L-Malic acid alleviates high-fat diet-induced depression-like behaviors by modulating lipid metabolism and suppressing ferroptosis through activation of the AMPK-CPT1A pathway

L-Malic acid alleviates high-fat diet-induced depression-like behaviors by modulating lipid metabolism and suppressing ferroptosis through activation of the AMPK-CPT1A pathway | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL This is a preprint and has not been peer reviewed. Data may be preliminary. 21 October 2025 V1 Latest version Share on L-Malic acid alleviates high-fat diet-induced depression-like behaviors by modulating lipid metabolism and suppressing ferroptosis through activation of the AMPK-CPT1A pathway Authors : Taojia Chen and Haining Yu [email protected] Authors Info & Affiliations https://doi.org/10.22541/au.176107693.38058477/v1 459 views 134 downloads Contents Abstract Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract AimEpidemiological evidence indicates a bidirectional relationship between depression and obesity. L-Malic acid (MA) has been shown to exert antioxidant, anti-inflammatory, metabolism-regulating, and neuroprotective effects. Nevertheless, studies on its role in depression are limited, and its intervention in high-fat diet (HFD)-induced depression has not been explored. This study therefore aims to investigate the ameliorative effects of MA on HFD-induced depression-like behaviors. MethodsFollowing the establishment of a depression model using an HFD protocol, behavioral tests were conducted to validate the model and assess the therapeutic effects of MA. Lipid metabolism, oxidative stress, and inflammatory cytokines were evaluated through a combination of biochemical assays, Oil Red O staining, and ELISA. To elucidate the mechanisms by which MA ameliorates depression-like behaviors, LC-MS-based metabolomics and RT-qPCR analyses were employed. Subsequently, the role of ferroptosis inhibition was confirmed through histopathology, Western blot, and molecular docking studies. ResultsMA significantly ameliorated HFD-induced depression-like behaviors. It elevated 5-HT in the hippocampus and serum, reduced MDA and enhanced SOD activity, and suppressed IL-6 and IL-1β. Furthermore, MA normalized the levels of 20 key hepatic metabolites, primarily associated with lipid metabolism pathways. Additionally, MA significantly modulated the ferroptosis-related proteins ACSL4 and GPX4 in both the liver and brain tissues, reduced ferrous iron levels, and ameliorated impaired mitochondrial morphology. Further mechanistic studies indicated that MA promoted AMPK phosphorylation and activated CPT1A. Molecular docking results revealed a high binding affinity between MA and AMPK. Conclusion This study reveals that MA alleviates HFD-induced depression-like behaviors, potentially through activation of the AMPK-CPT1A pathway to regulate lipid metabolism and inhibit ferroptosis. L-Malic acid alleviates high-fat diet-induced depression-like behaviors by modulating lipid metabolism and suppressing ferroptosis through activation of the AMPK-CPT1A pathway Taojia Chen a , Haining Yu a* a College of Pharmaceutical Science, Zhejiang University of Technology, Hangzhou, Zhejiang, 310014, China. *Corresponding authors at: College of Pharmaceutical Science, Zhejiang University of Technology, Hangzhou, Zhejiang, 310014, China. Email addresses: [email protected] (H. Yu). Highlights 1. L-Malic acid (MA) ameliorated high-fat diet (HFD)-induced depression-like behaviors in mice. 2. MA reduced oxidative stress and pro-inflammatory cytokine levels in HFD-fed mice. 3. MA alleviated lipid metabolism disorders in HFD mice. 4. Ferroptosis was activated in the HFD-induced depression mouse model. 5. MA suppressed ferroptosis by activating the AMPK-CPT1A signaling pathway. Abstract Aim Epidemiological evidence indicates a bidirectional relationship between depression and obesity. L-Malic acid (MA) has been shown to exert antioxidant, anti-inflammatory, metabolism-regulating, and neuroprotective effects. Nevertheless, studies on its role in depression are limited, and its intervention in high-fat diet (HFD)-induced depression has not been explored. This study therefore aims to investigate the ameliorative effects of MA on HFD-induced depression-like behaviors. Methods Following the establishment of a depression model using an HFD protocol, behavioral tests were conducted to validate the model and assess the therapeutic effects of MA. Lipid metabolism, oxidative stress, and inflammatory cytokines were evaluated through a combination of biochemical assays, Oil Red O staining, and ELISA. To elucidate the mechanisms by which MA ameliorates depression-like behaviors, LC-MS-based metabolomics and RT-qPCR analyses were employed. Subsequently, the role of ferroptosis inhibition was confirmed through histopathology, Western blot, and molecular docking studies. Results MA significantly ameliorated HFD-induced depression-like behaviors. It elevated 5-HT in the hippocampus and serum, reduced MDA and enhanced SOD activity, and suppressed IL-6 and IL-1β. Furthermore, MA normalized the levels of 20 key hepatic metabolites, primarily associated with lipid metabolism pathways. Additionally, MA significantly modulated the ferroptosis-related proteins ACSL4 and GPX4 in both the liver and brain tissues, reduced ferrous iron levels, and ameliorated impaired mitochondrial morphology. Further mechanistic studies indicated that MA promoted AMPK phosphorylation and activated CPT1A. Molecular docking results revealed a high binding affinity between MA and AMPK. Conclusion This study reveals that MA alleviates HFD-induced depression-like behaviors, potentially through activation of the AMPK-CPT1A pathway to regulate lipid metabolism and inhibit ferroptosis. Keywords L-Malic acid; Depression; High-fat diet; Ferroptosis; lipid metabolism 1. Intr oduction Depression is one of the most prevalent mental disorders worldwide, characterized by persistent and significant low mood, often accompanied by anhedonia, cognitive impairment, and somatic symptoms[1,2]. Accumulating evidence suggests that unhealthy dietary patterns, particularly long-term high-fat diet (HFD), constitute a major risk factor for depression[3–5]. HFD-induced metabolic dysregulation contributes to depressive pathology through multiple pathways. On one hand, aberrant lipid metabolism disrupts neurotransmitter systems, including 5-hydroxytryptamine (5-HT) signaling, impairing mood regulation[6]. On the other hand, HFD exacerbates mitochondrial dysfunction[7], oxidative stress[8], and neuroinflammation[9,10]—mechanisms widely recognized as core pathological features of depression. However, due to the complexity and heterogeneity of depression’s pathogenesis, clinically viable diagnostic biomarkers and therapeutic strategies remain limited[11], underscoring the need for novel therapeutic targets. Ferroptosis, a regulated cell death modality marked by iron dyshomeostasis, antioxidant system collapse, and lipid peroxidation[12], has been implicated in depression. The ferroptosis marker malondialdehyde (MDA) exhibits a positive correlation with depression severity[13,14]. Neuroinflammation further aggravates ferroptosis by activating microglia and upregulating iron transporters (e.g., divalent metal transporter 1 (DMT1)), leading to iron overload and oxidative damage[15,16]. Clinical studies confirm that elevated lipid peroxidation increases the risk of major depressive disorder (MDD), while antidepressants (e.g., fluoxetine) alleviate symptoms by reducing MDA levels[17]. Pharmacological agents such as edaravone[18] and Xiaoyaosan[19] exert antidepressant effects by modulating the SIRT1/Nrf2/HO-1/GPX4 axis and key ferroptosis-related proteins (such as acyl-CoA synthetase long-chain family member 4 (ACSL4), glutathione peroxidase 4 (GPX4)), reinforcing ferroptosis’ pivotal role in depression[20]. Notably, bidirectional crosstalk exists between lipid metabolism and ferroptosis[21–23]. Reactive oxygen species (ROS) derived from lipid peroxidation induce lipid droplet accumulation[24], which amplifies oxidative stress[25]. The AMP-activated protein kinase–carnitine palmitoyltransferase 1A (AMPK–CPT1A) pathway serves as a central regulator: activated AMPK inhibits acetyl-CoA carboxylase (ACC) via phosphorylation, enhances CPT1A activity, promotes fatty acid β-oxidation, and suppresses lipid peroxidation[26–28]. Animal studies demonstrate that AMPK activation protects hippocampal neurons from ferroptosis[29], whereas CPT1A deficiency triggers lipid droplet deposition and ferroptosis[30], highlighting the AMPK–CPT1A axis as a critical nexus linking lipid metabolism and ferroptosis. L-malic acid (MA), a key intermediate in the tricarboxylic acid (TCA) cycle, shows altered levels in depression patients and animal models[31–33]. Substantial evidence indicates MA’s potent antioxidant and anti-inflammatory properties [34–37]. In aged rats, MA elevates antioxidant enzyme activity, reduces ROS, and mitigates oxidative damage[35]; dietary MA supplementation in sows decreases serum tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and MDA while enhancing antioxidant capacity[36]. Moreover, skeletal muscle MA content inversely correlates with obesity [38], suggesting its role in metabolic regulation. For instance, MA supplementation enriches amino acid metabolism pathways (e.g., tryptophan, arginine)[39], whose metabolites scavenge ROS, maintain glutathione homeostasis, and suppress hepatic inflammation. MA also modulates arachidonic acid metabolism[39], further underscoring its metabolic centrality. In tilapia models, MA ameliorates hepatic lipid accumulation[40]. Emerging studies reveal MA’s neuroprotective potential: it enhances memory acquisition, consolidation, and retrieval in mice by reducing brain γ-aminobutyric acid (GABA) levels[41] and alleviates depressive-like behaviors and neuroinflammation in chronic unpredictable mild stress (CUMS) rats[42]. However, MA’s precise neuroprotective mechanisms remain elusive, and no studies have investigated its effects on HFD-induced depression. This study explores MA’s impact on HFD-induced depressive behaviors and its underlying mechanisms. Our findings not only bridge a knowledge gap regarding MA’s role in HFD-associated depression but also provide novel insights into MA-mediated antidepressant mechanisms, offering a theoretical foundation for lipid metabolism-targeted antidepressant strategies. 