6) available at the National Center for Biotechnology Information (NCBI) using the Cellranger v7.1.0 pipeline (https://www.10xgenomics.com/) with default parameters. The resulting gene expression matrices merged together using Seurat package v5. the pre-processing followed the guidelines provided by Seurat V5 tutorial. In short entries with fewer than 400 genes and greater than 7500 total genes were filtered to remove empty droplets and probable doublets, respectively, and cells that have >20% mitochondrial counts were also filtered to remove low quality cells. To account for differences in sequencing depth across samples, we normalized expression values for total unique molecular identifiers (UMIs) per cell and log transformed the counts using “Seurat Normalize Data” function. Clustering and identification of cell types: For cell clustering, normalized and scaled data were utilized to identify highly variable features using the “FindVariableFeatures” function (nfeatures = 2000). And followed this, dimensionality reduction was performed using these features. The resulting cell clusters were visualized using the uniform manifold approximation and projection (UMAP) method and annotated by examining the expression of known marker genes. Differential expression and functional enrichment analysis: To identify differential expression genes (DEGs), we used the “Seurat FindMarkers” function based on Wilcox likelihood-ratio test with default parameters, and selected the genes as DEGs with p_adj value 0.25, where log 2 FC > 0.25 indicated upregulated genes and log2FC < -0.25 indicated downregulated genes. To investigate the potential functions of DEGs, the gene ontology (GO) and kyoto encyclopedia of genes and genomes (KEGG) analysis were used with “ClusterProfiler” R package. Pathways with p.adj value < 0.05 were considered as significantly enriched. 2.2. Animals and design The animals used in this study and the experimental procedures involved had been approved by the Air Force Medical University Animal Care and Use Committee [Approval Number: 20250196], and strictly followed the National Institutes of Health Animal Care Guidelines and Animal Euthanasia Guidelines. Healthy male C57BL/6 mice (4 or 6-8 weeks) selected for the experiment were purchased from Shaanxi Shanyao Medical Biotechnology Co., Ltd (Shaanxi, China) and housed under the SPF conditions (temperature of 22 ± 2 ℃, humidity of 55% ± 10%, and 12 h of light/dark cycle). After an adaptation period of no less than 3 days, mice were subjected to the experiment. Hanbio Biotechnology (Shanghai, China) assisted in the construction and production of the gene knockdown or overexpressed recombinant adeno-associated virus (rAAV) vector targeting AMs. The alveolar-macrophage-specific knockdown system (AAV-F4/80-mir30-siUpp1) carried the alveolar-macrophage-specific promoter F4/80 17 and the target sequence for Upp1 knockdown (5’-CGGAGUUGAGCAUGUTT-3’). The alveolar-macrophage-specific overexpression system (AAV-F4/80-oeUpp1-3xflag) carried F4/80, the target sequence for Upp1 overexpression (NM_001159402) and flag tags. The control system (AAV-F4/80-siNC or AAV-F4/80-oeNC) did not carry flag tags. rAAV was delivered to the lungs through the airway to modify specific genes of AMs. Inject 50-70 μL (1×10 11 vg) of AAV in PBS suspension into the airway of healthy male C57BL/6 mice (4 weeks) using a 22G endotracheal intubation needle. On the 28th day of virus infection, the knockdown and overexpression efficiency were validated by RT-qPCR or fluorescent labeling with flag tags, respectively. LPS (5 mg/kg; L2880, Sigma-Aldrich, USA) was administered via non-invasive tracheal intubation for 24 h to establish an LPS-induced ALI/ARDS mice model, while the control group received an equal volume of PBS 18 . IgG2b (0.5 mg/mice; BE0090, Bio X Cell, West Lebanon, NH) and AbTIM4 (0.5 mg/mice; BE0171, Bio X Cell, West Lebanon, NH) were administered via non-invasive endotracheal intubation 1 h before LPS administration 19 . Mice were randomly divided into 11 groups (n = 6/group): (1) Control group treated with PBS; (2) LPS group treated with LPS dissolved in PBS; (3) AAV-siNC + Ctrl group treated with AAV-F4/80-siNC and PBS; (4) AAV-siUpp1 + Ctrl group treated with AAV-F4/80-mir30-siUpp1 and PBS; (5) AAV-siNC + LPS group treated with AAV-F4/80-siNC and LPS; (6) AAV-siUpp1 + LPS group treated with AAV-F4/80-mir30-siUpp1 and LPS; (7) AAV-oeNC + Ctrl + IgG2b group treated with AAV-F4/80-oeNC, IgG2b, and PBS; (8) AAV-oeUpp1 + Ctrl + IgG2b group treated with AAV-F4/80-oeUpp1-3xflag, IgG2b, and PBS; (9) AAV-oeNC + LPS + IgG2b group treated with AAV-F4/80-oeNC, IgG2b, and LPS; (10) AAV-oeUpp1 + LPS + IgG2b group treated with AAV-F4/80-oeUpp1-3xflag, IgG2b, and LPS; (11) AAV-oeUpp1 + LPS + AbTIM4 group treated with AAV-F4/80-oeUpp1-3xflag, AbTIM4, and LPS. We collected data on body weight (BW; BW1 and BW2 are the body weights of the mice before and after LPS administration, respectively) of mice, wet weight (WW) of the entire lung, and obtained mice orbital blood, bronchoalveolar lavage fluid (BALF) and lung tissue. Among them, BALF and lung tissue were collected from different batches of experimental groups. 2.3. Weight change and Lung Index (LI) Weight changes can comprehensively evaluate the severity of systemic pathophysiological stress in mice, including systemic inflammatory depletion, decreased appetite and dehydration, fluid leakage and loss, etc. Lung index (LI) is one of the gold standards for evaluating the severity or treatment effectiveness of ALI/ARDS. LI can quantitatively evaluate the degree of pulmonary edema, and an increase in LI indicates an increase in pulmonary vascular permeability, which is positively correlated with the degree of pulmonary edema. Weight change is calculated as (BW2-BW1) / BW1 × 100%. LI = 100 × WW / BW2. 2.4. Enzyme-linked immunosorbent assay (ELISA) To quantify the pro-inflammatory cytokines (IL-1β, IL-6, and TNF-α) and anti-inflammatory cytokines (IL-10 and TGF-β) in lung homogenates and BALF, ELISA was performed with specified kits (88-7013, 88-7064, 88-7324, 88-7105, and 88-8350 Thermo Fisher Scientific, USA). Prior to analysis, lung tissues were processed into homogenates using PBS with protease inhibitors (1:9, w/v) and then centrifuged at 4 °C (12000×g, 20 min). The supernatant was collected to assay following the instructions. The obtained cytokine levels were then adjusted against the total protein concentration determined by the BCA method (G2026, Servicebio, China), with results expressed in picograms per milligram of protein (pg/mg prot). BALF was collected by washing the lung with 1 mL pre-cold PBS through the trachea, repeating three times 20 . Then the fluid was centrifuged at 4 °C (500×g, 10 min) and the supernatant was collected for the cytokine detection, with results expressed in pg/mL. 2.5. Histological analysis After fixation with 4% paraformaldehyde (PFA) at room temperature for 24-48 h, the freshly separated left lung tissues were embedded in paraffin and cut into 5 μm sections. These sections were then stained with the hematoxylin and eosin (HE) staining kit (C0105S, Beyotime, China) according to the instruction manual. The stained sections were imaged by Nikon Eclipse C1 (Nikon, Japan) and analyzed by CaseViewer system (3DHISTECH Ltd., Budapest, Hungary). 2.6. Immunofluorescence (IF) Lung tissue sections embedded in paraffin were prepared as described in section 2.5, and performed the steps of dewaxing, hydration, and antigen repair. Sections were blocked with 3% bovine serum albumin (BSA; GC305010, Servicebio, China) at room temperature for 30 min, and incubated overnight at 4 °C with the following primary antibodies: F4/80 (1:500, GB113373, Servicebio, China), flag (1:500, GB15938, Servicebio, China), UPP1 (1:500, 14186-1-AP, Proteintech, Wuhan, China), iNOS (1:500, GB13594, Servicebio, China), CD206 (1:500, GB113497, Servicebio, China). On the second day, sections were incubated with the corresponding fluorescent conjugated secondary antibody at room temperature for 1 h in the dark. Or the Tunel assay kit (G1504, Servicebio, China) was used to label apoptotic cells. The secondary antibody information is as follows: CY3 labeled goat anti rabbit IgG (1:300, GB21303, Servicebio, China) for F4/80, Alexa Fluor 488 labeled goat anti mouse IgG (1:400, GB25301, Servicebio, China) for flag, HRP labeled goat anti rabbit IgG (1:500, GB23303, Servicebio, China) for UPP1, iNOS, and CD206. After counterstaining the cell nucleus with DAPI (G1012, Servicebio, China) at room temperature for 10 min, the sections were finally mounted with anti-fluorescence quenching sealing agent (G1401, Servicebio, China). The stained sections were imaged by Nikon Eclipse C1 (Nikon, Japan) and analyzed by CaseViewer system (3DHISTECH Ltd., Budapest, Hungary). To evaluate the infection efficiency of rAAV in mice lungs, we isolated left lung tissue for immunofluorescence staining on the 28th day of virus infection. The percentage of flag (green) and F4/80 (red) double positive cells to the number of F4/80 single positive cells in lung was used to evaluate the efficiency of viral infection. After LPS administration, we represented the protein expression level of UPP1 by the percentage of UPP1 (green) and F4/80 (red) double positive cells to the number of F4/80 single positive cells in lung. The percentage of iNOS/CD206 (green) and F4/80 (red) double positive cells to the number of F4/80 single positive cells in lung was used to evaluate the M1/M2 polarization phenotype. To evaluate the efferocytosis of LPS-induced ALI/ARDS model in vivo, we labeled AMs and apoptotic cells with F4/80 and Tunel, respectively. Tunel (green) and F4/80 (red) double positive cells represent efferocytosis events, and the percentage of that to the number of F4/80 single positive cells in lung was used to evaluate the efferocytosis level of AMs. 2.7. Cell culture 2.7.1. Primary extraction, differentiation culture, and identification of bone marrow-derived macrophages (BMDMs) Bone marrow-derived macrophages (BMDMs) were isolated from the tibia, fibula, and femur of healthy male C57BL/6 mice (6-8 weeks) 21 , and treated with 10% fetal bovine serum (FBS; C04001, VivaCell), 1% penicillin streptomycin solution (P/S; P1400, Solarbio, China), and 20 ng/mL recombinant protein macrophage colony-stimulating factor (M-CSF; 315-02, PEPROTECH, USA) for 7 days. The cells were maintained in a moist incubator containing 5% CO 2 at a temperature of 37°C. Differentiated and mature BMDMs were identified by flow cytometry (F4/80 and CD11b double positive cell ratio > 95%) and cell immunofluorescence. BMDMs were collected, washed, and resuspended in pre-cooled Cell Staining Buffer (E-CK-A107, Elabscience, China) at a density of 1×10 6 cells/100 μL. Cell suspension were incubated with FITC labeled anti mouse F4/80 antibody (1:200, 123107, BioLegend, USA) and PE labeled anti mouse CD11b antibody (1:100, 101207, BioLegends, USA) in the dark at 4 °C for 30 min. After washing unbound antibodies and resuspending, stained cells were analyzed on the flow cytometry system of NovoCyte (Agilent, China). The data was analyzed and performed by FlowJo 10.8.1 software (BD Biosciences). The results were shown in Supplementary Figure 1A. BMDMs were seeded onto the slides in 24-well plate at a density of 5×10 5 cells/well, and surface markers of macrophages were detected by immunofluorescence staining on the 7th day of culture. Cells were fixed with 4% PFA at room temperature for 15 min and permeabilized in PBS containing 0.3% Triton X-100 for 5 min. Cells were sealed with 5% BSA at room temperature for 30 min to eliminate non-specific binding. Cells were incubated overnight with F4/80 (1:400, 29414-1-AP, Proteintech, Wuhan, China) at 4 ℃, and on the second day, incubated with HRP labeled goat anti rabbit IgG (1:500, GB23303, Servicebio, China) at room temperature for 1 h in dark. Finally, the cell nuclei were observed and photographed after Hoechst counterstaining. The results were shown in Supplementary Figure 1B. 2.7.2. Cultivation of MH-S cells The mice alveolar macrophage cell line MH-S (iCell-m078, Shanghai, China) was purchased from iCell Bioscience Co., Ltd (Shanghai, China). The cells were cultured in RPMI 1640 medium (11875093, Gibco, USA) supplemented with 10% FBS and 1% P/S, and maintained in a moist incubator containing 5% CO 2 at a temperature of 37 °C. Cells are passaged every other day. Before the experiment, the cells were harvested, counted, and seeded into a 6-well plate (1×10 6 cells/well). 2.8. Induction of apoptosis and identification of Jurkat cells The human T-cell leukemia cell line Jurkat (clone E6-1, iCell-h117, Shanghai, China) was purchased from iCell Bioscience Co., Ltd (Shanghai, China). The cells were cultured in specialized medium (iCell-h117-001b, Shanghai, China) and maintained in a moist incubator containing 5% CO 2 at a temperature of 37 °C. Cells are passaged every 3 days in a semi liquid exchange manner. Jurkat cells were induced to apoptosis by UVC irradiation and identified according to the instructions of Annexin V-FITC/PI dual staining cell apoptosis detection kit (BB-4101, Bestbio, China). The results were shown in Supplementary Figure 1C. 2.9. Evaluation of efferocytosis in vitro BMDMs/MH-S cells and apoptotic Jurkat cells treated with specific conditions were prepared as described above. Apoptotic Jurkat cells labeled with Annexin V-APC (BB-41025, Bestbio, China) and BMDMs/MH-S cells were co-cultured at a ratio of 5:1 for a specific period of time. Then we labeled BMDMs/MH-S cells with FITC labeled anti mouse F4/80 antibodies (1:200, 123107, BioLegend, USA). The efferocytosis of macrophages was determined by flow cytometry. In addition, to visualize the efferocytosis of BMDMs, we labeled apoptotic Jurkat cells with Dil (D282, Thermo Fisher Scientific, USA) and labeled BMDMs using the method described in section 2.7.1. Cells co-located with F4/80 and Dil were considered as efferocytosis events. 2.10. Strategy of flow sorting and RNA sequencing Samples were prepared as described in section 2.9. Efferocytosis events in BMDMs were sorted by the flow cytometry sorting system of BD FACSARia (BD Biosciences). The sorted cell samples (n = 3 samples/group) were mixed with 1 mL RNAiso Plus (9109, Takara, Japan) and frozen in liquid nitrogen, and stored at -80 ℃. After RNA extraction, quality control, and reverse transcription, a micro cDNA library was constructed and sequenced on the Illumina sequencing platform of Genedenovo Biotechnology Co., Ltd. (Guangzhou, China). Bioinformatics analysis and graphic rendering were completed on cloud platform (https://www.omicshare.com/tools/). 2.11. Evaluation of macrophage polarization in vitro MH-S cells treated under specific conditions were collected, washed, and resuspended in pre-cooled Cell Staining Buffer at a density of 1×10 6 cells/100 μL. FITC labeled anti mouse CD86 antibody (1:100, 105006, BioLegend, USA) and APC labeled anti mouse CD206 antibody (1:100, 141708, BioLegends, USA) were added to the cell suspension and the mixed system was incubated at 4 °C for 30 min in the dark. The proportion of M1 (CD86 + CD206 - ) and M2 (CD86 + CD206 + ) macrophages were analyzed by flow cytometry. 2.12. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) Total RNA was extracted from cell samples according to the instructions of the RNA extraction kit (AN51L518, Life iLab, China), and the quality of RNA was detected by the Nano Drop system (Thermo Fisher Scientific, USA). After synthesizing cDNA by the mRNA reverse transcription kit (RR092A, Takara, Japan), RT-qPCR was executed with the TB Green™ Premix Ex Taq™ II (RR820A, Takara, Japan) on a Roche Light Cycler 480 platform. The program was performed as follows: pre-denaturation at 95 °C for 30 sec (1 cycle); denaturation at 95 °C for 5 sec and annealing/extension at 60 °C for 30 sec (40 cycles). The expression was normalized to the Gapdh and analyzed using the comparative 2 -ΔΔCq method 22 . The primer sequences are listed in Table 1. 2.13. Western blot (WB) The cell pellet was lysed on ice for 15 min using RIPA lysis buffer (P0013B, Beyotime, China) containing 1% phenylmethylsulfonyl fluoride (PMSF; ST507, Beyotime, China). The lysate was centrifuged (12000×g at 4 °C for 15 min) and the protein concentration was measured on the Nano Drop system. The protein was separated by 10% SDS-PAGE and transferred onto the PVDF membrane (ISEQ00010, Millipore, USA). After being sealed with 5% skim milk at room temperature for 1 h, the membranes were incubated with primary antibody at 4 °C overnight. The information of primary antibodys was as followed: Alpha Tubulin (1:5000, 80762-1-RR, Proteintech, China), UPP1 (1:500, 56941, SAB, China), TIM4 (1:500, bs-6197R, Bioss, China), CD206 (1:1000, 24595, CST, USA), iNOS (1:1000, 68186, CST, USA), total STAT3 (1:1000, 12640, CST, USA), and phospho-STAT3-Tyr705 (1:1000, 9145, CST, USA). Then the membranes were incubated with HRP coupled secondary antibody (1:3000, M21002, Abmart, China) at room temperature for 2 h. Finally, the membranes were developed by using ECL reagent (WBKLS0500, Millipore, USA) and chemiluminescence imaging system (Tanon 5200 Multi, Tanon, Shanghai, China). The bands were quantitatively analyzed for grayscale by using ImageJ software (version 1.8.0_322, National Institutes of Health, USA). 2.14. Statistical analysis Statistical analysis was carried out using GraphPad Prism software (version 9.0), with data presentes as mean ± standard deviation (SD). Comparisons between two groups were assessed by a two-tailed unpaired Student's t-test. Multi-group comparisons were evaluated through one-way ANOVA followed by Tukey's post hoc test. Significance thresholds were set at p < 0.05. 3. Results 3.1. Single-cell RNA sequencing analysis of lung tissue in LPS-induced ALI/ARDS mice After preliminary evaluation and quality control, we selected 32375 cells from the GSE264032 dataset for further analysis, including 13726 cells from the control group, 12539 cells from the extra-pulmonary group, and 6110 cells from the pulmonary group (Figure 1A). Using UMAP method to reduce dimensionality and annotate 11 cell types, including: Alveolar type 1 epithelial cell (AT1), Alveolar type 2 epithelial cell (AT2), Neutrophil, Monocyte, B cell, T cell, Myofibroblast, Fibroblast, Endothelial cell, M1 Macrophage, and M2 Macrophage (Figure 1B). In addition, we selected a small number of marker genes to validate the rationality of cell clustering (Figure 1C). In the cell composition distribution map, we found that the proportion of M2 macrophages increased in both the extra-pulmonary and pulmonary groups, while the proportion of M1 macrophages decreased (Figure 1D). KEGG enrichment analysis showed that the down-regulated DEGs in both extra-pulmonary and pulmonary macrophage populations were enriched in pathways related to efferocytosis, such as: Lysosome, Fc gamma R-mediated phagocytosis, Efferocytosis, and Autophagy pathway (Figure 1E). 