Isolation of feline-derived scFvs against VP1-CDE region of feline calicivirus from phage display library and characterization of their antigen-binding and antiviral potential in vitro

preprint OA: closed
Full text JSON View at publisher
Full text 125,460 characters · extracted from preprint-html · click to expand
Isolation of feline-derived scFvs against VP1-CDE region of feline calicivirus from phage display library and characterization of their antigen-binding and antiviral potential in vitro | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Isolation of feline-derived scFvs against VP1-CDE region of feline calicivirus from phage display library and characterization of their antigen-binding and antiviral potential in vitro Yanquan Wei, Hongmei Wang, Zhen Han, Shijun Bao, Huitian Gou, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8778333/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 14 You are reading this latest preprint version Abstract Feline calicivirus (FCV) causes infectious upper respiratory and virulent systemic diseases in feline population, with a lack of specific antiviral agents available. To address this, we constructed a feline-derived scFv phage display library targeting the VP1-CDE neutralizing region of FCV, using lymphocytes from VP1-CDE-immunized cats. The library had a titer of 2.1×10 8 CFU/mL and good sequence diversity. After three rounds of panning and phage ELISA screening (OD 450 S/N > 10), 5 unique scFv clones (3A5, 3B8, 3H5, 2H5, 2I5) were identified. Eukaryotic expression of scFv-Fc fusion proteins and validation via Western blot, ELISA and immunofluorescence assay confirmed their specific binding to VP1-CDE and FCV-infected F81 cells. Viral neutralization tests showed that scFv-3A5 had the strongest FCV-neutralizing activity (titer 1:64, MNC 1.172 µg/mL), scFv-2H5 showed weak activity (titer 1:16, MNC 4.688 µg/mL), and the other three clones had no significant neutralizing activity. This study provides promising candidate molecules for FCV diagnostic reagents and antiviral therapies. feline calicivirus VP1-CDE protein single-chain variable fragment phage display technology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Feline calicivirus (FCV), a member of the genus Vesivirus in the family Caliciviridae , is a globally prevalent pathogen that causes infectious upper respiratory tract diseases in cats[ 1 , 2 ]. FCV induces a spectrum of clinical manifestations, ranging from mild oral ulcers, sneezing, nasal discharge and coughing to severe systemic disorders caused by virulent systemic FCV (VS-FCV) strains, which are characterized by high fever, skin edema, visceral necrosis and a mortality rate of 50%-79%[ 3 – 5 ]. As a non-enveloped RNA virus, FCV possesses a linear single-stranded positive-sense genome of approximately 7.7 kb, containing three open reading frames (ORFs). Among these, ORF2 encodes the major capsid protein VP1[ 6 ]. VP1 is a key immunogenic component of FCV that mediates virus-host cell interactions and is classified into six functional regions (A-F) [ 7 ]. The CDE region serves as the major neutralizing epitope, with the E region playing a crucial role in recognizing feline junctional adhesion molecule A (fJAM-A) and eliciting neutralizing antibody responses[ 8 , 9 ]. Despite advances in preventive and diagnostic strategies, the paucity of specific antiviral agents remains a critical bottleneck in FCV control[ 10 ]. Single-chain variable fragments (scFvs), generated by linking the variable region of the feline IgG heavy chain (VH) and the variable region of the light chain (VL) of antibodies via a flexible (Gly4Ser) 3 linker, have emerged as promising alternatives to full-length monoclonal antibodies (mAbs) in antiviral research[ 11 , 12 ]. ScFvs exhibit distinct advantages, including low molecular weight, strong tissue penetration, high specificity, low immunogenicity and retained antigen-binding activity[ 13 ]. The three complementarity-determining regions (CDRs) within scFvs form the core antigen-recognition domain, which dictates antibody specificity[ 14 ]. Phage display antibody technology is a mature and widely used method for constructing scFv immune libraries, enabling the establishment of high-capacity libraries and screening of antigen-specific antibodies through multiple rounds of "adsorption-elution-enrichment"[ 15 ]. This technology achieves fusion expression of antibody genes with phage coat protein genes, featuring simplicity, high efficiency and cost-effectiveness[ 16 ]. M13 bacteriophage is the most commonly used vector due to its non-lytic nature and tolerance to extreme conditions (e.g., high temperature, pH fluctuations, denaturants)[ 17 , 18 ]. To date, this technology has been successfully applied to develop specific scFvs against various pathogens, including SARS-CoV-2, rabies virus and African swine fever virus [ 19 – 24 ]. However, significant gaps exist in FCV-specific scFv research: (1) Most existing FCV antibody studies focus on full-length mAbs, with few reports on scFvs targeting the VP1-CDE region, a key neutralizing antigenic determinant; (2) Feline-derived scFvs are rarely developed, while murine-derived mAbs often encounter immunogenicity issues in clinical applications; (3) The absence of a well-characterized feline-derived scFv library against FCV hinders the development of feline-tailored rapid diagnostic reagents and therapeutic antibodies. To address these limitations, this study aimed to construct a feline-derived scFv phage display library targeting FCV VP1-CDE protein and screen for clones with high binding activity. After 3–4 rounds of panning and multiple characterization assays, specific scFvs with potent neutralizing activity were identified. Materials and methods Materials and reagents Competent cells E. coli BL21(DE3), SS320, NEB5α F', and M13KO7 helper phage were purchased from New England Biolabs. Ni-affinity chromatography resin and Protein A affinity chromatography column were supplied by Sangon Biotech (Shanghai) Co., Ltd. HRP-conjugated anti-M13 antibody and HRP-conjugated IgG-Fc antibody were purchased from Sino Biological Inc. CY3-conjugated anti-human IgG-Fc was obtained from Sigma-Aldrich. The pComb3XSS vector, pFUSE-Fc vector, and F81 cells were preserved at our laborary. Two adult male cats, owned by Lanzhou Aibokang Pet Hospital, were housed at the Lanzhou Institute of Husbandry and Pharmaceutical Sciences, Chinese Academy of Agricultural Sciences. The Feline Peripheral Blood Lymphocyte Isolation Kit was obtained from Solarbio (Beijing) Science & Technology Co., Ltd. Primer design Based on the literature reported by Lu Z et al., feline-derived antibody gene sequences were retrieved from GenBank (accession numbers: KY795030-KY795318)[ 25 ]. Relatively conserved sequences were identified by aligning the VH and the variable region of the λ light chain (Vλ). Amplification primers for VH and Vλ were designed using SnapGene software (Table 1 ). All primers were synthesized by Tsingke Biotechnology Co., Ltd. Table 1 Primers for VH and Vλ gene amplification Primer name Primer sequence(5′→3′) FeIGHV-F CTACAAATCCTATGCATCCCAGGTTTTGCTGGTGCACTG FeIGHV-R CCGCCAGGCCACCTCCGCCTGAACCGCCTCCACCGAACACCGATGGGGCCTTGGGA FeIGLV-F GGTTCGGCGGAGGTGGCTCTGGCGGTGGCGGATCGTCCTAYGTGCACTCAGC FeIGLV-R AACAACTTCAACAGTGGACTTGGGCTGACCGAGGACGTC Prokaryotic expression and purification of recombinant VP1-CDE protein Recombinant pET-28a-VP1-CDE plasmid was constructed by homologous recombination, heat-shock transformed into E. coli BL21(DE3) competent cells, and spreaded on 50 µg/mL kanamycin-containing solid LB medium for overnight incubation at 37 ℃. A single colony was inoculated into kanamycin-containing LB medium and cultured overnight. The culture was transferred to fresh LB liquid medium; when OD 600 reached 0.6, 0.5 mM isopropyl-β-D-thiogalactoside (IPTG) was added for overnight induction at 16℃. Post-induction, the culture was centrifuged to discard supernatant; bacterial pellets were resuspended in PBS, ultrasonically disrupted on ice, and lysate centrifuged to separate supernatant and precipitate. VP1-CDE protein in the supernatant was purified by Ni-affinity chromatography and identified by SDS-PAGE and Western blot using anti-FCV feline serum as the primary antibody. Animal immunization and serum antibody titer determination The purified VP1-CDE protein was used as the immunogen to immunize experimental cats. For primary immunization, the protein was fully emulsified with Freund's complete adjuvant and administered via multiple subcutaneous back injections. Booster immunizations were performed with the antigen emulsified in Freund's incomplete adjuvant at two-week intervals. Serum was harvested 14 days post each immunization for antibody titer detection. Indirect ELISA was conducted with VP1-CDE protein (100 ng/well) as the coating antigen to measure serum antibody titers. When the titer exceeded 1:64,000 (OD 450 S/N ratio > 2.1), whole blood was collected from the cats to isolate peripheral blood lymphocytes (PBLs), which were used for the construction of the phage-displayed antibody library. Construction of phage display scFv library Total RNA was extracted from feline PBLs using Trizol reagent, and cDNA was synthesized via reverse transcription. Using the cDNA as a template, the VH and Vλ​ genes were amplified with two primer pairs (FeIGHV-F/FeIGHV-R and FeIGLV-F/FeIGLV-R) and purified. Overlap extension PCR (OE-PCR) was performed with VH​ and Vλ​ genes as templates and FeIGHV-F/FeIGLV-R primers to link them via a (Gly 4 Ser) 3 linker, generating scFv genes, which were inserted into the pComb3XSS phage vector via homologous recombination. The recombinant pComb3XSS vector carrying scFv genes was electroporated into E. coli SS320 competent cells. The electroporated bacterial suspension was transferred to 30 mL antibiotic-free 2YT medium and cultured at 37 ℃ for 1 h. A 100 µL aliquot was serially diluted to 10 3 -10 5 fold, plated on 2YT solid medium, and single colonies were counted to determine phage library titer (formula: Library titer = Number of single colonies × Dilution factor × Total volume of bacterial suspension). The remaining suspension was transferred to 300 mL 2YT medium supplemented with ampicillin and kanamycin, and cultured overnight at 37 ℃. The next day, the culture was centrifuged to collect supernatant; one-quarter volume of PEG 8000/NaCl solution was added, followed by 30 min incubation on ice. After centrifugation, supernatant was discarded, and the pellet was resuspended in 1 mL PBS to obtain the primary scFv phage display library. Twenty-four single colonies were randomly picked for PCR verification of scFv gene insertion, and PCR products of expected size were directly sequenced. Panning of the phage-displayed scFv library Plates were coated with VP1-CDE protein (1 µg/well) at 4 ℃ overnight, with four VP1-CDE-coated wells and four PBS-coated negative control wells. Next day, wells were emptied, blocked with 5% non-fat milk at 37 ℃ for 2 h, washed three times with PBST, then 100 µL primary phage library was added per well and incubated at 37 ℃ for 2 h. Non-specific phages were removed by 8–10 times PBST washes. 100 µL 0.1 mol/L HCl elution buffer was added with 5 min incubation, then immediately neutralized with one-quarter volume 1 mol/L Tris-HCl (pH 9.1). The solution was transferred to 1 mL E. coli NEB5α F' suspension, cultured at 37 ℃ for 1 h, then 2 µL M13KO7 helper phage was added for another 1 h incubation. The suspension was transferred to 35 mL ampicillin/kanamycin-supplemented 2YT medium. This panning was repeated 2–3 times; after each round, eluted phages were serially diluted and plated on 2YT solid medium to compare phage counts between VP1-CDE and control wells for enrichment confirmation. Phage ELISA: Plates were coated with VP1-CDE (100 ng/well) at 4 ℃ overnight, blocked with 5% non-fat milk at 37 ℃ for 2 h. Third-round enriched phages were serially diluted and plated; 92 single colonies and four negative control clones were randomly picked, inoculated into 2YT medium, and cultured overnight at 37 ℃. Next day, supernatants were collected by centrifugation, 150 µL per coated well was incubated at 37 ℃ for 1 h, washed five times with PBST, then HRP-conjugated anti-M13 antibody (1:8,000 in PBST) was added and incubated for 1 h. TMB substrate was added, reaction terminated with 2 mol/L H₂SO₄, and OD₄₅₀ values read. Clones with S/N > 2.1 were selected for eukaryotic expression. Eukaryotic expression of scFv-Fc and Western blot analysis Selected scFv genes were inserted into the pFUSE-Fc eukaryotic expression vector via homologous recombination to generate recombinant pFUSE-Fc-scFv plasmids, which were transiently transfected into Expi293F suspension cells. Five to seven days post-transfection, culture supernatant was collected, and scFv was purified with Protein A resin. SDS-PAGE was performed to determine scFv molecular weight and purity, followed by Western blot to verify its binding to VP1-CDE protein. VP1-CDE and feline parvovirus (FPV) VP2 proteins were used for Western blot; purified scFv (1:500) as primary antibody and HRP-conjugated anti-human IgG-Fc antibody (1:8,000) as secondary antibody, with chemiluminescence detection. Evaluation of scFv-Fc affinity by ELISA Plates were coated with VP1-CDE protein (100 ng/well), with PBS as blank controls. scFv was adjusted to 0.5 mg/mL and serially diluted (1:50, 1:100, 1:200, 1:400, 1:800, 1:1600), and each dilution was added to corresponding wells. HRP-conjugated anti-human IgG-Fc antibody (1:8,000) was used as secondary antibody. Then 100 µL TMB substrate was added, incubated in the dark for 10 min, reaction terminated with 50 µL 2 M H 2 SO 4 , and OD 450 values measured. Evaluation of the binding ability between scFv-Fc and FCV by Immunofluorescence Assay (IFA) F81 cells were seeded into 96-well plates. Next day, 100 TCID 50 FCV was inoculated per well, incubated for 3 h, then wells were emptied and washed three times with PBS. 100 µL pre-chilled 80% acetone was added to fix cells at -20 ℃ for 30 min; acetone was discarded, and wells washed three times with PBST. Cells were blocked with 5% non-fat milk at 37 ℃ for 2 h, washed three times with PBST. Five scFv constructs were diluted to 0.2 mg/mL with PBS, added to each well, incubated at 37 ℃ for 1 h, then washed three times with PBST. Cy3-conjugated anti-human IgG Fc antibody (1:500) was used as secondary antibody, incubated at 37 ℃ in the dark for 1 h, followed by three PBST washes. 