2. Materials and methods 2.1. Animals and treatments C57BL/6 J male mice, approximately 3–4 weeks old, were obtained from Zhejiang Academy of Medical Sciences. Animals were randomly divided into three groups (n=8/group): the normal control group (Normal) was fed standard rodent chow (MD17121, from Jiangsu Madisen Biopharmaceutical Co., Ltd., China), while the high-fat diet model group (HFD-Model) and high-fat diet plus MA intervention group (HFD-MA) received a 60% kcal fat diet (D12492, from Shanghai Fanboy Biotech Co., Ltd., China). After 16 weeks of dietary treatment, behavioral tests were performed in week 16 to evaluate depressive-like behaviors. Starting from week 17, the HFD-MA group received daily oral gavage of 0.63 g/kg MA, whereas the Normal and HFD-Model groups were administered equal volumes of saline for 28 consecutive days (Fig. 1A). The detailed nutritional composition of diets is shown in Table S1. At the experimental endpoint, mice were euthanized by cervical dislocation under isoflurane anesthesia. All experiments were approved by the laboratory animals ethical committee of the Zhejiang University of Technology and strictly followed NIH guide for laboratory animals (NIH Publication No. 85–23, revised 1996). 2.2. Basic parameter measurements (1) Body weight monitoring: Weekly body weight measurements were recorded to evaluate the effects of HFD and MA intervention on body weight. (2) High-fat diet intake: The daily consumption of high-fat diet was documented for both the HFD-Model and HFD-MA groups throughout the intervention period. (3) Organ index determination: At the experimental endpoint, the liver, epididymal white adipose tissue (eWAT), and spleen were collected and weighed. The organ index (%) was calculated using the following formula: Organ index (%) = (Organ weight (g) / Final body weight (g)) × 100%. 2.3. Behavioral tests To systematically evaluate the effects of HFD and MA intervention on depression-like behaviors, behavioral tests were conducted at two time points: the 16th week of HFD modeling and the endpoint of intervention (week 20). The testing sequence followed the standardized protocol established by McIlwain et al. [43], proceeding in the following order: open field test (OFT), sucrose preference test (SPT), tail suspension test (TST), and forced swim test (FST). This sequential arrangement was implemented to minimize potential carryover effects from preceding tests on subsequent behavioral outcomes. 2.3.1. OFT The open field apparatus (40 × 40 × 40 cm) was divided into 9 equal square sectors. Each mouse was initially placed in the central zone and allowed to acclimate for 1 min. Subsequently, the animal’s movement trajectory was recorded for 5 min, during which the total distance traveled and immobility time were quantitatively analyzed. 2.3.2. SPT The animals were individually housed for the sucrose preference test. Initially, they were acclimated to two bottles containing 1% sucrose solution for 24 hours. Subsequently, one sucrose solution bottle was replaced with pure water for another 24-hour period, with bottle positions alternated every 12 hours to eliminate potential side preference effects. Prior to testing, the mice were water-deprived for 24 hours. During the final 24-hour test period, each mouse was presented with pre-weighed sucrose solution and pre-weighed pure water, with bottle positions switched every 12 hours. Sucrose preference ratio was calculated as the percentage of sucrose intake relative to total fluid intake (sucrose solution + pure water). 2.3.3. TST Animals were hung on the iron stand about 45 cm away from the ground. Their behaviors were recorded by a camera for 6 min and the immobility time was measured for the last 4 min. 2.3.4. FST Animals were placed in an open cylindrical container (approximately 20 cm in height and 15 cm in diameter), filled with 23 ± 2 °C water to a depth of 15 cm. The procedure was recorded by a camera for 6 min, and the immobile time was calculated over the final 4 min. 2.4. Oil red O staining Following euthanasia, liver tissues were immediately fixed in 4% paraformaldehyde solution. The fixed tissues were subsequently dehydrated through a graded sucrose series (15%-30%) and rinsed with distilled water. Tissue sections were then stained with 60% Oil Red O solution (Wuhan Servicebio Technology Co., Ltd., China) for 8-10 minutes. After staining, sections were differentiated in 60% isopropanol and washed with distilled water. Finally, sections were mounted with glycerin gelatin. The above results were analyzed with Image J software. 2.5. Biochemical analysis of serum, liver and brain tissues Standard biochemical analytical methods were employed for quantitative determination of various parameters: (1) Serum, hippocampal and cortical 5-hydroxytryptamine (5-HT) levels were measured using enzyme-linked immunosorbent assay (ELISA) kits (Shanghai Enzyme-linked Biotechnology Co., Ltd., China); (2) Triglycerides (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) levels in serum, liver and brain tissues were determined using biochemical assay kits (Nanjing Jiancheng Bioengineering Institute, China); (3) IL-6 and IL-1β concentrations in liver and brain tissues were quantified by ELISA (Shanghai Enzyme-linked Biotechnology Co., Ltd., China) to evaluate inflammatory status; (4) Superoxide dismutase (SOD) activity and MDA content in serum, liver and brain tissues were assessed using kits from Nanjing Jiancheng Bioengineering Institute (Nanjing, China) to determine oxidative stress responses; (5) Ferrous ion (Fe²⁺) levels in liver and brain tissues were measured using detection kits from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China). All assays were strictly performed according to the manufacturers’ standardized protocols. 2.6. Transmission electron microscopy Mitochondrial ultrastructure in mouse hippocampus was evaluated using transmission electron microscopy (TEM). Briefly, fresh hippocampal tissue (1 mm³) was fixed in 1% osmium tetroxide at 4°C for 2 h, dehydrated through a graded ethanol series, and embedded in epoxy resin overnight at room temperature. Ultrathin sections (60–80 nm) were cut using a Leica UC7 ultramicrotome, then stained with 2% uranyl acetate in saturated ethanol for 8 min followed by 2.6% lead citrate for 8 min. Sections were examined under an HT7700 transmission electron microscope (HITACHI, Tokyo, Japan), with images captured for quantitative analysis. Mitochondrial density was statistically analyzed by counting mitochondria per 5 μm scale bar across groups. Damaged mitochondria were identified by cristae loss and/or rupture of inner/outer mitochondrial membranes. 2.7. Western blot Total proteins were extracted from liver and hippocampal tissues, and protein concentrations were determined using the BCA Protein Assay Kit (Beyotime Biotechnology. Inc., China). Protein samples were separated by 10% SDS-PAGE and transferred onto polyvinylidene fluoride (PVDF) membranes (Merck Millipore Co., Ltd., USA) The membranes were then blocked with 5% fat-free milk or 5% bovine serum albumin (BSA) at room temperature for 1 h, followed by overnight incubation at 4°C with the following primary antibodies: β-actin (1:10,000, Proteintech Inc.), ACSL4 (1:2,000, Proteintech Inc.), GPX4 (1:1,000, Proteintech Inc.), AMPK (1:2,000, Proteintech Inc.), phosphorylated AMPK (p-AMPK) (1:1,000, Cell Signaling Technology), and CPT1A (1:5,000, Proteintech Inc.). Subsequently, the membranes were incubated with the HRP-conjugated secondary antibody (1:10,000, Proteintech Inc.) for 2 h at room temperature. Protein bands were visualized using the BeyoECL Star chemiluminescence kit (Beyotime Biotechnology. Inc., China) and visualized using a ChemiDoc™ XRS+ Imaging System (Bio-RAD, USA). The blots were quantified using ImageJ software. 2.8. RT-qPCR analysis Total RNA was extracted from liver tissues using TRIzol according to the manufacturer’s instructions (Tiangen Biotech, Beijing, China). RNA purity and concentration were determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). A reverse transcription kit (EnzyArtisan, Shanghai, China) was used for cDNA synthesis. The qPCR was performed using 2 × S6 Universal SYBR qPCR mix (EnzyArtisan, Shanghai, China) and StepOne Real-Time PCR system (Applied Biosystems, USA). Data were normalized to GAPDH levels, and relative mRNA expression was calculated using the 2 -ΔΔCT method. The primers used in this study were as follows: FADS1 forward, 5ʹ-AGCACATGCCATACAACCATC -3′; FADS1 reverse, 5ʹ- TTTCCGCTGAACCACAAAATAGA -3′; GAPDH forward, 5ʹ- AGGTCGGTGTGAACGGATTTG-3ʹ; GAPDH reverse, 5ʹ- TGTAGACCATGTAGTTGAGGTCA -3′. 2.9. Untargeted metabolomics analysis The liver tissues were precisely weighed and extracted using a tissue extraction solvent mixture (75% methanol:chloroform [9:1, v/v] and 25% H2O). After grinding, ultrasound treatment, and centrifuging, the tissue supernatant was concentrated and dried. Subsequently, the dried sample was reconstituted in 200 μL of a 50% acetonitrile solution containing 2- chloro-L-phenylalanine (4 ppm) and stored at 4℃ for LC-MS analysis. LC analysis was performed using the Vanquish UHPLC System (Thermo Fisher Scientific, USA) equipped with an ACQUITY UPLC ® HSS T3 column (100 × 2.1 mm, 1.8 μm) (Waters, Milford, MA, USA) maintained at 40°C. The flow rate and injection volume were set at 0.3 mL/min and 2 μL, respectively. For LC-ESI (+)-MS analysis, the mobile phase consisted of 0.1% formic acid in acetonitrile (v/v) and 0.1% formic acid in water (v/v), while for LC-ESI (-)-MS analysis, acetonitrile and ammonium formate aqueous solution were employed as the mobile phase. Metabolite detection was carried out using an Orbitrap Exploris 120 mass spectrometer (Thermo Fisher Scientific, USA) equipped with an electrospray ionization source. The mass spectrometry parameters, including spray voltage, sheath gas pressure, and capillary temperature, were optimized for both ESI(+) and ESI(-) modes, and mass spectral data were acquired as previously described[44]. 