3.2. Efferocytosis in ALI/ARDS models in vitro and in vivo Based on the aforementioned bioinformatics analysis results, in order to clarify the role of efferocytosis in the ALI/ARDS model, we first constructed an ALI/ARDS mice model by non-invasive tracheal intubation and infusion of LPS (5 mg/kg). Through HE staining of mice lung tissue, it was observed that the LPS group had complete destruction of alveolar structure, thickening of alveolar septa, infiltration of numerous inflammatory cells, alveolar hemorrhage, and formation of protein exudate and transparent membrane (Figure 2A). The core principle of Tunel staining is to directly detect the characteristic event of nuclear DNA breakage during cell apoptosis at the molecular level. Therefore, we designed an immunofluorescence staining scheme to label AMs and apoptotic cells with F4/80 (red) and Tunel (green), respectively. F4/80 and Tunel double positive cells were considered as macrophages undergoing efferocytosis. The results showed that compared with the control group, LPS stimulation significantly increased the infiltration of macrophages (F4/80 + cells) and the number of apoptotic cells (Tunel + cells) in lung tissue, but the incidence of cell burial events (F4/80 + Tunel + /F4/80 + percentage) was significantly reduced (Figure 2B-C). This result suggested that both macrophages residing in lung tissue and macrophages formed by peripheral mononuclear cell colonization and differentiation had not effectively cleared apoptotic cells caused by adverse stimuli, resulting in defects in ALI/ARDS efferocytosis. To construct an in vitro cell model of efferocytosis, we extracted and differentiated mice bone marrow-derived mononuclear macrophages (BMDMs), and identified them by flow cytometry (F4/80 and CD11b double positive cell ratio > 95%) and immunofluorescence staining (macrophage marker F4/80) (Supplement Figure 1A-B). At the same time, we constructed an apoptotic cell model by irradiating Jurkat T cells with UVC, and detected the proportion of cell apoptosis by flow cytometry. We selected 1 hour of UVC irradiation as the subsequent experimental condition (Supplement Figure 1C). Interestingly, in the in vitro cell burial model, LPS stimulation at different time points significantly enhanced the efferocytosis of BMDMs, which is contrary to the results of in vivo experiments (Supplement Figure 1D). Among them, the promotion effect was most significant at the time point of 12 h, which was used as the condition for subsequent experiments (Figure 2D-E). Consistently, using cell immunofluorescence technology, F4/80 (green) labeled BMDMs in the LPS stimulated group engulfed more Dil (red) labeled ACs (Figure 2F). 3.3. UPP1was selected as a switch for the efferocytosis and polarization phenotype transition of AMs In order to explore the key genes involved in LPS promoting efferocytosis in vitro, we isolated BMDMs that engulfed ACs from the control and LPS group using flow cytometry and performed RNA sequencing. The results showed good consistency among three samples within each group (Figure 3A). We noticed significant changes in the transcriptome of BMDMs after 12 h of LPS treatment, with 909 upregulated genes and 2195 downregulated genes (Figure 3B). KEGG enrichment analysis showed that DEGs were enriched on pathways related to efferocytosis, including “Metabolic pathway”, “Chemokine signaling pathway”, and “Cytokine-cytokine receptor interaction” (Figure 3C). 77 genes from these pathways were sorted based on log 2 FC values from high to low. The expression of the TOP 10 genes was verified through RT-qPCR, and they were significantly upregulated in the LPS group (Figure 3D). Based on the condition that the count values from RNA-seq are not equal to 0 (excluding Pla1a , Car4 , Gstt4 , Lipg , Il2ra , Ido1 ) and the Cq values from RT-qPCR no more than 30 (excluding Nos2 , Il23r ), we assumed that Upp1 and Hdc might be the key genes. To further elucidate the roles of Upp1 and Hdc in efferocytosis, we knocked down two genes separately by siRNA transfection in MH-S cells derived from mice AMs. Flow cytometry showed that UPP1 knockdown significantly inhibited the promoting effect of LPS on the efferocytosis of MH-S cells (Figure 3E), while HDC knockdown had no significant effect on the efferocytosis of MH-S cells in both resting and inflammatory states (Supplementary Figure 2A). Subsequently, we validated the protein level of UPP1 in BMDMs (Figure 3F) and the mRNA and protein levels in MH-S cells (Figure 3G-H), confirming that UPP1 showed the most significant expression changes after 12 h of LPS stimulation. In addition, we also discussed the inconsistent effects of LPS stimulation on intracellular and extracellular organelles. We speculated that complex factors such as hypoxia might be one of the reasons for the deficiency of efferocytosis in vivo . The flow cytometry results showed that under the condition of 1% O 2 , the efferocytosis of MH-S cells in both resting and inflammatory states were reduced (Supplementary Figure 2B). Meanwhile, compared with LPS stimulation alone, the mRNA and protein levels of UPP1 decreased under hypoxic conditions (Supplementary Figure 2C-D). Therefore, UPP1 may be a key gene involved in the effect of LPS on efferocytosis. We also examined macrophage polarization phenotypes closely related to efferocytosis. The results showed that LPS increased the proportion of CD86 + CD206 - M1 macrophages and decreased the proportion of CD86 + CD206 + M2 macrophages, while UPP1 knockdown significantly promoted the effect of LPS on macrophage polarization phenotype (Figure 3I). In addition, UPP1 knockdown increased the transcription level of Nos2 (nitric oxide synthase 2) in resting MH-S, while reducing that of Mrc1 (mannose receptor C-type 1). When exposed to LPS-induced inflammatory environment, UPP1 knockdown resulted in further increase of Nos2 and reduction of Mrc1 in MH-S cells (Figure 3J). Furthermore, UPP1 knockdown significantly increased the protein level of M1 marker iNOS and decreased that of M2 marker CD206 in inflammatory state, while having no significant effect on two markers in resting state (Figure 3K-L). Therefore, UPP1 knockdown induced a significant macrophage polarization phenotype transition from M2 to M1. Moreover, UPP1 knockdown resulted in further increased expression of various pro-inflammatory markers in the LPS-induced inflammatory environment, including Il1b (interleukin 1 beta), Il6 (interleukin 6), Tnf (tumor necrosis factor), and Mcp1 (monocyte chemoattractant protein-1), while further reducing the expression of anti-inflammatory markers, including Il10 (interleukin 10) and Tgfb1 (transforming growth factor beta 1; Figure 3M). Collectively, consistent with our hypothesis, UPP1 does play a key role in activating efferocytosis, macrophage polarization phenotype transition, and secretion of inflammatory cytokines. 3.4. Reinforced UPP1 promoted efferocytosis and M2 polarization of AMs Overexpression studies were next carried out to investigate the effects of UPP1 on efferocytosis and M2 polarization. As expected, the transfection of UPP1 overexpression plasmid successfully induced the expression of UPP1 in MH-S cells (Figure 4A). LPS significantly increased the expression of UPP1, and UPP1 overexpression further increased UPP1 at the mRNA and protein levels (Figure 4E-G). Flow cytometry showed that UPP1 overexpression enhanced the efferocytosis of resting MH-S cells and further enhanced the promoting effect of LPS on efferocytosis (Figure 4B), and also reversed the inhibitory effect of hypoxia on efferocytosis (Figure 4C). In addition, at rest, UPP1 overexpression reduced the proportion of CD86 + CD206 - M1e macrophages and increased the that of CD86 + CD206 + M2 macrophages. Meanwhile, UPP1 overexpression significantly reversed the effect of LPS on macrophage M1 and M2 polarization under inflammatory conditions (Figure 4D). The changes in mRNA levels of M1 marker iNOS and M2 marker CD206 were consistent with the results of flow cytometry (Figure 4E). In the inflammatory environment simulated by LPS, UPP1 overexpression significantly increased the protein level of iNOS and reduced that of CD206. However, there was no significant effect on the protein levels of the two markers in resting MH-S cells (Figure 4F-G). Moreover, UPP1 overexpression inhibited the expression of pro-inflammatory factors and promoted the expression of anti-inflammatory factors (Figure 4H). Collectively, these data indicates that UPP1 overexpression promotes efferocytosis, polarization transition from M1 to M2, and the expression of anti-inflammatory factors upon LPS treatment. In other words, UPP1 has the potential for inflammation repair. 3.5. UPP1 promoted efferocytosis and M2 polarization of AMs by regulating TIM4 We further investigated the role of relevant signal transduction in the mechanisms of macrophage efferocytosis and polarization phenotype transition. The heatmap of RNA-seq data revealed a considerable increase in the mRNA expression of the efferocytosis-binding receptors, Timd4 (T cell immunoglobulin and mucin domain containing 4), in the LPS group compared with the Control group (Figure 5A). It was worth noting that LPS stimulation resulted in an increase in the protein level of TIM4 in both BMDMs (Figure 5B-C) and MH-S cells (Figure 5D). Interestingly, UPP1 knockdown led to a decrease in the protein level of TIM4 in pro-inflammatory MH-S cells (Figure 5E). Compared with the corresponding control group, UPP1 overexpression resulted in increasing the protein levels of TIM4 in both resting and pro-inflammatory MH-S cells (Figure 5F). Based on these results, we investigated whether TIM4 could be one of the molecular mechanisms through which UPP1 enhanced efferocytosis. In the rescue experiment, we used AbTIM4 as the neutralizing antibody for TIM4, while IgG2b was used as the control neutralizing antibody in other groups. Whether AbTIM4 was administered or not did not affect the expression of UPP1 at the mRNA and protein levels (Figure 5K-M). This indicated that UPP1 was upstream of TIM4. The results of flow cytometry showed that compared with the oeUpp1 + LPS + IgG2b group, the oeUpp1 + LPS + AbTIM4 group had significantly reduced efferocytosis (Figure 5G-H), decreased the proportion of CD86 + CD206 + M2 macrophages, and increased the proportion of CD86 + CD206 - M1 macrophages (Figure 5I-J). RT-qPCR and western blot showed that after AbTIM4 administration, the expression of CD206 was reduced, while that of iNOS was increased (Figure 5K-M). Consistently, comparing the levels of pro-inflammatory and anti-inflammatory factors in two groups of cells, the oeUpp1 + LPS + AbTIM4 group showed an increase in pro-inflammatory factor expression and a decrease in anti-inflammatory factor expression (Figure 5N). In summary, AbTIM4 hinders the positive signal transduction of UPP1 on efferocytosis and M2 polarization, as well as the effect on anti-inflammatory repair. Therefore, UPP1 enhances efferocytosis, M2 polarization, and anti-inflammatory repair of AMs by regulating TIM4. 3.6. UPP1 enhanced the expression of TIM4-mediated efferocytosis and M2 polarization by promoting STAT3 phosphorylation To elucidate the regulatory mechanism of UPP1 inTIM4-mediated efferocytosis and M2 polarization, we transfected MH-S cells with UPP1 empty vector plasmid (Vector) or overexpression plasmid (oeUpp1) and performed RNA-seq analysis. Gene set enrichment analysis (GSEA) showed significant enrichment of the JAK-STAT signaling pathway (Figure 6A). The heat map displayed DEGs enriched in the JAK-STAT signaling pathway, with UPP1 overexpression significantly upregulating the transcription of Stat3 (Figure 6B). To verify the relationship between UPP1 and STAT3, we detected STAT3 and its phosphorylation levels in the overexpression group using western blot. The results showed that UPP1 overexpression increased the total and phosphorylated protein expression of STAT3 in resting MH-S cells. LPS treatment increased STAT3 and its phosphorylation levels and UPP1 overexpression further promoted the increase in phosphorylation levels without in total protein expression (Figure 6C). Therefore, UPP1 promotes STAT3 phosphorylation levels. Stattic is an effective STAT3 inhibitor that can inhibit the phosphorylation sites of Y705 and S727. When MH-S cells were treated with Stattic one hour before LPS administration, STAT3 phosphorylation levels were significantly inhibited, while total protein expression was not affected (Figure 6I-J). We found that Stattic blocked the promoting effect of UPP1 overexpression on efferocytosis (Figure 6D-E). The flow cytometry results showed that compared with the oeUpp1 + LPS group, the proportion of CD86 + CD206 + M2 macrophages in the oeUpp1 + LPS + Stattic group was significantly reduced, while the proportion of CD86 + CD206 - M1 macrophages increased (Figure 6F-G). Consistently, after Stattic treatment, the expression of CD206 was reduced, while the expression of iNOS was increased (Figure 6H-J). In addition, Stattic had no significant effect on the mRNA and protein expression of UPP1, but downregulated the protein expression of TIM4 (Figure 6H-J). Based on these results, it can be inferred that STAT3 is a bridging effector involved between UPP1 and TIM4. Moreover, Stattic treatment resulted in an increase in pro-inflammatory cytokine expression and a decrease in anti-inflammatory cytokine expression (Figure 6K). In summary, UPP1 enhances the expression of TIM4 and TIM4-mediated efferocytosis and M2 polarization by promoting STAT3 phosphorylation. 3.7. Upp1 alveolar-macrophage-specific knockdown exacerbated LPS-induced ALI/ARDS To pay special attention to the role of UPP1 in the lungs, we administered recombinant adeno-associated virus (rAAV) of Upp1 alveolar-macrophage-specific knockdown adenovirus (AAV-F4/80-miR30-siUpp1) through the airway. After 28 days of infection, the mRNA level of Upp1 in AMs significantly decreased (Supplement Figure 3A). We validated the protein expression of UPP1 in AMs of mice in each group using F4/80 (red) and UPP1 (green) double labeled immunofluorescence (Supplement Figure 3B-C). The typical features of ALI/ARDS were observed in the lungs of mice exposed to LPS, however, UPP1 knockdown resulted in more severe damage. The specific situation was reflected in greater weight loss (Figure 7A), more severe pulmonary edema (Figure 7B), and aggravated progression of lung injury (Figure 7C). Further analysis of inflammatory factors showed that UPP1 knockdown significantly exacerbated LPS induced inflammation. In lung tissue homogenate (Figure 7D) and BALF (Figure 7E), the secretion of pro-inflammatory cytokines (IL-1β, IL-6, and TNF-α) significantly increased, while the secretion of anti-inflammatory cytokines (IL-10 and TGF-β) significantly decreased. In addition, we evaluated the efferocytosis and polarization of AMs in vivo using double labeled immunofluorescence. The results showed that the infiltration of macrophages and the number of apoptotic cells further increased, and the efferocytosis was continuously damaged in the lungs of UPP1 knockdown mice exposed to LPS (Figure 7F-G). Meanwhile, UPP1 knockdown further reduced the proportion of M2 macrophages (Figure 7H-I) and increased the proportion of M1 macrophages (Figure 7J-K), promoting the transition of AMs from M2 to M1. These findings indicated that Upp1 alveolar-macrophage-specific knockdown further exacerbated LPS-induced lung inflammation, efferocytosis, and pro-inflammatory M1 polarization. 3.8. Upp1 alveolar-macrophage-specific overexpression gene therapy promoted lung injury repair of LPS-induced ALI/ARDS, while TIM4-blocking inhibited the positive effect Although the benefits of UPP1 overexpression in the immune response of AMs in vitro have been validated, UPP1 has not yet been developed as a therapeutic target for ALI/ARDS. rAAV has been widely used as a vector for gene delivery in experimental animals and human gene therapy 23 , because of which it has the characteristics of high safety, low immunogenicity 24,25 , targeted regulation 26 , and high stability 27 . To further evaluate whether UPP1 overexpression can be used for the treatment of ALI/ARDS, we designed an AAV overexpression gene delivery system (AAV-F4/80-oeNC-null, AAV-F4/80-oeUpp1-3xflag) carrying the alveolar-macrophage-specific promoter F4/80. We infected mice through non-invasive tracheal instillation, and confirmed the infection efficiency of UPP1 in mice lung tissue on the 28th day after infection by marking the flag tag with green fluorescence (Supplementary Figure 4 A-B). At the same time, dual immunofluorescence for F4/80 (red) and UPP1 (green) confirmed the protein level of UPP1 in AMs of each group, which was consistent with the trend of in vitro experiments (Supplementary Figure 4C-D). Compared with the control group (AAV-oeNC/AAV-oeUpp1 + Ctrl + IgG2b), the ALI/ARDS model group (AAV-oeNC + LPS + IgG2b) mice showed a significant decrease in body weight (Figure 8A) and an increase in lung index (Figure 8B). The physiological condition and pulmonary edema degree of the UPP1 gene therapy group (AAV-oeUpp1 + LPS + IgG2b) mice improved, but AbTIM4 inhibited these effects (Figure 8A-B). In H&E staining, UPP1 overexpression partially delayed the progression of lung injury (Figure 8C). Specifically, the alveoli maintain a certain structure, with reduced thickness of alveolar septa, infiltration of inflammatory cells, intra alveolar bleeding, and protein exudation. However, the lung tissue damage in the AbTIM4 inhibition group (AAV-oeUpp1 + LPS + AbTIM4) was more severe than that in the ALI/ARDS model group (Figure 8C). In addition, ELISA analysis of lung tissue homogenate and BALF showed that UPP1 overexpression reduced the levels of pro-inflammatory cytokines (IL-1β, IL-6, and TNF-α) and promoted the secretion of anti-inflammatory cytokines (IL-10 and TGF-β) (Figure 8D-E). However, the addition of AbTIM4 resulted in increased secretion of pro-inflammatory cytokines and decreased secretion of anti-inflammatory cytokines, hindering the anti-inflammatory effect of UPP1 (Figure 8D-E). Next, we evaluated the effects of UPP1 and TIM4 on efferocytosis through immunofluorescence staining. As expected, the number of macrophage infiltration and ACs significantly decreased in the UPP1 gene therapy group, and efferocytosis was enhanced, indicating that macrophages effectively eliminated ACs (Figure 8F-G). Meanwhile, the addition of AbTIM4 did not significantly affect the number of macrophages, but increased the number of ACs, inhibited efferocytosis, and significantly hindered the clearance of ACs (Figure 8F-G). Moreover, compared with the ALI/ARDS model group, UPP1 overexpression therapy promoted the transformation of macrophages towards the M2 phenotype (CD206 marked) (Figure 8H-I) and reduced the infiltration of M1 macrophages (iNOS marked) (Figure 8J-K). However, AbTIM4 inhibited the macrophages polarization transition from M1 to M2. After administration of AbTIM4, the number of CD206 positive macrophages decreased (Figure 8H-I) and the number of iNOS positive macrophages increased (Figure 8J-K). In summary, Upp1 overexpression gene therapy targeting pulmonary macrophages promotes lung injury repair of LPS-induced ALI/ARDS, while blocking TIM4 inhibits this positive effect. 