50 µL Hoechst 33342 nuclear stain was added, stained at room temperature in the dark for 10 min, and observed under a fluorescence microscope. Virus-free wells served as negative controls. Viral neutralization test (VNT) of scFv-Fc Five scFv-Fc proteins were adjusted to an initial concentration of 75 µg/mL and serially 4-fold diluted with DMEM. Each scFv-Fc dilution was thoroughly mixed with 100 TCID₅₀ FCV suspension, incubated at 37 ℃ for 1 h, and inoculated onto F81 feline kidney cells. Four replicate wells were set for each dilution, with FCV-infected and normal cell controls established simultaneously. Following 48 h of incubation, the cytopathic effect (CPE) was observed and recorded under an inverted microscope. Statistical Analysis Data are expressed as the mean ± standard deviation (SD) unless stated otherwise. Statistical significance was determined via the two-tailed Student’s non-parametric test or one-way analysis of variance (ANOVA), with all analyses conducted using GraphPad Prism software V6.0 (GraphPad Software, Inc., San Diego, CA, USA). Group differences were deemed statistically significant at P < 0.05 (*) and P < 0.01 (**), ‘ns’ indicates no significant difference. Results Prokaryotic expression and purification of VP1-CDE protein The recombinant pET-28a-VP1-CDE plasmid was verified by PCR, and a specific band of approximately 500 bp was amplified, which was consistent with the expected size, indicating successful construction of the recombinant plasmid (Fig. 1 A). The pET-28a-VP1-CDE plasmid was transformed into E. coli BL21(DE3) competent cells for induced prokaryotic expression. Bacterial cells were lysed by ultrasonication, and the lysate supernatant was collected for purification of the VP1-CDE protein via Ni-affinity chromatography. SDS-PAGE analysis revealed a band of approximately 18 kDa in both the bacterial lysate supernatant and purified eluates, which was consistent with the theoretical molecular weight of the VP1-CDE protein (Fig. 1 B). Subsequent Western blot analysis using anti-FCV feline serum as the primary antibody demonstrated that specific bands of the expected molecular weight were detected in both the VP1-CDE protein and FCV viral suspension lanes, confirming the correct expression and immunoreactivity of the VP1-CDE protein (Fig. 1 C). Determination of serum antibody titer in immunized cats Following immunization of experimental cats with the VP1-CDE protein as the immunogen, blood was collected from the hind limb veins after five consecutive immunizations, and serum was isolated for antibody titer determination via indirect ELISA. The results showed that the serum antibody titers of the two experimental cats reached a sample-to-negative (S/N) OD 450 ratio of > 2.1 at a dilution of 1:64,000, which met the established criteria for constructing a phage-displayed antibody library (Fig. 2 ). Amplification of scFv genes Total RNA was extracted from PBLs and reverse-transcribed into cDNA, from which the variable heavy (VH​) and variable lambda light chain (Vλ) gene fragments were amplified separately. A VH​ gene fragment of approximately 400 bp and a Vλ gene fragment of approximately 350 bp were successfully amplified (Fig. 3 A, B), consistent with the expected sizes. Using gel-purified VH​ and Vλ fragments as templates, overlap extension PCR was performed, and an scFv gene band of approximately 750 bp was successfully obtained (Fig. 3 C). Construction and quality evaluation of the scfv phage-displayed library The scFv fragments were cloned into the linearized pComb3XSS phage vector, and a scFv phage-displayed library was constructed following electroporation into E. coli SS320 competent cells. The titer of the antibody library was determined by serial dilution and plating of the electroporated bacterial suspension, which reached 2.1×10 8 CFU/mL. Twenty-four single colonies were randomly selected for PCR verification, all of which yielded an amplification band of approximately 750 bp. Phylogenetic tree analysis was performed using MEGA software based on the sequences of the 24 clones, and the results showed that the 24 sequences were non-redundant (Fig. 4 ). These data indicated that the constructed scFv phage-displayed library exhibited good diversity and met the requirements for subsequent panning experiments. Panning of the scFv phage-displayed library Panning of the scFv phage-displayed library was performed based on antigen-antibody specific binding, and the library underwent three rounds of "adsorption-elution-enrichment" panning cycles. Plating results demonstrated that specific phage enrichment was achieved in both the second and third rounds: the number of phage-containing bacteria eluted from VP1-CDE-coated wells was significantly higher than that from PBS-coated control wells, indicating successful enrichment of VP1-CDE-specific phage antibodies (Fig. 5 A,B). Ninety-two single colonies were randomly selected from third-round panning plates for phage ELISA screening, with four parallel negative controls established. Among these clones, 30 exhibited an S/N ratio of OD 450 >10 and were identified as high-affinity positive clones (Fig. 5 C). The 30 positive clones were subjected to PCR amplification. Fifteen scFv genes amplified from the positive clones were randomly selected for nucleotide sequencing and deduced amino acid sequence alignment. Sequence alignment via Snapgene software revealed five clones with unique scFv amino acid sequences, which were designated as 3A5, 3B8, 3H5, 2H5 and 2I5, respectively. The VH sequences of the five scFvs were highly conserved, whereas their Vλ sequences showed significant amino acid diversity. The major amino acid variations were concentrated in the CDR3 regions. The CDR3 regions of the Vλ domains of the five scFvs contained 10–13 amino acids, while the framework regions were relatively conserved. Eukaryotic expression of scFvs and evaluation of their binding affinity by Western blot The five scFv genes were individually ligated into the pFUSE-Fc eukaryotic expression vector and transfected into Expi293F cells. After 5 days of transfection, the culture supernatant was harvested and purified via Protein A resin. SDS-PAGE analysis of the purified eluted proteins revealed a single band at approximately 55 kDa, which was consistent with the theoretical molecular weight of the recombinant scFvs proteins (Fig. 6 A). The VP1-CDE protein and FPV VP2 protein (negative control) were separately prepared for Western blot assay. The five distinct scFvs were used as the primary antibodies, and HRP-conjugated anti-human IgG-Fc antibody was used as the secondary antibody. The results showed that specific binding bands were detected in the range of 15–25 kDa, indicating that all five scFvs could specifically bind to the VP1-CDE protein but not to the FPV VP2 protein (Fig. 6 B-F). Evaluation of scFv-Fc binding affinity for VP1-CDE antigen by ELISA Initially, all five scFv-Fc fusion proteins were adjusted to a concentration of 0.5 mg/mL, and then the recombinant proteins were serially diluted for indirect ELISA to determine their specific antigen-binding capacity to the VP1-CDE antigen. The results showed that the OD 450 values of the wells incubated with the five scFv-Fc proteins exhibited a decreasing trend with the decrease in the antigen coating concentration, and the corresponding OD 450 values were significantly higher than those of the negative control wells coated solely with PBS. These findings indicated that all five scFv-Fc proteins exhibited specific VP1-CDE antigen-binding activity. Among them, scFv-3A5 exhibited the highest OD 450 absorbance values, demonstrating excellent antigen-binding capacity, whereas scFv-2I5 and scFv-3B8 exhibited the lowest OD 450 absorbance values, with relatively weaker antigen-binding capacity (Fig. 7 ). Evaluation of scFv-Fc binding affinity to FCV by IFA To further verify the specific cellular binding of recombinant scFv-Fc fusion proteins to FCV, an indirect IFA was performed to evaluate the reactivity of five scFv-Fc proteins (3A5, 3B8, 3H5, 2H5, 2I5) with FCV-infected F81 cells. F81 cells were seeded in 96-well plates and cultured overnight. The following day, each well was inoculated with 100 TCID50 of FCV for a 3-hour incubation, after which the cells were fixed with 80% acetone. The five scFv-Fc proteins were individually diluted to 0.2 mg/mL as primary antibodies, and Cy3-conjugated anti-human IgG-Fc antibody (1:500 dilution) was applied as the secondary antibody. Hoechst 33342 nuclear stain was used as an internal reference to normalize fluorescent signal intensity in the assay. IFA results showed that all five scFv-Fc proteins induced specific red fluorescent staining in the cytoplasm of FCV-infected F81 cells, with the red fluorescence merging the blue nuclear fluorescence from Hoechst 33342 staining. This indicated specific binding of the scFv-Fc proteins to FCV, whereas no specific fluorescence was detected in negative controls (uninfected F81 cells), confirming the absence of non-specific binding. These findings confirmed that all five scFv-Fc proteins exhibit specific binding activity against FCV (Fig. 8 ). Characterization of the viral neutralization activity of scFv-Fc fusion proteins A VNT was performed to detect and evaluate the neutralizing activity of the five recombinant scFv-Fc proteins against FCV. Each of the five scFv-Fc proteins (initial concentration: 75 µg/mL) was individually mixed with FCV suspension and co-incubated, followed by inoculation into pre-seeded 96-well F81 cell plates. Using CPE as the endpoint criterion, the neutralization titer and minimum neutralization concentration (MNC) of each recombinant protein against FCV were determined. The results showed that scFv-3A5 exhibited significant neutralizing activity against FCV, with a neutralization titer of 1:64 and an MNC of 1.172 µg/mL. In contrast, scFv-2H5 displayed weak but detectable neutralizing activity against FCV, with a neutralization titer of 1:16 and an MNC of 4.688 µg/mL. No detectable neutralizing activity against FCV was observed for the other three scFv-Fc proteins (Table 2 ). Table 2 Neutralizing titers of recombinant scFvs against FCV Group Antibody dilution factor 4 0 4 1 4 2 4 3 4 4 scFv-3A5 0/4 0/4 0/4 0/4 4/4 scFv-3B8 4/4 4/4 4/4 4/4 4/4 scFv-3H5 4/4 4/4 4/4 4/4 4/4 scFv-2H5 0/4 0/4 0/4 4/4 4/4 scFv-2I5 4/4 4/4 4/4 4/4 4/4 F81 control 0/4 FCV control 4/4 Note: The ratios in the table represent the number of CPE-positive wells relative to the total number of viral-scFv complex-inoculated wells. Discussion FCV is an important pathogenic agent that is widely prevalent in felids worldwide, with its seropositivity rate reaching as high as 90% in feline populations[ 26 ]. Over the past 20 years, some FCV strains evolved into VS-FCVs with strong replication, causing diverse severe symptoms and relatively high mortality in infected cats[ 27 ]. At present, although FCV vaccines are available for prevention and control, there is still a lack of effective emergency therapeutic measures for FCV infection[ 28 ]. Therefore, the development of efficient and safe antibody-based therapeutics for the clinical treatment of FCV infection holds great practical value. Traditional mouse-derived monoclonal antibodies are xenogeneic proteins. If used for continuous clinical immunological intervention, they tend to induce the host to produce anti-mouse antibody immune responses[ 29 ]. In addition, their large molecular weight hinders efficient in vitro expression and large-scale production[ 30 ]. ScFv has distinct advantages including small molecular weight, controllable purity and high specificity, exhibiting enormous application potential in the diagnosis and clinical treatment of animal diseases[ 20 ]. Numerous studies have confirmed that scFv can exert neutralizing effects and block viral infection processes against a variety of viruses, effectively protecting hosts from viral infectious diseases[ 12 , 19 ]. This finding suggests that scFv holds great potential as a novel therapeutic agent for FCV infection. In this study, phage display antibody technology was employed to screen and obtain FCV-targeting scFvs, which effectively circumvented the limitations of traditional hybridoma technology for monoclonal antibody preparation, such as cumbersome operation and a prolonged experimental cycle. Monoclonal antibody 4D7, generated by Tajima T et al. via immunizing mice with a mixed population of FCV strains, could bind to 36 field isolates and 2 laboratory strains in ELISA assays; however, it exhibited no neutralizing activity against the FCV F4 strain[ 31 ]. In contrast, the FCV-targeting scFv-3A5 prepared in this study not only had a minimum neutralizing concentration of 1.172 µg/mL, demonstrating excellent neutralizing activity, but also featured a simpler and more efficient preparation process, thus holding promising clinical translation potential. The size of a phage display antibody library serves as a core prerequisite for obtaining high-affinity scFvs: the larger the library size, the higher the probability of screening out high-affinity clones[ 32 ]. Numerous studies have confirmed that the library size of a phage-displayed antibody library needs to reach 10 7 to 10 8 CFU/mL to meet the screening requirements for high-affinity antibodies[ 15 ]. The phage-displayed scFv library constructed in this study had a library size of 2.1×10 8 CFU/mL. Sequencing and amino acid sequence alignment of randomly selected recombinant phages revealed that this library had favorable sequence diversity, indicating that both its library size and diversity conformed to the panning requirements. Solid-phase antigen panning and phage ELISA are the core steps for screening antigen-specific scFvs: solid-phase panning involves co-incubating the antibody library with immobilized antigens, followed by elution of bound phages via pH gradient elution and subsequent amplification and recovery in E. coli [ 33 ]; after multiple rounds of panning, phage ELISA is required to evaluate the antigen-binding activity of the enriched antibodies for the screening of high-affinity clones[ 34 ]. In this study, with a S/N ratio of OD 450 >10 as the selection criterion, 30 scFvs with high binding activity against the VP1-CDE protein were obtained via phage ELISA. This result is consistent with the findings reported by Li Y et al.