2.10. Molecular docking The protein structure of AMPK (PDB ID: 4EAI) was retrieved from the Protein Data Bank (https://www.rcsb.org/), with all bound small molecules and water molecules removed. Subsequently, protein preparation was performed using AutoDock Tools (version 1.5.7), including the addition of hydrogen atoms and charge calculation. The 2D structural SDF file of the MA compound was obtained from the PubChem database and converted to PDB format using OpenBabel software (version 3.1.1). The docking grid box dimensions were determined based on the protein’s active site, followed by receptor-ligand docking calculations using AutoDock Vina. The conformation with the lowest binding free energy (indicating highest binding affinity) was selected from the computational results. Finally, 3D visualization and analysis were conducted using PyMOL (version 3.8.1) to generate representative structural diagrams. not-yet-known not-yet-known not-yet-known unknown 2.11. Statistical analysis The statistical analyses were performed using GraphPad Prism 9.0 software and values were expressed as mean ± SD. Student’s two-tailed t-test and one-way analysis of variance (ANOVA) followed by the Tukey’s post hoc test were used to compare between two groups and among three or more groups respectively. All experiments were randomized and blinded, and P < 0.05 was considered statistically significant. The raw metabolomics data was first converted using the ProteoWizard software package (v3.0.8789) and processed for feature detection, retention time correction, and alignment using XCMS. After identifying the metabolites, locally estimated scatterplot smoothing signal correction was applied for data normalization to correct for any systematic bias. The SIMCA 14.1 software was used for multivariate statistical analysis. After scaling data, models were built using the principal component analysis (PCA) and orthogonal partial least square-discrimination analysis (OPLS-DA), which were evaluated for over fitting by permutation tests. The differential metabolites were identified using P value 1 as threshold parameters. MetaboAnalyst 5.0 software (www.metaboanalyst.ca) and Microbial Informatics (https://www.bioinformatics.com.cn) were used for the pathway enrichment analysis [45]. 3. Results not-yet-known not-yet-known not-yet-known unknown 3.1. MA ameliorated weight gain and depression-like behavioral symptoms in HFD-fed mice Our data revealed no significant differences in initial body weight among the three groups. Following 16 weeks of dietary intervention, both the HFD-Model and HFD-MA groups exhibited significantly higher body weights compared to the Normal group (P < 0.0001 and P 0.05). However, after 4 weeks of MA intervention treatment, the HFD-MA group demonstrated significantly reduced body weight relative to the HFD-Model group (P < 0.01) (Figure 1B-C). We closely monitored the food intake in HFD-fed mice throughout the MA intervention period. However, no significant alterations in food consumption were detected between the two HFD groups (P > 0.05) (Table 1), suggesting that the therapeutic effects of MA may be mediated through modulation of lipid metabolism rather than via alterations in feeding behavior. Furthermore, the disease control animals that were induced HFD displayed markedly enlarged eWAT, along with significantly elevated epididymal white adipose index and liver index (P < 0.0001 and P < 0.01, respectively) compared with those of animals fed a normal control diet (Figure 1D-F). MA administration effectively ameliorated these pathological alterations, with all parameters showing significant improvement relative to the untreated model group (P < 0.01 and P < 0.01, respectively). The OFT results demonstrated that compared to the Normal group, the HFD-Model group exhibited significantly shorter total travel distance and longer immobility time (P < 0.01 and P < 0.01, respectively) (Figure 1G-I). Additionally, HFD-fed mice showed reduced sucrose preference (P < 0.001) in the SPT (Figure 1J). The results from the FST and TST confirmed that obese mice displayed behavior akin to depression, as evidenced by significantly prolonged immobility times (P < 0.01 and P < 0.01, respectively) (Figure 1K-L). Importantly, MA administration significantly or partially ameliorated these depression-like behavioral alterations. At the neurochemical level, the most widely accepted hypothesis of depression involves depletion of monoamine neurotransmitters in the brains of affected individuals, most notably the indolamine serotonin (5-hydroxytryptamine, 5-HT). Our biochemical analyses revealed that HFD-Model mice exhibited significantly decreased 5-HT levels in both serum and hippocampal tissues compared to the Normal group (P < 0.001 and P < 0.05, respectively) (Figure 1M, O). Following MA administration, these 5-HT concentrations were significantly restored (P < 0.05 for both compartments), demonstrating MA’s capacity to normalize 5-HT turnover in both peripheral circulation and hippocampal regions. Notably, no significant intergroup differences in 5-HT content were observed in the cerebral cortex (Figure 1N). Table 1. Feed intake of high-fat diet mice during MA intervention Week 17 22.54±2.42 24.27±2.05 Week 18 24.19±2.16 22.59±2.21 Week 19 22.74±2.13 24.06±1.65 Week 20 23.29±1.14 22.89±1.10 Fig. 1. MA ameliorated weight gain and depression-like behavioral symptoms in HFD-fed mice. (A) Schematic diagram of the experiment. (B) Representative images of mice from each group. (C) Body weight change curves. (D) Representative images of epididymal white adipose tissue in different groups of mice. (E) Epididymal white adipose tissue index. (F) Liver index. (G) OFT trajectory map. (H) Total distance in OFT. (I) Immobility time in OFT. (J) Sucrose preference rate. (K) Immobility time in FST. (L) Immobility time in TST. (M) 5-HT in hippocampus. (N) 5-HT in cortex. (O) 5-HT in serum. (C-L), n=8. (M-O), n=6. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, compared to the Normal group. # P < 0.05, ## P < 0.01, compared to the HFD-Model group. not-yet-known not-yet-known not-yet-known unknown 3.2. MA reduced lipid accumulation in HFD-fed mice Lipids, as fundamental structural components of cell membranes, play pivotal roles in critical physiological processes including energy transport, cellular recognition, and signal transduction[46]. Our experimental results demonstrated that HFD-Model mice exhibited significant dyslipidemia compared to the Normal group, characterized by markedly elevated serum TC and LDL-C levels (P < 0.001 and P < 0.0001, respectively), along with increased hepatic TG and cerebral LDL-C content (both P < 0.01). Conversely, HDL-C levels were significantly reduced in both liver and brain tissues (P < 0.05 and P < 0.001, respectively). MA intervention produced substantial therapeutic effects, with the HFD-MA group showing significantly decreased serum and cerebral LDL-C as well as hepatic TG levels compared to the model group (P < 0.05, P < 0.05, and P < 0.01, respectively), accompanied by significant recovery of HDL-C levels in liver and brain tissues (P < 0.05 and P < 0.01, respectively) (Figure 2A-L). Notably, although HDL-C serves as a ”lipid scavenger” and plays a crucial role in reverse cholesterol transport[47,48], its serum levels showed no statistically significant differences among groups (P > 0.05). This observation suggests that the excessive elevation of other lipid species in HFD-Model mice may overwhelm the compensatory capacity of HDL-C-mediated clearance mechanisms, thereby perpetuating lipid metabolic disorders. Histopathological analysis of liver tissues revealed only sparsely distributed minute lipid droplets in hepatocytes of the Normal group, indicating physiological maintenance of hepatic lipid storage at low levels (Figure 2M). In contrast, HFD-Model group hepatocytes displayed characteristic steatotic features with numerous diffusely distributed red-stained lipid droplets. Quantitative analysis confirmed that MA intervention significantly reduced lipid droplet area in HFD-MA group hepatocytes compared to the model group (P < 0.0001) (Figure 2N), demonstrating MA’s efficacy in alleviating HFD-induced hepatic lipid accumulation. 3.3. MA alleviated HFD-induced oxidative stress and inflammation in mice The lipid metabolic process generates elevated levels of ROS that may exceed the scavenging capacity of antioxidant systems such as SOD, consequently compromising the body’s antioxidant defense system and inducing lipid peroxidation[49,50]. Compared with the Normal group, HFD-Model mice exhibited significantly decreased SOD activity in serum, liver, and brain tissues ( P < 0.01, P < 0.01, and P < 0.05, respectively) (Figure 2O-Q), along with markedly increased MDA levels ( P < 0.001, P < 0.05, and P < 0.05, respectively) (Figure 2R-T). Following MA intervention, the HFD-MA group demonstrated significant recovery of SOD activity ( P < 0.05 for all three tissues) and reduction in MDA levels ( P < 0.05, P < 0.01, and P < 0.05, respectively) compared to the HFD-Model group, indicating that MA treatment partially restored the oxidative-antioxidative balance. Furthermore, pro-inflammatory signaling triggered by antioxidant defense depletion also contributes to the pathogenesis of depression[51]. Subsequent analysis of inflammatory factors revealed that HFD-Model mice showed significantly elevated levels of IL-1β and IL-6 in liver tissue compared to the Normal group ( P < 0.01 and P 0.05 for both). Notably, the brain tissue exhibited parallel changes in IL-1β and IL-6 levels, suggesting that high-fat diet may simultaneously induce inflammatory responses in both liver and brain tissues, an effect that could be mitigated by MA treatment (Figure 2U-X). Fig. 2. MA alleviated HFD-induced lipid accumulation, oxidative stress, and inflammation in mice. (A) Serum TG. (B) Serum TC. (C) Serum LDL-C. (D) Serum HDL-C. (E) Liver TG. (F) Liver TC. (G) Liver LDL-C. (H) Liver HDL-C. (I) Brain TG. (J) Brain TC. (K) Brain LDL-C. (L) Brain HDL-C. (M) Histological staining images. (N) Relative area of lipid droplets. (O) Serum SOD. (P) Liver SOD. (Q) Brain SOD. (R) Serum MDA. (S) Liver MDA. (T) Brain MDA. (U) Liver IL-1β. (V) Brain IL-1β. (W) Liver IL-6. (X) Brain IL-6. (A-L and O-X), n=6. (M, N), n=3. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, compared to the Normal group. # P < 0.05, ## P < 0.01, ### P < 0.001, #### P < 0.0001, compared to the HFD-Model group. 3.4. MA modulated the hepatic metabolic profile in HFD-fed mice MA, a crucial metabolic regulator, has been demonstrated to ameliorate lipid metabolism disorders[39,40]. The present study revealed that MA significantly attenuated HFD-induced hepatic lipid accumulation in mice. To further elucidate the metabolic regulatory mechanisms underlying MA’s effects on HFD-associated depression-like behaviors, untargeted metabolomic analysis of liver tissues was performed. Partial least squares-discriminant analysis (PLS-DA) revealed significant differences in metabolic profiles among the Normal, HFD-Model, and HFD-MA groups (positive ion mode: R 2 Y=0.994, Q 2 =0.894; negative ion mode: R 2 Y=0.991, Q 2 =0.871) (Figure 3A-B). Permutation test analysis was conducted to validate potential model overfitting, demonstrating that all permutated Q 2 values were lower than those of the original models under both positive and negative ion modes, confirming the absence of overfitting. OPLS-DA further verified distinct separation among the three groups (Figure S1). HFD feeding was sufficient to trigger widespread changes of metabolites, with 70 and 68 metabolites being significantly induced and repressed, respectively, compared to normal chow-fed mice (Figure 3C), including L-kynurenine, 8,11,14-Eicosatrienoic acid (that is, dihomo-γ-linolenic acid, DGLA), sphingosine, glutathione (GSH), taurocholic acid, and erucic acid. Notably, MA intervention completely reversed 9 elevated and 11 reduced metabolites to normal levels (Figure 3D), such as taurocholic acid, DGLA, erucic acid, sphingosine, deoxycholic acid, and N-acetylserotonin (detailed in Table S2). Receiver operating characteristic (ROC) curve analysis demonstrated that all 20 reversed metabolites exhibited area under the curve (AUC) values exceeding 0.8 when comparing Normal versus HFD-Model groups (Figure S2), indicating their diagnostic potential for distinguishing depressed mice. Similarly, ROC analysis between HFD-Model and HFD-MA groups showed AUC values association between these metabolic changes and MA’s antidepressant effects. Metabolic pathway topology analysis via MetaboAnalyst revealed that MA primarily modulated key pathways including apoptosis, unsaturated fatty acid biosynthesis, sphingolipid signaling, linoleic acid metabolism, glycine/serine/threonine metabolism, and arachidonic acid metabolism (Figure 3E). Lipid-related pathways played particularly important roles in MA’s antidepressant effects. Specifically, HFD-Model mice showed significantly decreased hepatic DGLA and increased erucic acid levels compared to Normal controls, both of which were normalized by MA treatment. Existing evidence indicates that DGLA, an ω-6 polyunsaturated fatty acid, exhibits an inverse correlation with depression risk[52]. DGLA can be converted to arachidonic acid by Δ5-desaturase (encoded by fatty acid desaturase 1, FADS1)[53], which subsequently generates pro-inflammatory leukotrienes and prostaglandins[54]. DGLA accumulation competitively inhibits arachidonic acid metabolism, thereby exerting anti-inflammatory effects[55,56]. Consistent with this mechanism, RT-qPCR analysis demonstrated significant upregulation of hepatic FADS1 expression in HFD-Model mice ( P < 0.001) (Figure 3F), indicating enhanced DGLA-to-arachidonic acid conversion, while MA intervention markedly reversed this trend ( P < 0.01). These findings suggest that MA may regulate unsaturated fatty acid metabolism and maintain hepatic metabolic homeostasis by elevating DGLA levels and suppressing FADS1 expression, consequently reducing arachidonic acid-derived inflammatory mediators. Fig. 3. MA modulated the hepatic metabolic profile in HFD-fed mice. (A) PLS-DA score plot and permutation test plot in positive ion mode. (B) PLS-DA score plot and permutation test plot in negative ion mode. (C) Heatmap of differential liver metabolites between the Normal group and HFD-Model group. (D) Heatmap of significantly modulated liver metabolites after MA intervention. (E) Heatmap of enriched pathway analysis for MA-modulated liver metabolites. (F) FADS1 mRNA expression levels in mice liver. (A-E), n=6. (F), n=3. * P < 0.05, *** P < 0.001, compared to the Normal group. ## P < 0.01, compared to the HFD-Model group. 3.5. MA inhibited ferroptosis in HFD-fed mice Numerous studies have demonstrated abnormally elevated iron levels in the hippocampus and prefrontal cortex of patients with depression[57,58]. Uncontrolled lipid peroxidation, a hallmark feature of ferroptosis, is closely associated with neuronal death and plays a pivotal role in depression pathogenesis[59]. Our findings demonstrated that MA treatment significantly reversed alterations in the lipid peroxidation marker MDA and antioxidant enzyme SOD activity, potentially through upregulating DGLA levels and suppressing FADS1 gene expression to modulate unsaturated fatty acid metabolism. Building upon these observations, we next investigated whether MA treatment could inhibit HFD-induced ferroptosis. As shown in Figures 4A and 4B, HFD-Model mice exhibited significantly increased Fe 2+ levels in both liver and brain tissues compared to the Normal group ( P < 0.05 and P < 0.001, respectively), which were markedly attenuated by MA intervention (both P < 0.01). TEM revealed abnormal mitochondrial morphology in the hippocampus of HFD-Model mice, characterized by cristae fragmentation or disappearance, outer membrane disruption, blurred boundaries, and increased vacuolization. In contrast, HFD-MA group mitochondria maintained relatively intact structures with more discernible cristae (Figure 4C). Quantitative analysis indicated no significant differences in total mitochondrial numbers among groups ( P > 0.05) (Figure 4D), but the proportion of damaged mitochondria was significantly higher in HFD-Model versus Normal group ( P < 0.01), with MA treatment significantly reducing this ratio ( P < 0.05) (Figure 4E). Furthermore, HFD-Model mice showed significantly upregulated hepatic ACSL4 ( P < 0.01) and downregulated GPX4 protein expression ( P < 0.01) compared to Normal controls, both of which were effectively reversed by MA intervention ( P < 0.05 and P < 0.01, respectively) (Figure 4F-H). Hippocampal ACSL4 and GPX4 expression patterns mirrored those observed in liver tissues (Figure 4I-K). Collectively, these findings demonstrate that HFD-induced depression-like mice exhibit activated ferroptosis pathways, which are significantly suppressed by MA treatment. Fig. 4. MA inhibited ferroptosis in HFD-fed mice. (A) Levels of Fe 2+ in liver. (B) Levels of Fe 2+ in brain. (C) Morphology of mitochondria in the hippocampus of mice. (D) Quantified mitochondrial number. (E) Percentage of damaged mitochondria. (F-H) ACSL4 and GPX4 protein expression and relative intensity in liver. (I-K) ACSL4 and GPX4 protein expression and relative intensity in hippocampus. (A, B), n=6. (C-K), n=3. * P < 0.05, ** P < 0.01, *** P < 0.001, compared to the Normal group. # P < 0.05, ## P < 0.01, compared to the HFD-Model group. not-yet-known not-yet-known not-yet-known unknown 3.6. MA inhibited HFD-induced ferroptosis in mice through the AMPK-CPT1A pathway AMPK, a cellular energy sensor, maintains lipid metabolic homeostasis by phosphorylating ACC to inhibit fatty acid synthesis while activating CPT1 to promote fatty acid β-oxidation [60,61]. Dysregulated AMPK activity has been consistently observed in metabolic disorders (e.g., diabetes, obesity) and neurodegenerative diseases[62,63]. Emerging evidence demonstrates that AMPK modulates ferroptosis susceptibility in disease progression[64,65]. We subsequently investigated the role of the AMPK-CPT1A pathway in MA-mediated ferroptosis inhibition. Our results revealed that while total AMPK protein expression in liver and hippocampal tissues showed no significant differences between HFD-Model and Normal groups (P > 0.05 for both), the phosphorylation level (p-AMPK/AMPK ratio) was markedly reduced (P < 0.001 and P < 0.01, respectively), accompanied by significantly downregulated CPT1A expression (P < 0.01 and P < 0.001, respectively). MA treatment effectively restored both p-AMPK and CPT1A levels (Figures 5A-H). To further validate MA-AMPK interactions, we performed molecular docking analysis (Figures 5I-J). The results demonstrated strong binding affinity between MA and AMPK protein, with the highest binding energy reaching -5.201 kcal/mol. In this conformation, MA formed hydrogen bonds with THR-88, ILE-87, THR-86, ARG-69, ARG-151, and PHE-243 residues of AMPK. These findings suggest that MA may exert its antidepressant effects by promoting AMPK phosphorylation to activate CPT1A expression, thereby inhibiting ferroptosis in both liver and hippocampal tissues. Fig. 5. MA activated the AMPK-CPT1A signaling pathway in HFD-fed mice. (A-D) AMPK and CPT1A protein expression and relative intensity in liver. (E-H) AMPK and CPT1A protein expression and relative intensity in hippocampus. (I, J) Molecular docking of MA and AMPK. (A-H), n=3. ** P < 0.01, *** P < 0.001, compared to the Normal group. ## P < 0.01, compared to the HFD-Model group. 