4. Discussion This study explored the regulatory mechanism of macrophage efferocytosis and polarization in LPS-induced ALI/ARDS models, and identified UPP1 as a key target for ALI/ARDS treatment. Four key findings emerged from this study. First, LPS stimulation led to the upregulation of efferocytosis in in vitro macrophage models. Second, the LPS-induced enhancement of macrophage efferocytosis was positively correlated with the increased expression of UPP1. Third, in vitro assays further verified that UPP1 promoted the phosphorylation of STAT3, thereby upregulating TIM4 signaling to mediate the augmentation of efferocytosis. Fourth, LPS stimulation failed to enhance alveolar macrophage efferocytosis in ALI/ARDS mice, a phenomenon primarily attributable to the complexity of the alveolar inflammatory microenvironment and the suppression of efferocytosis induced by acute hypoxia. Notably, UPP1 upregulation abrogated the inhibitory effect on efferocytosis and mitigated lung injury. Impaired AMs efferocytosis in ALI/ARDS is linked to persistent inflammation, alveolar barrier disruption, and poor clinical outcomes, with studies showing reduced efferocytosis capacity in ARDS patients compared to non-ARDS sepsis patients 12,28 . Mechanisms of efferocytosis impairment include neutrophil extracellular trap (NET) accumulation and HMGB1-mediated inhibition of Rab43-dependent CD91 trafficking 29 , which collectively hinder apoptotic cell clearance and perpetuate lung injury. Therapeutic strategies targeting efferocytosis enhancement, such as AMPK activation via metformin, HMGB1 inhibition, and Treg cell modulation, have shown promise in preclinical models by promoting inflammation resolution and improving lung function 12 . Recent research also highlights the role of ERK5/Mer in mediating efferocytosis 30 , underscoring the complexity of efferocytosis regulation in ALI/ARDS pathophysiology. In this study, we found that LPS can improve macrophage efferosytosis in vitro by activation of UPP1/p-STAT3/TIM4 axis. UPP1 is a central component of the pyrimidine salvage pathway 31 . Recent research has expanded its recognized roles to immune microenvironment modulation, with high UPP1 expression linked to immunosuppressive phenotypes in various cancers 32 . But in ALI/ARDS, the role of UPP1 has not been reported. This study demonstrated the critical role of UPP1 in modulating efferocytosis and relieving lung injury. Notably, although LPS stimulation enhanced efferocytosis in macrophages in vitro , this effect was not significant in vivo . This inconsistent phenomenon may be attributed to the fact that hypoxia and complex immune microenvironment induced by ALI/ARDS can partially inhibit the efferocytosis of macrophages, which is consistent with the previous report 14 . Interesting, study has reported that unlike acute hypoxia, macrophage efferocytosis is enhanced under chronic hypoxic conditions 33 . This finding further demonstrates the complexity of oxygen's regulatory effects on macrophage efferocytosis. During efferocytosis progress, apoptotic cells release "Find-Me" signals (e.g., ATP, LPC) to recruit phagocytes, expose phosphatidylserine (PS) as the core "Eat-Me" signal that binds directly to receptors like TIM4/BAI1 or indirectly to TAM receptors (MerTK, AXL) via Gas6/MFG-E8, while "Don't-Eat-Me" signals (CD47, CD24) on healthy cells prevent erroneous phagocytosis 34,35 . Ligand-receptor binding activates the ELMO1-DOCK180-RAC1 and Stabilin-2-GULP-RAC1 axis to drive actin cytoskeleton rearrangement for engulfment, followed by phagosome maturation via Rab GTPases and LC3-associated phagocytosis (LAP) for efficient degradation, and metabolic adaptations (glucose uptake, fatty acid oxidation) in phagocytes maintain homeostasis and immune silence 35 . TIM4, a T cell immunoglobulin and mucin domain (TIM) family member and one of the phosphatidylserine (PS) receptors, is predominantly expressed on macrophages and binds high-affinity directly to externalized PS on apoptotic cells via its immunoglobulin domain, a conserved "eat-me" signal recognition mechanism in efferocytosis 36 . Previous studies reported that TIM4 enhanced efferocytosis by interacting with MerTK (amplifying PI3K-AKT/RAC1 signaling), synergizing with β1 integrin via Fn1 and drive actin rearrangement 37,38 . In this study, we found that TIM4 played an important role in UPP1 enhanced efferocytosis in ALI/ARDS, which was proven by that AbTIM4 hindered the efferocytosis level and M2 polarization, as well as the effect on anti-inflammatory repair induced by UPP1. This discovery sheds new light on the molecular mechanism underlying UPP1-mediated lung protection and provides a potential therapeutic target for ALI/ARDS. Further exploration of the upstream signaling pathway of TIM4 showed that RNA-seq-based Gene Set Enrichment Analysis of UPP1-overexpressing MH-S cells revealed significant enrichment of the JAK-STAT signaling pathway. Western blot confirmed that UPP1 overexpression increased STAT3 phosphorylation (without affecting total STAT3 protein) in both resting and LPS-stimulated MH-S cells. Using the STAT3 inhibitor Stattic, it was found that Stattic blocked UPP1-mediated promotion of efferocytosis and M2 polarization, down-regulated TIM4 expression, and aggravated inflammation—while having no effect on UPP1 expression. This demonstrated that UPP1 regulates TIM4 expression and its downstream functions by promoting STAT3 phosphorylation, forming a "UPP1-STAT3-TIM4" regulatory axis. UPP1 is a key enzyme in the pyrimidine salvage pathway that catalyzes uridine degradation into uracil and ribose-1-phosphate 39 . The present study demonstrated that STAT3 acts as a critical intermediate in the UPP1-induced enhancement of efferocytosis. The regulatory interaction between UPP1 and STAT3 is intricate and bidirectional. Emerging data indicate STAT3’s capacity to upregulate pyrimidine metabolism-related enzymes by binding conserved promoter motifs, paralleling its regulation of target genes such as UPP1 and SPP1 in inflammatory and oncogenic contexts 40,41 . Conversely, UPP1-mediated enhancement of STAT3 phosphorylation is firmly supported by functional study that UPP1 activates the PI3K/AKT signaling pathway by facilitating AKT-PDK1/PDK2 binding 42 , and AKT-dependent phosphorylation of STAT3 is a key downstream event 43 . In lung adenocarcinoma models, UPP1-driven PI3K/AKT/mTOR activation not only upregulates PD-L1 but also sustains STAT3 signal, amplifying immunosuppressive and pro-survival signals 32 —a mechanism likely relevant to ALI/ARDS, where dysregulated PI3K/AKT/STAT3 signaling exacerbates lung inflammation and injury 44 . Notably, several limitations of this study should be acknowledged. First, the specific molecular mechanism by which UPP1 regulates TIM4 expression or surface localization remains unclear—future studies should explore whether UPP1 affects TIM4 transcription, translation, or post-translational modification (e.g., glycosylation) in macrophages. Second, while we focused on macrophages, TIM4 is also expressed on dendritic cells 45 and B cells 46 , and the contribution of non-macrophage TIM4 to UPP1-enhanced lung repair requires investigation. Third, in vivo validation using TIM4 knockout mice would further confirm the necessity of TIM4 in UPP1-mediated protection, complementing the neutralization experiments with AbTIM4. This study elucidates the regulatory mechanism of macrophage efferocytosis and polarization in LPS-induced ALI/ARDS, identifies UPP1 as a pivotal therapeutic target, and confirms that UPP1 upregulation reverses impaired macrophage efferocytosis to alleviate lung injury. Declarations Acknowledgments The National Natural Science Foundation of China [grant numbers 82270084, 82300107] provided support for this work. Conflict of Interests The authors declare no competing interests. References Fan E, Brodie D, Slutsky AS. Acute Respiratory Distress Syndrome: Advances in Diagnosis and Treatment. JAMA 2018; 319 : 698–710. Al-Husinat L, Azzam S, Al Sharie S, Araydah M, Battaglini D, Abushehab S et al. A narrative review on the future of ARDS: evolving definitions, pathophysiology, and tailored management. Crit Care 2025; 29 : 88. Meyer NJ, Gattinoni L, Calfee CS. Acute respiratory distress syndrome. Lancet 2021; 398 : 622–637. Rampon GL, Simpson SQ, Agrawal R. Prone Positioning for Acute Hypoxemic Respiratory Failure and ARDS: A Review. Chest 2023; 163 : 332–340. Chaudhuri D, Sasaki K, Karkar A, Sharif S, Lewis K, Mammen MJ et al. Corticosteroids in COVID-19 and non-COVID-19 ARDS: a systematic review and meta-analysis. Intensive Care Med 2021; 47 : 521–537. Gorman EA, O’Kane CM, McAuley DF. Acute respiratory distress syndrome in adults: diagnosis, outcomes, long-term sequelae, and management. Lancet 2022; 400 : 1157–1170. Aegerter H, Lambrecht BN, Jakubzick CV. Biology of lung macrophages in health and disease. Immunity 2022; 55 : 1564–1580. Wang L, Wang D, Zhang T, Ma Y, Tong X, Fan H. The role of immunometabolism in macrophage polarization and its impact on acute lung injury/acute respiratory distress syndrome. Front Immunol 2023; 14 : 1117548. Doran AC, Yurdagul A, Tabas I. Efferocytosis in health and disease. Nat Rev Immunol 2020; 20 : 254–267. Schilperoort M, Ngai D, Sukka SR, Avrampou K, Shi H, Tabas I. The role of efferocytosis-fueled macrophage metabolism in the resolution of inflammation. Immunol Rev 2023; 319 : 65–80. Woods PS, Mutlu GM. Differences in glycolytic metabolism between tissue-resident alveolar macrophages and recruited lung macrophages. Front Immunol 2025; 16 : 1535796. Grégoire M, Uhel F, Lesouhaitier M, Gacouin A, Guirriec M, Mourcin F et al. Impaired efferocytosis and neutrophil extracellular trap clearance by macrophages in ARDS. Eur Respir J 2018; 52 : 1702590. Mahida RY, Scott A, Parekh D, Lugg ST, Hardy RS, Lavery GG et al. Acute respiratory distress syndrome is associated with impaired alveolar macrophage efferocytosis. Eur Respir J 2021; 58 : 2100829. Mahida RY, Scott A, Parekh D, Lugg ST, Hardy RS, Lavery GG et al. Acute respiratory distress syndrome is associated with impaired alveolar macrophage efferocytosis. Eur Respir J 2021; 58 : 2100829. Liu X, Ou X, Zhang T, Li X, Qiao Q, Jia L et al. In situ neutrophil apoptosis and macrophage efferocytosis mediated by Glycyrrhiza protein nanoparticles for acute inflammation therapy. J Control Release Off J Control Release Soc 2024; 369 : 215–230. Zheng W, Zhou Z, Guo X, Zuo X, Zhang J, An Y et al. Efferocytosis and Respiratory Disease. Int J Mol Sci 2023; 24 : 14871. Ma J, Ao Y, Yue Z, Wang Z, Hou X, Li H et al. Elevated GFI1 in Alveolar Macrophages Suppresses ACOD1 Expression and Exacerbates Lipopolysaccharide‐Induced Lung Injury in Obesity. Adv Sci 2025; 12 : 2413546. Pan J, Li Z, Zhu M, Guo L, Chen W, Yu L. Vitamin E exerts a mitigating effect on LPS-induced acute lung injury by regulating macrophage polarization through the AMPK/NRF2/NF-κB pathway. Int Immunopharmacol 2025; 159 : 114893. Zeng L, Wang Y, Huang Y, Yang W, Zhou P, Wan Y et al. IRG1/itaconate enhances efferocytosis by activating Nrf2-TIM4 signaling pathway to alleviate con A induced autoimmune liver injury. Cell Commun Signal 2025; 23 : 63. Shen R, Jiang Y, Liu G, Gao S, Sun H, Wu X et al. Single‐Cell Landscape of Bronchoalveolar Lavage Fluid Identifies Specific Neutrophils during Septic Immunosuppression. Adv Sci 2025; 12 : 2406218. Preparation and culture of bone marrow-derived macrophages from mice for functional analysis. STAR Protoc 2021; 2 : 100246. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods San Diego Calif 2001; 25 : 402–408. Wang J-H, Gessler DJ, Zhan W, Gallagher TL, Gao G. Adeno-associated virus as a delivery vector for gene therapy of human diseases. Signal Transduct Target Ther 2024; 9 : 78. Costa Verdera H, Kuranda K, Mingozzi F. AAV Vector Immunogenicity in Humans: A Long Journey to Successful Gene Transfer. Mol Ther J Am Soc Gene Ther 2020; 28 : 723–746. Dhungel BP, Winburn I, Pereira C da F, Huang K, Chhabra A, Rasko JEJ. Understanding AAV vector immunogenicity: from particle to patient. Theranostics 2024; 14 : 1260–1288. Kochergin-Nikitsky K, Belova L, Lavrov A, Smirnikhina S. Tissue and cell-type-specific transduction using rAAV vectors in lung diseases. J Mol Med 2021; 99 : 1057–1071. Muhuri M, Levy DI, Schulz M, McCarty D, Gao G. Durability of transgene expression after rAAV gene therapy. Mol Ther 2022; 30 : 1364–1380. Wang Y, Zhang L-F, Zhang J-J, Yu S-S, Li W-L, Zhou T-J et al. Spontaneous Inflammation Resolution Inspired Nanoparticles Promote Neutrophil Apoptosis and Macrophage Efferocytosis for Acute Respiratory Distress Syndrome Treatment. Adv Healthc Mater 2025; 14 : e2402421. Wang Y, Zhang W, Xu Y, Wu D, Gao Z, Zhou J et al. Extracellular HMGB1 Impairs Macrophage-Mediated Efferocytosis by Suppressing the Rab43-Controlled Cell Surface Transport of CD91. Front Immunol 2022; 13 : 767630. Li J, Shao R, Xie Q, Qin K, Ming S, Xie Y et al. Ulinastatin promotes macrophage efferocytosis and ameliorates lung inflammation via the ERK5/Mer signaling pathway. FEBS Open Bio 2022; 12 : 1498–1508. Strefeler A, Blanco-Fernandez J, Jourdain AA. Nucleosides are overlooked fuels in central carbon metabolism. Trends Endocrinol Metab TEM 2024; 35 : 290–299. Li Y, Jiang M, Aye L, Luo L, Zhang Y, Xu F et al. UPP1 promotes lung adenocarcinoma progression through the induction of an immunosuppressive microenvironment. Nat Commun 2024; 15 : 1200. Wang Y-T, Trzeciak AJ, Rojas WS, Saavedra P, Chen Y-T, Chirayil R et al. Metabolic adaptation supports enhanced macrophage efferocytosis in limited-oxygen environments. Cell Metab 2023; 35 : 316-331.e6. Yang S, Min C, Moon H, Moon B, Lee J, Jeon J et al. Internalization of apoptotic cells during efferocytosis requires Mertk-mediated calcium influx. Cell Death Dis 2023; 14 : 391. Moon B, Yang S, Moon H, Lee J, Park D. After cell death: the molecular machinery of efferocytosis. Exp Mol Med 2023; 55 : 1644–1651. Kim D, Lee S-A, Moon H, Kim K, Park D. The Tim gene family in efferocytosis. Genes Genomics 2020; 42 : 979–986. Moon B, Lee J, Lee S-A, Min C, Moon H, Kim D et al. Mertk Interacts with Tim-4 to Enhance Tim-4-Mediated Efferocytosis. Cells 2020; 9 : 1625. Flannagan RS, Canton J, Furuya W, Glogauer M, Grinstein S. The phosphatidylserine receptor TIM4 utilizes integrins as coreceptors to effect phagocytosis. Mol Biol Cell 2014; 25 : 1511–1522. Nwosu ZC, Ward MH, Sajjakulnukit P, Poudel P, Ragulan C, Kasperek S et al. Uridine-derived ribose fuels glucose-restricted pancreatic cancer. Nature 2023; 618 : 151–158. Xiao X, Qiu T, Cheng Q, Wang W, Fan C, Zuo F. Uridine phosphorylase-1 promotes cell viability and cell-cycle progression in human epidermal keratinocytes via the glycolytic pathway. Clin Exp Pharmacol Physiol 2024; 51 : e13874. Wang T, Kaneko S, Kriukov E, Alvarez D, Lam E, Wang Y et al. SOCS3 regulates pathological retinal angiogenesis through modulating SPP1 expression in microglia and macrophages. Mol Ther J Am Soc Gene Ther 2024; 32 : 1425–1444. Du W, Tu S, Zhang W, Zhang Y, Liu W, Xiong K et al. UPP1 enhances bladder cancer progression and gemcitabine resistance through AKT. Int J Biol Sci 2024; 20 : 1389–1409. Galoczova M, Coates P, Vojtesek B. STAT3, stem cells, cancer stem cells and p63. Cell Mol Biol Lett 2018; 23 : 12. Xie C, Wang T, Liu A, Huang B, Zeng W, Li Z et al. Sirt4 Overexpression Modulates the JAK2/STAT3 and PI3K/AKT/mTOR Axes to Alleviate Sepsis-Induced Acute Lung Injury. Cell Biochem Biophys 2025; 83 : 1785–1798. Caronni N, Piperno GM, Simoncello F, Romano O, Vodret S, Yanagihashi Y et al. TIM4 expression by dendritic cells mediates uptake of tumor-associated antigens and anti-tumor responses. Nat Commun 2021; 12 : 2237. Miyanishi M, Tada K, Koike M, Uchiyama Y, Kitamura T, Nagata S. Identification of Tim4 as a phosphatidylserine receptor. Nature 2007; 450 : 435–439. Table Table 1. Primer sequences of mice. Gene Forward (5’-3’) Reverse (3’-5’) Pla1a ATGGCTCAGCATTGGAAGTTCAG CGGAGGAGGTTGGCACTCTG Car4 GTGCGTGCATTATCGGAGGAGAC TGTGCTCTGAACCGTTGTCATTCC Gstt4 GAATGGCATCCCCTTCGACTTCC AAGATGAACTTGCCGTCCTTGAGG Nos2 ACTCAGCCAAGCCCTCACCTAC TCCAATCTCTGCCTATCCGTCTCG Lipg ACCCAGCCCACCCTCTACATTAC ATCGCCCAAGTCCTCCTCAGTG IL2ra CTTGCTGATGTTGGGGTTTCTCTC TAGGATGGTGCCGTTCTTGTAGG Ido1 ACGGACTGAGAGGACACAGGTTAC CTCGGTTCCACACATACGCCATG Upp1 CTGCTGGCTTCCTTCCTGAT CAGCCACACAGTCACCACAC Hdc TCTACCTCCGACATGCCAACTCTG CCCGAAGGACCGAATCACAAACC IL23r TCCACCAAACTTCCCAAGAAACTG GCACTGAGCATCTCCATCTTCTG Il1b GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT Il6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC Tnf CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG Mcp1 CCCAATGAGTAGGCTGGAGA TCTGGACCCATTCCTTCTTG Il10 GCTCTTACTGACTGGCATGAG CGCAGCTCTAGGAGCATGTG Tgfb1 CTCCCGTGGCTTCTAGTGC GCCTTAGTTTGGACAGGATCTG Nos2 GTTCTCAGCCCAACAATACAAGA GTGGACGGGTCGATGTCAC Mrc1 AAATGGCTTCCTGGAGAGCC ACCCTCCGGTACTACAGCAT Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA Additional Declarations There is no conflict of interest Supplementary Files EMMSupplement.pdf Supplement Figure 1,Supplement Figure 2,Supplement Figure 3,Supplement Figure 4 Graphicalabstract.jpg Graphical abstract Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9171327","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":615756052,"identity":"9a510f0a-0520-40dc-a965-e424d0f46d40","order_by":0,"name":"Yongheng Gao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6ElEQVRIiWNgGAWjYJACZgYDGzk29sYHEO4BorQUpBnz8xw2IEXLh8OJM2ckE6lF3v3wMekCg8OJG24+Zt10s41Bju9GAuPnAjxaDM+kpUnPMEg33nA7me12bhuDseSNBGbpGfi0NOSYSfMYWMtuuJ1/DKQlccONBDZmHnxa+t+AtDAzbrh5GGxLPUEt8hJgW5wVZ85gBmtJMCCkxUDiWbI1jwEokIF+yTknYTjzzMNmaby29CcfvM3zBxSVQIfllNnI8x1PPvgZry0HGFgkkPggNmMDHg1AWxoYmD/gVTEKRsEoGAWjAAB2O0xqP2gZ9QAAAABJRU5ErkJggg==","orcid":"","institution":"Department of Pulmonary and Critical Care Medicine, Tangdu Hospital, Fourth Military Medical University.","correspondingAuthor":true,"prefix":"","firstName":"Yongheng","middleName":"","lastName":"Gao","suffix":""},{"id":615756053,"identity":"24fad80c-6e20-48e2-891b-edcde868b302","order_by":1,"name":"Yifeng Wang","email":"","orcid":"","institution":"Department of Pulmonary and Critical Care Medicine, Tangdu Hospital, Fourth Military Medical University.","correspondingAuthor":false,"prefix":"","firstName":"Yifeng","middleName":"","lastName":"Wang","suffix":""},{"id":615756054,"identity":"005397fd-68fb-427d-867e-c5c999cb6667","order_by":2,"name":"Xian Guo","email":"","orcid":"","institution":"Tangdu Hospital, Fourth MIlitary Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xian","middleName":"","lastName":"Guo","suffix":""},{"id":615756055,"identity":"1f6f60fb-49da-4c31-978e-f307bfc404a2","order_by":3,"name":"Xinxin Wang","email":"","orcid":"","institution":"Department of Pulmonary and Critical Care Medicine, Tangdu hospital, Fourth Military Medical University.","correspondingAuthor":false,"prefix":"","firstName":"Xinxin","middleName":"","lastName":"Wang","suffix":""},{"id":615756056,"identity":"9773ddf1-7931-4e03-acb8-cb8f8d6ac0e5","order_by":4,"name":"Ruoxuan