[ 35 ], thus further validating the reliability of this screening system. Peripheral blood lymphocytes from cats subcutaneously immunized with the VP1-CDE protein were used to construct a phage-displayed scFv library in this study. The FCV VP1-CDE protein, as the major neutralizing epitope region of VP1, is a potential subunit vaccine candidate[ 8 ]; Yang Y et al. also confirmed that the optimal protective antigen region of FCV strains is the CE region[ 9 ]. Based on the aforementioned research findings, the VP1-CDE protein was selected as the immunogen for in vitro expression in this study, and a soluble recombinant protein was successfully obtained. Western-blot results showed that both the VP1-CDE protein and FCV particles could specifically bind to anti-FCV serum, which suggested that this protein retains the native antibody-binding sites and possesses the potential to act as an immunogen to induce the production of specific scFvs. After three rounds of panning, the phage-displayed library constructed in this study yielded scFv-3A5 with high neutralizing activity, which had a neutralization titer of 1:64, a value slightly lower than that of the nanobody against FPV reported by Sun Y et al. [ 36 ]. In vitro antibody engineering represents a highly efficient strategy to enhance antibody affinity and neutralizing activity, whose feasibility has been validated in previous studies: A panel of 9E8 affinity-matured antibodies was developed via in vitro phage affinity maturation based on the CDR-hot spot mutagenesis strategy to improve the selectivity and sensitivity of the HIV P24 diagnostic assay [ 37 ]; Four bispecific antibodies were engineered with variable fragments from EV71- and CA16-specific neutralizing antibodies. Bs(scFv)4-IgG-1 outperformed parental antibodies in cross-neutralization and achieved 100% therapeutic efficacy[ 38 ]. Amino acid sequence alignment of the scFvs obtained in this study revealed that scFv-3A5 and scFv-3B8 shared highly homologous VH domain sequences, with only three amino acid differences in the Vλ domain. However, scFv-3A5 exhibited significantly superior VP1-CDE binding activity and viral neutralizing capacity to scFv-3B8, suggesting that these three amino acid residues may serve as key determinants of scFv neutralizing activity. Furthermore, scFv-3A5 and scFv-2I5 showed considerable sequence variation in the VH domain but a high degree of sequence identity in the Vλ domain, while scFv-3A5 still had markedly stronger VP1-CDE binding activity and FCV neutralizing activity than scFv-2I5. This indicated that the VH domain sequence may exert a decisive regulatory role in the antigen-binding activity and viral neutralizing activity of scFv. Future studies may employ in vitro antibody engineering technologies (e.g., site-directed mutagenesis and chain shuffling) to conduct targeted optimization on potential key amino acid residues within the VH/VL domains, thereby further enhancing the affinity and neutralizing activity of the scFvs. Conclusion In summary, a phage-displayed scFv library was constructed from peripheral blood lymphocytes of cats subcutaneously immunized with FCV VP1-CDE protein, followed by three rounds of panning. Western blot, ELISA and IFA results verified the isolation of high-affinity scFvs specific to VP1-CDE protein and FCV. Viral neutralization test further confirmed the FCV-neutralizing activity of these scFvs. Notably, two clones (scFv-3A5 and scFv-2H5) were obtained, both showing high-affinity FCV binding and potent anti-FCV neutralizing activity, thus exhibiting considerable in vitro therapeutic potential for FCV infection. Authors’ contributions Yanquan Wei: Writing the original draft, Methodology, Investigation. Hongmei Wang: Writing the original draft and validation. Zhen Han: Methodology, Investigation. Shijun Bao: Software. Huitian Gou: Formal analysis. Dongdong Sun:Writing the original draft. Yu Guo: Project administration and funding acquisition. Yihan Liu: Project administration, funding acquisition, and conceptualization. Declarations Ethics approval and consent to participate Two adult male cats, owned by Lanzhou Aibokang Pet Hospital, were housed at the Lanzhou Institute of Husbandry and Pharmaceutical Sciences, Chinese Academy of Agricultural Sciences. Informed consent was obtained from the owner for their use in this study. These two cats were employed for both antigen inoculation and peripheral blood lymphocyte isolation in this study. The experiments and protocols for this study have been approved by Gansu Agricultural University (approval No. VMC2025007), and Lanzhou Institute of Husbandry and Pharmaceutical Sciences, Chinese Academy of Agricultural Sciences, China (approval No. 2025-72). Consent for publication Not applicable. Competing interests The authors declare no competing interests. Funding This research was funded by Gansu Province Technology Innovation Guidance Program-East-West Collaboration Project(23CXNA0016), Lanzhou Youth Science and Technology Talent Innovation Project(2024-QN-165), Gansu Provincial Joint Scientific Research Fund-Major Project(25JRRA1086). Author Contribution Yanquan Wei: Writing the original draft, Methodology, Investigation. Hongmei Wang: Writing the original draft and validation. Zhen Han: Methodology, Investigation. Shijun Bao: Software. Huitian Gou: Formal analysis. Dongdong Sun:Writing the original draft. Yu Guo: Project administration and funding acquisition. Yihan Liu: Project administration, funding acquisition, and conceptualization. Acknowledgement We thank Zhenping Zhao, Yali Jin and Xinlong Zhu from Gansu Agricultural University for their technical assistance in the experiments, and Lulu Wang from Nankai University for her constructive comments. Data Availability All data generated or analyzed during this study are included in this published article. References Fastier LB. A new feline virus isolated in tissue culture. Am J Vet Res. 1957;18(67):382–9. Sato Y, Ohe K, Murakami M, Fukuyama M, Furuhata K, Kishikawa S, Suzuki Y, Kiuchi A, Hara M, Ishikawa Y, et al. Phylogenetic analysis of field isolates of feline calcivirus (FCV) in Japan by sequencing part of its capsid gene. Vet Res Commun. 2002;26(3):205–19. Ossiboff RJ, Sheh A, Shotton J, Pesavento PA, Parker JSL. Feline caliciviruses (FCVs) isolated from cats with virulent systemic disease possess in vitro phenotypes distinct from those of other FCV isolates. J Gen Virol. 2007;88(Pt 2):506–17. Wang D, Zhu J, Yang H, Lyu Y. Epidemiology and Molecular Characterization of Feline Calicivirus in Beijing, China. Animals: open access J MDPI 2025, 15(4). Slaviero M, de Almeida BA, de Castro LT, Panziera W, Pavarini SP, Driemeier D, Sonne L. Feline herpesvirus and calicivirus: Occurrence and pathology in cats with respiratory disease. Top companion Anim Med. 2025;69:101023. Tang A, Li B, Zhu M, Zhu S, Zhang D, Li N, Zhang M, Zhu Y, Li C, Meng C, et al. A novel feline herpesvirus vector subunit FCV VP1 and FPV VP2 vaccine protects cats against FHV-1 and FPV challenge and induces serum neutralizing antibody responses against FCV. Front Immunol. 2025;16:1636514. Wei Y, Zeng Q, Gou H, Bao S. Update on feline calicivirus: viral evolution, pathogenesis, epidemiology, prevention and control. Front Microbiol. 2024;15:1388420. Li L, Liu Z, Shi J, Yang M, Yan Y, Fu Y, Shen Z, Peng G. The CDE region of feline Calicivirus VP1 protein is a potential candidate subunit vaccine. BMC Vet Res. 2024;20(1):80. Yang Y, Qi R, Chen M, Feng K, Liu Z, Kang H, Jiang Q, Qu L, Liu J. Screening and Immune Efficacy Evaluation of Antigens with Protection Against Feline Calicivirus. Vaccines 2024, 12(11). Yang Y, Song H, Zhang K, Wang S, Zhao Y, Zhang Q, Jin M. Efficient eukaryotic expression and potent antiviral activity of a long-acting recombinant feline interferon-omega2-Fc fusion protein against major feline viruses. Antiviral Res. 2025;243:106272. Lee G, Budhathoki S, Lee GY, Oh KJ, Ham YK, Kim YJ, Lim YR, Hoang PT, Lee Y, Lim SW et al. Broad-Spectrum Antiviral Activity of 3D8, a Nucleic Acid-Hydrolyzing Single-Chain Variable Fragment (scFv), Targeting SARS-CoV-2 and Multiple Coronaviruses In Vitro. Viruses 2021, 13(4). van Dorsten RT, Lambson BE, Wibmer CK, Weinberg MS, Moore PL, Morris L. Neutralization Breadth and Potency of Single-Chain Variable Fragments Derived from Broadly Neutralizing Antibodies Targeting Multiple Epitopes on the HIV-1 Envelope. J Virol 2020, 94(2). Li C, Wang Y, Liu T, Niklasch M, Qiao K, Durand S, Chen L, Liang M, Baumert TF, Tong S, et al. An E. coli-produced single-chain variable fragment (scFv) targeting hepatitis B virus surface protein potently inhibited virion secretion. Antiviral Res. 2019;162:118–29. Larman HB, Xu GJ, Pavlova NN, Elledge SJ. Construction of a rationally designed antibody platform for sequencing-assisted selection. Proc Natl Acad Sci USA. 2012;109(45):18523–8. Zheng X, Liu Q, Liang Y, Feng W, Yu H, Tong C, Song B. Advancement in the development of single chain antibodies using phage display technology. PeerJ. 2024;12:e17143. Ledsgaard L, Ljungars A, Rimbault C, Sorensen CV, Tulika T, Wade J, Wouters Y, McCafferty J, Laustsen AH. Advances in antibody phage display technology. Drug Discovery Today. 2022;27(8):2151–69. Nur A, Schubert M, Lai JY, Hust M, Choong YS, Isa W, Lim TS. Antibody Phage Display. Methods Mol Biol. 2023;2702:3–12. Liu M, Xi L, Wang Z, Wang Y, Gao X, Wei H, Feng Y, Wang J, Wu Q, Shang Y, et al. Recent advances in M13 phage display: Novel strategies of construction and biopanning recognition elements for food safety detection. Biosens Bioelectron. 2025;289:117880. Mendoza-Salazar I, Gomez-Castellano KM, Gonzalez-Gonzalez E, Gamboa-Suasnavart R, Rodriguez-Luna SD, Santiago-Casas G, Cortes-Paniagua MI, Perez-Tapia SM, Almagro JC. Anti-SARS-CoV-2 Omicron Antibodies Isolated from a SARS-CoV-2 Delta Semi-Immune Phage Display Library. Antibodies 2022, 11(1). Muller BH, Lafay F, Demangel C, Perrin P, Tordo N, Flamand A, Lafaye P, Guesdon JL. Phage-displayed and soluble mouse scFv fragments neutralize rabies virus. J Virol Methods. 1997;67(2):221–33. Song JX, Wang MX, Zhang YX, Wan B, Du YK, Zhuang GQ, Li ZB, Qiao SL, Geng R, Wu YN, et al. Identification and epitope mapping of anti-p72 single-chain antibody against African swine fever virus based on phage display antibody library. J Integr Agr. 2023;22(9):2834–47. Ray K, Embleton MJ, Jailkhani BL, Bhan MK, Kumar R. Selection of single chain variable fragments (scFv) against the glycoprotein antigen of the rabies virus from a human synthetic scFv phage display library and their fusion with the Fc region of human IgG1. Clin Exp Immunol. 2001;125(1):94–101. Kramer RA, Marissen WE, Goudsmit J, Visser TJ, Clijsters-Van der Horst M, Bakker AQ, de Jong M, Jongeneelen M, Thijsse S, Backus HH, et al. The human antibody repertoire specific for rabies virus glycoprotein as selected from immune libraries. Eur J Immunol. 2005;35(7):2131–45. Kim JW, Cho AH, Shin HG, Jang SH, Cho SY, Lee YR, Lee S. Development and Characterization of Phage Display-Derived Monoclonal Antibodies to the S2 Domain of Spike Proteins of Wild-Type SARS-CoV-2 and Multiple Variants. Viruses 2023, 15(1). Lu Z, Tallmadge RL, Callaway HM, Felippe MJB, Parker JSL. Sequence analysis of feline immunoglobulin mRNAs and the development of a felinized monoclonal antibody specific to feline panleukopenia virus. Sci Rep. 2017;7(1):12713. Cubillos-Zapata C, Angulo I, Almanza H, Borrego B, Zamora-Ceballos M, Caston JR, Mena I, Blanco E, Barcena J. Precise location of linear epitopes on the capsid surface of feline calicivirus recognized by neutralizing and non-neutralizing monoclonal antibodies. Vet Res. 2020;51(1):59. Heng W, Zang D, Li R, Jiang Q, Liu J, Jia H, Kang H. A novel replication-deficient FCV vaccine provides strong immune protection in cats. J Virol. 