4. Discussion Converging evidence from clinical, epidemiological, and animal studies indicates that long-term excessive consumption of a HFD adversely affects cognitive and emotional function[66,66–68]. However, the specific mechanisms through which HFD impacts brain health have not been fully elucidated. MA, a key intermediate metabolite in the TCA cycle, shows significant alterations in both patients with depression and animal models of depression[31–33]. Previous studies have demonstrated that MA can improve memory function in mice[41] and alleviate depressive-like behaviors and neuroinflammatory responses in a rat model subjected to CUMS[42]. Nevertheless, no studies to date have investigated the potential interventional effects of MA on HFD-induced depressive-like behaviors. Therefore, this study aims to explore the therapeutic efficacy of MA on HFD-induced depressive-like behaviors and its underlying molecular mechanisms. Our results indicate that MA ameliorates HFD-induced depressive-like behaviors by regulating lipid metabolism and inhibiting ferroptosis via activation of the AMPK–CPT1A pathway. These findings provide new insights into the mechanisms by MA ameliorates depression and offer a theoretical foundation for developing antidepressant strategies targeting lipid metabolism regulation. Consistent with previous rodent studies documenting a negative correlation between excessive HFD intake and neurobehavioral outcomes, our results showed that 16 weeks of HFD consumption significantly reduced the total distance traveled in the OFT and increased immobility time in mice. MA treatment reversed these behavioral changes, significantly improving the decline in autonomous motor and exploratory activities induced by HFD. Similarly, MA rescued the increased immobility time in the TST and FST, effectively mitigating HFD-induced behavioral despair, which suggests that MA has improving effects on HFD-induced depressive-like behaviors. However, MA treatment did not significantly increase the sucrose preference rate in HFD-fed mice. Previous research has indicated that sucrose preference may involve highly complex neurobiological mechanisms reflected in behavioral tasks[69]. Long-term HFD intake may reduce motivation to obtain sweet rewards, a change not necessarily linked to a decreased hedonic response to consuming palatable foods[70]. Therefore, the impact of HFD on the nervous system—particularly on dopaminergic transmission and cannabinoid signaling—requires further in-depth investigation[70]. Studies suggest that disrupted serotonergic neurotransmission may contribute to the comorbidity between HFD and depression[71]. Prolonged HFD exposure leads to significantly reduced levels of 5-HT in the plasma and brains of rodents[6,72]. HFD may interfere with emotional and cognitive function by affecting serotonin dynamics in brain regions such as the hippocampus[73] and prefrontal cortex[74]. However, changes in 5-HT levels in HFD animal models are inconsistent. As highlighted by Moncrieff et al.[75], the intrinsic complexity of the serotonergic system may be a primary reason for contradictory findings across studies. In the present study, MA administration increased 5-HT levels in the serum and hippocampal region of HFD-induced depressive model mice to some extent, though its regulatory effects in other brain regions may be limited. In humans, both body mass index and waist circumference are negatively correlated with physical and mental functioning[76,77], suggesting detrimental effects of obesity on neuropsychological and biobehavioral health[78,79]. In this study, long-term HFD feeding significantly increased body weight, liver index, and epididymal white fat index in mice, induced hepatic lipid accumulation, and led to elevated levels of TC, TG, and LDL-C, or reduced HDL-C in the serum, liver, and brain tissues. These changes resemble metabolic disorders associated with obesity in humans. MA intervention ameliorated HFD-induced abnormal lipid metabolism, reduced hepatic steatosis, and did not affect food intake. The regulatory role of MA in lipid metabolism has been validated in various models. For instance, dietary supplementation with a complex of MA and L-lactate decreased serum TG, increased HDL-C levels, and enhanced hepatic lipid metabolism in broilers[80]; in a rabbit model, skeletal muscle MA content was negatively correlated with serum free fatty acids. Additionally, studies have shown that simvastatin, a lipid-lowering agent, has therapeutic potential for hippocampal neural function and neuropsychiatric disorders[81,82]. Moon et al. also reported that a single administration of palmitic acid—the most representative saturated fatty acid in HFD—induced anxiety-like behaviors in mice[83]. Together with our results, these reports highlight the important role of disordered lipid metabolism in the development and progression of cognitive dysfunction and emotional symptoms. Furthermore, MA treatment enhanced SOD activity and reduced levels of MDA, IL-6, and IL-1β, indicating attenuated oxidative stress and inflammatory responses. Dysregulated lipid metabolism can induce oxidative stress and inflammation, which in turn exacerbate metabolic abnormalities, forming a vicious cycle. This interactive network significantly influences the onset and progression of chronic diseases. Given the significant efficacy of MA in animal experiments, we comprehensively evaluated its impact on liver metabolism in HFD-fed mice using untargeted metabolomics. The liver, as a central metabolic organ, is closely linked to the occurrence and development of depression. Clinical studies have repeatedly reported a positive correlation between depression and the incidence and severity of liver disease[84,85]. Our results showed that HFD intake significantly downregulated levels of GSH and L-glutamate in the liver of mice, suggesting impaired overall antioxidant capacity. GSH is a crucial intracellular antioxidant molecule[86], and its depletion is closely related to HFD-induced anxiety-like behaviors[87]. The biosynthesis of GSH depends on the availability of glutamate, cysteine, and glycine[88]. Among these, L-glutamate is not only a precursor for GSH synthesis but also widely involved in key neural processes such as synaptic plasticity, learning and memory, and neural development[89]. Additionally, GSH and GPX4 together constitute the GPX4–GSH antioxidant system, which plays a central role in counteracting oxidative stress and inhibiting ferroptosis[90]. On the other hand, lipid metabolism-related pathways played key roles in the ameliorative effects of MA on HFD-induced depressive-like behaviors, involving various processes such as biosynthesis of unsaturated fatty acids, arachidonic acid metabolism, linoleic acid metabolism, sphingolipid signaling, primary bile acid biosynthesis, steroid hormone biosynthesis, sphingolipid metabolism, cholesterol metabolism, and bile secretion. Previous studies have indicated that MA can regulate the arachidonic acid metabolism pathway[39] and significantly improve hepatic lipid accumulation in a tilapia model[40]. Chen et al.[39] found through serum metabolomic analysis in sows that the improving effects of MA on oxidative stress and inflammation were closely related to its modulation of amino acid and lipid metabolism. These reports, consistent with our results, demonstrate the regulatory effect of MA on lipid metabolism. Oxidized metabolites of DGLA possess anti-inflammatory, anti-proliferative, anti-atherosclerotic, and vasodilatory effects[91–93] and can be further metabolized into arachidonic acid by Δ-5 desaturase, encoded by the FADS1 gene. HFD serves as an exogenous source of arachidonic acid; its excessive intake promotes the production of pro-inflammatory lipids such as arachidonic acid and its derivatives, thereby enhancing inflammatory signaling[94]. Arachidonic acid can also promote lipid peroxidation-induced cell death[95]. In neuropsychiatric disorders such as major depressive disorder and Alzheimer’s disease, levels of arachidonic acid and its metabolites are often elevated [96], while increasing DGLA levels can reduce the biosynthesis of arachidonic acid metabolites[55,56]. This study revealed that MA may maintain unsaturated fatty acid metabolic homeostasis by upregulating DGLA levels and inhibiting FADS1 expression, thereby reducing the synthesis of arachidonic acid metabolites. Additionally, erucic acid, an ω-9 monounsaturated fatty acid, can promote the expression of genes related to peroxisomal β-oxidation by activating PPARα, while inhibiting SIRT1, AMPK, and CPT1A activity, leading to malonyl-CoA accumulation, reduced mitochondrial oxidative capacity, and hepatic steatosis[97]. This study observed significantly elevated levels of erucic acid in the liver of HFD-fed mice, which were effectively reduced by MA intervention, suggesting that MA may enhance mitochondrial fatty acid oxidation efficiency by reducing erucic acid accumulation, thereby alleviating HFD-induced liver injury and steatosis. However, whether this mechanism involves peroxisomal regulation requires further investigation. The intake and metabolic status of polyunsaturated fatty acids directly affect cellular susceptibility to ferroptosis[59]. Ferroptosis is a form of cell death characterized by aberrant iron deposition, collapse of antioxidant systems, and lipid peroxidation[12]. Abnormal elevations in iron content have been observed in the hippocampus and prefrontal cortex of patients with depression[57,58]. Uncontrolled lipid peroxidation is a hallmark of ferroptosis and is closely associated with neuronal death[59]. Accumulated polyunsaturated fatty acids in depressive states become major substrates for lipid peroxidation; elevated levels of oxidized products such as ceramides and lysophosphatidylcholine can exacerbate oxidative damage and promote ferroptosis[98–100]. Antidepressants like fluoxetine can exert therapeutic effects by reducing levels of lipid peroxidation products such as MDA[17]. Ferroptosis may also be regulated via the liver–brain axis, affecting hepatic amino acid metabolism, inducing neuroinflammation, and promoting ROS generation[65,101], suggesting that inhibiting ferroptosis could be an effective approach for treating depression[20]. In our study, a series of pathological phenomena related to ferroptosis, such as lipid peroxidation, elevated Fe²⁺ levels, and altered mitochondrial morphology, were detected in HFD-induced depressive mice. MA additionally upregulated GPX4, downregulated ACSL4, and inhibited the process of lipid peroxidation in mice. These results indicate that characteristic changes of ferroptosis were observed in both the liver and brain tissues of the HFD-induced depressive mouse model, and the beneficial effects of MA are associated with its anti-ferroptotic actions. AMPK plays a key role in regulating glucose and fatty acid homeostasis and controlling systemic energy metabolism. Dysregulation of AMPK expression or activity is often observed in metabolic diseases such as diabetes and obesity, as