Hei","email":"","orcid":"","institution":"Department of Clinical Laboratory, Tangdu Hospital, Fourth Military Medical University.","correspondingAuthor":false,"prefix":"","firstName":"Ruoxuan","middleName":"","lastName":"Hei","suffix":""},{"id":615756057,"identity":"5f13ffe3-c86e-4644-a439-846da5309c1c","order_by":5,"name":"Jian Chen","email":"","orcid":"","institution":"Department of Pulmonary and Critical Care Medicine, Tangdu hospital, Fourth Military Medical University.","correspondingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Chen","suffix":""},{"id":615756058,"identity":"2de229cc-b8ee-4543-97db-32a2765b496b","order_by":6,"name":"Tongtong Zhang","email":"","orcid":"","institution":"The Second Affiliated Hospital of The Air Force Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Tongtong","middleName":"","lastName":"Zhang","suffix":""},{"id":615756059,"identity":"df3df169-68c8-4682-8e65-9f48ef7d1d6e","order_by":7,"name":"Jiahao Wu","email":"","orcid":"","institution":"Department of Pulmonary and Critical Care Medicine, Tangdu hospital, Fourth Military Medical University.","correspondingAuthor":false,"prefix":"","firstName":"Jiahao","middleName":"","lastName":"Wu","suffix":""},{"id":615756060,"identity":"7eb24ebc-349b-41a0-a943-c241a3c22044","order_by":8,"name":"Jiaying Gao","email":"","orcid":"","institution":"Department of Respiratory and Critical Care Medicine, the First Affiliated Hospital of Army Medical University (Southwest Hospital).","correspondingAuthor":false,"prefix":"","firstName":"Jiaying","middleName":"","lastName":"Gao","suffix":""},{"id":615756061,"identity":"54529662-76b8-4ff9-806c-a748ef3ff5f7","order_by":9,"name":"Fuguo Gao","email":"","orcid":"","institution":"Department of Pulmonary and Critical Care Medicine, The 940th Hospital of the Joint Logistics Support Force of PLA.","correspondingAuthor":false,"prefix":"","firstName":"Fuguo","middleName":"","lastName":"Gao","suffix":""},{"id":615756062,"identity":"aca8a6a1-de16-47c8-a30c-3ec6678801f5","order_by":10,"name":"Yao He","email":"","orcid":"","institution":"Department of Pulmonary and Critical Care Medicine, Tangdu hospital, Fourth Military Medical University.","correspondingAuthor":false,"prefix":"","firstName":"Yao","middleName":"","lastName":"He","suffix":""},{"id":615756063,"identity":"35a1458f-03ec-4308-9912-d6637946ac13","order_by":11,"name":"Danni Sun","email":"","orcid":"","institution":"Department of Pulmonary and Critical Care Medicine, Tangdu hospital, Fourth Military Medical University.","correspondingAuthor":false,"prefix":"","firstName":"Danni","middleName":"","lastName":"Sun","suffix":""},{"id":615756064,"identity":"35eafc7f-f0bb-414a-ba19-5aef052099d9","order_by":12,"name":"Fagunag Jin","email":"","orcid":"","institution":"Air force military medical university, tangdu hospital","correspondingAuthor":false,"prefix":"","firstName":"Fagunag","middleName":"","lastName":"Jin","suffix":""}],"badges":[],"createdAt":"2026-03-19 15:47:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9171327/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9171327/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":106243663,"identity":"63d20143-14d5-40cb-9106-d961e05f681f","added_by":"auto","created_at":"2026-04-06 15:33:13","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3364463,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eScRNA-seq analysis of lung tissue in LPS-induced ALI/ARDS mice.\u003c/strong\u003e (A) UMAP plot of the cell distribution. (B) UMAP plot of the major cell populations. (C) Bubble plot of marker gene expression in each major cell populations. (D) Histograms of the percentage of each major cell populations. (E) Bubble plot of KEGG enrichment analysis of TOP 20 pathway in M1and M2 macrophage populations in extra-pulmonary and pulmonary groups.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-9171327/v1/cafb5fa87c1a02c9df02d819.png"},{"id":106403575,"identity":"dc0e2e58-fad9-4327-a56f-36c6ea7e6ebb","added_by":"auto","created_at":"2026-04-08 09:14:31","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":4566200,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEfferocytosis in ALI/ARDS models \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vitro\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003e(A) Representative H\u0026amp;E-stained mice lung tissue sections (n = 6). Scale bar: 100 μm. (B-C) Representative images and quantification of dual immunofluorescence staining for F4/80 (red) and Tunel (green) in mice lung tissues (n = 6). Scale bar: 20 μm. Statistical analysis was performed (F4/80\u003csup\u003e+\u003c/sup\u003e cells for the number of AMs, Tunel\u003csup\u003e+\u003c/sup\u003e cells for ACs, F4/80\u003csup\u003e+\u003c/sup\u003eTunel\u003csup\u003e+\u003c/sup\u003e for efferocytosis events). (D-E) Flow cytometry gating strategy for BMDMs efferocytosis model in vitro. The percentage of efferocytosis events in each group was statistically analyzed (n = 3). (F) Representative images of immunofluorescence staining for verify the efferocytosis of BMDMs in each group (n = 3). Scale bar: 20 μm. Data represent the mean ± SD. \u003cem\u003en.s.\u003c/em\u003e, not significant, * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, *** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, **** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-9171327/v1/bb41f641c0427ffb67a1d23d.png"},{"id":106403444,"identity":"23606261-57c9-4207-a3aa-9cc952cce645","added_by":"auto","created_at":"2026-04-08 09:14:17","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3711017,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUPP1 is selected as a switch for the efferocytosis and polarization phenotype transition of AMs. \u003c/strong\u003e(A-D, F) BMDMs was pre-treated with Vehicle (Control group) or LPS (1 μg/mL; LPS group) and then co-cultured with ACs. BMDMs that engulfed ACs were isolated by flow cytometry to perform RNA-seq, RT-qPCR, and western-blot analysis (n = 3 mice/each group). (A) Heat map of RNA-seq. The intensity of red indicates higher expression levels, while blue indicates lower. (B) Up: statistical histograms of DEGs. Down: scatter plot of DEGs. (C) Bubble plot of the enriched KEGG pathways from DEGs. (D) RT-qPCR analysis of TOP 10 genes in BMDMs. (E) Flow cytometry analysis of efferocytosis in MH-S cells with \u003cem\u003eUpp1\u003c/em\u003e knockdown. (F) Western-blot analysis of UPP1 in BMDMs. (G) RT-qPCR analysis of \u003cem\u003eUpp1\u003c/em\u003e in MH-S cells pre-treated with 1 μg/mL LPS for 0, 3, 6, 12, and 24 h. (H) Western-blot analysis of UPP1 in MH-S cells pre-treated with 1 μg/mL LPS for 0, 3, 6, 12, and 24 h. (I) Flow cytometry analysis of the percentage of CD86\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e- \u003c/sup\u003eM1 macrophages and CD86\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e+ \u003c/sup\u003eM2 macrophages in MH-S cells with \u003cem\u003eUpp1\u003c/em\u003e knockdown. (J) RT-qPCR analysis of \u003cem\u003eUpp1\u003c/em\u003e, \u003cem\u003eNos2\u003c/em\u003e, \u003cem\u003eMrc1\u003c/em\u003e in MH-S cells with \u003cem\u003eUpp1\u003c/em\u003e knockdown. (K-L) Western-blot analysis of UPP1, iNOS, and CD206 in MH-S cells with \u003cem\u003eUpp1\u003c/em\u003e knockdown. (M) RT-qPCR analysis of pro-inflammatory and anti-inflammatory markers in MH-S cells with \u003cem\u003eUpp1\u003c/em\u003e knockdown. Data represent the mean ± SD. n = 3, \u003cem\u003en.s.\u003c/em\u003e, not significant, * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, *** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, **** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-9171327/v1/e5cfbe458f033047144545b2.png"},{"id":106243670,"identity":"706295b8-f685-4f00-b03e-99d692d61e95","added_by":"auto","created_at":"2026-04-06 15:33:13","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2958226,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eReinforced UPP1 promotes efferocytosis and M2 polarization of AMs. \u003c/strong\u003e(A) Western-blot analysis of the transfection of UPP1 overexpression plasmid in MH-S cells. (B) Flow cytometry analysis of efferocytosis in MH-S cells transfected by UPP1 overexpression plasmid. (C) Flow cytometry analysis of efferocytosis in MH-S cells cultured in 1% O\u003csub\u003e2\u003c/sub\u003e. (D) Flow cytometry analysis of the percentage of CD86\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e- \u003c/sup\u003eM1 macrophages and CD86\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e+ \u003c/sup\u003eM2 macrophages in MH-S cells. (E) RT-qPCR analysis of \u003cem\u003eUpp1\u003c/em\u003e, \u003cem\u003eNos2\u003c/em\u003e, \u003cem\u003eMrc1\u003c/em\u003e in MH-S cells. (F-G) Western-blot analysis of UPP1, iNOS, and CD206 in MH-S cells. (H) RT-qPCR analysis of pro-inflammatory and anti-inflammatory markers in MH-S cells. Data represent the mean ± SD. n = 3, \u003cem\u003en.s.\u003c/em\u003e, not significant, * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, *** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, **** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-9171327/v1/24f279587179cdb4177d8f8d.png"},{"id":106403477,"identity":"81dba47a-5a48-4c65-9c58-ec95a25a27c3","added_by":"auto","created_at":"2026-04-08 09:14:21","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3338715,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUPP1 promotes efferocytosis and M2 polarization of AMs by regulating TIM4. \u003c/strong\u003e(A-C) BMDMs were pre-treated with Vehicle (Control group) or LPS (1 μg/mL; LPS group) and then co-cultured with ACs. BMDMs that engulfed ACs were isolated by flow cytometry to perform RNA-seq, and western-blot analysis (n = 3 mice/each group). (A) Heat map of RNA-seq. Up: the intensity of red indicates TPM values for genes. Down: the color scale represents log\u003csub\u003e2\u003c/sub\u003eFC (LPS/Ctrl). (B-C) Western-blot analysis of TIM4 in BMDMs. (D) Western-blot analysis of TIM4 in MH-S cells with 1 μg/mL LPS for 3, 6, 12, and 24 h. (E) Western-blot analysis of TIM4 for the knockdown group in MH-S cells. (F) Western-blot analysis of TIM4 for the overexpression group. (G-H) Flow cytometry analysis of efferocytosis in MH-S cells. (I-J) Flow cytometry analysis of the percentage of CD86\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e- \u003c/sup\u003eM1 macrophages and CD86\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e+ \u003c/sup\u003eM2 macrophages in MH-S cells. (K) RT-qPCR analysis of \u003cem\u003eUpp1\u003c/em\u003e, \u003cem\u003eNos2\u003c/em\u003e, \u003cem\u003eMrc1\u003c/em\u003e in MH-S cells. (L-M) Western-blot analysis of UPP1, iNOS, and CD206 in MH-S cells. (N) RT-qPCR analysis of pro-inflammatory and anti-inflammatory markers in MH-S cells. Data represent the mean ± SD. n = 3, \u003cem\u003en.s.\u003c/em\u003e, not significant, * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, *** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, **** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-9171327/v1/a44caec1824ab2dbbb8828c3.png"},{"id":106243666,"identity":"ccf00e3d-b89d-4c14-9862-8b16d03c19fe","added_by":"auto","created_at":"2026-04-06 15:33:13","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3267815,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUPP1 enhances the expression of TIM4-mediated efferocytosis and M2 polarization by promoting STAT3 phosphorylation. \u003c/strong\u003e(A-B) MH-S cells were transfected with empty or overexpression plasmids to perform RNA-seq. (A) GSEA analysis of RNA-seq. (B) Heat map of JAK-STAT signaling pathway. The color scale represents log\u003csub\u003e2\u003c/sub\u003eFC (oeUpp1/Vector). (C) Western-blot analysis of t-STAT3 and p-STAT3 for the overexpression group in MH-S cells. (D-E) Flow cytometry analysis of efferocytosis in MH-S cells. (F-G) Flow cytometry analysis of the percentage of CD86\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e- \u003c/sup\u003eM1 macrophages and CD86\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e+ \u003c/sup\u003eM2 macrophages in MH-S cells. (H) RT-qPCR analysis of \u003cem\u003eUpp1\u003c/em\u003e, \u003cem\u003eNos2\u003c/em\u003e, \u003cem\u003eMrc1\u003c/em\u003e in MH-S cells. (I-J) Western-blot analysis of t-STAT3, p-STAT3, UPP1, TIM4, iNOS, and CD206 in MH-S cells. (K) RT-qPCR analysis of pro-inflammatory and anti-inflammatory markers in MH-S cells. Data represent the mean ± SD. n = 3, \u003cem\u003en.s.\u003c/em\u003e, not significant, * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, *** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, **** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-9171327/v1/a54ccce518fc855e3ff02d38.png"},{"id":106243671,"identity":"a0798faa-e841-4fee-a896-d89688e30613","added_by":"auto","created_at":"2026-04-06 15:33:13","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":4855352,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eUpp1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e alveolar-macrophage-specific knockdown exacerbated LPS-induced ALI/ARDS.\u003c/strong\u003e (A) Statistical analysis of weight changes before and after LPS treatment, calculated as (BW2-BW1) / BW1 × 100%. (B) Lung index (LI), calculated as 100 × (WW / BW2). (C) Representative H\u0026amp;E-stained lung tissue sections. Scale bar: 50 μm. (D-E) ELISA analysis of pro-inflammatory cytokines (IL-1β, IL-6, TNF-α) and anti-inflammatory cytokines (IL-10, TGF-β) levels in lung homogenates (D) and BALF (E). (F-G) Representative images and quantification of dual immunofluorescence staining for F4/80 (red) and Tunel (green) in mice lung tissues. Scale bar: 20 μm. Statistical analysis was performed (F4/80\u003csup\u003e+\u003c/sup\u003e cells for the number of AMs, Tunel\u003csup\u003e+\u003c/sup\u003e cells for ACs, F4/80\u003csup\u003e+\u003c/sup\u003eTunel\u003csup\u003e+\u003c/sup\u003e for efferocytosis events). (H-I) Representative images and quantification of dual immunofluorescence staining for F4/80 (red) and CD206 (green) in lung tissues. Scale bar: 20 μm. Statistical analysis was performed (F4/80\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e+\u003c/sup\u003e for M2 macrophages). (J-K) Representative images and quantification of dual immunofluorescence staining for F4/80 (red) and iNOS (green) in lung tissues. Scale bar: 20 μm. Statistical analysis was performed (F4/80\u003csup\u003e+\u003c/sup\u003eiNOS\u003csup\u003e+\u003c/sup\u003e for M1 macrophages). Data represent the mean ± SD. n = 6, \u003cem\u003en.s.\u003c/em\u003e, not significant, * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, *** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, **** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-9171327/v1/599e7e1cb1662ac01e723909.png"},{"id":106243672,"identity":"aafa4e97-58bd-4627-b396-9de4f3db2c0c","added_by":"auto","created_at":"2026-04-06 15:33:13","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":7740337,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eUpp1 \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ealveolar-macrophage-specific overexpression gene therapy promotes lung injury repair of LPS-induced ALI/ARDS, while Tim4-blocking inhibites the positive effect. \u003c/strong\u003e(A) Statistical analysis of weight changes before and after LPS treatment, calculated as (BW2-BW1) / BW1 × 100%. (B) Lung index (LI), calculated as 100 × (WW / BW2). (C) Representative H\u0026amp;E-stained lung tissue sections. Scale bar: 50 μm. (D-E) ELISA analysis of pro-inflammatory cytokines (IL-1β, IL-6, TNF-α) and anti-inflammatory cytokines (IL-10, TGF-β) levels in lung homogenates (D) and BALF (E). (F-G) Representative images and quantification of dual immunofluorescence staining for F4/80 (red) and Tunel (green) in mice lung tissues. Scale bar: 20 μm. Statistical analysis was performed (F4/80\u003csup\u003e+\u003c/sup\u003e cells for the number of AMs, Tunel\u003csup\u003e+\u003c/sup\u003e cells for ACs, F4/80\u003csup\u003e+\u003c/sup\u003eTunel\u003csup\u003e+\u003c/sup\u003e for efferocytosis events). (H-I) Representative images and quantification of dual immunofluorescence staining for F4/80 (red) and CD206 (green) in lung tissues. Scale bar: 20 μm. Statistical analysis was performed (F4/80\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e+\u003c/sup\u003e for M2 macrophages). (J-K) Representative images and quantification of dual immunofluorescence staining for F4/80 (red) and iNOS (green) in lung tissues. Scale bar: 20 μm. Statistical analysis was performed (F4/80\u003csup\u003e+\u003c/sup\u003eiNOS\u003csup\u003e+\u003c/sup\u003e for M1 macrophages). Data represent the mean ± SD. n = 6, \u003cem\u003en.s.\u003c/em\u003e, not significant, * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, *** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, **** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-9171327/v1/89700ca51a9a3180b3aa33df.png"},{"id":108012932,"identity":"a58b3ce4-87e4-4c08-aff7-c18340fd779c","added_by":"auto","created_at":"2026-04-28 13:16:54","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":33909322,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9171327/v1/c13c587b-0845-494c-8e3f-338c8344e1fa.pdf"},{"id":106243665,"identity":"fdcb9761-a2d6-48b3-8ec6-3ec492523cb2","added_by":"auto","created_at":"2026-04-06 15:33:13","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":742311,"visible":true,"origin":"","legend":"Supplement Figure 1\u0026#xFF0C;Supplement Figure 2\u0026#xFF0C;Supplement Figure 3\u0026#xFF0C;Supplement Figure 4","description":"","filename":"EMMSupplement.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9171327/v1/e641145f2dfa5c746ba712c6.pdf"},{"id":106403139,"identity":"992ebf72-8c23-4bdd-94df-1710469533f7","added_by":"auto","created_at":"2026-04-08 09:13:39","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":91194,"visible":true,"origin":"","legend":"\u003cp\u003eGraphical abstract\u003c/p\u003e","description":"","filename":"Graphicalabstract.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9171327/v1/fa77431437ebb7355b42961d.jpg"}],"financialInterests":"There is no conflict of interest","formattedTitle":"Role of UPP1 triggering TIM4-mediated efferocytosis and M2 polarization in alveolar macrophages to promote the resolution of inflammation in acute lung injury/acute respiratory distress syndrome","fulltext":[{"header":"1.