2025;99(8):e0009325. Fumian TM, Tuipulotu DE, Netzler NE, Lun JH, Russo AG, Yan GJH, White PA. Potential Therapeutic Agents for Feline Calicivirus Infection. Viruses 2018, 10(8). Berinstein NL, Pennell NM, Weerasinghe R, Buckstein R, Piliotis E, Imrie KR, Chodirker L, Cussen MA, Miles E, Reis MD et al. Management of newly diagnosed high-risk and intermediate-risk follicular lymphoma with (90) Y ibritumomab tiuxetan in a phase II study. Hematological oncology 2018. Li F, Vijayasankaran N, Shen AY, Kiss R, Amanullah A. Cell culture processes for monoclonal antibody production. Mabs-Austin. 2010;2(5):466–79. Tajima T, Yoshizaki S, Nakata E, Tohya Y, Ishiguro S, Fujikawa Y, Sugii S. Production of a monoclonal antibody reacted broadly with feline calicivirus field isolates. J Vet Med Sci. 1998;60(2):155–60. Zahra DG, Vancov T, Dunn JM, Hawkins NJ, Ward RL. Selectable in-vivo recombination to increase antibody library size–an improved phage display vector system. Gene. 1999;227(1):49–54. Peng H, Rader C. Phage Display Selection of Antibody Libraries: Panning Procedures. Cold Spring Harbor protocols 2026, 2026(1):pdb prot108602. Peng H, Rader C. Phage Display Selection of Antibody Libraries: Screening of Selected Binders. Cold Spring Harbor protocols 2026, 2026(1):pdb prot108603. Li Y, Song J, Jiang S, Yang Y, Han Y, Zhong L, Zhou J, Wang M, Song H, Xu Y. Canine distemper virus (CDV)-neutralizing activities of an anti-CDV canine-derived single-chain variable antibody fragment 4–15 (scFv 4–15) screened by phage display technology. Int J Biol Macromol. 2024;257(Pt 2):128645. Sun Y, Li T, Liu J, Guo D, Xu L, Hu B, Zeng H, Cao W, Deng X, Ji Z, et al. A recombinant Fc-fused nanobody provides complete protection against feline parvovirus infection. Vet Microbiol. 2026;312:110837. Xia L, Zhang J, Cui C, Bi X, Xiong J, Yu H, An Z, Luo W, Xia N. In vitro affinity maturation and characterization of anti-P24 antibody for HIV diagnostic assay. J BioChem. 2015;158(6):531–8. Zhou B, Xu L, Zhu R, Tang J, Wu Y, Su R, Yin Z, Liu D, Jiang Y, Wen C, et al. A bispecific broadly neutralizing antibody against enterovirus 71 and coxsackievirus A16 with therapeutic potential. Antiviral Res. 2019;161:28–35. Additional Declarations No competing interests reported. Supplementary Files fig.1A.png fig.1C.png fig.1B.png fig.6B.jpg fig.6D.jpg fig.6C.jpg fig.6A.jpg fig.3A.tif fig.3C.tif fig.3B.tif fig.6F.jpg fig.6E.jpg Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 25 Feb, 2026 Reviews received at journal 23 Feb, 2026 Reviews received at journal 18 Feb, 2026 Reviews received at journal 16 Feb, 2026 Reviewers agreed at journal 13 Feb, 2026 Reviewers agreed at journal 13 Feb, 2026 Reviews received at journal 13 Feb, 2026 Reviewers agreed at journal 13 Feb, 2026 Reviewers agreed at journal 13 Feb, 2026 Reviewers invited by journal 12 Feb, 2026 Editor assigned by journal 10 Feb, 2026 Editor invited by journal 10 Feb, 2026 Submission checks completed at journal 09 Feb, 2026 First submitted to journal 09 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8778333","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":591999697,"identity":"7d15c211-9d07-40c4-953e-902f2ee14768","order_by":0,"name":"Yanquan Wei","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA00lEQVRIie3RMQuCQBTA8SdFLTc0PhH0EwQHghCEfRUfgS0FjY1JcC59gAI/h7Nxg4sfwDF3I6E90qnxbgy6P9z2fsO9B2Ay/WRR/w7IVmWSNJ0+qZYuVPLkozaxROxDvREzpgO8dBtgO5GUXBsBCKE7PyoIr9rAzpikk0Pivoe1HxQqgrvcYShJOJRyhIJyFfEuA+GSzvZNINMhUA8kin1ES5Pw6vlaZMXS5Yz6JXONv3hpTPXjjYxPy6bpDqGrJH1j/J6Dq8eHRp3WBU0mk+l/+wBuLERu6dMlhQAAAABJRU5ErkJggg==","orcid":"","institution":"Gansu Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Yanquan","middleName":"","lastName":"Wei","suffix":""},{"id":591999698,"identity":"6534a970-c7da-4616-bfdc-de0b1a51623c","order_by":1,"name":"Hongmei Wang","email":"","orcid":"","institution":"Gansu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Hongmei","middleName":"","lastName":"Wang","suffix":""},{"id":591999699,"identity":"b42fc579-8c38-442c-b8d6-ecce83eadb8a","order_by":2,"name":"Zhen Han","email":"","orcid":"","institution":"Sichuan Purity Pharmaceutical CO., LTD","correspondingAuthor":false,"prefix":"","firstName":"Zhen","middleName":"","lastName":"Han","suffix":""},{"id":591999700,"identity":"c5f175e1-75e4-4cc9-9b41-1b8261c52585","order_by":3,"name":"Shijun Bao","email":"","orcid":"","institution":"Gansu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Shijun","middleName":"","lastName":"Bao","suffix":""},{"id":591999703,"identity":"fec67056-f346-4d9c-8370-7b283efc92b1","order_by":4,"name":"Huitian Gou","email":"","orcid":"","institution":"Gansu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Huitian","middleName":"","lastName":"Gou","suffix":""},{"id":591999706,"identity":"7e29f2c4-1b00-49d3-8ef9-d81a862587c7","order_by":5,"name":"Dongdong Sun","email":"","orcid":"","institution":"Nankai University","correspondingAuthor":false,"prefix":"","firstName":"Dongdong","middleName":"","lastName":"Sun","suffix":""},{"id":591999708,"identity":"3714f088-b0f0-4b98-a2f3-c91d6525d213","order_by":6,"name":"Yu Guo","email":"","orcid":"","institution":"Nankai University","correspondingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Guo","suffix":""},{"id":591999710,"identity":"22197f38-3d74-472a-8150-d0a5ccf50d4a","order_by":7,"name":"Yihan Liu","email":"","orcid":"","institution":"Gansu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yihan","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2026-02-03 16:24:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8778333/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8778333/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":102910600,"identity":"b9142965-e387-4800-af54-eba79aa41683","added_by":"auto","created_at":"2026-02-18 10:06:08","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":351964,"visible":true,"origin":"","legend":"\u003cp\u003eProkaryotic expression and purification of the VP1-CDE protein. A: PCR verification of the pET-28a-VP1-CDE plasmid; A1–4: different recombinant clones of the pET-28a-VP1-CDE plasmid. B: Purification of the VP1-CDE protein via Ni-affinity chromatography; B1: bacterial lysate before induction; B2: bacterial lysate after induction; B3: crude ultrasonic lysate supernatant; B4: ultrasonic lysate precipitate; B5–7: purified eluted fractions of the VP1-CDE protein. C: Western blot analysis of the VP1-CDE protein using anti-FCV feline serum as the primary antibody; C1: VP1-CDE protein; C2: FCV viral suspension.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/153f0f36843447e4d420879f.png"},{"id":102910601,"identity":"42036068-5875-4eda-9b08-a09324541d41","added_by":"auto","created_at":"2026-02-18 10:06:08","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":83385,"visible":true,"origin":"","legend":"\u003cp\u003eDetection of serum antibody titer in experimental cats following five consecutive immunizations\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/6d285ebd607cf486d07b998b.png"},{"id":102910576,"identity":"771b1cae-7107-4a46-97d7-05ef3cb9198b","added_by":"auto","created_at":"2026-02-18 10:06:07","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":211034,"visible":true,"origin":"","legend":"\u003cp\u003eAmplification of VH​ and Vλ genes and scFv assembly via overlap extension PCR. A: Amplified VH​ fragment; B: Amplified Vλ fragment; C: Amplified scFv fragment.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/69d6eb2550f91c42a23a5e3a.png"},{"id":102910583,"identity":"dffa0fe6-37b3-4801-b07b-521bf2c5eda4","added_by":"auto","created_at":"2026-02-18 10:06:07","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":308740,"visible":true,"origin":"","legend":"\u003cp\u003eSequence diversity of 24 scFv clones from the phage-displayed library analyzed by phylogenetic tree.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/5f4d2e39c733651bace196a3.png"},{"id":102910591,"identity":"1b2fe34a-5541-4f01-80dc-bc510599b60e","added_by":"auto","created_at":"2026-02-18 10:06:08","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":464598,"visible":true,"origin":"","legend":"\u003cp\u003ePanning of the phage-displayed scFv library. A: Bacterial plating results of the 2nd round of panning with VP1-CDE antigen (10\u003csup\u003en\u003c/sup\u003e denotes the dilution factor of the bacterial suspension); the left panel shows phage-containing bacterial enrichment, and the right panel is the negative control. B: Bacterial plating results of the 3rd round of panning. C: Phage ELISA results. Clones with a sample-to-negative control (S/N) ratio of OD\u003csub\u003e450\u003c/sub\u003e \u0026gt;10 were identified as high-affinity clones.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/8864636be640a775a49226aa.png"},{"id":102910578,"identity":"ea7ace56-2630-4068-8bdb-a1a573f0e215","added_by":"auto","created_at":"2026-02-18 10:06:07","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":343646,"visible":true,"origin":"","legend":"\u003cp\u003eSDS-PAGE and Western blot analysis of eukaryotic expressed scFv-Fc. A: SDS-PAGE analysis of scFv eukaryotic expression products; 1: scFv-3A5, 2: scFv-3B8, 3: scFv-3H5, 4: scFv-2H5, 5: scFv-2I5. B–F: Western blot analysis of five scFv-Fcs; B: scFv-3A5, C: scFv-3B8, D: scFv-3H5, E: scFv-2H5, F: scFv-2I5. B1-F1: VP1-CDE protein (target antigen); B2-F2: FPV VP2 protein (negative control).\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/88e56129843a45fb42060f12.png"},{"id":102910602,"identity":"13040480-7e36-4109-ad6a-4fd9f8c35e58","added_by":"auto","created_at":"2026-02-18 10:06:08","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":69389,"visible":true,"origin":"","legend":"\u003cp\u003eEvaluation of the VP1-CDE antigen-binding capacity of scFv-Fcs by ELISA\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/56c73923df4cb1d8ad96f69d.png"},{"id":102910577,"identity":"906c1eb5-6f33-4325-97b9-8ab9cecb2aec","added_by":"auto","created_at":"2026-02-18 10:06:07","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1172152,"visible":true,"origin":"","legend":"\u003cp\u003eDetection of scFv-Fc proteins' FCV binding capacity by IFA. A: scFv-3A5; B: scFv-3B8; C: scFv-3H5; D: scFv-2H5; E: scFv-2I5; F: Negative control (uninfected F81 cells)\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/bef9a1b6f9c9cb092358dc07.png"},{"id":103056462,"identity":"5161c572-4d79-4c2c-a9a1-b6348a48656c","added_by":"auto","created_at":"2026-02-20 09:10:52","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4229323,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/2419f5c7-a85c-4246-bb20-a11f0a58c9e6.pdf"},{"id":102910594,"identity":"e602aa17-8766-42dd-a7e2-99d79a08e2fe","added_by":"auto","created_at":"2026-02-18 10:06:08","extension":"png","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":93860,"visible":true,"origin":"","legend":"","description":"","filename":"fig.1A.png","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/3fee82b31c30944e75aa76a4.png"},{"id":102910599,"identity":"29c25ab6-0a5a-4645-b355-5d29cd0dacf4","added_by":"auto","created_at":"2026-02-18 10:06:08","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":902594,"visible":true,"origin":"","legend":"","description":"","filename":"fig.1C.png","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/144a9b53812377630727b95b.png"},{"id":103049476,"identity":"e100502c-53c6-49bf-8afd-a4675d57101e","added_by":"auto","created_at":"2026-02-20 07:41:40","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":737209,"visible":true,"origin":"","legend":"","description":"","filename":"fig.1B.png","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/0ad1005628088c7571aca9b7.png"},{"id":102910593,"identity":"86f01494-7981-44ed-b45a-8ea072d8dcac","added_by":"auto","created_at":"2026-02-18 10:06:08","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":5039,"visible":true,"origin":"","legend":"","description":"","filename":"fig.6B.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/c771f8f617aea538b69b3483.jpg"},{"id":102963981,"identity":"b792ebdd-18b4-4870-b0e1-f912597fa0d5","added_by":"auto","created_at":"2026-02-19 04:21:04","extension":"jpg","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":4170,"visible":true,"origin":"","legend":"","description":"","filename":"fig.6D.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/231607ee28e42963f2521810.jpg"},{"id":102910581,"identity":"3c6667d2-6cd1-4598-b1d0-0f41a0ede0b6","added_by":"auto","created_at":"2026-02-18 10:06:07","extension":"jpg","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":5079,"visible":true,"origin":"","legend":"","description":"","filename":"fig.6C.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/78d748e73a7f285be09c4c5e.jpg"},{"id":102910598,"identity":"cd0584de-c790-4fa8-b2b0-92413f342f30","added_by":"auto","created_at":"2026-02-18 10:06:08","extension":"jpg","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":316637,"visible":true,"origin":"","legend":"","description":"","filename":"fig.6A.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/b41e903d4c71ad32172b5e12.jpg"},{"id":102910586,"identity":"d125a583-c131-4c0b-87fb-7c82fc9dc76f","added_by":"auto","created_at":"2026-02-18 10:06:07","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":7468826,"visible":true,"origin":"","legend":"","description":"","filename":"fig.3A.tif","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/54e2172126599a370b98a609.tif"},{"id":102910603,"identity":"a446ef85-fae6-483e-b64c-227728273b9e","added_by":"auto","created_at":"2026-02-18 10:06:08","extension":"tif","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":7468826,"visible":true,"origin":"","legend":"","description":"","filename":"fig.3C.tif","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/0e26c715f1edfc4b021e3cef.tif"},{"id":103049530,"identity":"66f28c1b-22bd-4a6a-b2b3-84800236cad3","added_by":"auto","created_at":"2026-02-20 07:42:14","extension":"tif","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":5598160,"visible":true,"origin":"","legend":"","description":"","filename":"fig.3B.tif","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/1e1b8a532aa74a3fea5fa7db.tif"},{"id":102910579,"identity":"6725e7ae-2c6c-40bc-8134-4415455af67c","added_by":"auto","created_at":"2026-02-18 10:06:07","extension":"jpg","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":5091,"visible":true,"origin":"","legend":"","description":"","filename":"fig.6F.