well as in neurodegenerative disorders[62,63]. For example, HFD-induced obesity significantly suppresses hepatic AMPK activity[102]. Activated AMPK promotes fatty acid β-oxidation and inhibits lipid peroxidation by phosphorylating and inhibiting ACC and enhancing CPT1 activity[26–28]. Animal studies have shown that AMPK activation protects hippocampal neurons from ferroptosis damage[29], while CPT1A deficiency directly leads to lipid droplet accumulation and ferroptosis[30]. Western blot analysis revealed decreased protein expression of p-AMPK and CPT1A in the liver and brain tissues of HFD-fed mice, which was significantly reversed by MA intervention. Molecular docking results indicated good binding affinity between MA and AMPK. Collectively, our findings suggest that MA may alleviate ferroptosis in HFD-induced depressive mice by activating the AMPK–CPT1A signaling pathway. Although our study preliminarily reveals the mechanism of MA’s action, some limitations should be addressed. While we observed that MA activates the AMPK–CPT1A pathway, direct evidence for the necessity of this pathway is lacking. To further investigate this issue, we plan to conduct AMPK knockdown experiments in the future to clarify its role in this process. Additionally, the current study lacks a comparison of effects with ferroptosis-specific inhibitors alongside MA. Nevertheless, the results of this study preliminarily demonstrate that MA can ameliorate HFD-induced depressive-like behaviors, potentially through activating the AMPK–CPT1A pathway to improve lipid metabolism and inhibit ferroptosis. 5. Conclusions In conclusion, to our knowledge, this is the first study to investigate the effects of MA on HFD-induced depressive-like behaviors. As illustrated in Figure 6, our results indicate that MA regulates lipid metabolism by activating the AMPK–CPT1A pathway, reducing hepatic lipid deposition. Simultaneously, it increases levels of DGLA metabolites and downregulates FADS1 gene expression, upregulates GPX4 protein expression and SOD activity, reduces lipid peroxide production, downregulates ACSL4 protein expression and ferrous ion levels, and attenuates inflammatory responses, ultimately inhibiting ferroptosis and ameliorating HFD-induced depressive-like behaviors. This study not only provides new perspectives for understanding the mechanisms by which MA improves depression but also offers a theoretical basis for developing lipid metabolism-based antidepressant strategies. Fig. 6. Mechanism of MA on HFD-induced depressive-like behaviors. Declaration of competing interest The authors declare they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. CRediT authorship contribution statement Taojia Chen: Methodology, Investigation, Data curation, Writing – original draft. Haining Yu: Conceptualization, Methodology, Writing – review & editing, Supervision, Project administration. Funding None. not-yet-known not-yet-known not-yet-known unknown Availability of data and materials The datasets generated and/or analyzed during the current study are available from the corresponding author upon reasonable request. Supplementary materials Supplementary material associated with this article can be found, in the online version. References [1] C. Otte, S.M. Gold, B.W. Penninx, C.M. Pariante, A. Etkin, M. Fava, D.C. Mohr, A.F. Schatzberg, Major depressive disorder, Nat Rev Dis Primers 2 (2016) 1–20. https://doi.org/10.1038/nrdp.2016.65.[2] K.M. Kendall, E.V. Assche, T.F.M. Andlauer, K.W. Choi, J.J. Luykx, E.C. Schulte, Y. Lu, The genetic basis of major depression, Psychological Medicine 51 (2021) 2217–2230. https://doi.org/10.1017/S0033291721000441.[3] E. Altherr, A. Rainwater, D. Kaviani, T. Q, G. Ad, Long-term high fat diet consumption reversibly alters feeding behavior via a dopamine-associated mechanism in mice, Behavioural Brain Research 414 (2021) 113470. https://doi.org/10.1016/j.bbr.2021.113470.[4] A. Abildgaard, S. Lund, K. Hougaard, Chronic high-fat diet increases acute neuroendocrine stress response independently of prenatal dexamethasone treatment in male rats, Acta Neuropsychiatrica 26 (2014) 8–18. https://doi.org/10.1017/neu.2013.28.[5] M. Ortiz-Valladares, R. Pedraza-Medina, M.F. Pinto-González, J.G. Muñiz, O. Gonzalez-Perez, N.A. Moy-López, Neurobiological approaches of high-fat diet intake in early development and their impact on mood disorders in adulthood: A systematic review, Neurosci Biobehav Rev 129 (2021) 218–230. https://doi.org/10.1016/j.neubiorev.2021.07.028.[6] J. Zemdegs, G. Quesseveur, D. Jarriault, L. Pénicaud, X. Fioramonti, B.P. Guiard, High-fat diet-induced metabolic disorders impairs 5-HT function and anxiety-like behavior in mice, Br J Pharmacol 173 (2016) 2095–2110. https://doi.org/10.1111/bph.13343.[7] C. Yang, G. Sui, D. Li, L. Wang, S. Zhang, P. Lei, Z. Chen, F. Wang, Exogenous IGF-1 alleviates depression-like behavior and hippocampal mitochondrial dysfunction in high-fat diet mice, Physiology & Behavior 229 (2021) 113236. https://doi.org/10.1016/j.physbeh.2020.113236.[8] R. Rebai, L. Jasmin, A. Boudah, Agomelatine effects on fat-enriched diet induced neuroinflammation and depression-like behavior in rats, Biomedicine & Pharmacotherapy 135 (2021) 111246. https://doi.org/10.1016/j.biopha.2021.111246.[9] Y. Yang, Z. Zhong, B. Wang, W. Y, Xiaoyao San ameliorates high-fat diet-induced anxiety and depression via regulating gut microbiota in mice, Biomedicine & Pharmacotherapy 156 (2022) 113902. https://doi.org/10.1016/j.biopha.2022.113902.[10] J. Schachter, J. Martel, C.-S. Lin, C.-J. Chang, T.-R. Wu, C.-C. Lu, Y.-F. Ko, H.-C. Lai, D.M. Ojcius, J.D. Young, Effects of obesity on depression: A role for inflammation and the gut microbiota, Brain Behav Immun 69 (2018) 1–8. https://doi.org/10.1016/j.bbi.2017.08.026.[11] L. Cui, S. Li, S. Wang, X. Wu, Y. Liu, W. Yu, Y. Wang, Y. Tang, M. Xia, B. Li, Major depressive disorder: hypothesis, mechanism, prevention and treatment, Sig Transduct Target Ther 9 (2024) 1–32. https://doi.org/10.1038/s41392-024-01738-y.[12] J. Li, F. Cao, H. Yin, Z. Huang, Z. Lin, N. Mao, B. Sun, G. Wang, Ferroptosis: past, present and future, Cell Death Dis 11 (2020) 1–13. https://doi.org/10.1038/s41419-020-2298-2.[13] Y. Syafrita, D. Amir, R. Susanti, F. I, Relationship of brain-derived neurotrophic factor, malondialdehyde, and 8-Hydroxy 2-Deoxyguanosine with post-ischemic stroke depression, Dementia & Neuropsychologia 14 (2020) 41–46. https://doi.org/10.1590/1980-57642020dn14-010007.[14] A. Almulla, Y. Thipakorn, A. Algon, T. C, A.-H. Hk, M. M, Reverse cholesterol transport and lipid peroxidation biomarkers in major depression and bipolar disorder: A systematic review and meta-analysis, Brain, Behavior, and Immunity 113 (2023) 374–388. https://doi.org/10.1016/j.bbi.2023.08.007.[15] P. Urrutia, P. Aguirre, A. Esparza, T. V, M. Np, A. M, G.-B. C, N. Mt, Inflammation alters the expression of DMT1, FPN1 and hepcidin, and it causes iron accumulation in central nervous system cells, Journal of Neurochemistry 126 (2013) 541–549. https://doi.org/10.1111/jnc.12244.[16] J. Lee, D. Hyun, The interplay between intracellular iron homeostasis and neuroinflammation in neurodegenerative diseases, Antioxidants 12 (2023) 918. https://doi.org/10.3390/antiox12040918.[17] M. Sowa-Kućma, K. Styczeń, M. Siwek, P. Misztak, R.J. Nowak, D. Dudek, J.K. Rybakowski, G. Nowak, M. Maes, Lipid Peroxidation and Immune Biomarkers Are Associated with Major Depression and Its Phenotypes, Including Treatment-Resistant Depression and Melancholia, Neurotox Res 33 (2018) 448–460. https://doi.org/10.1007/s12640-017-9835-5.[18] R. Dang, M. Wang, X. Li, H. Wang, L. Liu, Q. Wu, J. Zhao, P. Ji, L. Zhong, J. Licinio, P. Xie, Edaravone ameliorates depressive and anxiety-like behaviors via Sirt1/Nrf2/HO-1/Gpx4 pathway, J Neuroinflammation 19 (2022) 41. https://doi.org/10.1186/s12974-022-02400-6.[19] H. Jiao, H. Yang, Z. Yan, J. Chen, M. Xu, Y. Jiang, Y. Liu, Z. Xue, Q. Ma, X. Li, J. Chen, Traditional Chinese formula Xiaoyaosan alleviates depressive-like behavior in CUMS mice by regulating PEBP1-GPX4-mediated ferroptosis in the hippocampus, NDT 17 (2021) 1001–1019. https://doi.org/10.2147/NDT.S302443.[20] Y. Cheng, Y. Song, H. Chen, Q. Li, Y. Gao, G. Lu, C. Luo, Ferroptosis mediated by lipid reactive oxygen species: A possible causal link of neuroinflammation to neurological disorders, Oxidative Medicine and Cellular Longevity 2021 (2021) 5005136. https://doi.org/10.1155/2021/5005136.[21] Z. Jiang, H. Sun, J. Miao, Q. Sheng, J. Xu, Z. Gao, X. Zhang, Y. Song, K. Chen, The natural flavone acacetin protects against high-fat diet-induced lipid accumulation in the liver via the endoplasmic reticulum stress/ferroptosis pathway, Biochemical and Biophysical Research Communications 640 (2023) 183–191. https://doi.org/10.1016/j.bbrc.2022.12.014.[22] X. Dai, R. Zhang, B. Wang, Contribution of classification based on ferroptosis-related genes to the heterogeneity of MAFLD, BMC Gastroenterology 22 (2022) 55. https://doi.org/10.1186/s12876-022-02137-9.[23] D. Li, Y. Li, The interaction between ferroptosis and lipid metabolism in cancer, Sig Transduct Target Ther 5 (2020) 1–10. https://doi.org/10.1038/s41392-020-00216-5.[24] E. Seo, H. Kang, H. Choi, W. Choi, H.-S. Jun, Reactive oxygen species-induced changes in glucose and lipid metabolism contribute to the accumulation of cholesterol in the liver during aging, Aging Cell 18 (2019) e12895. https://doi.org/10.1111/acel.12895.[25] J. Marschallinger, T. Iram, M. Zardeneta, S.E. Lee, B. Lehallier, M.S. Haney, J.V. Pluvinage, V. Mathur, O. Hahn, D.W. Morgens, J. Kim, J. Tevini, T.K. Felder, H. Wolinski, C.R. Bertozzi, M.C. Bassik, L. Aigner, T. Wyss-Coray, Lipid-droplet-accumulating microglia represent a dysfunctional and proinflammatory state in the aging brain, Nat Neurosci 23 (2020) 194–208. https://doi.org/10.1038/s41593-019-0566-1.[26] X. Jiang, B.R. Stockwell, M. Conrad, Ferroptosis: mechanisms, biology, and role in disease, Nat Rev Mol Cell Biol 22 (2021) 266–282. https://doi.org/10.1038/s41580-020-00324-8.[27] H. Lee, F. Zandkarimi, Y. Zhang, J.K. Meena, J. Kim, L. Zhuang, S. Tyagi, L. Ma, T.F. Westbrook, G.R. Steinberg, D. Nakada, B.R. Stockwell, B. Gan, Energy-stress-mediated AMPK activation inhibits ferroptosis, Nat Cell Biol 22 (2020) 225–234. https://doi.org/10.1038/s41556-020-0461-8.