\tIntroduction","content":"\u003cp\u003eAcute lung injury (ALI) and acute respiratory distress syndrome (ARDS) represent a spectrum of life-threatening acute respiratory failure characterized by diffuse alveolar epithelial and endothelial damage, non-cardiogenic pulmonary edema, and refractory hypoxemia\u003csup\u003e1,2\u003c/sup\u003e. As a major challenge in clinical critical care, ALI/ARDS affects over millions of patients annually in the world, with mortality rates ranging from 30% to 60%—and even exceeding 60% among critically ill patients with COVID-19-associated ARDS\u003csup\u003e3–5\u003c/sup\u003e. Despite decades of research, the only therapeutic intervention proven to improve survival is lung-protective mechanical ventilation, while pharmacologic therapies have failed to consistently translate into clinical benefits. This therapeutic stagnation is primarily attributed to an incomplete understanding of the complex pathophysiological mechanisms underlying ALI/ARDS, particularly the dysregulated inflammatory responses and impaired tissue repair processes that drive disease progression\u003csup\u003e2,6\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eMacrophages, as central regulators of lung immunity, play a dual role in ALI/ARDS pathogenesis: initiating pro-inflammatory responses in the acute phase and mediating anti-inflammatory tissue repair in the resolution phase\u003csup\u003e7,8\u003c/sup\u003e. A key functional attribute of macrophages—efferocytosis (the phagocytic clearance of apoptotic cells)—has emerged as a potential linchpin in ALI/ARDS progression and resolution\u003csup\u003e9,10\u003c/sup\u003e. Efficient efferocytosis is critical to preventing secondary necrosis of apoptotic cells, which would otherwise release pro-inflammatory alarmins and perpetuate tissue damage\u003csup\u003e11\u003c/sup\u003e. Clinical evidence directly links defective efferocytosis to ARDS severity, namely that alveolar macrophages (AMs) from ARDS patients exhibit a significantly reduced efferocytosis index (7.6% vs. 22.7% in sepsis patients without ARDS), which correlates with increased alveolar neutrophil apoptosis and elevated levels of pro-inflammatory cytokines (e.g., IL-8, IL-1)\u003csup\u003e12\u003c/sup\u003e. In preclinical and clinical studies of ARDS, impaired efferocytosis is consistently associated with sustained inflammation and poor outcomes\u003csup\u003e13\u003c/sup\u003e, supporting the hypothesis that enhancing efferocytosis could mitigate ALI/ARDS pathology\u003csup\u003e12,14,15\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eDespite the growing recognition of efferocytosis as a therapeutic target, critical gaps in knowledge persist, limiting the development of targeted interventions. Among these, one of the most critical problems is that the key molecular regulators governing macrophage efferocytosis in ALI/ARDS are not fully elucidated. While molecules such as MerTK, GAS6, and AXL have been implicated in efferocytosis in other contexts, their specific roles in ALI/ARDS-associated efferocytosis defects remain poorly characterized\u003csup\u003e16\u003c/sup\u003e. Are there any novel key molecules that mediate the efferocytosis process in ALI/ARDS and thereby affect this progress? Addressing these knowledge gaps is essential to advance our understanding of ALI/ARDS pathophysiology and develop novel therapeutic strategies. This study aims to synthesize current evidence on macrophage efferocytosis in ALI/ARDS, highlight unresolved questions regarding its temporal regulation and molecular mechanisms, and underscore the translational potential of targeting this process to improve patient outcomes.\u003c/p\u003e"},{"header":"2.\tMaterials and methods","content":"\u003ch1\u003e2.1. Single-cell RNA sequencing (scRNA-seq) analysis\u003c/h1\u003e\n\u003cp\u003eData source:\u0026nbsp;GSE264032 from the gene expression omnibus (GEO) database contains lung tissues from 3 mice. They were classified into the pulmonary group (the model constructed by intratracheal injection of LPS) with a mice, the extrapulmonary group (the models constructed by intraperitoneal injection of LPS) with a mice and the control group with a mice.\u003c/p\u003e\n\u003cp\u003eRaw sequence reads in FASTQ format from 3 lung tissues were processed and aligned to the reference transcriptome (GCF_000001635.26_GRCm38.p6) available at the National Center for Biotechnology Information (NCBI) using the Cellranger v7.1.0 pipeline (https://www.10xgenomics.com/) with default parameters. The resulting gene expression matrices merged together using Seurat package v5. the pre-processing followed the guidelines provided by Seurat V5 tutorial. In short entries with fewer than 400 genes and greater than 7500 total genes were filtered to remove empty droplets and probable doublets, respectively, and cells that have \u0026gt;20% mitochondrial counts were also filtered to remove low quality cells. To account for differences in sequencing depth across samples, we normalized expression values for total unique molecular identifiers (UMIs) per cell and log transformed the counts using \u0026ldquo;Seurat Normalize Data\u0026rdquo; function.\u003c/p\u003e\n\u003cp\u003eClustering and identification of cell types:\u0026nbsp;For cell clustering, normalized and scaled data were utilized to identify highly variable features using the \u0026ldquo;FindVariableFeatures\u0026rdquo; function (nfeatures = 2000). And followed this, dimensionality reduction was performed using these features. The resulting cell clusters were visualized using the uniform manifold approximation and projection (UMAP) method and annotated by examining the expression of known marker genes.\u003c/p\u003e\n\u003cp\u003eDifferential expression and functional enrichment analysis: To identify differential expression genes (DEGs), we used the \u0026ldquo;Seurat FindMarkers\u0026rdquo; function based on Wilcox likelihood-ratio test with default parameters, and selected the genes as DEGs with p_adj value \u0026lt; 0.05 and |log2FC| \u0026gt; 0.25, where log\u003csub\u003e2\u003c/sub\u003eFC \u0026gt; 0.25 indicated upregulated genes and log2FC \u0026lt; -0.25 indicated downregulated genes. To investigate the potential functions of DEGs, the gene ontology (GO) and kyoto encyclopedia of genes and genomes (KEGG) analysis were used with \u0026ldquo;ClusterProfiler\u0026rdquo; R package. Pathways with p.adj value \u0026lt; 0.05 were considered as significantly enriched.\u003c/p\u003e\n\u003ch1\u003e2.2. Animals and design\u003c/h1\u003e\n\u003cp\u003eThe animals used in this study and the experimental procedures involved had been approved by the Air Force Medical University Animal Care and Use Committee [Approval Number: 20250196], and strictly followed the National Institutes of Health Animal Care Guidelines and Animal Euthanasia Guidelines. Healthy male C57BL/6 mice (4 or 6-8 weeks) selected for the experiment were purchased from Shaanxi Shanyao Medical Biotechnology Co., Ltd (Shaanxi, China) and housed under the SPF conditions (temperature of 22 \u0026plusmn; 2 ℃, humidity of 55% \u0026plusmn; 10%, and 12 h of light/dark cycle). After an adaptation period of no less than 3 days, mice were subjected to the experiment.\u003c/p\u003e\n\u003cp\u003eHanbio Biotechnology (Shanghai, China) assisted in the construction and production of the gene knockdown or overexpressed recombinant adeno-associated virus (rAAV) vector targeting AMs. The alveolar-macrophage-specific knockdown system (AAV-F4/80-mir30-siUpp1) carried the alveolar-macrophage-specific promoter F4/80\u0026nbsp;\u003csup\u003e17\u003c/sup\u003e and the target sequence for \u003cem\u003eUpp1\u003c/em\u003e knockdown (5\u0026rsquo;-CGGAGUUGAGCAUGUTT-3\u0026rsquo;). The alveolar-macrophage-specific overexpression system (AAV-F4/80-oeUpp1-3xflag) carried F4/80, the target sequence for \u003cem\u003eUpp1\u003c/em\u003e overexpression (NM_001159402) and flag tags. The control system (AAV-F4/80-siNC or AAV-F4/80-oeNC) did not carry flag tags. rAAV was delivered to the lungs through the airway to modify specific genes of AMs. Inject 50-70 \u0026mu;L (1\u0026times;10\u003csup\u003e11\u003c/sup\u003e vg) of AAV in PBS suspension into the airway of healthy male C57BL/6 mice (4 weeks) using a 22G endotracheal intubation needle. On the 28th day of virus infection, the knockdown and overexpression efficiency were validated by RT-qPCR or fluorescent labeling with flag tags, respectively.\u003c/p\u003e\n\u003cp\u003eLPS (5 mg/kg; L2880, Sigma-Aldrich, USA) was administered via non-invasive tracheal intubation for 24 h to establish an LPS-induced ALI/ARDS mice model, while the control group received an equal volume of PBS\u003csup\u003e18\u003c/sup\u003e. IgG2b (0.5 mg/mice; BE0090, Bio X Cell, West Lebanon, NH) and AbTIM4 (0.5 mg/mice; BE0171, Bio X Cell, West Lebanon, NH) were administered via non-invasive endotracheal intubation 1 h before LPS administration\u0026nbsp;\u003csup\u003e19\u003c/sup\u003e . Mice were randomly divided into 11 groups (n = 6/group): (1) Control group treated with PBS; (2) LPS group treated with LPS dissolved in PBS; (3) AAV-siNC + Ctrl group treated with AAV-F4/80-siNC and PBS; (4) AAV-siUpp1 + Ctrl group treated with AAV-F4/80-mir30-siUpp1 and PBS; (5) AAV-siNC + LPS group treated with AAV-F4/80-siNC and LPS; (6) AAV-siUpp1 + LPS group treated with AAV-F4/80-mir30-siUpp1 and LPS; (7) AAV-oeNC + Ctrl + IgG2b group treated with AAV-F4/80-oeNC, IgG2b, and PBS; (8) AAV-oeUpp1 + Ctrl + IgG2b group treated with AAV-F4/80-oeUpp1-3xflag, IgG2b, and PBS; (9) AAV-oeNC + LPS + IgG2b group treated with AAV-F4/80-oeNC, IgG2b, and LPS; (10) AAV-oeUpp1 + LPS + IgG2b group treated with AAV-F4/80-oeUpp1-3xflag, IgG2b, and LPS; (11) AAV-oeUpp1 + LPS + AbTIM4 group treated with AAV-F4/80-oeUpp1-3xflag, AbTIM4, and LPS. We collected data on body weight (BW; BW1 and BW2 are the body weights of the mice before and after LPS administration, respectively) of mice, wet weight (WW) of the entire lung, and obtained mice orbital blood, bronchoalveolar lavage fluid (BALF) and lung tissue. Among them, BALF and lung tissue were collected from different batches of experimental groups.\u003c/p\u003e\n\u003ch1\u003e2.3. Weight change and Lung Index (LI)\u003c/h1\u003e\n\u003cp\u003eWeight changes can comprehensively evaluate the severity of systemic pathophysiological stress in mice, including systemic inflammatory depletion, decreased appetite and dehydration, fluid leakage and loss, etc. Lung index (LI) is one of the gold standards for evaluating the severity or treatment effectiveness of ALI/ARDS. LI can quantitatively evaluate the degree of pulmonary edema, and an increase in LI indicates an increase in pulmonary vascular permeability, which is positively correlated with the degree of pulmonary edema. Weight change is calculated as (BW2-BW1) / BW1 \u0026times; 100%. LI = 100 \u0026times; WW / BW2.\u003c/p\u003e\n\u003ch1\u003e2.4. Enzyme-linked immunosorbent assay (ELISA)\u003c/h1\u003e\n\u003cp\u003eTo quantify the pro-inflammatory cytokines (IL-1\u0026beta;, IL-6, and TNF-\u0026alpha;) and anti-inflammatory cytokines (IL-10 and TGF-\u0026beta;) in lung homogenates and BALF, ELISA was performed with specified kits (88-7013, 88-7064, 88-7324, 88-7105, and 88-8350 Thermo Fisher Scientific, USA). Prior to analysis, lung tissues were processed into homogenates using PBS with protease inhibitors (1:9, w/v) and then centrifuged at 4 \u0026deg;C (12000\u0026times;g, 20 min). The supernatant was collected to assay following the instructions. The obtained cytokine levels were then adjusted against the total protein concentration determined by the BCA method (G2026, Servicebio, China), with results expressed in picograms per milligram of protein (pg/mg prot). BALF was collected by washing the lung with 1 mL pre-cold PBS through the trachea, repeating three times\u0026nbsp;\u003csup\u003e20\u003c/sup\u003e. Then the fluid was centrifuged at 4 \u0026deg;C (500\u0026times;g, 10 min) and the supernatant was collected for the cytokine detection, with results expressed in pg/mL.\u003c/p\u003e\n\u003ch1\u003e2.5. Histological analysis\u003c/h1\u003e\n\u003cp\u003eAfter fixation with 4% paraformaldehyde (PFA) at room temperature for 24-48 h, the freshly separated left lung tissues were embedded in paraffin and cut into 5 \u0026mu;m sections. These sections were then stained with the hematoxylin and eosin (HE) staining kit (C0105S, Beyotime, China) according to the instruction manual. The stained sections were imaged by Nikon Eclipse C1 (Nikon, Japan) and analyzed by CaseViewer system (3DHISTECH Ltd., Budapest, Hungary).\u003c/p\u003e\n\u003ch1\u003e2.6. Immunofluorescence (IF)\u003c/h1\u003e\n\u003cp\u003eLung tissue sections embedded in paraffin were prepared as described in section 2.5, and performed the steps of dewaxing, hydration, and antigen repair. Sections were blocked with 3% bovine serum albumin (BSA; GC305010, Servicebio, China) at room temperature for 30 min, and incubated overnight at 4 \u0026deg;C with the following primary antibodies: F4/80 (1:500, GB113373, Servicebio, China), flag (1:500, GB15938, Servicebio, China), UPP1 (1:500, 14186-1-AP, Proteintech, Wuhan, China), iNOS (1:500, GB13594, Servicebio, China), CD206 (1:500, GB113497, Servicebio, China). On the second day, sections were incubated with the corresponding fluorescent conjugated secondary antibody at room temperature for 1 h in the dark. Or the Tunel assay kit (G1504, Servicebio, China) was used to label apoptotic cells. The secondary antibody information is as follows: CY3 labeled goat anti rabbit IgG (1:300, GB21303, Servicebio, China) for F4/80, Alexa Fluor 488 labeled goat anti mouse IgG (1:400, GB25301, Servicebio, China) for flag, HRP labeled goat anti rabbit IgG (1:500, GB23303, Servicebio, China) for UPP1, iNOS, and CD206. After counterstaining the cell nucleus with DAPI (G1012, Servicebio, China) at room temperature for 10 min, the sections were finally mounted with anti-fluorescence quenching sealing agent (G1401, Servicebio, China). The stained sections were imaged by Nikon Eclipse C1 (Nikon, Japan) and analyzed by CaseViewer system (3DHISTECH Ltd., Budapest, Hungary).\u003c/p\u003e\n\u003cp\u003eTo evaluate the infection efficiency of rAAV in mice lungs, we isolated left lung tissue for immunofluorescence staining on the 28th day of virus infection. The percentage of flag (green) and F4/80 (red) double positive cells to the number of F4/80 single positive cells in lung was used to evaluate the efficiency of viral infection. After LPS administration, we represented the protein expression level of UPP1 by the percentage of UPP1 (green) and F4/80 (red) double positive cells to the number of F4/80 single positive cells in lung. The percentage of iNOS/CD206 (green) and F4/80 (red) double positive cells to the number of F4/80 single positive cells in lung was used to evaluate the M1/M2 polarization phenotype.\u003c/p\u003e\n\u003cp\u003eTo evaluate the efferocytosis of LPS-induced ALI/ARDS model in vivo, we labeled AMs and apoptotic cells with F4/80 and Tunel, respectively. Tunel (green) and F4/80 (red) double positive cells represent efferocytosis events, and the percentage of that to the number of F4/80 single positive cells in lung was used to evaluate the efferocytosis level of AMs.\u003c/p\u003e\n\u003ch1\u003e2.7. Cell culture\u0026nbsp;\u003c/h1\u003e\n\u003ch1\u003e2.7.1. Primary extraction, differentiation culture, and identification of bone marrow-derived macrophages (BMDMs)\u003c/h1\u003e\n\u003cp\u003eBone marrow-derived macrophages (BMDMs) were isolated from the tibia, fibula, and femur of healthy male C57BL/6 mice (6-8 weeks)\u0026nbsp;\u003csup\u003e21\u003c/sup\u003e, and treated with 10% fetal bovine serum (FBS; C04001, VivaCell), 1% penicillin streptomycin solution (P/S; P1400, Solarbio, China), and 20 ng/mL recombinant protein macrophage colony-stimulating factor (M-CSF; 315-02, PEPROTECH, USA) for 7 days. The cells were maintained in a moist incubator containing 5% CO\u003csub\u003e2\u003c/sub\u003e at a temperature of 37\u0026deg;C. Differentiated and mature BMDMs were identified by flow cytometry (F4/80 and CD11b double positive cell ratio \u0026gt; 95%) and cell immunofluorescence.\u003c/p\u003e\n\u003cp\u003eBMDMs were collected, washed, and resuspended in pre-cooled Cell Staining Buffer (E-CK-A107, Elabscience, China) at a density of 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells/100 \u0026mu;L. Cell suspension were incubated with FITC labeled anti mouse F4/80 antibody (1:200, 123107, BioLegend, USA) and PE labeled anti mouse CD11b antibody (1:100, 101207, BioLegends, USA) in the dark at 4 \u0026deg;C for 30 min. After washing unbound antibodies and resuspending, stained cells were analyzed on the flow cytometry system of NovoCyte (Agilent, China). The data was analyzed and performed by FlowJo 10.8.1 software (BD Biosciences). The results were shown in Supplementary Figure 1A.\u003c/p\u003e\n\u003cp\u003eBMDMs were seeded onto the slides in 24-well plate at a density of 5\u0026times;10\u003csup\u003e5\u0026nbsp;\u003c/sup\u003ecells/well, and surface markers of macrophages were detected by immunofluorescence staining on the 7th day of culture. Cells were fixed with 4% PFA at room temperature for 15 min and permeabilized in PBS containing 0.3% Triton X-100 for 5 min. Cells were sealed with 5% BSA at room temperature for 30 min to eliminate non-specific binding. Cells were incubated overnight with F4/80 (1:400, 29414-1-AP, Proteintech, Wuhan, China) at 4 ℃, and on the second day, incubated with HRP labeled goat anti rabbit IgG (1:500, GB23303, Servicebio, China) at room temperature for 1 h in dark. Finally, the cell nuclei were observed and photographed after Hoechst counterstaining. The results were shown in Supplementary Figure 1B.\u003c/p\u003e\n\u003ch1\u003e2.7.2. Cultivation of MH-S cells\u003c/h1\u003e\n\u003cp\u003eThe mice alveolar macrophage cell line MH-S (iCell-m078, Shanghai, China) was purchased from iCell Bioscience Co., Ltd (Shanghai, China). The cells were cultured in RPMI 1640 medium (11875093, Gibco, USA) supplemented with 10% FBS and 1% P/S, and maintained in a moist incubator containing 5% CO\u003csub\u003e2\u003c/sub\u003e at a temperature of 37 \u0026deg;C. Cells are passaged every other day. Before the experiment, the cells were harvested, counted, and seeded into a 6-well plate (1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells/well).\u003c/p\u003e\n\u003ch1\u003e2.8. Induction of apoptosis and identification of Jurkat cells\u003c/h1\u003e\n\u003cp\u003eThe human T-cell leukemia cell line Jurkat (clone E6-1, iCell-h117, Shanghai, China) was purchased from iCell Bioscience Co., Ltd (Shanghai, China). The cells were cultured in specialized medium (iCell-h117-001b, Shanghai, China) and maintained in a moist incubator containing 5% CO\u003csub\u003e2\u003c/sub\u003e at a temperature of 37 \u0026deg;C. Cells are passaged every 3 days in a semi liquid exchange manner. Jurkat cells were induced to apoptosis by UVC irradiation and identified according to the instructions of Annexin V-FITC/PI dual staining cell apoptosis detection kit (BB-4101, Bestbio, China). The results were shown in Supplementary Figure 1C.\u003c/p\u003e\n\u003ch1\u003e2.9. Evaluation of efferocytosis \u003cem\u003ein vitro\u003c/em\u003e\u0026nbsp;\u003c/h1\u003e\n\u003cp\u003eBMDMs/MH-S cells and apoptotic Jurkat cells treated with specific conditions were prepared as described above. Apoptotic Jurkat cells labeled with Annexin V-APC (BB-41025, Bestbio, China) and BMDMs/MH-S cells were co-cultured at a ratio of 5:1 for a specific period of time. Then we labeled BMDMs/MH-S cells with FITC labeled anti mouse F4/80 antibodies (1:200, 123107, BioLegend, USA). The efferocytosis of macrophages was determined by flow cytometry. In addition, to visualize the efferocytosis of BMDMs, we labeled apoptotic Jurkat cells with Dil (D282, Thermo Fisher Scientific, USA) and labeled BMDMs using the method described in section 2.7.1. Cells co-located with F4/80 and Dil were considered as efferocytosis events.