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/c36d074afb27be2ddc97cf5e.jpg"},{"id":102910587,"identity":"0201efa7-76e0-4c24-b861-7cd8bbd2f2ee","added_by":"auto","created_at":"2026-02-18 10:06:07","extension":"jpg","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":3723,"visible":true,"origin":"","legend":"","description":"","filename":"fig.6E.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8778333/v1/cae1f9342491903e0c3268e2.jpg"}],"financialInterests":"No competing interests reported.","formattedTitle":"Isolation of feline-derived scFvs against VP1-CDE region of feline calicivirus from phage display library and characterization of their antigen-binding and antiviral potential in vitro","fulltext":[{"header":"Introduction","content":"\u003cp\u003eFeline calicivirus (FCV), a member of the genus \u003cem\u003eVesivirus\u003c/em\u003e in the family \u003cem\u003eCaliciviridae\u003c/em\u003e, is a globally prevalent pathogen that causes infectious upper respiratory tract diseases in cats[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. FCV induces a spectrum of clinical manifestations, ranging from mild oral ulcers, sneezing, nasal discharge and coughing to severe systemic disorders caused by virulent systemic FCV (VS-FCV) strains, which are characterized by high fever, skin edema, visceral necrosis and a mortality rate of 50%-79%[\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. As a non-enveloped RNA virus, FCV possesses a linear single-stranded positive-sense genome of approximately 7.7 kb, containing three open reading frames (ORFs). Among these, ORF2 encodes the major capsid protein VP1[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. VP1 is a key immunogenic component of FCV that mediates virus-host cell interactions and is classified into six functional regions (A-F) [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The CDE region serves as the major neutralizing epitope, with the E region playing a crucial role in recognizing feline junctional adhesion molecule A (fJAM-A) and eliciting neutralizing antibody responses[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Despite advances in preventive and diagnostic strategies, the paucity of specific antiviral agents remains a critical bottleneck in FCV control[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSingle-chain variable fragments (scFvs), generated by linking the variable region of the feline IgG heavy chain (VH) and the variable region of the light chain (VL) of antibodies via a flexible (Gly4Ser)\u003csub\u003e3\u003c/sub\u003e linker, have emerged as promising alternatives to full-length monoclonal antibodies (mAbs) in antiviral research[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. ScFvs exhibit distinct advantages, including low molecular weight, strong tissue penetration, high specificity, low immunogenicity and retained antigen-binding activity[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The three complementarity-determining regions (CDRs) within scFvs form the core antigen-recognition domain, which dictates antibody specificity[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Phage display antibody technology is a mature and widely used method for constructing scFv immune libraries, enabling the establishment of high-capacity libraries and screening of antigen-specific antibodies through multiple rounds of \"adsorption-elution-enrichment\"[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. This technology achieves fusion expression of antibody genes with phage coat protein genes, featuring simplicity, high efficiency and cost-effectiveness[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. M13 bacteriophage is the most commonly used vector due to its non-lytic nature and tolerance to extreme conditions (e.g., high temperature, pH fluctuations, denaturants)[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. To date, this technology has been successfully applied to develop specific scFvs against various pathogens, including SARS-CoV-2, rabies virus and African swine fever virus [\u003cspan additionalcitationids=\"CR20 CR21 CR22 CR23\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHowever, significant gaps exist in FCV-specific scFv research: (1) Most existing FCV antibody studies focus on full-length mAbs, with few reports on scFvs targeting the VP1-CDE region, a key neutralizing antigenic determinant; (2) Feline-derived scFvs are rarely developed, while murine-derived mAbs often encounter immunogenicity issues in clinical applications; (3) The absence of a well-characterized feline-derived scFv library against FCV hinders the development of feline-tailored rapid diagnostic reagents and therapeutic antibodies. To address these limitations, this study aimed to construct a feline-derived scFv phage display library targeting FCV VP1-CDE protein and screen for clones with high binding activity. After 3\u0026ndash;4 rounds of panning and multiple characterization assays, specific scFvs with potent neutralizing activity were identified.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMaterials and reagents\u003c/h2\u003e \u003cp\u003eCompetent cells \u003cem\u003eE. coli\u003c/em\u003e BL21(DE3), SS320, NEB5α F', and M13KO7 helper phage were purchased from New England Biolabs. Ni-affinity chromatography resin and Protein A affinity chromatography column were supplied by Sangon Biotech (Shanghai) Co., Ltd. HRP-conjugated anti-M13 antibody and HRP-conjugated IgG-Fc antibody were purchased from Sino Biological Inc. CY3-conjugated anti-human IgG-Fc was obtained from Sigma-Aldrich. The pComb3XSS vector, pFUSE-Fc vector, and F81 cells were preserved at our laborary. Two adult male cats, owned by Lanzhou Aibokang Pet Hospital, were housed at the Lanzhou Institute of Husbandry and Pharmaceutical Sciences, Chinese Academy of Agricultural Sciences. The Feline Peripheral Blood Lymphocyte Isolation Kit was obtained from Solarbio (Beijing) Science \u0026amp; Technology Co., Ltd.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePrimer design\u003c/h3\u003e\n\u003cp\u003eBased on the literature reported by Lu Z et al., feline-derived antibody gene sequences were retrieved from GenBank (accession numbers: KY795030-KY795318)[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Relatively conserved sequences were identified by aligning the VH and the variable region of the λ light chain (Vλ). Amplification primers for VH and Vλ were designed using SnapGene software (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). All primers were synthesized by Tsingke Biotechnology Co., Ltd.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers for VH and Vλ gene amplification\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence(5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFeIGHV-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTACAAATCCTATGCATCCCAGGTTTTGCTGGTGCACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFeIGHV-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGCCAGGCCACCTCCGCCTGAACCGCCTCCACCGAACACCGATGGGGCCTTGGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFeIGLV-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTTCGGCGGAGGTGGCTCTGGCGGTGGCGGATCGTCCTAYGTGCACTCAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFeIGLV-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACAACTTCAACAGTGGACTTGGGCTGACCGAGGACGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eProkaryotic expression and purification of recombinant VP1-CDE protein\u003c/h3\u003e\n\u003cp\u003eRecombinant pET-28a-VP1-CDE plasmid was constructed by homologous recombination, heat-shock transformed into \u003cem\u003eE. coli\u003c/em\u003e BL21(DE3) competent cells, and spreaded on 50 \u0026micro;g/mL kanamycin-containing solid LB medium for overnight incubation at 37 ℃. A single colony was inoculated into kanamycin-containing LB medium and cultured overnight. The culture was transferred to fresh LB liquid medium; when OD\u003csub\u003e600\u003c/sub\u003e reached 0.6, 0.5 mM isopropyl-β-D-thiogalactoside (IPTG) was added for overnight induction at 16℃. Post-induction, the culture was centrifuged to discard supernatant; bacterial pellets were resuspended in PBS, ultrasonically disrupted on ice, and lysate centrifuged to separate supernatant and precipitate. VP1-CDE protein in the supernatant was purified by Ni-affinity chromatography and identified by SDS-PAGE and Western blot using anti-FCV feline serum as the primary antibody.\u003c/p\u003e\n\u003ch3\u003eAnimal immunization and serum antibody titer determination\u003c/h3\u003e\n\u003cp\u003eThe purified VP1-CDE protein was used as the immunogen to immunize experimental cats. For primary immunization, the protein was fully emulsified with Freund's complete adjuvant and administered via multiple subcutaneous back injections. Booster immunizations were performed with the antigen emulsified in Freund's incomplete adjuvant at two-week intervals. Serum was harvested 14 days post each immunization for antibody titer detection. Indirect ELISA was conducted with VP1-CDE protein (100 ng/well) as the coating antigen to measure serum antibody titers. When the titer exceeded 1:64,000 (OD\u003csub\u003e450\u003c/sub\u003e S/N ratio\u0026thinsp;\u0026gt;\u0026thinsp;2.1), whole blood was collected from the cats to isolate peripheral blood lymphocytes (PBLs), which were used for the construction of the phage-displayed antibody library.\u003c/p\u003e\n\u003ch3\u003eConstruction of phage display scFv library\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from feline PBLs using Trizol reagent, and cDNA was synthesized via reverse transcription. Using the cDNA as a template, the VH and Vλ​ genes were amplified with two primer pairs (FeIGHV-F/FeIGHV-R and FeIGLV-F/FeIGLV-R) and purified. Overlap extension PCR (OE-PCR) was performed with VH​ and Vλ​ genes as templates and FeIGHV-F/FeIGLV-R primers to link them via a (Gly\u003csub\u003e4\u003c/sub\u003eSer)\u003csub\u003e3\u003c/sub\u003e linker, generating scFv genes, which were inserted into the pComb3XSS phage vector via homologous recombination.\u003c/p\u003e \u003cp\u003eThe recombinant pComb3XSS vector carrying scFv genes was electroporated into \u003cem\u003eE. coli\u003c/em\u003e SS320 competent cells. The electroporated bacterial suspension was transferred to 30 mL antibiotic-free 2YT medium and cultured at 37 ℃ for 1 h. A 100 \u0026micro;L aliquot was serially diluted to 10\u003csup\u003e3\u003c/sup\u003e-10\u003csup\u003e5\u003c/sup\u003e fold, plated on 2YT solid medium, and single colonies were counted to determine phage library titer (formula: Library titer\u0026thinsp;=\u0026thinsp;Number of single colonies \u0026times; Dilution factor \u0026times; Total volume of bacterial suspension).\u003c/p\u003e \u003cp\u003eThe remaining suspension was transferred to 300 mL 2YT medium supplemented with ampicillin and kanamycin, and cultured overnight at 37 ℃. The next day, the culture was centrifuged to collect supernatant; one-quarter volume of PEG 8000/NaCl solution was added, followed by 30 min incubation on ice. After centrifugation, supernatant was discarded, and the pellet was resuspended in 1 mL PBS to obtain the primary scFv phage display library. Twenty-four single colonies were randomly picked for PCR verification of scFv gene insertion, and PCR products of expected size were directly sequenced.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003ePanning of the phage-displayed scFv library\u003c/h2\u003e \u003cp\u003ePlates were coated with VP1-CDE protein (1 \u0026micro;g/well) at 4 ℃ overnight, with four VP1-CDE-coated wells and four PBS-coated negative control wells. Next day, wells were emptied, blocked with 5% non-fat milk at 37 ℃ for 2 h, washed three times with PBST, then 100 \u0026micro;L primary phage library was added per well and incubated at 37 ℃ for 2 h. Non-specific phages were removed by 8\u0026ndash;10 times PBST washes. 100 \u0026micro;L 0.1 mol/L HCl elution buffer was added with 5 min incubation, then immediately neutralized with one-quarter volume 1 mol/L Tris-HCl (pH 9.1). The solution was transferred to 1 mL \u003cem\u003eE. coli\u003c/em\u003e NEB5α F' suspension, cultured at 37 ℃ for 1 h, then 2 \u0026micro;L M13KO7 helper phage was added for another 1 h incubation. The suspension was transferred to 35 mL ampicillin/kanamycin-supplemented 2YT medium. This panning was repeated 2\u0026ndash;3 times; after each round, eluted phages were serially diluted and plated on 2YT solid medium to compare phage counts between VP1-CDE and control wells for enrichment confirmation.