[28] T. Liao, W. Mei, L. Zhang, L. Ding, N. Yang, P. Wang, L. Zhang, L-carnitine alleviates synovitis in knee osteoarthritis by regulating lipid accumulation and mitochondrial function through the AMPK-ACC-CPT1 signaling pathway, Journal of Orthopaedic Surgery and Research 18 (2023) 386. https://doi.org/10.1186/s13018-023-03872-9.[29] Z. Xie, X. Wang, X. Luo, J. Yan, J. Zhang, R. Sun, A. Luo, S. Li, Activated AMPK mitigates diabetes-related cognitive dysfunction by inhibiting hippocampal ferroptosis, Biochemical Pharmacology 207 (2023) 115374. https://doi.org/10.1016/j.bcp.2022.115374.[30] Z.S. Ulhaq, Y. Ogino, W.K.F. Tse, Deciphering the pathogenesis of retinopathy associated with carnitine palmitoyltransferase I deficiency in zebrafish model, Biochemical and Biophysical Research Communications 664 (2023) 100–107. https://doi.org/10.1016/j.bbrc.2023.04.096.[31] L. Ting, S. Liu, Y. Gao, H. Ym, T. Js, Q. Xm, Stable isotope-resolved metabolomics reveals the abnormal brain glucose catabolism in depression based on chronic unpredictable mild stress rats, Journal of Proteome Research 20 (2021) 3549–3558. https://doi.org/10.1021/acs.jproteome.1c00155.[32] Z. Liang, Y. Jia, Z. Li, L. M, W. Ml, Y. Yl, Y. Lj, S. L, Z. Rx, Urinary biomarkers for diagnosing poststroke depression in patients with type 2 diabetes mellitus, Diabetes, Metabolic Syndrome And Obesity-Targets And Therapy 12 (2019) 1379–1386. https://doi.org/10.2147/DMSO.S215187.[33] D.P. Patel, K.W. Krausz, C. Xie, D. Beyoğlu, F.J. Gonzalez, J.R. Idle, Metabolic profiling by gas chromatography-mass spectrometry of energy metabolism in high-fat diet-fed obese mice, PLOS ONE 12 (2017) e0177953. https://doi.org/10.1371/journal.pone.0177953.[34] S. Ding, Y. Yang, J. Mei, Protective Effects of L-Malate against Myocardial Ischemia/Reperfusion Injury in Rats, Evidence-Based Complementary and Alternative Medicine 2016 (2016) e3803657. https://doi.org/10.1155/2016/3803657.[35] W. Jl, W. Qp, Y. Xf, W. Mk, Z. Jm, H. Q, Z. Xy, L-malate reverses oxidative stress and antioxidative defenses in liver and heart of aged rats, Physiological Research 57 (2008). https://doi.org/10.33549/physiolres.931161.[36] P. Zhang, G. Jiang, Y. Wang, E. Yan, L. He, J. Guo, J. Yin, X. Zhang, Maternal consumption of l-malic acid enriched diets improves antioxidant capacity and glucose metabolism in offspring by regulating the gut microbiota, Redox Biology 67 (2023) 102889. https://doi.org/10.1016/j.redox.2023.102889.[37] F.-L. Zhang, Z. Hu, Y.-F. Wang, W.-J. Zhang, B.-W. Zhou, Q.-S. Sun, Z.-B. Lin, K.-X. Liu, Organoids transplantation attenuates intestinal ischemia/reperfusion injury in mice through L-Malic acid-mediated M2 macrophage polarization, Nat Commun 14 (2023) 6779. https://doi.org/10.1038/s41467-023-42502-0.[38] Y. Nishida, K. Nishijima, Y. Yamada, H. Tanaka, A. Matsumoto, J. Fan, Y. Uda, H. Tomatsu, H. Yamamoto, K. Kami, S. Kitajima, K. Tanaka, Whole-body insulin resistance and energy expenditure indices, serum lipids, and skeletal muscle metabolome in a state of lipoprotein lipase overexpression, Metabolomics 17 (2021) 26. https://doi.org/10.1007/s11306-021-01777-4.[39] M. Chen, Y. Zhao, S. Li, Z. Chang, H. Liu, D. Zhang, S. Wang, X. Zhang, J. Wang, Maternal malic acid may ameliorate oxidative stress and inflammation in sows through modulating gut microbiota and host metabolic profiles during late pregnancy, Antioxidants 13 (2024) 253. https://doi.org/10.3390/antiox13020253.[40] Y.-J. Chen, T.-Y. Zhang, L. Luo, Y.-Q. Shi, F.-J. Bai, D.-N. Jiang, Impact of dietary L-malic acid supplementation on growth, feed utilization, ash deposition, and hepatic lipid metabolism of juvenile genetically improved farmed tilapia, oreochromis niloticus, Journal of the World Aquaculture Society 48 (2017) 563–573. https://doi.org/10.1111/jwas.12388.[41] H.Y. Zhou, G.T. Zheng, S.S. Zhang, [Effects of L-malate, an inhibitor of glutamate decarboxylase, on learning and memory in mice], Yao Xue Xue Bao 31 (1996) 897–900.[42] K.M.M. Koriem, H.A.K. Tharwat, Malic acid improves behavioral, biochemical, and molecular disturbances in the hypothalamus of stressed rats, JIN 22 (2023) 98. https://doi.org/10.31083/j.jin2204098.[43] K.L. McIlwain, M.Y. Merriweather, L.A. Yuva-Paylor, R. Paylor, The use of behavioral test batteries: Effects of training history, Physiol. Behav. 73 (2001) 705–717. https://doi.org/10.1016/S0031-9384(01)00528-5.[44] E.J. Want, P. Masson, F. Michopoulos, I.D. Wilson, G. Theodoridis, R.S. Plumb, J. Shockcor, N. Loftus, E. Holmes, J.K. Nicholson, Global metabolic profiling of animal and human tissues via UPLC-MS, Nat Protoc 8 (2013) 17–32. https://doi.org/10.1038/nprot.2012.135.[45] R.D. Oades, G.M. Halliday, Ventral tegmental (A10) system: neurobiology. 1. Anatomy and connectivity, Brain Res 434 (1987) 117–165. https://doi.org/10.1016/0165-0173(87)90011-7.[46] H. Yoon, J. Shaw, M. Haigis, G. A, Lipid metabolism in sickness and in health: Emerging regulators of lipotoxicity, Molecular Cell 81 (2021) 3708–3730. https://doi.org/10.1016/j.molcel.2021.08.027.[47] M. Riwanto, U. Landmesser, High density lipoproteins and endothelial functions: mechanistic insights and alterations in cardiovascular disease1, Journal of Lipid Research 54 (2013) 3227–3243. https://doi.org/10.1194/jlr.R037762.[48] P. Perswani, S.M. Ismail, H. Mumtaz, N. Uddin, M. Asfand, A.B.B. Khalil, A. Ijlal, S.E. Khan, M. Usman, H. Younas, A. Rai, Rethinking HDL-C: An in-depth narrative review of its role in cardiovascular health, Current Problems in Cardiology 49 (2024) 102152. https://doi.org/10.1016/j.cpcardiol.2023.102152.[49] C. Fan, A. Ling-Hu, D. Sun, W. Gao, C. Zhang, X. Duan, H. Li, W. Tian, Q. Yu, Z. Ke, Nobiletin ameliorates hepatic lipid deposition, oxidative stress, and inflammation by mechanisms that involve the Nrf2/NF-κB axis in nonalcoholic fatty liver disease, J. Agric. Food Chem. 71 (2023) 20105–20117. https://doi.org/10.1021/acs.jafc.3c06498.[50] Z. Chen, R. Tian, Z. She, J. Cai, H. Li, Role of oxidative stress in the pathogenesis of nonalcoholic fatty liver disease, Free Radical Biology and Medicine 152 (2020) 116–141. https://doi.org/10.1016/j.freeradbiomed.2020.02.025.[51] S. Bhatt, A.N. Nagappa, C.R. Patil, Role of oxidative stress in depression, Drug Discov Today 25 (2020) 1270–1276. https://doi.org/10.1016/j.drudis.2020.05.001.[52] T. Yary, T. Tolmunen, S.M. Lehto, T.-P. Tuomainen, T. Nurmi, J. Kauhanen, S. Voutilainen, A. Ruusunen, Serum dihomo-γ-linolenic acid level is inversely associated with the risk of depression. A 21-year follow-up study in general population men, Journal of Affective Disorders 213 (2017) 151–155. https://doi.org/10.1016/j.jad.2017.02.022.[53] A.P. Simopoulos, The importance of the omega-6/omega-3 fatty acid ratio in cardiovascular disease and other chronic diseases, Exp Biol Med (Maywood) 233 (2008) 674–688. https://doi.org/10.3181/0711-MR-311.[54] E. Gorica, V. Calderone, Arachidonic acid derivatives and neuroinflammation, CNS & Neurological Disorders Drug Targets 21 (2022) 118–129. https://doi.org/10.2174/1871527320666210208130412.[55] J. de Goede, W.M.M. Verschuren, J.M.A. Boer, D. Kromhout, J.M. Geleijnse, Alpha-Linolenic acid Intake and 10-year incidence of coronary heart disease and stroke in 20,000 middle-aged men and women in the netherlands, PLOS ONE 6 (2011) e17967. https://doi.org/10.1371/journal.pone.0017967.[56] L. Iversen, K. Fogh, G. Bojesen, K. Kragballe, Linoleic acid and dihomogammalinolenic acid inhibit leukotriene B4 formation and stimulate the formation of their 15-lipoxygenase products by human neutrophils in vitro. Evidence of formation of antiinflammatory compounds, Agents Actions 33 (1991) 286–291. https://doi.org/10.1007/BF01986575.[57] C. Berthou, J. Iliou, D. Barba, Iron, neuro-bioavailability and depression, EJHaem 3 (2021) 263–275. https://doi.org/10.1002/jha2.321.[58] A. Knyszyńska, A. Radecka, P. Zabielska, Ł. J, K. B, L. A, The role of iron metabolism in fatigue, depression, and quality of life in multiple sclerosis patients, International Journal of Environmental Research and Public Health 17 (2020) 6818. https://doi.org/10.3390/ijerph17186818.[59] L.E. Pope, S.J. Dixon, Regulation of ferroptosis by lipid metabolism, Trends Cell Biol 33 (2023) 1077–1087. https://doi.org/10.1016/j.tcb.2023.05.003.[60] D. Hardie, D. Pan, Regulation of fatty acid synthesis and oxidation by the AMP-activated protein kinase, Biochemical Society Transactions 30 (2002) 1064–1070. https://doi.org/10.1042/bst0301064.[61] Y. Li, S. Xu, M. Mihaylova, Z. B, H. X, J. B, P. O, L. Z, L. E, S. Jy, G. B, W. M, V. Tj, S. Rj, C. Ra, Z. M, AMPK phosphorylates and inhibits SREBP activity to attenuate hepatic steatosis and atherosclerosis in diet-induced insulin-resistant mice, Cell Metabolism 13 (2011) 376–388. https://doi.org/10.1016/j.cmet.2011.03.009.[62] C. Peixoto, W. Oliveira, S. Araújo, N. Aks, AMPK activation: Role in the signaling pathways of neuroinflammation and neurodegeneration, Experimental Neurology 298 (2017) 31–41. https://doi.org/10.1016/j.expneurol.2017.08.013.[63] D. Carling, AMPK signalling in health and disease, Current Opinion in Cell Biology 45 (2017) 31–37. https://doi.org/10.1016/j.ceb.2017.01.005.[64] T. Guo, W. Yan, X. Cui, N. Liu, X. Wei, Y. Sun, K. Fan, J. Liu, Y. Zhu, Z. Wang, Y. Zhang, L. Chen, Liraglutide attenuates type 2 diabetes mellitus-associated non-alcoholic fatty liver disease by activating AMPK/ACC signaling and inhibiting ferroptosis, Molecular Medicine 29 (2023) 132. https://doi.org/10.1186/s10020-023-00721-7.[65] X. Yu, S. Wang, Z. Ji, M. J, M. Y, W. X, Y. X, X. P, L. M, G. Y, Ferroptosis: An important mechanism of disease mediated by the gut-liver-brain axis, Life Sciences 347 (2024) 122650. https://doi.org/10.1016/j.lfs.2024.122650.[66] H. Zhuang, X. Yao, H. Li, Q. Li, C. Yang, C. Wang, D. Xu, Y. Xiao, Y. Gao, J. Gao, M. Bi, R. Liu, G. Teng, L. Liu, Long-term high-fat diet consumption by mice throughout adulthood induces neurobehavioral alterations and hippocampal neuronal remodeling accompanied by augmented microglial lipid accumulation, Brain Behav Immun 100 (2022) 155–171. https://doi.org/10.1016/j.bbi.2021.11.018.