\u003c/p\u003e\n\u003ch1\u003e2.10. Strategy of flow sorting and RNA sequencing\u003c/h1\u003e\n\u003cp\u003eSamples were prepared as described in section 2.9. Efferocytosis events in BMDMs were sorted by the flow cytometry sorting system of BD FACSARia (BD Biosciences). The sorted cell samples (n = 3 samples/group) were mixed with 1 mL RNAiso Plus (9109, Takara, Japan) and frozen in liquid nitrogen, and stored at -80 ℃. After RNA extraction, quality control, and reverse transcription, a micro cDNA library was constructed and sequenced on the Illumina sequencing platform of Genedenovo Biotechnology Co., Ltd. (Guangzhou, China). Bioinformatics analysis and graphic rendering were completed on cloud platform (https://www.omicshare.com/tools/).\u003c/p\u003e\n\u003ch1\u003e2.11. Evaluation of macrophage polarization \u003cem\u003ein vitro\u003c/em\u003e\u003c/h1\u003e\n\u003cp\u003eMH-S cells treated under specific conditions were collected, washed, and resuspended in pre-cooled Cell Staining Buffer at a density of 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells/100 \u0026mu;L. FITC labeled anti mouse CD86 antibody (1:100, 105006, BioLegend, USA) and APC labeled anti mouse CD206 antibody (1:100, 141708, BioLegends, USA) were added to the cell suspension and the mixed system was incubated at 4 \u0026deg;C for 30 min in the dark. The proportion of M1 (CD86\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e-\u003c/sup\u003e) and M2 (CD86\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e+\u003c/sup\u003e) macrophages were analyzed by flow cytometry.\u003c/p\u003e\n\u003ch1\u003e2.12. Reverse transcription quantitative polymerase chain reaction (RT-qPCR)\u003c/h1\u003e\n\u003cp\u003eTotal RNA was extracted from cell samples according to the instructions of the RNA extraction kit (AN51L518, Life iLab, China), and the quality of RNA was detected by the Nano Drop system (Thermo Fisher Scientific, USA). After synthesizing cDNA by the mRNA reverse transcription kit (RR092A, Takara, Japan), RT-qPCR was executed with the TB Green\u0026trade; Premix Ex Taq\u0026trade; II (RR820A, Takara, Japan) on a Roche Light Cycler 480 platform. The program was performed as follows: pre-denaturation at 95 \u0026deg;C for 30 sec (1 cycle); denaturation at 95 \u0026deg;C for 5 sec and annealing/extension at 60 \u0026deg;C for 30 sec (40 cycles). The expression was normalized to the \u003cem\u003eGapdh\u003c/em\u003e and analyzed using the comparative 2\u003csup\u003e-\u0026Delta;\u0026Delta;Cq\u003c/sup\u003e method\u0026nbsp;\u003csup\u003e22\u003c/sup\u003e. The primer sequences are listed in Table 1.\u003c/p\u003e\n\u003ch1\u003e2.13. Western blot (WB)\u003c/h1\u003e\n\u003cp\u003eThe cell pellet was lysed on ice for 15 min using RIPA lysis buffer (P0013B, Beyotime, China) containing 1% phenylmethylsulfonyl fluoride (PMSF; ST507, Beyotime, China). The lysate was centrifuged (12000\u0026times;g at 4 \u0026deg;C for 15 min) and the protein concentration was measured on the Nano Drop system. The protein was separated by 10% SDS-PAGE and transferred onto the PVDF membrane (ISEQ00010, Millipore, USA). After being sealed with 5% skim milk at room temperature for 1 h, the membranes were incubated with primary antibody at 4 \u0026deg;C overnight. The information of primary antibodys was as followed: Alpha Tubulin (1:5000, 80762-1-RR, Proteintech, China), UPP1 (1:500, 56941, SAB, China), TIM4 (1:500, bs-6197R, Bioss, China), CD206 (1:1000, 24595, CST, USA), iNOS (1:1000, 68186, CST, USA), total STAT3 (1:1000, 12640, CST, USA), and phospho-STAT3-Tyr705 (1:1000, 9145, CST, USA). Then the membranes were incubated with HRP coupled secondary antibody (1:3000, M21002, Abmart, China) at room temperature for 2 h. Finally, the membranes were developed by using ECL reagent (WBKLS0500, Millipore, USA) and chemiluminescence imaging system (Tanon 5200 Multi, Tanon, Shanghai, China). The bands were quantitatively analyzed for grayscale by using ImageJ software (version 1.8.0_322, National Institutes of Health, USA).\u003c/p\u003e\n\u003ch1\u003e2.14. Statistical analysis\u003c/h1\u003e\n\u003cp\u003eStatistical analysis was carried out using GraphPad Prism software (version 9.0), with data presentes as mean \u0026plusmn; standard deviation (SD). Comparisons between two groups were assessed by a two-tailed unpaired Student\u0026apos;s t-test. Multi-group comparisons were evaluated through one-way ANOVA followed by Tukey\u0026apos;s post hoc test. Significance thresholds were set at p \u0026lt; 0.05.\u003c/p\u003e"},{"header":"3.\tResults","content":"\u003cp\u003e3.1. Single-cell RNA sequencing analysis of lung tissue in LPS-induced ALI/ARDS mice\u003c/p\u003e\n\u003cp\u003eAfter preliminary evaluation and quality control, we selected 32375 cells from the GSE264032 dataset for further analysis, including 13726 cells from the control group, 12539 cells from the extra-pulmonary group, and 6110 cells from the pulmonary group (Figure 1A). Using UMAP method to reduce dimensionality and annotate 11 cell types, including: Alveolar type 1 epithelial cell (AT1), Alveolar type 2 epithelial cell (AT2), Neutrophil, Monocyte, B cell, T cell, Myofibroblast, Fibroblast, Endothelial cell, M1 Macrophage, and M2 Macrophage (Figure 1B). In addition, we selected a small number of marker genes to validate the rationality of cell clustering (Figure 1C). In the cell composition distribution map, we found that the proportion of M2 macrophages increased in both the extra-pulmonary and pulmonary groups, while the proportion of M1 macrophages decreased (Figure 1D). KEGG enrichment analysis showed that the down-regulated DEGs in both extra-pulmonary and pulmonary macrophage populations were enriched in pathways related to efferocytosis, such as: Lysosome, Fc gamma R-mediated phagocytosis, Efferocytosis, and Autophagy pathway (Figure 1E).\u003c/p\u003e\n\u003cp\u003e3.2. Efferocytosis in ALI/ARDS models \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eBased on the aforementioned bioinformatics analysis results, in order to clarify the role of efferocytosis in the ALI/ARDS model, we first constructed an ALI/ARDS mice model by non-invasive tracheal intubation and infusion of LPS (5 mg/kg). Through HE staining of mice lung tissue, it was observed that the LPS group had complete destruction of alveolar structure, thickening of alveolar septa, infiltration of numerous inflammatory cells, alveolar hemorrhage, and formation of protein exudate and transparent membrane (Figure 2A). The core principle of Tunel staining is to directly detect the characteristic event of nuclear DNA breakage during cell apoptosis at the molecular level. Therefore, we designed an immunofluorescence staining scheme to label AMs and apoptotic cells with F4/80 (red) and Tunel (green), respectively. F4/80 and Tunel double positive cells were considered as macrophages undergoing efferocytosis. The results showed that compared with the control group, LPS stimulation significantly increased the infiltration of macrophages (F4/80\u003csup\u003e+\u003c/sup\u003ecells) and the number of apoptotic cells (Tunel\u003csup\u003e+\u003c/sup\u003ecells) in lung tissue, but the incidence of cell burial events (F4/80\u003csup\u003e+\u003c/sup\u003eTunel\u003csup\u003e+\u003c/sup\u003e/F4/80\u003csup\u003e+\u0026nbsp;\u003c/sup\u003epercentage) was significantly reduced (Figure 2B-C). This result suggested that both macrophages residing in lung tissue and macrophages formed by peripheral mononuclear cell colonization and differentiation had not effectively cleared apoptotic cells caused by adverse stimuli, resulting in defects in ALI/ARDS efferocytosis. To construct an in vitro cell model of efferocytosis, we extracted and differentiated mice bone marrow-derived mononuclear macrophages (BMDMs), and identified them by flow cytometry (F4/80 and CD11b double positive cell ratio \u0026gt; 95%) and immunofluorescence staining (macrophage marker F4/80) (Supplement Figure 1A-B). At the same time, we constructed an apoptotic cell model by irradiating Jurkat T cells with UVC, and detected the proportion of cell apoptosis by flow cytometry. We selected 1 hour of UVC irradiation as the subsequent experimental condition (Supplement Figure 1C). Interestingly, in the in vitro cell burial model, LPS stimulation at different time points significantly enhanced the efferocytosis of BMDMs, which is contrary to the results of in vivo experiments (Supplement Figure 1D). Among them, the promotion effect was most significant at the time point of 12 h, which was used as the condition for subsequent experiments (Figure 2D-E). Consistently, using cell immunofluorescence technology, F4/80 (green) labeled BMDMs in the LPS stimulated group engulfed more Dil (red) labeled ACs (Figure 2F).\u003c/p\u003e\n\u003cp\u003e3.3. UPP1was selected as a switch for the efferocytosis and polarization phenotype transition of AMs\u003c/p\u003e\n\u003cp\u003eIn order to explore the key genes involved in LPS promoting efferocytosis in vitro, we isolated BMDMs that engulfed ACs from the control and LPS group using flow cytometry and performed RNA sequencing. The results showed good consistency among three samples within each group (Figure 3A). We noticed significant changes in the transcriptome of BMDMs after 12 h of LPS treatment, with 909 upregulated genes and 2195 downregulated genes (Figure 3B). KEGG enrichment analysis showed that DEGs were enriched on pathways related to efferocytosis, including “Metabolic pathway”, “Chemokine signaling pathway”, and “Cytokine-cytokine receptor interaction” (Figure 3C). 77 genes from these pathways were sorted based on log\u003csub\u003e2\u003c/sub\u003eFC values from high to low. The expression of the TOP 10 genes was verified through RT-qPCR, and they were significantly upregulated in the LPS group (Figure 3D). Based on the condition that the count values from RNA-seq are not equal to 0 (excluding \u003cem\u003ePla1a\u003c/em\u003e, \u003cem\u003eCar4\u003c/em\u003e, \u003cem\u003eGstt4\u003c/em\u003e, \u003cem\u003eLipg\u003c/em\u003e, \u003cem\u003eIl2ra\u003c/em\u003e, \u003cem\u003eIdo1\u003c/em\u003e) and the Cq values from RT-qPCR no more than 30 (excluding \u003cem\u003eNos2\u003c/em\u003e, \u003cem\u003eIl23r\u003c/em\u003e), we assumed that \u003cem\u003eUpp1\u003c/em\u003e and\u0026nbsp;\u003cem\u003eHdc\u003c/em\u003e might be the key genes. To further elucidate the roles of \u003cem\u003eUpp1\u003c/em\u003e and \u003cem\u003eHdc\u003c/em\u003e in efferocytosis, we knocked down two genes separately by siRNA transfection in MH-S cells derived from mice AMs. Flow cytometry showed that UPP1 knockdown significantly inhibited the promoting effect of LPS on the efferocytosis of MH-S cells (Figure 3E), while HDC knockdown had no significant effect on the efferocytosis of MH-S cells in both resting and inflammatory states (Supplementary Figure 2A). Subsequently, we validated the protein level of UPP1 in BMDMs (Figure 3F) and the mRNA and protein levels in MH-S cells (Figure 3G-H), confirming that UPP1 showed the most significant expression changes after 12 h of LPS stimulation. In addition, we also discussed the inconsistent effects of LPS stimulation on intracellular and extracellular organelles. We speculated that complex factors such as hypoxia might be one of the reasons for the deficiency of efferocytosis \u003cem\u003ein vivo\u003c/em\u003e. The flow cytometry results showed that under the condition of 1% O\u003csub\u003e2\u003c/sub\u003e, the efferocytosis of MH-S cells in both resting and inflammatory states were reduced (Supplementary Figure 2B). Meanwhile, compared with LPS stimulation alone, the mRNA and protein levels of UPP1 decreased under hypoxic conditions (Supplementary Figure 2C-D). Therefore, UPP1 may be a key gene involved in the effect of LPS on efferocytosis. We also examined macrophage polarization phenotypes closely related to efferocytosis. The results showed that LPS increased the proportion of CD86\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e-\u0026nbsp;\u003c/sup\u003eM1 macrophages and decreased the proportion of CD86\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e+\u0026nbsp;\u003c/sup\u003eM2 macrophages, while UPP1 knockdown significantly promoted the effect of LPS on macrophage polarization phenotype (Figure 3I). In addition, UPP1 knockdown increased the transcription level of \u003cem\u003eNos2\u003c/em\u003e (nitric oxide synthase 2) in resting MH-S, while reducing that of \u003cem\u003eMrc1\u0026nbsp;\u003c/em\u003e(mannose receptor C-type 1). When exposed to LPS-induced inflammatory environment, UPP1 knockdown resulted in further increase of \u003cem\u003eNos2\u003c/em\u003e and reduction of \u003cem\u003eMrc1\u003c/em\u003e in MH-S cells (Figure 3J). Furthermore, UPP1 knockdown significantly increased the protein level of M1 marker iNOS and decreased that of M2 marker CD206 in inflammatory state, while having no significant effect on two markers in resting state (Figure 3K-L). Therefore, UPP1 knockdown induced a significant macrophage polarization phenotype transition from M2 to M1. Moreover, UPP1 knockdown resulted in further increased expression of various pro-inflammatory markers in the LPS-induced inflammatory environment, including \u003cem\u003eIl1b\u003c/em\u003e (interleukin 1 beta), \u003cem\u003eIl6\u003c/em\u003e (interleukin 6), \u003cem\u003eTnf\u003c/em\u003e (tumor necrosis factor), and \u003cem\u003eMcp1\u003c/em\u003e (monocyte chemoattractant protein-1), while further reducing the expression of anti-inflammatory markers, including \u003cem\u003eIl10\u003c/em\u003e (interleukin 10) and \u003cem\u003eTgfb1\u003c/em\u003e (transforming growth factor beta 1;\u0026nbsp;Figure 3M). Collectively, consistent with our hypothesis, UPP1 does play a key role in activating efferocytosis, macrophage polarization phenotype transition, and secretion of inflammatory cytokines.\u003c/p\u003e\n\u003cp\u003e3.4. Reinforced UPP1 promoted efferocytosis and M2 polarization of AMs\u003c/p\u003e\n\u003cp\u003eOverexpression studies were next carried out to investigate the effects of UPP1 on efferocytosis and M2 polarization. As expected, the transfection of UPP1 overexpression plasmid successfully induced the expression of UPP1 in MH-S cells (Figure 4A). LPS significantly increased the expression of UPP1, and UPP1 overexpression further increased UPP1 at the mRNA and protein levels (Figure 4E-G). Flow cytometry showed that UPP1 overexpression enhanced the efferocytosis of resting MH-S cells and further enhanced the promoting effect of LPS on efferocytosis (Figure 4B), and also reversed the inhibitory effect of hypoxia on efferocytosis (Figure 4C). In addition, at rest, UPP1 overexpression reduced the proportion of CD86\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e-\u003c/sup\u003e M1e macrophages and increased the that of CD86\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e+\u003c/sup\u003e M2 macrophages. Meanwhile, UPP1 overexpression significantly reversed the effect of LPS on macrophage M1 and M2 polarization under inflammatory conditions (Figure 4D). The changes in mRNA levels of M1 marker iNOS and M2 marker CD206 were consistent with the results of flow cytometry (Figure 4E). In the inflammatory environment simulated by LPS, UPP1 overexpression significantly increased the protein level of iNOS and reduced that of CD206. However, there was no significant effect on the protein levels of the two markers in resting MH-S cells (Figure 4F-G). Moreover, UPP1 overexpression inhibited the expression of pro-inflammatory factors and promoted the expression of anti-inflammatory factors (Figure 4H). Collectively, these data indicates that UPP1 overexpression promotes efferocytosis, polarization transition from M1 to M2, and the expression of anti-inflammatory factors upon LPS treatment. In other words, UPP1 has the potential for inflammation repair.\u003c/p\u003e\n\u003cp\u003e3.5. UPP1 promoted efferocytosis and M2 polarization of AMs by regulating TIM4\u003c/p\u003e\n\u003cp\u003eWe further investigated the role of relevant signal transduction in the mechanisms of macrophage\u0026nbsp;efferocytosis\u0026nbsp;and polarization phenotype transition. The heatmap of RNA-seq data revealed a considerable increase in the mRNA expression of the efferocytosis-binding receptors, \u003cem\u003eTimd4\u003c/em\u003e (T cell immunoglobulin and mucin domain containing 4), in the LPS group compared with the Control group (Figure 5A). It was worth noting that LPS stimulation resulted in an increase in the protein level of TIM4 in both BMDMs (Figure 5B-C) and MH-S cells (Figure 5D). Interestingly, UPP1 knockdown led to a decrease in the protein level of TIM4 in pro-inflammatory MH-S cells (Figure 5E). Compared with the corresponding control group, UPP1 overexpression resulted in increasing the protein levels of TIM4 in both resting and pro-inflammatory MH-S cells (Figure 5F). Based on these results, we investigated whether TIM4 could be one of the molecular mechanisms through which UPP1 enhanced\u0026nbsp;efferocytosis. In the rescue experiment, we used AbTIM4 as the neutralizing antibody for TIM4, while IgG2b was used as the control neutralizing antibody in other groups. Whether AbTIM4 was administered or not did not affect the expression of UPP1 at the mRNA and protein levels (Figure 5K-M). This indicated that UPP1 was upstream of TIM4. The results of flow cytometry showed that compared with the oeUpp1 + LPS + IgG2b group, the oeUpp1 + LPS + AbTIM4 group had significantly reduced\u0026nbsp;efferocytosis\u0026nbsp;(Figure 5G-H), decreased the proportion of CD86\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e+\u003c/sup\u003e M2 macrophages, and increased the proportion of CD86\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e-\u003c/sup\u003e M1 macrophages (Figure 5I-J). RT-qPCR and western blot showed that after AbTIM4 administration, the expression of CD206 was reduced, while that of iNOS was increased (Figure 5K-M). Consistently, comparing the levels of pro-inflammatory and anti-inflammatory factors in two groups of cells, the oeUpp1 + LPS + AbTIM4 group showed an increase in pro-inflammatory factor expression and a decrease in anti-inflammatory factor expression (Figure 5N). In summary, AbTIM4 hinders the positive signal transduction of UPP1 on\u0026nbsp;efferocytosis\u0026nbsp;and M2 polarization, as well as the effect on anti-inflammatory repair. Therefore, UPP1 enhances\u0026nbsp;efferocytosis, M2 polarization, and anti-inflammatory repair\u0026nbsp;of AMs\u0026nbsp;by regulating TIM4.