\u003c/p\u003e \u003cp\u003ePhage ELISA: Plates were coated with VP1-CDE (100 ng/well) at 4 ℃ overnight, blocked with 5% non-fat milk at 37 ℃ for 2 h. Third-round enriched phages were serially diluted and plated; 92 single colonies and four negative control clones were randomly picked, inoculated into 2YT medium, and cultured overnight at 37 ℃. Next day, supernatants were collected by centrifugation, 150 \u0026micro;L per coated well was incubated at 37 ℃ for 1 h, washed five times with PBST, then HRP-conjugated anti-M13 antibody (1:8,000 in PBST) was added and incubated for 1 h. TMB substrate was added, reaction terminated with 2 mol/L H₂SO₄, and OD₄₅₀ values read. Clones with S/N\u0026thinsp;\u0026gt;\u0026thinsp;2.1 were selected for eukaryotic expression.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eEukaryotic expression of scFv-Fc and Western blot analysis\u003c/h3\u003e\n\u003cp\u003eSelected scFv genes were inserted into the pFUSE-Fc eukaryotic expression vector via homologous recombination to generate recombinant pFUSE-Fc-scFv plasmids, which were transiently transfected into Expi293F suspension cells. Five to seven days post-transfection, culture supernatant was collected, and scFv was purified with Protein A resin. SDS-PAGE was performed to determine scFv molecular weight and purity, followed by Western blot to verify its binding to VP1-CDE protein. VP1-CDE and feline parvovirus (FPV) VP2 proteins were used for Western blot; purified scFv (1:500) as primary antibody and HRP-conjugated anti-human IgG-Fc antibody (1:8,000) as secondary antibody, with chemiluminescence detection.\u003c/p\u003e\n\u003ch3\u003eEvaluation of scFv-Fc affinity by ELISA\u003c/h3\u003e\n\u003cp\u003ePlates were coated with VP1-CDE protein (100 ng/well), with PBS as blank controls. scFv was adjusted to 0.5 mg/mL and serially diluted (1:50, 1:100, 1:200, 1:400, 1:800, 1:1600), and each dilution was added to corresponding wells. HRP-conjugated anti-human IgG-Fc antibody (1:8,000) was used as secondary antibody. Then 100 \u0026micro;L TMB substrate was added, incubated in the dark for 10 min, reaction terminated with 50 \u0026micro;L 2 M H\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e, and OD\u003csub\u003e450\u003c/sub\u003e values measured.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eEvaluation of the binding ability between scFv-Fc and FCV by Immunofluorescence Assay (IFA)\u003c/h2\u003e \u003cp\u003eF81 cells were seeded into 96-well plates. Next day, 100 TCID\u003csub\u003e50\u003c/sub\u003e FCV was inoculated per well, incubated for 3 h, then wells were emptied and washed three times with PBS. 100 \u0026micro;L pre-chilled 80% acetone was added to fix cells at -20 ℃ for 30 min; acetone was discarded, and wells washed three times with PBST. Cells were blocked with 5% non-fat milk at 37 ℃ for 2 h, washed three times with PBST. Five scFv constructs were diluted to 0.2 mg/mL with PBS, added to each well, incubated at 37 ℃ for 1 h, then washed three times with PBST. Cy3-conjugated anti-human IgG Fc antibody (1:500) was used as secondary antibody, incubated at 37 ℃ in the dark for 1 h, followed by three PBST washes. 50 \u0026micro;L Hoechst 33342 nuclear stain was added, stained at room temperature in the dark for 10 min, and observed under a fluorescence microscope. Virus-free wells served as negative controls.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eViral neutralization test (VNT) of scFv-Fc\u003c/h2\u003e \u003cp\u003eFive scFv-Fc proteins were adjusted to an initial concentration of 75 \u0026micro;g/mL and serially 4-fold diluted with DMEM. Each scFv-Fc dilution was thoroughly mixed with 100 TCID₅₀ FCV suspension, incubated at 37 ℃ for 1 h, and inoculated onto F81 feline kidney cells. Four replicate wells were set for each dilution, with FCV-infected and normal cell controls established simultaneously. Following 48 h of incubation, the cytopathic effect (CPE) was observed and recorded under an inverted microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eData are expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) unless stated otherwise. Statistical significance was determined via the two-tailed Student\u0026rsquo;s non-parametric test or one-way analysis of variance (ANOVA), with all analyses conducted using GraphPad Prism software V6.0 (GraphPad Software, Inc., San Diego, CA, USA). Group differences were deemed statistically significant at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 (*) and P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 (**), \u0026lsquo;ns\u0026rsquo; indicates no significant difference.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eProkaryotic expression and purification of VP1-CDE protein\u003c/h2\u003e \u003cp\u003eThe recombinant pET-28a-VP1-CDE plasmid was verified by PCR, and a specific band of approximately 500 bp was amplified, which was consistent with the expected size, indicating successful construction of the recombinant plasmid (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). The pET-28a-VP1-CDE plasmid was transformed into E. coli BL21(DE3) competent cells for induced prokaryotic expression. Bacterial cells were lysed by ultrasonication, and the lysate supernatant was collected for purification of the VP1-CDE protein via Ni-affinity chromatography. SDS-PAGE analysis revealed a band of approximately 18 kDa in both the bacterial lysate supernatant and purified eluates, which was consistent with the theoretical molecular weight of the VP1-CDE protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Subsequent Western blot analysis using anti-FCV feline serum as the primary antibody demonstrated that specific bands of the expected molecular weight were detected in both the VP1-CDE protein and FCV viral suspension lanes, confirming the correct expression and immunoreactivity of the VP1-CDE protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of serum antibody titer in immunized cats\u003c/h2\u003e \u003cp\u003eFollowing immunization of experimental cats with the VP1-CDE protein as the immunogen, blood was collected from the hind limb veins after five consecutive immunizations, and serum was isolated for antibody titer determination via indirect ELISA. The results showed that the serum antibody titers of the two experimental cats reached a sample-to-negative (S/N) OD\u003csub\u003e450\u003c/sub\u003e ratio of \u0026gt;\u0026thinsp;2.1 at a dilution of 1:64,000, which met the established criteria for constructing a phage-displayed antibody library (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eAmplification of scFv genes\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from PBLs and reverse-transcribed into cDNA, from which the variable heavy (VH​) and variable lambda light chain (Vλ) gene fragments were amplified separately. A VH​ gene fragment of approximately 400 bp and a Vλ gene fragment of approximately 350 bp were successfully amplified (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B), consistent with the expected sizes. Using gel-purified VH​ and Vλ fragments as templates, overlap extension PCR was performed, and an scFv gene band of approximately 750 bp was successfully obtained (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eConstruction and quality evaluation of the scfv phage-displayed library\u003c/h2\u003e \u003cp\u003eThe scFv fragments were cloned into the linearized pComb3XSS phage vector, and a scFv phage-displayed library was constructed following electroporation into \u003cem\u003eE. coli\u003c/em\u003e SS320 competent cells. The titer of the antibody library was determined by serial dilution and plating of the electroporated bacterial suspension, which reached 2.1\u0026times;10\u003csup\u003e8\u003c/sup\u003e CFU/mL. Twenty-four single colonies were randomly selected for PCR verification, all of which yielded an amplification band of approximately 750 bp. Phylogenetic tree analysis was performed using MEGA software based on the sequences of the 24 clones, and the results showed that the 24 sequences were non-redundant (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). These data indicated that the constructed scFv phage-displayed library exhibited good diversity and met the requirements for subsequent panning experiments.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003ePanning of the scFv phage-displayed library\u003c/h2\u003e \u003cp\u003ePanning of the scFv phage-displayed library was performed based on antigen-antibody specific binding, and the library underwent three rounds of \"adsorption-elution-enrichment\" panning cycles. Plating results demonstrated that specific phage enrichment was achieved in both the second and third rounds: the number of phage-containing bacteria eluted from VP1-CDE-coated wells was significantly higher than that from PBS-coated control wells, indicating successful enrichment of VP1-CDE-specific phage antibodies (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA,B). Ninety-two single colonies were randomly selected from third-round panning plates for phage ELISA screening, with four parallel negative controls established. Among these clones, 30 exhibited an S/N ratio of OD\u003csub\u003e450\u003c/sub\u003e \u0026gt;10 and were identified as high-affinity positive clones (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). The 30 positive clones were subjected to PCR amplification. Fifteen scFv genes amplified from the positive clones were randomly selected for nucleotide sequencing and deduced amino acid sequence alignment. Sequence alignment via Snapgene software revealed five clones with unique scFv amino acid sequences, which were designated as 3A5, 3B8, 3H5, 2H5 and 2I5, respectively. The VH sequences of the five scFvs were highly conserved, whereas their Vλ sequences showed significant amino acid diversity. The major amino acid variations were concentrated in the CDR3 regions. The CDR3 regions of the Vλ domains of the five scFvs contained 10\u0026ndash;13 amino acids, while the framework regions were relatively conserved.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eEukaryotic expression of scFvs and evaluation of their binding affinity by Western blot\u003c/h2\u003e \u003cp\u003eThe five scFv genes were individually ligated into the pFUSE-Fc eukaryotic expression vector and transfected into Expi293F cells. After 5 days of transfection, the culture supernatant was harvested and purified via Protein A resin. SDS-PAGE analysis of the purified eluted proteins revealed a single band at approximately 55 kDa, which was consistent with the theoretical molecular weight of the recombinant scFvs proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). The VP1-CDE protein and FPV VP2 protein (negative control) were separately prepared for Western blot assay. The five distinct scFvs were used as the primary antibodies, and HRP-conjugated anti-human IgG-Fc antibody was used as the secondary antibody. The results showed that specific binding bands were detected in the range of 15\u0026ndash;25 kDa, indicating that all five scFvs could specifically bind to the VP1-CDE protein but not to the FPV VP2 protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB-F).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eEvaluation of scFv-Fc binding affinity for VP1-CDE antigen by ELISA\u003c/h2\u003e \u003cp\u003eInitially, all five scFv-Fc fusion proteins were adjusted to a concentration of 0.5 mg/mL, and then the recombinant proteins were serially diluted for indirect ELISA to determine their specific antigen-binding capacity to the VP1-CDE antigen. The results showed that the OD\u003csub\u003e450\u003c/sub\u003e values of the wells incubated with the five scFv-Fc proteins exhibited a decreasing trend with the decrease in the antigen coating concentration, and the corresponding OD\u003csub\u003e450\u003c/sub\u003e values were significantly higher than those of the negative control wells coated solely with PBS. These findings indicated that all five scFv-Fc proteins exhibited specific VP1-CDE antigen-binding activity. Among them, scFv-3A5 exhibited the highest OD\u003csub\u003e450\u003c/sub\u003e absorbance values, demonstrating excellent antigen-binding capacity, whereas scFv-2I5 and scFv-3B8 exhibited the lowest OD\u003csub\u003e450\u003c/sub\u003e absorbance values, with relatively weaker antigen-binding capacity (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eEvaluation of scFv-Fc binding affinity to FCV by IFA\u003c/h2\u003e \u003cp\u003eTo further verify the specific cellular binding of recombinant scFv-Fc fusion proteins to FCV, an indirect IFA was performed to evaluate the reactivity of five scFv-Fc proteins (3A5, 3B8, 3H5, 2H5, 2I5) with FCV-infected F81 cells. F81 cells were seeded in 96-well plates and cultured overnight. The following day, each well was inoculated with 100 TCID50 of FCV for a 3-hour incubation, after which the cells were fixed with 80% acetone. The five scFv-Fc proteins were individually diluted to 0.2 mg/mL as primary antibodies, and Cy3-conjugated anti-human IgG-Fc antibody (1:500 dilution) was applied as the secondary antibody. Hoechst 33342 nuclear stain was used as an internal reference to normalize fluorescent signal intensity in the assay. IFA results showed that all five scFv-Fc proteins induced specific red fluorescent staining in the cytoplasm of FCV-infected F81 cells, with the red fluorescence merging the blue nuclear fluorescence from Hoechst 33342 staining. This indicated specific binding of the scFv-Fc proteins to FCV, whereas no specific fluorescence was detected in negative controls (uninfected F81 cells), confirming the absence of non-specific binding. These findings confirmed that all five scFv-Fc proteins exhibit specific binding activity against FCV (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eCharacterization of the viral neutralization activity of scFv-Fc fusion