[67] M.S. Faith, P.E. Matz, M.A. Jorge, Obesity-depression associations in the population, J Psychosom Res 53 (2002) 935–942. https://doi.org/10.1016/s0022-3999(02)00308-2.[68] E. Vagena, J.K. Ryu, B. Baeza-Raja, N.M. Walsh, C. Syme, J.P. Day, M.D. Houslay, G.S. Baillie, A high-fat diet promotes depression-like behavior in mice by suppressing hypothalamic PKA signaling, Transl Psychiatry 9 (2019) 141. https://doi.org/10.1038/s41398-019-0470-1.[69] J.P.H. Verharen, J.W. de Jong, Y. Zhu, S. Lammel, A computational analysis of mouse behavior in the sucrose preference test, Nat Commun 14 (2023) 2419. https://doi.org/10.1038/s41467-023-38028-0.[70] D.M. Arcego, R. Krolow, C. Lampert, A.P. Toniazzo, E.D.S. Garcia, C. Lazzaretti, G. Costa, C. Scorza, C. Dalmaz, Chronic high-fat diet affects food-motivated behavior and hedonic systems in the nucleus accumbens of male rats, Appetite 153 (2020) 104739. https://doi.org/10.1016/j.appet.2020.104739.[71] M. Hersey, J.L. Woodruff, N. Maxwell, A.T. Sadek, M.K. Bykalo, I. Bain, C.A. Grillo, G.G. Piroli, P. Hashemi, L.P. Reagan, High-fat diet induces neuroinflammation and reduces the serotonergic response to escitalopram in the hippocampus of obese rats, Brain Behav Immun 96 (2021) 63–72. https://doi.org/10.1016/j.bbi.2021.05.010.[72] M. Kim, S. Bae, K.-M. Lim, Impact of high fat diet-induced obesity on the plasma levels of monoamine neurotransmitters in C57BL/6 mice, Biomol Ther (Seoul) 21 (2013) 476–480. https://doi.org/10.4062/biomolther.2013.063.[73] Y. Kurhe, R. Mahesh, Ondansetron ameliorates depression associated with obesity in high-fat diet fed experimental mice: An investigation-based on the behavioral, biochemical, and molecular approach, Indian Journal of Pharmacology 49 (2017) 290. https://doi.org/10.4103/ijp.IJP_805_16.[74] A. Lama, C. Pirozzi, C. Annunziata, M.G. Morgese, M. Senzacqua, I. Severi, A. Calignano, L. Trabace, A. Giordano, R. Meli, G. Mattace Raso, Palmitoylethanolamide counteracts brain fog improving depressive-like behaviour in obese mice: Possible role of synaptic plasticity and neurogenesis, British Journal of Pharmacology 178 (2021) 845–859. https://doi.org/10.1111/bph.15071.[75] J. Moncrieff, R.E. Cooper, T. Stockmann, S. Amendola, M.P. Hengartner, M.A. Horowitz, The serotonin theory of depression: a systematic umbrella review of the evidence, Mol Psychiatry 28 (2023) 3243–3256. https://doi.org/10.1038/s41380-022-01661-0.[76] E. Štefanová, P. Bakalár, T. Baška, Eating-Disordered Behavior in Adolescents: Associations with Body Image, Body Composition and Physical Activity, Int J Environ Res Public Health 17 (2020) 6665. https://doi.org/10.3390/ijerph17186665.[77] X. Zhu, Y. Yue, L. Li, L. Zhu, Y. Cai, Y. Shu, The relationship between depression and relative fat mass (RFM): A population-based study, J Affect Disord 356 (2024) 323–328. https://doi.org/10.1016/j.jad.2024.04.031.[78] H. Liu, H. Dong, Y. Zhou, M. Jin, H. Hao, Y. Yuan, H. Jia, The association between Metabolic Score for Visceral Fat and depression in overweight or obese individuals: evidence from NHANES, Front Endocrinol (Lausanne) 15 (2024) 1482003. https://doi.org/10.3389/fendo.2024.1482003.[79] C. Martins, F.M.D.C. Coelho, R.T. Pinheiro, J.V.D.S. Motta, L.D.M. De Souza, C.A.T. Pinheiro, E.F. Kelbert, M.S. Souza, L.M.D.S. Pinheiro, K.A.T. Pinheiro, People living with HIV/AIDS: body image and its important associations with mental health and BMI, Psychol Health Med 25 (2020) 1020–1028. https://doi.org/10.1080/13548506.2019.1691244.[80] K. Qiu, Z. Chen, A. Zheng, W. Chang, H. Cai, X. Zhang, G. Liu, Augmentation of performance, carcass trait, biochemical profile and lipid metabolism concerning the use of organic acidifier in broiler chickens, Agriculture 13 (2023) 1765. https://doi.org/10.3390/agriculture13091765.[81] X.-K. Tong, C. Lecrux, P. Rosa-Neto, E. Hamel, Age-dependent rescue by simvastatin of Alzheimer’s disease cerebrovascular and memory deficits, J Neurosci 32 (2012) 4705–4715. https://doi.org/10.1523/JNEUROSCI.0169-12.2012.[82] H. Wu, W. Lv, Q. Pan, P.K. Kalavagunta, Q. Liu, G. Qin, M. Cai, L. Zhou, T. Wang, Z. Xia, J. Shang, Simvastatin therapy in adolescent mice attenuates HFD-induced depression-like behavior by reducing hippocampal neuroinflammation, J Affect Disord 243 (2019) 83–95. https://doi.org/10.1016/j.jad.2018.09.022.[83] M. Ml, J. Jj, L. Ma, C. Gs, B. Na, K. Ka, F. Gg, The saturated fatty acid, palmitic acid, induces anxiety-like behavior in mice, Metabolism: Clinical and Experimental 63 (2014). https://doi.org/10.1016/j.metabol.2014.06.002.[84] B.H. Mullish, M.S. Kabir, M.R. Thursz, A. Dhar, Review article: depression and the use of antidepressants in patients with chronic liver disease or liver transplantation, Aliment Pharmacol Ther 40 (2014) 880–892. https://doi.org/10.1111/apt.12925.[85] N.A. Youssef, M.F. Abdelmalek, M. Binks, C.D. Guy, A. Omenetti, A.D. Smith, A.M.E. Diehl, A. Suzuki, Associations of depression, anxiety and antidepressants with histological severity of nonalcoholic fatty liver disease, Liver Int 33 (2013) 1062–1070. https://doi.org/10.1111/liv.12165.[86] I. Zalachoras, F. Hollis, E. Ramos-Fernández, L. Trovo, S. Sonnay, E. Geiser, N. Preitner, P. Steiner, C. Sandi, L. Morató, Therapeutic potential of glutathione-enhancers in stress-related psychopathologies, Neuroscience & Biobehavioral Reviews 114 (2020) 134–155. https://doi.org/10.1016/j.neubiorev.2020.03.015.[87] A. Ganji, I. Salehi, A. Sarihi, S. Shahidi, A. Komaki, Effects of Hypericum Scabrum extract on anxiety and oxidative stress biomarkers in rats fed a long-term high-fat diet, Metab Brain Dis 32 (2017) 503–511. https://doi.org/10.1007/s11011-016-9940-9.[88] G. Wu, J.R. Lupton, N.D. Turner, Y.-Z. Fang, S. Yang, Glutathione metabolism and its implications for health, The Journal of Nutrition 134 (2004) 489–492. https://doi.org/10.1093/jn/134.3.489.[89] N.C. Danbolt, Glutamate uptake, Prog Neurobiol 65 (2001) 1–105. https://doi.org/10.1016/s0301-0082(00)00067-8.[90] L. Yang, S. Venneti, D. Nagrath, Glutaminolysis: A hallmark of cancer metabolism, Annual Review of Biomedical Engineering 19 (2017) 163–194. https://doi.org/10.1146/annurev-bioeng-071516-044546.[91] H. Gallagher, J.O. Williams, N. Ferekidis, A. Ismail, Y.-H. Chan, D.R. Michael, I.A. Guschina, V.J. Tyrrell, V.B. O’Donnell, J.L. Harwood, I. Khozin-Goldberg, S. Boussiba, D.P. Ramji, Dihomo-γ-linolenic acid inhibits several key cellular processes associated with atherosclerosis, Biochim Biophys Acta Mol Basis Dis 1865 (2019) 2538–2550. https://doi.org/10.1016/j.bbadis.2019.06.011.[92] M.M. Johnson, D.D. Swan, M.E. Surette, J. Stegner, T. Chilton, A.N. Fonteh, F.H. Chilton, Dietary supplementation with gamma-linolenic acid alters fatty acid content and eicosanoid production in healthy humans, J Nutr 127 (1997) 1435–1444. https://doi.org/10.1093/jn/127.8.1435.[93] W. X, L. H, G. Y, Multiple roles of dihomo-γ-linolenic acid against proliferation diseases, PubMed (2012). https://pubmed.ncbi.nlm.nih.gov/22333072/ (accessed August 3, 2025).[94] S. T, P. A, N. M, W. G, T. I, Arachidonic Acid Metabolites in Cardiovascular and Metabolic Diseases, International Journal of Molecular Sciences 19 (2018). https://doi.org/10.3390/ijms19113285.[95] M.S. Mortensen, J. Ruiz, J.L. Watts, Polyunsaturated fatty acids drive lipid peroxidation during ferroptosis, Cells 12 (2023) 804. https://doi.org/10.3390/cells12050804.[96] R.P. Bazinet, S. Layé, Polyunsaturated fatty acids and their metabolites in brain function and disease, Nat Rev Neurosci 15 (2014) 771–785. https://doi.org/10.1038/nrn3820.[97] X. Chen, L. Shang, S. Deng, P. Li, K. Chen, T. Gao, X. Zhang, Z. Chen, J. Zeng, Peroxisomal oxidation of erucic acid suppresses mitochondrial fatty acid oxidation by stimulating malonyl-CoA formation in the rat liver, Journal of Biological Chemistry 295 (2020) 10168–10179. https://doi.org/10.1074/jbc.RA120.013583.[98] J. Liu, P. Green, J. John Mann, R. Si, S. Me, Pathways of polyunsaturated fatty acid utilization: implications for brain function in neuropsychiatric health and disease, Brain Research 1597 (2015) 220–246. https://doi.org/10.1016/j.brainres.2014.11.059.[99] M. Sublette, F. Daray, L. Ganança, S. Sr, The role of polyunsaturated fatty acids in the neurobiology of major depressive disorder and suicide risk, Molecular Psychiatry 29 (2024) 269–286. https://doi.org/10.1038/s41380-023-02322-6.[100] X. Wang, S. Li, J. Yu, W. W, D. Z, G. S, M. Y, T. R, L. T, M. S, F. Q, D. X, Saikosaponin B2 ameliorates depression-induced microglia activation by inhibiting ferroptosis-mediated neuroinflammation and ER stress, Journal of Ethnopharmacology 316 (2023) 116729. https://doi.org/10.1016/j.jep.2023.116729.[101] Y. Matsubara, H. Kiyohara, T. Teratani, M. Y, K. T, Organ and brain crosstalk: The liver-brain axis in gastrointestinal, liver, and pancreatic diseases, Neuropharmacology 205 (2022) 108915. https://doi.org/10.1016/j.neuropharm.2021.108915.[102] J. Tian, M. Cai, S. Jin, Q. Chen, J. Xu, Q. Guo, Z. Yan, X. Han, H. Lu, JianPi-QingHua formula attenuates nonalcoholic fatty liver disease by regulating the AMPK/SIRT1/NF-κB pathway in high-fat-diet-fed C57BL/6 mice, Pharmaceutical Biology 61 (2023) 647–656. https://doi.org/10.1080/13880209.2023.2188549. Information & Authors Information Version history V1 Version 1 21 October 2025 Copyright This work is licensed under a Non Exclusive No Reuse License. Authors Affiliations Taojia Chen Zhejiang University of Technology College of Pharmaceutical Science View all articles by this author Haining Yu [email protected] Zhejiang University of Technology College of Pharmaceutical Science View all articles by this author Metrics & Citations Metrics Article Usage 459 views 134 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Taojia Chen, Haining Yu. L-Malic acid alleviates high-fat diet-induced depression-like behaviors by modulating lipid metabolism and suppressing ferroptosis through activation of the AMPK-CPT1A pathway. Authorea . 21 October 2025. DOI: https://doi.org/10.22541/au.176107693.38058477/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.176107693.38058477/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'a005966868500db4',t:'MTc3OTU1NTMxOQ=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();