\u003c/p\u003e\n\u003cp\u003e3.6. UPP1 enhanced the expression of TIM4-mediated efferocytosis and M2 polarization by promoting STAT3 phosphorylation\u003c/p\u003e\n\u003cp\u003eTo elucidate the regulatory mechanism of UPP1 inTIM4-mediated efferocytosis and M2 polarization, we transfected MH-S cells with UPP1 empty vector plasmid (Vector) or overexpression plasmid (oeUpp1) and performed RNA-seq analysis. Gene set enrichment analysis (GSEA) showed significant enrichment of the JAK-STAT signaling pathway (Figure 6A). The heat map displayed DEGs enriched in the JAK-STAT signaling pathway, with UPP1 overexpression significantly upregulating the transcription of \u003cem\u003eStat3\u003c/em\u003e (Figure 6B). To verify the relationship between UPP1 and STAT3, we detected STAT3 and its phosphorylation levels in the overexpression group using western blot. The results showed that UPP1 overexpression increased the total and phosphorylated protein expression of STAT3 in resting MH-S cells. LPS treatment increased STAT3 and its phosphorylation levels and UPP1 overexpression further promoted the increase in phosphorylation levels without in total protein expression (Figure 6C). Therefore, UPP1 promotes STAT3 phosphorylation levels. Stattic is an effective STAT3 inhibitor that can inhibit the phosphorylation sites of Y705 and S727. When MH-S cells were treated with Stattic one hour before LPS administration, STAT3 phosphorylation levels were significantly inhibited, while total protein expression was not affected (Figure 6I-J). We found that Stattic blocked the promoting effect of UPP1 overexpression on\u0026nbsp;efferocytosis\u0026nbsp;(Figure 6D-E). The flow cytometry results showed that compared with the oeUpp1 + LPS group, the proportion of CD86\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e+\u003c/sup\u003e M2 macrophages in the oeUpp1 + LPS + Stattic group was significantly reduced, while the proportion of CD86\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e-\u003c/sup\u003e M1 macrophages increased (Figure 6F-G). Consistently, after Stattic treatment, the expression of CD206 was reduced, while the expression of iNOS was increased (Figure 6H-J). In addition, Stattic had no significant effect on the mRNA and protein expression of UPP1, but downregulated the protein expression of TIM4 (Figure 6H-J). Based on these results, it can be inferred that STAT3 is a bridging effector involved between UPP1 and TIM4. Moreover, Stattic treatment resulted in an increase in pro-inflammatory cytokine expression and a decrease in anti-inflammatory cytokine expression (Figure 6K). In summary, UPP1 enhances the expression of TIM4 and TIM4-mediated efferocytosis and M2 polarization by promoting STAT3 phosphorylation.\u003c/p\u003e\n\u003cp\u003e3.7. \u003cem\u003eUpp1\u003c/em\u003e alveolar-macrophage-specific knockdown exacerbated LPS-induced ALI/ARDS\u003c/p\u003e\n\u003cp\u003eTo pay special attention to the role of UPP1 in the lungs, we administered recombinant adeno-associated virus (rAAV) of \u003cem\u003eUpp1\u003c/em\u003e alveolar-macrophage-specific knockdown adenovirus (AAV-F4/80-miR30-siUpp1) through the airway. After 28 days of infection, the mRNA level of \u003cem\u003eUpp1\u003c/em\u003e in AMs significantly decreased (Supplement Figure 3A). We validated the protein expression of UPP1 in AMs of mice in each group using F4/80 (red) and UPP1 (green) double labeled immunofluorescence (Supplement Figure 3B-C). The typical features of ALI/ARDS were observed in the lungs of mice exposed to LPS, however, UPP1 knockdown resulted in more severe damage. The specific situation was reflected in greater weight loss (Figure 7A), more severe pulmonary edema (Figure 7B), and aggravated progression of lung injury (Figure 7C). Further analysis of inflammatory factors showed that UPP1 knockdown significantly exacerbated LPS induced inflammation. In lung tissue homogenate (Figure 7D) and BALF (Figure 7E), the secretion of pro-inflammatory cytokines (IL-1β, IL-6, and TNF-α) significantly increased, while the secretion of anti-inflammatory cytokines (IL-10 and TGF-β) significantly decreased. In addition, we evaluated the efferocytosis and polarization of AMs \u003cem\u003ein vivo\u003c/em\u003e using double labeled immunofluorescence. The results showed that the infiltration of macrophages and the number of apoptotic cells further increased, and the efferocytosis was continuously damaged in the lungs of UPP1 knockdown mice exposed to LPS (Figure 7F-G). Meanwhile, UPP1 knockdown further reduced the proportion of M2 macrophages (Figure 7H-I) and increased the proportion of M1 macrophages (Figure 7J-K), promoting the transition of AMs from M2 to M1. These findings indicated that \u003cem\u003eUpp1\u003c/em\u003e alveolar-macrophage-specific knockdown further exacerbated LPS-induced lung inflammation, efferocytosis, and pro-inflammatory M1 polarization.\u003c/p\u003e\n\u003cp\u003e3.8. \u003cem\u003eUpp1\u003c/em\u003e alveolar-macrophage-specific overexpression gene therapy promoted lung injury repair of LPS-induced ALI/ARDS, while TIM4-blocking inhibited the positive effect\u003c/p\u003e\n\u003cp\u003eAlthough the benefits of UPP1 overexpression in the immune response of AMs \u003cem\u003ein vitro\u003c/em\u003e have been validated, UPP1 has not yet been developed as a therapeutic target for ALI/ARDS. rAAV has been widely used as a vector for gene delivery in experimental animals and human gene therapy\u003csup\u003e23\u003c/sup\u003e, because of which it has the characteristics of high safety, low immunogenicity\u003csup\u003e24,25\u003c/sup\u003e, targeted regulation\u003csup\u003e26\u003c/sup\u003e, and high stability\u003csup\u003e27\u003c/sup\u003e. To further evaluate whether UPP1 overexpression can be used for the treatment of ALI/ARDS, we designed an AAV overexpression gene delivery system (AAV-F4/80-oeNC-null, AAV-F4/80-oeUpp1-3xflag) carrying the alveolar-macrophage-specific promoter F4/80. We infected mice through non-invasive tracheal instillation, and confirmed the infection efficiency of UPP1 in mice lung tissue on the 28th day after infection by marking the flag tag with green fluorescence (Supplementary Figure 4 A-B). At the same time, dual immunofluorescence for F4/80 (red) and UPP1 (green) confirmed the protein level of UPP1 in AMs of each group, which was consistent with the trend of in vitro experiments (Supplementary Figure 4C-D). Compared with the control group (AAV-oeNC/AAV-oeUpp1 + Ctrl + IgG2b), the ALI/ARDS model group (AAV-oeNC + LPS + IgG2b) mice showed a significant decrease in body weight (Figure 8A) and an increase in lung index (Figure 8B). The physiological condition and pulmonary edema degree of the UPP1 gene therapy group (AAV-oeUpp1 + LPS + IgG2b) mice improved, but AbTIM4 inhibited these effects (Figure 8A-B). In H\u0026amp;E staining, UPP1 overexpression partially delayed the progression of lung injury (Figure 8C). Specifically, the alveoli maintain a certain structure, with reduced thickness of alveolar septa, infiltration of inflammatory cells, intra alveolar bleeding, and protein exudation. However, the lung tissue damage in the AbTIM4 inhibition group (AAV-oeUpp1 + LPS + AbTIM4) was more severe than that in the ALI/ARDS model group (Figure 8C). In addition, ELISA analysis of lung tissue homogenate and BALF showed that UPP1 overexpression reduced the levels of pro-inflammatory cytokines (IL-1β, IL-6, and TNF-α) and promoted the secretion of anti-inflammatory cytokines (IL-10 and TGF-β) (Figure 8D-E). However, the addition of AbTIM4 resulted in increased secretion of pro-inflammatory cytokines and decreased secretion of anti-inflammatory cytokines, hindering the anti-inflammatory effect of UPP1 (Figure 8D-E). Next, we evaluated the effects of UPP1 and TIM4 on efferocytosis through immunofluorescence staining. As expected, the number of macrophage infiltration and ACs significantly decreased in the UPP1 gene therapy group, and efferocytosis was enhanced, indicating that macrophages effectively eliminated ACs (Figure 8F-G). Meanwhile, the addition of AbTIM4 did not significantly affect the number of macrophages, but increased the number of ACs, inhibited efferocytosis, and significantly hindered the clearance of ACs (Figure 8F-G). Moreover, compared with the ALI/ARDS model group, UPP1 overexpression therapy promoted the transformation of macrophages towards the M2 phenotype (CD206 marked) (Figure 8H-I) and reduced the infiltration of M1 macrophages (iNOS marked) (Figure 8J-K). However, AbTIM4 inhibited the macrophages polarization transition from M1 to M2. After administration of AbTIM4, the number of CD206 positive macrophages decreased (Figure 8H-I) and the number of iNOS positive macrophages increased (Figure 8J-K). In summary, Upp1 overexpression gene therapy targeting pulmonary macrophages promotes lung injury repair of LPS-induced ALI/ARDS, while blocking TIM4 inhibits this positive effect.\u003c/p\u003e"},{"header":"4.\tDiscussion","content":"\u003cp\u003eThis study explored the regulatory mechanism of macrophage efferocytosis and polarization in LPS-induced ALI/ARDS models, and identified UPP1 as a key target for ALI/ARDS treatment. Four key findings emerged from this study. First, LPS stimulation led to the upregulation of efferocytosis in\u003cem\u003e\u0026nbsp;in vitro\u0026nbsp;\u003c/em\u003emacrophage models. Second, the LPS-induced enhancement of macrophage efferocytosis was positively correlated with the increased expression of UPP1. Third, \u003cem\u003ein vitro\u003c/em\u003e assays further verified that UPP1 promoted the phosphorylation of STAT3, thereby upregulating TIM4 signaling to mediate the augmentation of efferocytosis. Fourth, LPS stimulation failed to enhance alveolar macrophage efferocytosis in ALI/ARDS mice, a phenomenon primarily attributable to the complexity of the alveolar inflammatory microenvironment and the suppression of efferocytosis induced by acute hypoxia. Notably, UPP1 upregulation abrogated the inhibitory effect on efferocytosis and mitigated lung injury.\u003c/p\u003e\n\u003cp\u003eImpaired AMs efferocytosis in ALI/ARDS is linked to persistent inflammation, alveolar barrier disruption, and poor clinical outcomes, with studies showing reduced efferocytosis capacity in ARDS patients compared to non-ARDS sepsis patients\u003csup\u003e12,28\u003c/sup\u003e. Mechanisms of efferocytosis impairment include neutrophil extracellular trap (NET) accumulation and HMGB1-mediated inhibition of Rab43-dependent CD91 trafficking\u003csup\u003e29\u003c/sup\u003e, which collectively hinder apoptotic cell clearance and perpetuate lung injury. Therapeutic strategies targeting efferocytosis enhancement, such as AMPK activation via metformin, HMGB1 inhibition, and Treg cell modulation, have shown promise in preclinical models by promoting inflammation resolution and improving lung function\u003csup\u003e12\u003c/sup\u003e. Recent research also highlights the role of ERK5/Mer in mediating efferocytosis\u003csup\u003e30\u003c/sup\u003e, underscoring the complexity of efferocytosis regulation in ALI/ARDS pathophysiology. In this study, we found that LPS can improve macrophage efferosytosis in vitro by activation of UPP1/p-STAT3/TIM4 axis. UPP1 is a central component of the pyrimidine salvage pathway\u003csup\u003e31\u003c/sup\u003e. Recent research has expanded its recognized roles to immune microenvironment modulation, with high UPP1 expression linked to immunosuppressive phenotypes in various cancers\u003csup\u003e32\u003c/sup\u003e. But in ALI/ARDS, the role of UPP1 has not been reported. This study demonstrated the critical role of UPP1 in modulating efferocytosis and relieving lung injury. Notably, although LPS stimulation enhanced efferocytosis in macrophages \u003cem\u003ein vitro\u003c/em\u003e, this effect was not significant \u003cem\u003ein vivo\u003c/em\u003e. This inconsistent phenomenon may be attributed to the fact that hypoxia and complex immune microenvironment induced by ALI/ARDS can partially inhibit the efferocytosis of macrophages, which is consistent with the previous report\u003csup\u003e14\u003c/sup\u003e. Interesting, study has reported that unlike acute hypoxia, macrophage efferocytosis is enhanced under chronic hypoxic conditions\u003csup\u003e33\u003c/sup\u003e. This finding further demonstrates the complexity of oxygen's regulatory effects on macrophage efferocytosis.\u003c/p\u003e\n\u003cp\u003eDuring efferocytosis progress, apoptotic cells release \"Find-Me\" signals (e.g., ATP, LPC) to recruit phagocytes, expose phosphatidylserine (PS) as the core \"Eat-Me\" signal that binds directly to receptors like TIM4/BAI1 or indirectly to TAM receptors (MerTK, AXL) via Gas6/MFG-E8, while \"Don't-Eat-Me\" signals (CD47, CD24) on healthy cells prevent erroneous phagocytosis\u003csup\u003e34,35\u003c/sup\u003e. Ligand-receptor binding activates the ELMO1-DOCK180-RAC1 and Stabilin-2-GULP-RAC1 axis to drive actin cytoskeleton rearrangement for engulfment, followed by phagosome maturation via Rab GTPases and LC3-associated phagocytosis (LAP) for efficient degradation, and metabolic adaptations (glucose uptake, fatty acid oxidation) in phagocytes maintain homeostasis and immune silence\u003csup\u003e35\u003c/sup\u003e. TIM4, a T cell immunoglobulin and mucin domain (TIM) family member and one of the phosphatidylserine (PS) receptors, is predominantly expressed on macrophages and binds high-affinity directly to externalized PS on apoptotic cells via its immunoglobulin domain, a conserved \"eat-me\" signal recognition mechanism in efferocytosis\u003csup\u003e36\u003c/sup\u003e. Previous studies reported that TIM4 enhanced efferocytosis by interacting with MerTK (amplifying PI3K-AKT/RAC1 signaling), synergizing with β1 integrin via Fn1 and drive actin rearrangement\u003csup\u003e37,38\u003c/sup\u003e. In this study, we found that TIM4 played an important role in UPP1 enhanced\u0026nbsp;efferocytosis in ALI/ARDS, which was proven by that\u0026nbsp;AbTIM4 hindered the efferocytosis level and M2 polarization, as well as the effect on anti-inflammatory repair induced by UPP1. This discovery sheds new light on the molecular mechanism underlying UPP1-mediated lung protection and provides a potential therapeutic target for ALI/ARDS.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFurther exploration of the upstream signaling pathway of TIM4 showed that RNA-seq-based Gene Set Enrichment Analysis of UPP1-overexpressing MH-S cells revealed significant enrichment of the JAK-STAT signaling pathway. Western blot confirmed that UPP1 overexpression increased STAT3 phosphorylation (without affecting total STAT3 protein) in both resting and LPS-stimulated MH-S cells. Using the STAT3 inhibitor Stattic, it was found that Stattic blocked UPP1-mediated promotion of efferocytosis and M2 polarization, down-regulated TIM4 expression, and aggravated inflammation—while having no effect on UPP1 expression. This demonstrated that UPP1 regulates TIM4 expression and its downstream functions by promoting STAT3 phosphorylation, forming a \"UPP1-STAT3-TIM4\" regulatory axis. UPP1 is a key enzyme in the pyrimidine salvage pathway that catalyzes uridine degradation into uracil and ribose-1-phosphate\u003csup\u003e39\u003c/sup\u003e. The present study demonstrated that STAT3 acts as a critical intermediate in the UPP1-induced enhancement of efferocytosis. The regulatory interaction between UPP1 and STAT3 is intricate and bidirectional. Emerging data indicate STAT3’s capacity to upregulate pyrimidine metabolism-related enzymes by binding conserved promoter motifs, paralleling its regulation of target genes such as UPP1 and SPP1 in inflammatory and oncogenic contexts\u003csup\u003e40,41\u003c/sup\u003e. Conversely, UPP1-mediated enhancement of STAT3 phosphorylation is firmly supported by functional study that UPP1 activates the PI3K/AKT signaling pathway by facilitating AKT-PDK1/PDK2 binding\u003csup\u003e42\u003c/sup\u003e, and AKT-dependent phosphorylation of STAT3 is a key downstream event\u003csup\u003e43\u003c/sup\u003e. In lung adenocarcinoma models, UPP1-driven PI3K/AKT/mTOR activation not only upregulates PD-L1 but also sustains STAT3 signal, amplifying immunosuppressive and pro-survival signals\u003csup\u003e32\u003c/sup\u003e—a mechanism likely relevant to ALI/ARDS, where dysregulated PI3K/AKT/STAT3 signaling exacerbates lung inflammation and injury\u003csup\u003e44\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eNotably, several limitations of this study should be acknowledged. First, the specific molecular mechanism by which UPP1 regulates TIM4 expression or surface localization remains unclear—future studies should explore whether UPP1 affects TIM4 transcription, translation, or post-translational modification (e.g., glycosylation) in macrophages. Second, while we focused on macrophages, TIM4 is also expressed on dendritic cells\u003csup\u003e45\u003c/sup\u003e and B cells\u003csup\u003e46\u003c/sup\u003e, and the contribution of non-macrophage TIM4 to UPP1-enhanced lung repair requires investigation. Third, in vivo validation using TIM4 knockout mice would further confirm the necessity of TIM4 in UPP1-mediated protection, complementing the neutralization experiments with AbTIM4.\u003c/p\u003e\n\u003cp\u003eThis study elucidates the regulatory mechanism of macrophage efferocytosis and polarization in LPS-induced ALI/ARDS, identifies UPP1 as a pivotal therapeutic target, and confirms that UPP1 upregulation reverses impaired macrophage efferocytosis to alleviate lung injury.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe National Natural Science Foundation of China [grant numbers 82270084, 82300107] provided support for this work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eFan E, Brodie D, Slutsky AS. Acute Respiratory Distress Syndrome: Advances in Diagnosis and Treatment. \u003cem\u003eJAMA\u003c/em\u003e 2018; \u003cstrong\u003e319\u003c/strong\u003e: 698\u0026ndash;710.\u003c/li\u003e\n\u003cli\u003eAl-Husinat L, Azzam S, Al Sharie S, Araydah M, Battaglini D, Abushehab S \u003cem\u003eet al.\u003c/em\u003e A narrative review on the future of ARDS: evolving definitions, pathophysiology, and tailored management. \u003cem\u003eCrit Care\u003c/em\u003e 2025; \u003cstrong\u003e29\u003c/strong\u003e: 88.\u003c/li\u003e\n\u003cli\u003eMeyer NJ, Gattinoni L, Calfee CS. Acute respiratory distress syndrome. \u003cem\u003eLancet\u003c/em\u003e 2021; \u003cstrong\u003e398\u003c/strong\u003e: 622\u0026ndash;637.\u003c/li\u003e\n\u003cli\u003eRampon GL, Simpson SQ, Agrawal R. Prone Positioning for Acute Hypoxemic Respiratory Failure and ARDS: A Review. \u003cem\u003eChest\u003c/em\u003e 2023; \u003cstrong\u003e163\u003c/strong\u003e: 332\u0026ndash;340.\u003c/li\u003e\n\u003cli\u003eChaudhuri D, Sasaki K, Karkar A, Sharif S, Lewis K, Mammen MJ \u003cem\u003eet al.\u003c/em\u003e Corticosteroids in COVID-19 and non-COVID-19 ARDS: a systematic review and meta-analysis. \u003cem\u003eIntensive Care Med\u003c/em\u003e 2021; \u003cstrong\u003e47\u003c/strong\u003e: 521\u0026ndash;537.\u003c/li\u003e\n\u003cli\u003eGorman EA, O\u0026rsquo;Kane CM, McAuley DF. Acute respiratory distress syndrome in adults: diagnosis, outcomes, long-term sequelae, and management. \u003cem\u003eLancet\u003c/em\u003e 2022; \u003cstrong\u003e400\u003c/strong\u003e: 1157\u0026ndash;1170.