proteins\u003c/h2\u003e \u003cp\u003eA VNT was performed to detect and evaluate the neutralizing activity of the five recombinant scFv-Fc proteins against FCV. Each of the five scFv-Fc proteins (initial concentration: 75 \u0026micro;g/mL) was individually mixed with FCV suspension and co-incubated, followed by inoculation into pre-seeded 96-well F81 cell plates. Using CPE as the endpoint criterion, the neutralization titer and minimum neutralization concentration (MNC) of each recombinant protein against FCV were determined. The results showed that scFv-3A5 exhibited significant neutralizing activity against FCV, with a neutralization titer of 1:64 and an MNC of 1.172 \u0026micro;g/mL. In contrast, scFv-2H5 displayed weak but detectable neutralizing activity against FCV, with a neutralization titer of 1:16 and an MNC of 4.688 \u0026micro;g/mL. No detectable neutralizing activity against FCV was observed for the other three scFv-Fc proteins (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eNeutralizing titers of recombinant scFvs against FCV\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"5\" nameend=\"c6\" namest=\"c2\"\u003e \u003cp\u003eAntibody dilution factor\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u003csup\u003e0\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4\u003csup\u003e3\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4\u003csup\u003e4\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003escFv-3A5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003escFv-3B8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003escFv-3H5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003escFv-2H5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003escFv-2I5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eF81 control\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c6\" namest=\"c2\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFCV control\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c6\" namest=\"c2\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003eNote: The ratios in the table represent the number of CPE-positive wells relative to the total number of viral-scFv complex-inoculated wells.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eFCV is an important pathogenic agent that is widely prevalent in felids worldwide, with its seropositivity rate reaching as high as 90% in feline populations[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Over the past 20 years, some FCV strains evolved into VS-FCVs with strong replication, causing diverse severe symptoms and relatively high mortality in infected cats[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. At present, although FCV vaccines are available for prevention and control, there is still a lack of effective emergency therapeutic measures for FCV infection[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Therefore, the development of efficient and safe antibody-based therapeutics for the clinical treatment of FCV infection holds great practical value.\u003c/p\u003e \u003cp\u003eTraditional mouse-derived monoclonal antibodies are xenogeneic proteins. If used for continuous clinical immunological intervention, they tend to induce the host to produce anti-mouse antibody immune responses[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. In addition, their large molecular weight hinders efficient in vitro expression and large-scale production[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. ScFv has distinct advantages including small molecular weight, controllable purity and high specificity, exhibiting enormous application potential in the diagnosis and clinical treatment of animal diseases[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Numerous studies have confirmed that scFv can exert neutralizing effects and block viral infection processes against a variety of viruses, effectively protecting hosts from viral infectious diseases[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. This finding suggests that scFv holds great potential as a novel therapeutic agent for FCV infection.\u003c/p\u003e \u003cp\u003eIn this study, phage display antibody technology was employed to screen and obtain FCV-targeting scFvs, which effectively circumvented the limitations of traditional hybridoma technology for monoclonal antibody preparation, such as cumbersome operation and a prolonged experimental cycle. Monoclonal antibody 4D7, generated by Tajima T et al. via immunizing mice with a mixed population of FCV strains, could bind to 36 field isolates and 2 laboratory strains in ELISA assays; however, it exhibited no neutralizing activity against the FCV F4 strain[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In contrast, the FCV-targeting scFv-3A5 prepared in this study not only had a minimum neutralizing concentration of 1.172 \u0026micro;g/mL, demonstrating excellent neutralizing activity, but also featured a simpler and more efficient preparation process, thus holding promising clinical translation potential.\u003c/p\u003e \u003cp\u003eThe size of a phage display antibody library serves as a core prerequisite for obtaining high-affinity scFvs: the larger the library size, the higher the probability of screening out high-affinity clones[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Numerous studies have confirmed that the library size of a phage-displayed antibody library needs to reach 10\u003csup\u003e7\u003c/sup\u003e to 10\u003csup\u003e8\u003c/sup\u003e CFU/mL to meet the screening requirements for high-affinity antibodies[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The phage-displayed scFv library constructed in this study had a library size of 2.1\u0026times;10\u003csup\u003e8\u003c/sup\u003e CFU/mL. Sequencing and amino acid sequence alignment of randomly selected recombinant phages revealed that this library had favorable sequence diversity, indicating that both its library size and diversity conformed to the panning requirements.\u003c/p\u003e \u003cp\u003eSolid-phase antigen panning and phage ELISA are the core steps for screening antigen-specific scFvs: solid-phase panning involves co-incubating the antibody library with immobilized antigens, followed by elution of bound phages via pH gradient elution and subsequent amplification and recovery in E. coli [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]; after multiple rounds of panning, phage ELISA is required to evaluate the antigen-binding activity of the enriched antibodies for the screening of high-affinity clones[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In this study, with a S/N ratio of OD\u003csub\u003e450\u003c/sub\u003e \u0026gt;10 as the selection criterion, 30 scFvs with high binding activity against the VP1-CDE protein were obtained via phage ELISA. This result is consistent with the findings reported by Li Y et al.[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], thus further validating the reliability of this screening system.\u003c/p\u003e \u003cp\u003ePeripheral blood lymphocytes from cats subcutaneously immunized with the VP1-CDE protein were used to construct a phage-displayed scFv library in this study. The FCV VP1-CDE protein, as the major neutralizing epitope region of VP1, is a potential subunit vaccine candidate[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]; Yang Y et al. also confirmed that the optimal protective antigen region of FCV strains is the CE region[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Based on the aforementioned research findings, the VP1-CDE protein was selected as the immunogen for in vitro expression in this study, and a soluble recombinant protein was successfully obtained. Western-blot results showed that both the VP1-CDE protein and FCV particles could specifically bind to anti-FCV serum, which suggested that this protein retains the native antibody-binding sites and possesses the potential to act as an immunogen to induce the production of specific scFvs.\u003c/p\u003e \u003cp\u003eAfter three rounds of panning, the phage-displayed library constructed in this study yielded scFv-3A5 with high neutralizing activity, which had a neutralization titer of 1:64, a value slightly lower than that of the nanobody against FPV reported by Sun Y et al. [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In vitro antibody engineering represents a highly efficient strategy to enhance antibody affinity and neutralizing activity, whose feasibility has been validated in previous studies: A panel of 9E8 affinity-matured antibodies was developed via in vitro phage affinity maturation based on the CDR-hot spot mutagenesis strategy to improve the selectivity and sensitivity of the HIV P24 diagnostic assay [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]; Four bispecific antibodies were engineered with variable fragments from EV71- and CA16-specific neutralizing antibodies. Bs(scFv)4-IgG-1 outperformed parental antibodies in cross-neutralization and achieved 100% therapeutic efficacy[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Amino acid sequence alignment of the scFvs obtained in this study revealed that scFv-3A5 and scFv-3B8 shared highly homologous VH domain sequences, with only three amino acid differences in the Vλ domain. However, scFv-3A5 exhibited significantly superior VP1-CDE binding activity and viral neutralizing capacity to scFv-3B8, suggesting that these three amino acid residues may serve as key determinants of scFv neutralizing activity. Furthermore, scFv-3A5 and scFv-2I5 showed considerable sequence variation in the VH domain but a high degree of sequence identity in the Vλ domain, while scFv-3A5 still had markedly stronger VP1-CDE binding activity and FCV neutralizing activity than scFv-2I5. This indicated that the VH domain sequence may exert a decisive regulatory role in the antigen-binding activity and viral neutralizing activity of scFv. Future studies may employ in vitro antibody engineering technologies (e.g., site-directed mutagenesis and chain shuffling) to conduct targeted optimization on potential key amino acid residues within the VH/VL domains, thereby further enhancing the affinity and neutralizing activity of the scFvs.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, a phage-displayed scFv library was constructed from peripheral blood lymphocytes of cats subcutaneously immunized with FCV VP1-CDE protein, followed by three rounds of panning. Western blot, ELISA and IFA results verified the isolation of high-affinity scFvs specific to VP1-CDE protein and FCV. Viral neutralization test further confirmed the FCV-neutralizing activity of these scFvs. Notably, two clones (scFv-3A5 and scFv-2H5) were obtained, both showing high-affinity FCV binding and potent anti-FCV neutralizing activity, thus exhibiting considerable in vitro therapeutic potential for FCV infection.\u003c/p\u003e \u003cdiv id=\"Sec26\" class=\"Section2\"\u003e \u003ch2\u003eAuthors\u0026rsquo; contributions\u003c/h2\u003e \u003cp\u003eYanquan Wei: Writing the original draft, Methodology, Investigation. Hongmei Wang: Writing the original draft and validation. Zhen Han: Methodology, Investigation. Shijun Bao: Software. Huitian Gou: Formal analysis. Dongdong Sun:Writing the original draft. Yu Guo: Project administration and funding acquisition. Yihan Liu: Project administration, funding acquisition, and conceptualization.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e \u003cp\u003eTwo adult male cats, owned by Lanzhou Aibokang Pet Hospital, were housed at the Lanzhou Institute of Husbandry and Pharmaceutical Sciences, Chinese Academy of Agricultural Sciences. Informed consent was obtained from the owner for their use in this study. These two cats were employed for both antigen inoculation and peripheral blood lymphocyte isolation in this study. The experiments and protocols for this study have been approved by Gansu Agricultural University (approval No. VMC2025007), and Lanzhou Institute of Husbandry and Pharmaceutical Sciences, Chinese Academy of Agricultural Sciences, China (approval No. 2025-72).\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent for publication\u003c/strong\u003e \u003cp\u003eNot applicable.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eCompeting interests\u003c/strong\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis research was funded by Gansu Province Technology Innovation Guidance Program-East-West Collaboration Project(23CXNA0016), Lanzhou Youth Science and Technology Talent Innovation Project(2024-QN-165), Gansu Provincial Joint Scientific Research Fund-Major Project(25JRRA1086).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eYanquan Wei: Writing the original draft, Methodology, Investigation. Hongmei Wang: Writing the original draft and validation. Zhen Han: Methodology, Investigation. Shijun Bao: Software. Huitian Gou: Formal analysis. Dongdong Sun:Writing the original draft. Yu Guo: Project administration and funding acquisition. Yihan Liu: Project administration, funding acquisition, and conceptualization.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eWe thank Zhenping Zhao, Yali Jin and Xinlong Zhu from Gansu Agricultural University for their technical assistance in the experiments, and Lulu Wang from Nankai University for her constructive comments.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eAll data generated or analyzed during this study are included in this published article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eFastier LB. A new feline virus isolated in tissue culture. Am J Vet Res. 1957;18(67):382\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSato Y, Ohe K, Murakami M, Fukuyama M, Furuhata K, Kishikawa S, Suzuki Y, Kiuchi A, Hara M, Ishikawa Y, et al. Phylogenetic analysis of field isolates of feline calcivirus (FCV) in Japan by sequencing part of its capsid gene. Vet Res Commun. 2002;26(3):205\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOssiboff RJ, Sheh A, Shotton J, Pesavento PA, Parker JSL. Feline caliciviruses (FCVs) isolated from cats with virulent systemic disease possess in vitro phenotypes distinct from those of other FCV isolates. J Gen Virol. 2007;88(Pt 2):506\u0026ndash;17.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang D, Zhu J, Yang H, Lyu Y. Epidemiology and Molecular Characterization of Feline Calicivirus in Beijing, China. Animals: open access J MDPI 2025, 15(4).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSlaviero M, de Almeida BA, de Castro LT, Panziera W, Pavarini SP, Driemeier D, Sonne L. Feline herpesvirus and calicivirus: Occurrence and pathology in cats with respiratory disease. Top companion Anim Med. 2025;69:101023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang A, Li B, Zhu M, Zhu S, Zhang D, Li N, Zhang M, Zhu Y, Li C, Meng C, et al. A novel feline herpesvirus vector subunit FCV VP1 and FPV VP2 vaccine protects cats against FHV-1 and FPV challenge and induces serum neutralizing antibody responses against FCV. Front Immunol. 2025;16:1636514.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei Y, Zeng Q, Gou H, Bao S. Update on feline calicivirus: viral evolution, pathogenesis, epidemiology, prevention and control. Front Microbiol. 2024;15:1388420.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi L, Liu Z, Shi J, Yang M, Yan Y, Fu Y, Shen Z, Peng G. The CDE region of feline Calicivirus VP1 protein is a potential candidate subunit vaccine. BMC Vet Res. 2024;20(1):80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, Qi R, Chen M, Feng K, Liu Z, Kang H, Jiang Q, Qu L, Liu J. Screening and Immune Efficacy Evaluation of Antigens with Protection Against Feline Calicivirus. Vaccines 2024, 12(11).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, Song H, Zhang K, Wang S, Zhao Y, Zhang Q, Jin M. Efficient eukaryotic expression and potent antiviral activity of a long-acting recombinant feline interferon-omega2-Fc fusion protein against major feline viruses. Antiviral Res. 2025;243:106272.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee G, Budhathoki S, Lee GY, Oh KJ, Ham YK, Kim YJ, Lim YR, Hoang PT, Lee Y, Lim SW et al. Broad-Spectrum Antiviral Activity of 3D8, a Nucleic Acid-Hydrolyzing Single-Chain Variable Fragment (scFv), Targeting SARS-CoV-2 and Multiple Coronaviruses In Vitro. Viruses 2021, 13(4).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan Dorsten RT, Lambson BE, Wibmer CK, Weinberg MS, Moore PL, Morris L. Neutralization Breadth and Potency of Single-Chain Variable Fragments Derived from Broadly Neutralizing Antibodies Targeting Multiple Epitopes on the HIV-1 Envelope. J Virol 2020, 94(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi C, Wang Y, Liu T, Niklasch M, Qiao K, Durand S, Chen L, Liang M, Baumert TF, Tong S, et al. An E. coli-produced single-chain variable fragment (scFv) targeting hepatitis B virus surface protein potently inhibited virion secretion. Antiviral Res. 2019;162:118\u0026ndash;29.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLarman HB, Xu GJ, Pavlova NN, Elledge SJ. Construction of a rationally designed antibody platform for sequencing-assisted selection. Proc Natl Acad Sci USA. 2012;109(45):18523\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng X, Liu Q, Liang Y, Feng W, Yu H, Tong C, Song B. Advancement in the development of single chain antibodies using phage display technology. PeerJ. 2024;12:e17143.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLedsgaard L, Ljungars A, Rimbault C, Sorensen CV, Tulika T, Wade J, Wouters Y, McCafferty J, Laustsen AH. Advances in antibody phage display technology. Drug Discovery Today. 2022;27(8):2151\u0026ndash;69.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNur A, Schubert M, Lai JY, Hust M, Choong YS, Isa W, Lim TS. Antibody Phage Display. Methods Mol Biol. 2023;2702:3\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu M, Xi L, Wang Z, Wang Y, Gao X, Wei H, Feng Y, Wang J, Wu Q, Shang Y, et al. Recent advances in M13 phage display: Novel strategies of construction and biopanning recognition elements for food safety detection. Biosens Bioelectron. 2025;289:117880.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMendoza-Salazar I, Gomez-Castellano KM, Gonzalez-Gonzalez E, Gamboa-Suasnavart R, Rodriguez-Luna SD, Santiago-Casas G, Cortes-Paniagua MI, Perez-Tapia SM, Almagro JC. Anti-SARS-CoV-2 Omicron Antibodies Isolated from a SARS-CoV-2 Delta Semi-Immune Phage Display Library. \u003cem\u003eAntibodies\u003c/em\u003e 2022, 11(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMuller BH, Lafay F, Demangel C, Perrin P, Tordo N, Flamand A, Lafaye P, Guesdon JL. Phage-displayed and soluble mouse scFv fragments neutralize rabies virus. J Virol Methods. 1997;67(2):221\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong JX, Wang MX, Zhang YX, Wan B, Du YK, Zhuang GQ, Li ZB, Qiao SL, Geng R, Wu YN, et al. Identification and epitope mapping of anti-p72 single-chain antibody against African swine fever virus based on phage display antibody library. J Integr Agr. 2023;22(9):2834\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRay K, Embleton MJ, Jailkhani BL, Bhan MK, Kumar R. Selection of single chain variable fragments (scFv) against the glycoprotein antigen of the rabies virus from a human synthetic scFv phage display library and their fusion with the Fc region of human IgG1. Clin Exp Immunol. 2001;125(1):94\u0026ndash;101.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKramer RA, Marissen WE, Goudsmit J, Visser TJ, Clijsters-Van der Horst M, Bakker AQ, de Jong M, Jongeneelen M, Thijsse S, Backus HH, et al. The human antibody repertoire specific for rabies virus glycoprotein as selected from immune libraries. Eur J Immunol. 2005;35(7):2131\u0026ndash;45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim JW, Cho AH, Shin HG, Jang SH, Cho SY, Lee YR, Lee S. Development and Characterization of Phage Display-Derived Monoclonal Antibodies to the S2 Domain of Spike Proteins of Wild-Type SARS-CoV-2 and Multiple Variants. Viruses 2023, 15(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu Z, Tallmadge RL, Callaway HM, Felippe MJB, Parker JSL. Sequence analysis of feline immunoglobulin mRNAs and the development of a felinized monoclonal antibody specific to feline panleukopenia virus. Sci Rep. 2017;7(1):12713.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCubillos-Zapata C, Angulo I, Almanza H, Borrego B, Zamora-Ceballos M, Caston JR, Mena I, Blanco E, Barcena J. Precise location of linear epitopes on the capsid surface of feline calicivirus recognized by neutralizing and non-neutralizing monoclonal antibodies. Vet Res. 2020;51(1):59.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeng W, Zang D, Li R, Jiang Q, Liu J, Jia H, Kang H. A novel replication-deficient FCV vaccine provides strong immune protection in cats. J Virol. 2025;99(8):e0009325.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFumian TM, Tuipulotu DE, Netzler NE, Lun JH, Russo AG, Yan GJH, White PA. Potential Therapeutic Agents for Feline Calicivirus Infection. \u003cem\u003eViruses\u003c/em\u003e 2018, 10(8).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerinstein NL, Pennell NM, Weerasinghe R, Buckstein R, Piliotis E, Imrie KR, Chodirker L, Cussen MA, Miles E, Reis MD et al. Management of newly diagnosed high-risk and intermediate-risk follicular lymphoma with (90) Y ibritumomab tiuxetan in a phase II study. \u003cem\u003eHematological oncology\u003c/em\u003e 2018.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi F, Vijayasankaran N, Shen AY, Kiss R, Amanullah A. Cell culture processes for monoclonal antibody production. Mabs-Austin. 2010;2(5):466\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTajima T, Yoshizaki S, Nakata E, Tohya Y, Ishiguro S, Fujikawa Y, Sugii S. Production of a monoclonal antibody reacted broadly with feline calicivirus field isolates. J Vet Med Sci. 1998;60(2):155\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZahra DG, Vancov T, Dunn JM, Hawkins NJ, Ward RL. Selectable in-vivo recombination to increase antibody library size\u0026ndash;an improved phage display vector system. Gene. 1999;227(1):49\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng H, Rader C. Phage Display Selection of Antibody Libraries: Panning Procedures. \u003cem\u003eCold Spring Harbor protocols\u003c/em\u003e 2026, 2026(1):pdb prot108602.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng H, Rader C. Phage Display Selection of Antibody Libraries: Screening of Selected Binders. \u003cem\u003eCold Spring Harbor protocols\u003c/em\u003e 2026, 2026(1):pdb prot108603.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Song J, Jiang S, Yang Y, Han Y, Zhong L, Zhou J, Wang M, Song H, Xu Y. Canine distemper virus (CDV)-neutralizing activities of an anti-CDV canine-derived single-chain variable antibody fragment 4\u0026ndash;15 (scFv 4\u0026ndash;15) screened by phage display technology. Int J Biol Macromol. 2024;257(Pt 2):128645.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun Y, Li T, Liu J, Guo D, Xu L, Hu B, Zeng H, Cao W, Deng X, Ji Z, et al. A recombinant Fc-fused nanobody provides complete protection against feline parvovirus infection. Vet Microbiol. 2026;312:110837.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia L, Zhang J, Cui C, Bi X, Xiong J, Yu H, An Z, Luo W, Xia N. In vitro affinity maturation and characterization of anti-P24 antibody for HIV diagnostic assay. J BioChem. 2015;158(6):531\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou B, Xu L, Zhu R, Tang J, Wu Y, Su R, Yin Z, Liu D, Jiang Y, Wen C, et al. A bispecific broadly neutralizing antibody against enterovirus 71 and coxsackievirus A16 with therapeutic potential. Antiviral Res. 2019;161:28\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"feline calicivirus, VP1-CDE protein, single-chain variable fragment, phage display technology","lastPublishedDoi":"10.21203/rs.3.rs-8778333/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8778333/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eFeline calicivirus (FCV) causes infectious upper respiratory and virulent systemic diseases in feline population, with a lack of specific antiviral agents available. To address this, we constructed a feline-derived scFv phage display library targeting the VP1-CDE neutralizing region of FCV, using lymphocytes from VP1-CDE-immunized cats. The library had a titer of 2.1\u0026times;10\u003csup\u003e8\u003c/sup\u003e CFU/mL and good sequence diversity. After three rounds of panning and phage ELISA screening (OD\u003csub\u003e450\u003c/sub\u003e S/N\u0026thinsp;\u0026gt;\u0026thinsp;10), 5 unique scFv clones (3A5, 3B8, 3H5, 2H5, 2I5) were identified. Eukaryotic expression of scFv-Fc fusion proteins and validation via Western blot, ELISA and immunofluorescence assay confirmed their specific binding to VP1-CDE and FCV-infected F81 cells. Viral neutralization tests showed that scFv-3A5 had the strongest FCV-neutralizing activity (titer 1:64, MNC 1.172 \u0026micro;g/mL), scFv-2H5 showed weak activity (titer 1:16, MNC 4.688 \u0026micro;g/mL), and the other three clones had no significant neutralizing activity. This study provides promising candidate molecules for FCV diagnostic reagents and antiviral therapies.\u003c/p\u003e","manuscriptTitle":"Isolation of feline-derived scFvs against VP1-CDE region of feline calicivirus from phage display library and characterization of their antigen-binding and antiviral potential in vitro","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-18 10:05:57","doi":"10.21203/rs.3.rs-8778333/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-02-25T12:32:40+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-23T20:15:41+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-18T15:43:57+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-16T08:49:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"18832367060095599153313413534509846618","date":"2026-02-13T16:52:41+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"145125330225388364971897306722668268956","date":"2026-02-13T10:52:34+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-13T10:16:23+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"59889634151739053341798619659790611423","date":"2026-02-13T08:05:55+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"218983555372142469929747797694725607980","date":"2026-02-13T07:07:38+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-02-12T20:53:11+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-02-10T07:04:38+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-02-10T06:32:09+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-10T04:39:01+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Veterinary Research","date":"2026-02-10T04:24:23+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"aeca542c-8427-421d-ba94-5e0fbd80b0d6","owner":[],"postedDate":"February 18th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-12T15:09:04+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-18 10:05:57","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8778333","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8778333","identity":"rs-8778333","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00