\u003c/li\u003e\n\u003cli\u003eAegerter H, Lambrecht BN, Jakubzick CV. Biology of lung macrophages in health and disease. \u003cem\u003eImmunity\u003c/em\u003e 2022; \u003cstrong\u003e55\u003c/strong\u003e: 1564\u0026ndash;1580.\u003c/li\u003e\n\u003cli\u003eWang L, Wang D, Zhang T, Ma Y, Tong X, Fan H. The role of immunometabolism in macrophage polarization and its impact on acute lung injury/acute respiratory distress syndrome. \u003cem\u003eFront Immunol\u003c/em\u003e 2023; \u003cstrong\u003e14\u003c/strong\u003e: 1117548.\u003c/li\u003e\n\u003cli\u003eDoran AC, Yurdagul A, Tabas I. Efferocytosis in health and disease. \u003cem\u003eNat Rev Immunol\u003c/em\u003e 2020; \u003cstrong\u003e20\u003c/strong\u003e: 254\u0026ndash;267.\u003c/li\u003e\n\u003cli\u003eSchilperoort M, Ngai D, Sukka SR, Avrampou K, Shi H, Tabas I. The role of efferocytosis-fueled macrophage metabolism in the resolution of inflammation. \u003cem\u003eImmunol Rev\u003c/em\u003e 2023; \u003cstrong\u003e319\u003c/strong\u003e: 65\u0026ndash;80.\u003c/li\u003e\n\u003cli\u003eWoods PS, Mutlu GM. Differences in glycolytic metabolism between tissue-resident alveolar macrophages and recruited lung macrophages. \u003cem\u003eFront Immunol\u003c/em\u003e 2025; \u003cstrong\u003e16\u003c/strong\u003e: 1535796.\u003c/li\u003e\n\u003cli\u003eGr\u0026eacute;goire M, Uhel F, Lesouhaitier M, Gacouin A, Guirriec M, Mourcin F \u003cem\u003eet al.\u003c/em\u003e Impaired efferocytosis and neutrophil extracellular trap clearance by macrophages in ARDS. \u003cem\u003eEur Respir J\u003c/em\u003e 2018; \u003cstrong\u003e52\u003c/strong\u003e: 1702590.\u003c/li\u003e\n\u003cli\u003eMahida RY, Scott A, Parekh D, Lugg ST, Hardy RS, Lavery GG \u003cem\u003eet al.\u003c/em\u003e Acute respiratory distress syndrome is associated with impaired alveolar macrophage efferocytosis. \u003cem\u003eEur Respir J\u003c/em\u003e 2021; \u003cstrong\u003e58\u003c/strong\u003e: 2100829.\u003c/li\u003e\n\u003cli\u003eMahida RY, Scott A, Parekh D, Lugg ST, Hardy RS, Lavery GG \u003cem\u003eet al.\u003c/em\u003e Acute respiratory distress syndrome is associated with impaired alveolar macrophage efferocytosis. \u003cem\u003eEur Respir J\u003c/em\u003e 2021; \u003cstrong\u003e58\u003c/strong\u003e: 2100829.\u003c/li\u003e\n\u003cli\u003eLiu X, Ou X, Zhang T, Li X, Qiao Q, Jia L \u003cem\u003eet al.\u003c/em\u003e In situ neutrophil apoptosis and macrophage efferocytosis mediated by Glycyrrhiza protein nanoparticles for acute inflammation therapy. \u003cem\u003eJ Control Release Off J Control Release Soc\u003c/em\u003e 2024; \u003cstrong\u003e369\u003c/strong\u003e: 215\u0026ndash;230.\u003c/li\u003e\n\u003cli\u003eZheng W, Zhou Z, Guo X, Zuo X, Zhang J, An Y \u003cem\u003eet al.\u003c/em\u003e Efferocytosis and Respiratory Disease. \u003cem\u003eInt J Mol Sci\u003c/em\u003e 2023; \u003cstrong\u003e24\u003c/strong\u003e: 14871.\u003c/li\u003e\n\u003cli\u003eMa J, Ao Y, Yue Z, Wang Z, Hou X, Li H \u003cem\u003eet al.\u003c/em\u003e Elevated GFI1 in Alveolar Macrophages Suppresses ACOD1 Expression and Exacerbates Lipopolysaccharide‐Induced Lung Injury in Obesity. \u003cem\u003eAdv Sci\u003c/em\u003e 2025; \u003cstrong\u003e12\u003c/strong\u003e: 2413546.\u003c/li\u003e\n\u003cli\u003ePan J, Li Z, Zhu M, Guo L, Chen W, Yu L. Vitamin E exerts a mitigating effect on LPS-induced acute lung injury by regulating macrophage polarization through the AMPK/NRF2/NF-\u0026kappa;B pathway. \u003cem\u003eInt Immunopharmacol\u003c/em\u003e 2025; \u003cstrong\u003e159\u003c/strong\u003e: 114893.\u003c/li\u003e\n\u003cli\u003eZeng L, Wang Y, Huang Y, Yang W, Zhou P, Wan Y \u003cem\u003eet al.\u003c/em\u003e IRG1/itaconate enhances efferocytosis by activating Nrf2-TIM4 signaling pathway to alleviate con A induced autoimmune liver injury. \u003cem\u003eCell Commun Signal\u003c/em\u003e 2025; \u003cstrong\u003e23\u003c/strong\u003e: 63.\u003c/li\u003e\n\u003cli\u003eShen R, Jiang Y, Liu G, Gao S, Sun H, Wu X \u003cem\u003eet al.\u003c/em\u003e Single‐Cell Landscape of Bronchoalveolar Lavage Fluid Identifies Specific Neutrophils during Septic Immunosuppression. \u003cem\u003eAdv Sci\u003c/em\u003e 2025; \u003cstrong\u003e12\u003c/strong\u003e: 2406218.\u003c/li\u003e\n\u003cli\u003ePreparation and culture of bone marrow-derived macrophages from mice for functional analysis. \u003cem\u003eSTAR Protoc\u003c/em\u003e 2021; \u003cstrong\u003e2\u003c/strong\u003e: 100246.\u003c/li\u003e\n\u003cli\u003eLivak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. \u003cem\u003eMethods San Diego Calif\u003c/em\u003e 2001; \u003cstrong\u003e25\u003c/strong\u003e: 402\u0026ndash;408.\u003c/li\u003e\n\u003cli\u003eWang J-H, Gessler DJ, Zhan W, Gallagher TL, Gao G. Adeno-associated virus as a delivery vector for gene therapy of human diseases. \u003cem\u003eSignal Transduct Target Ther\u003c/em\u003e 2024; \u003cstrong\u003e9\u003c/strong\u003e: 78.\u003c/li\u003e\n\u003cli\u003eCosta Verdera H, Kuranda K, Mingozzi F. AAV Vector Immunogenicity in Humans: A Long Journey to Successful Gene Transfer. \u003cem\u003eMol Ther J Am Soc Gene Ther\u003c/em\u003e 2020; \u003cstrong\u003e28\u003c/strong\u003e: 723\u0026ndash;746.\u003c/li\u003e\n\u003cli\u003eDhungel BP, Winburn I, Pereira C da F, Huang K, Chhabra A, Rasko JEJ. Understanding AAV vector immunogenicity: from particle to patient. \u003cem\u003eTheranostics\u003c/em\u003e 2024; \u003cstrong\u003e14\u003c/strong\u003e: 1260\u0026ndash;1288.\u003c/li\u003e\n\u003cli\u003eKochergin-Nikitsky K, Belova L, Lavrov A, Smirnikhina S. Tissue and cell-type-specific transduction using rAAV vectors in lung diseases. \u003cem\u003eJ Mol Med\u003c/em\u003e 2021; \u003cstrong\u003e99\u003c/strong\u003e: 1057\u0026ndash;1071.\u003c/li\u003e\n\u003cli\u003eMuhuri M, Levy DI, Schulz M, McCarty D, Gao G. Durability of transgene expression after rAAV gene therapy. \u003cem\u003eMol Ther\u003c/em\u003e 2022; \u003cstrong\u003e30\u003c/strong\u003e: 1364\u0026ndash;1380.\u003c/li\u003e\n\u003cli\u003eWang Y, Zhang L-F, Zhang J-J, Yu S-S, Li W-L, Zhou T-J \u003cem\u003eet al.\u003c/em\u003e Spontaneous Inflammation Resolution Inspired Nanoparticles Promote Neutrophil Apoptosis and Macrophage Efferocytosis for Acute Respiratory Distress Syndrome Treatment. \u003cem\u003eAdv Healthc Mater\u003c/em\u003e 2025; \u003cstrong\u003e14\u003c/strong\u003e: e2402421.\u003c/li\u003e\n\u003cli\u003eWang Y, Zhang W, Xu Y, Wu D, Gao Z, Zhou J \u003cem\u003eet al.\u003c/em\u003e Extracellular HMGB1 Impairs Macrophage-Mediated Efferocytosis by Suppressing the Rab43-Controlled Cell Surface Transport of CD91. \u003cem\u003eFront Immunol\u003c/em\u003e 2022; \u003cstrong\u003e13\u003c/strong\u003e: 767630.\u003c/li\u003e\n\u003cli\u003eLi J, Shao R, Xie Q, Qin K, Ming S, Xie Y \u003cem\u003eet al.\u003c/em\u003e Ulinastatin promotes macrophage efferocytosis and ameliorates lung inflammation via the ERK5/Mer signaling pathway. \u003cem\u003eFEBS Open Bio\u003c/em\u003e 2022; \u003cstrong\u003e12\u003c/strong\u003e: 1498\u0026ndash;1508.\u003c/li\u003e\n\u003cli\u003eStrefeler A, Blanco-Fernandez J, Jourdain AA. Nucleosides are overlooked fuels in central carbon metabolism. \u003cem\u003eTrends Endocrinol Metab TEM\u003c/em\u003e 2024; \u003cstrong\u003e35\u003c/strong\u003e: 290\u0026ndash;299.\u003c/li\u003e\n\u003cli\u003eLi Y, Jiang M, Aye L, Luo L, Zhang Y, Xu F \u003cem\u003eet al.\u003c/em\u003e UPP1 promotes lung adenocarcinoma progression through the induction of an immunosuppressive microenvironment. \u003cem\u003eNat Commun\u003c/em\u003e 2024; \u003cstrong\u003e15\u003c/strong\u003e: 1200.\u003c/li\u003e\n\u003cli\u003eWang Y-T, Trzeciak AJ, Rojas WS, Saavedra P, Chen Y-T, Chirayil R \u003cem\u003eet al.\u003c/em\u003e Metabolic adaptation supports enhanced macrophage efferocytosis in limited-oxygen environments. \u003cem\u003eCell Metab\u003c/em\u003e 2023; \u003cstrong\u003e35\u003c/strong\u003e: 316-331.e6.\u003c/li\u003e\n\u003cli\u003eYang S, Min C, Moon H, Moon B, Lee J, Jeon J \u003cem\u003eet al.\u003c/em\u003e Internalization of apoptotic cells during efferocytosis requires Mertk-mediated calcium influx. \u003cem\u003eCell Death Dis\u003c/em\u003e 2023; \u003cstrong\u003e14\u003c/strong\u003e: 391.\u003c/li\u003e\n\u003cli\u003eMoon B, Yang S, Moon H, Lee J, Park D. After cell death: the molecular machinery of efferocytosis. \u003cem\u003eExp Mol Med\u003c/em\u003e 2023; \u003cstrong\u003e55\u003c/strong\u003e: 1644\u0026ndash;1651.\u003c/li\u003e\n\u003cli\u003eKim D, Lee S-A, Moon H, Kim K, Park D. The Tim gene family in efferocytosis. \u003cem\u003eGenes Genomics\u003c/em\u003e 2020; \u003cstrong\u003e42\u003c/strong\u003e: 979\u0026ndash;986.\u003c/li\u003e\n\u003cli\u003eMoon B, Lee J, Lee S-A, Min C, Moon H, Kim D \u003cem\u003eet al.\u003c/em\u003e Mertk Interacts with Tim-4 to Enhance Tim-4-Mediated Efferocytosis. \u003cem\u003eCells\u003c/em\u003e 2020; \u003cstrong\u003e9\u003c/strong\u003e: 1625.\u003c/li\u003e\n\u003cli\u003eFlannagan RS, Canton J, Furuya W, Glogauer M, Grinstein S. The phosphatidylserine receptor TIM4 utilizes integrins as coreceptors to effect phagocytosis. \u003cem\u003eMol Biol Cell\u003c/em\u003e 2014; \u003cstrong\u003e25\u003c/strong\u003e: 1511\u0026ndash;1522.\u003c/li\u003e\n\u003cli\u003eNwosu ZC, Ward MH, Sajjakulnukit P, Poudel P, Ragulan C, Kasperek S \u003cem\u003eet al.\u003c/em\u003e Uridine-derived ribose fuels glucose-restricted pancreatic cancer. \u003cem\u003eNature\u003c/em\u003e 2023; \u003cstrong\u003e618\u003c/strong\u003e: 151\u0026ndash;158.\u003c/li\u003e\n\u003cli\u003eXiao X, Qiu T, Cheng Q, Wang W, Fan C, Zuo F. Uridine phosphorylase-1 promotes cell viability and cell-cycle progression in human epidermal keratinocytes via the glycolytic pathway. \u003cem\u003eClin Exp Pharmacol Physiol\u003c/em\u003e 2024; \u003cstrong\u003e51\u003c/strong\u003e: e13874.\u003c/li\u003e\n\u003cli\u003eWang T, Kaneko S, Kriukov E, Alvarez D, Lam E, Wang Y \u003cem\u003eet al.\u003c/em\u003e SOCS3 regulates pathological retinal angiogenesis through modulating SPP1 expression in microglia and macrophages. \u003cem\u003eMol Ther J Am Soc Gene Ther\u003c/em\u003e 2024; \u003cstrong\u003e32\u003c/strong\u003e: 1425\u0026ndash;1444.\u003c/li\u003e\n\u003cli\u003eDu W, Tu S, Zhang W, Zhang Y, Liu W, Xiong K \u003cem\u003eet al.\u003c/em\u003e UPP1 enhances bladder cancer progression and gemcitabine resistance through AKT. \u003cem\u003eInt J Biol Sci\u003c/em\u003e 2024; \u003cstrong\u003e20\u003c/strong\u003e: 1389\u0026ndash;1409.\u003c/li\u003e\n\u003cli\u003eGaloczova M, Coates P, Vojtesek B. STAT3, stem cells, cancer stem cells and p63. \u003cem\u003eCell Mol Biol Lett\u003c/em\u003e 2018; \u003cstrong\u003e23\u003c/strong\u003e: 12.\u003c/li\u003e\n\u003cli\u003eXie C, Wang T, Liu A, Huang B, Zeng W, Li Z \u003cem\u003eet al.\u003c/em\u003e Sirt4 Overexpression Modulates the JAK2/STAT3 and PI3K/AKT/mTOR Axes to Alleviate Sepsis-Induced Acute Lung Injury. \u003cem\u003eCell Biochem Biophys\u003c/em\u003e 2025; \u003cstrong\u003e83\u003c/strong\u003e: 1785\u0026ndash;1798.\u003c/li\u003e\n\u003cli\u003eCaronni N, Piperno GM, Simoncello F, Romano O, Vodret S, Yanagihashi Y \u003cem\u003eet al.\u003c/em\u003e TIM4 expression by dendritic cells mediates uptake of tumor-associated antigens and anti-tumor responses. \u003cem\u003eNat Commun\u003c/em\u003e 2021; \u003cstrong\u003e12\u003c/strong\u003e: 2237.\u003c/li\u003e\n\u003cli\u003eMiyanishi M, Tada K, Koike M, Uchiyama Y, Kitamura T, Nagata S. Identification of Tim4 as a phosphatidylserine receptor. \u003cem\u003eNature\u003c/em\u003e 2007; \u003cstrong\u003e450\u003c/strong\u003e: 435\u0026ndash;439.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003cp\u003e\u003cstrong\u003eTable 1. Primer sequences of mice.\u003c/strong\u003e\u003c/p\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eForward (5\u0026rsquo;-3\u0026rsquo;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eReverse (3\u0026rsquo;-5\u0026rsquo;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003ePla1a\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eATGGCTCAGCATTGGAAGTTCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eCGGAGGAGGTTGGCACTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCar4\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eGTGCGTGCATTATCGGAGGAGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eTGTGCTCTGAACCGTTGTCATTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eGstt4\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eGAATGGCATCCCCTTCGACTTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eAAGATGAACTTGCCGTCCTTGAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eNos2\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eACTCAGCCAAGCCCTCACCTAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eTCCAATCTCTGCCTATCCGTCTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eLipg\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eACCCAGCCCACCCTCTACATTAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eATCGCCCAAGTCCTCCTCAGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eIL2ra\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eCTTGCTGATGTTGGGGTTTCTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eTAGGATGGTGCCGTTCTTGTAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eIdo1\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eACGGACTGAGAGGACACAGGTTAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eCTCGGTTCCACACATACGCCATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eUpp1\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eCTGCTGGCTTCCTTCCTGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eCAGCCACACAGTCACCACAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eHdc\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eTCTACCTCCGACATGCCAACTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eCCCGAAGGACCGAATCACAAACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eIL23r\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eTCCACCAAACTTCCCAAGAAACTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eGCACTGAGCATCTCCATCTTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eIl1b\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eGCAACTGTTCCTGAACTCAACT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eATCTTTTGGGGTCCGTCAACT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eIl6\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eTAGTCCTTCCTACCCCAATTTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eTTGGTCCTTAGCCACTCCTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eTnf\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eCCCTCACACTCAGATCATCTTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eGCTACGACGTGGGCTACAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eMcp1\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eCCCAATGAGTAGGCTGGAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eTCTGGACCCATTCCTTCTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eIl10\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eGCTCTTACTGACTGGCATGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eCGCAGCTCTAGGAGCATGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eTgfb1\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eCTCCCGTGGCTTCTAGTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eGCCTTAGTTTGGACAGGATCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eNos2\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eGTTCTCAGCCCAACAATACAAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eGTGGACGGGTCGATGTCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eMrc1\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eAAATGGCTTCCTGGAGAGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eACCCTCCGGTACTACAGCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 11.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eGapdh\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eAGGTCGGTGTGAACGGATTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44.4444%;\"\u003e\n \u003cp\u003eTGTAGACCATGTAGTTGAGGTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"acute lung injury, acute respiratory distress syndrome, alveolar macrophages, efferocytosis, macrophage polarization, UPP1/TIM4/STAT3 axis, rAAV gene therapy","lastPublishedDoi":"10.21203/rs.3.rs-9171327/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9171327/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAcute lung injury (ALI)/acute respiratory distress syndrome (ARDS) is associated with high mortality. Impaired efferocytosisof alveolar macrophages (AMs) is a key factor contributing to poor clinical outcomes, yet the molecular mechanisms regulating this process remain unclear. The efferocytosis in LPS-induced AMs and ALI/ARDS mice model were evaluated by flow cytometry and immunofluorescence staining. The expression levels of uridine phosphorylase 1 (UPP1), T-cell immunoglobulin and mucin domain containing 4 (TIM4) in AMs were both detected in\u003cem\u003e in vivo\u003c/em\u003eand\u003cem\u003e in vitro\u003c/em\u003e. \u003cem\u003eIn vitro\u003c/em\u003e, UPP1 knockdown/overexpression experiments were performed to evaluate changes of efferocytosis and macrophage polarization in LPS stimulated AMs. \u003cem\u003eIn vivo\u003c/em\u003e, UPP1 overexpression and TIM4 neutralizing antibody intervention were performed to observe the changes of efferocytosis, macrophage polarization, inflammation factors and the repair of lung injury. Efferocytosis was downregulated in LPS-induced ALI/ARDS animal models, whereas LPS stimulation led to the upregulation of efferocytosis in \u003cem\u003ein vitro\u003c/em\u003e AMs. In-depth mechanistic investigations revealed that the LPS-induced enhancement of efferocytosis was positively correlated with the increased expression of UPP1. And UPP1 promoted the phosphorylation of STAT3, thereby upregulating TIM4 signaling to mediate the augmentation of efferocytosis. Further, UPP1 upregulation abrogated the inhibitory effect on efferocytosis in ALI/ARDS and mitigated lung injury. UPP1 regulates AMs efferocytosis and M2 polarization via the STAT3-TIM4 axis, promoting inflammatory resolution in ALI/ARDS. This study provides a novel therapeutic target for ALI/ARDS treatment.\u003c/p\u003e","manuscriptTitle":"Role of UPP1 triggering TIM4-mediated efferocytosis and M2 polarization in alveolar macrophages to promote the resolution of inflammation in acute lung injury/acute respiratory distress syndrome","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-06 15:33:08","doi":"10.21203/rs.3.rs-9171327/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8fcb9a88-b9f9-4c3e-936a-acec788fdc84","owner":[],"postedDate":"April 6th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":65522387,"name":"Biological sciences/Immunology/Inflammation/Acute inflammation"},{"id":65522388,"name":"Biological sciences/Immunology/Cell death and immune response"}],"tags":[],"updatedAt":"2026-04-28T13:12:56+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-06 15:33:08","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9171327","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9171327","identity":"rs-9171327","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.