Phylogeny, taxonomy and life cycle of Diderma brasiliensis (Physarales, Didymiaceae): a new species of myxomycete

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Diderma brasiliensis was found during a myxodiversity survey in Central Brazil, occurring abundantly on decomposing fallen trunks, leaf litter, and on the stems and leaves of the climbing plant Epipremnum aureum. It has globose to subglobose sporophores with reticulate spores and tortuous capillitia with nodular insertions, the latter two being very distinctive features of the species. In addition to these unique morphological traits, the proposal of this new species is phylogenetically supported by the 18S rRNA and mtSSU DNA regions. We also investigated its life cycle and cultivation strategies, recording the different stages of development and behavior, and we report a possible predatory interaction between the plasmodium of D. brasiliensis and the fungus Fusarium cf. decemcellulare. Although it shares similarities with other species of the genus, such as D. cor-rubrum, D. crustaceum, and D. subdictyospermum, D. brasiliensis is distinguished by the shape of its sporophore and capillitium, characterized by the presence of amorphous nodules and deeply reticulated spores. This study expands the knowledge of Neotropical myxomycetes and provides new insights into cultivation methods and ecological interactions.
Full text 112,993 characters · extracted from preprint-html · click to expand
Phylogeny, taxonomy and life cycle of Diderma brasiliensis (Physarales, Didymiaceae): a new species of myxomycete | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Phylogeny, taxonomy and life cycle of Diderma brasiliensis (Physarales, Didymiaceae): a new species of myxomycete Lucca Araujo Toschi, Lucas Leonardo-Silva, Solange Xavier-Santos This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7222482/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract Diderma brasiliensis was found during a myxodiversity survey in Central Brazil, occurring abundantly on decomposing fallen trunks, leaf litter, and on the stems and leaves of the climbing plant Epipremnum aureum . It has globose to subglobose sporophores with reticulate spores and tortuous capillitia with nodular insertions, the latter two being very distinctive features of the species. In addition to these unique morphological traits, the proposal of this new species is phylogenetically supported by the 18S rRNA and mtSSU DNA regions. We also investigated its life cycle and cultivation strategies, recording the different stages of development and behavior, and we report a possible predatory interaction between the plasmodium of D. brasiliensis and the fungus Fusarium cf. decemcellulare. Although it shares similarities with other species of the genus, such as D. cor-rubrum , D. crustaceum , and D. subdictyospermum , D. brasiliensis is distinguished by the shape of its sporophore and capillitium, characterized by the presence of amorphous nodules and deeply reticulated spores. This study expands the knowledge of Neotropical myxomycetes and provides new insights into cultivation methods and ecological interactions. Cultivation dark spores myxodiversity new taxa ribosomal RNA Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Physarales is a large order of dark-spored myxomycetes, comprising approximately 450 species (Lado 2005-2025), currently divided into two families: Physaraceae and Didymiaceae. The order includes the genera Didymium Schrad, the most representative, Diderma Persoon, both described at the end of the 18th century (Persoon 1794; Schrad 1797), Diachea Fries and Polyschismium Corda, formerly Lepidoderma de Bary ex Rostaf (García-Martín et al. 2023). The genus Diderma currently includes approximately 90 valid species, with D. globosum Persoon as the type species (Lado 2005-2025; Novozhilov et al. 2022). It is characterized by a one-, two- or three-layered peridium with granular lime and filamentous capillitia (Persoon 1794; Poulant et al. 2011). In the past two decades, three species of the genus Diderma have been described in Brazil: D. albo-columella Bezerra & Cavalcanti (Bezerra et al. 2010), D. aglomerospora Barbosa & Cavalcanti (Barborsa et al. 2021) and D. laiseae Moreira, Leonardo-Silva & Xavier-Santos (Moreira et al. 2024). In this context, we describe Diderma brasiliensis , a new species from Brazil, based on both morphological and phylogenetic evidence. Furthermore, we investigate the species’ life cycle and present strategies for cultivating and domesticating phaneroplasmodia – the vegetative phase – which has yielded interesting observations to be presented and discussed, such as the plasmodium's interaction preferences with Fusarium cf. decemcellulare Brick. Materials and Methods Specimens and morphological characterization Specimens were collected over a six-month period in the Botanical Garden of Anápolis, Goiás, Brazil. The vouchers were deposited in the fungal collection of the fungarium of the Universidade Estadual de Goiás (HUEG-Fungi) and isotypes sent to the URM herbarium and SP herbarium (Thiers 2025 [updated continuously]). For macroscopic characterization, sporophores were photographed using a Leica EZ4HD stereoscope, and their size was estimated from the diameter measured at two different points on 50 individuals. The color indication for the characters was based on Kornerup & Wansher (1978) color cards. For the microscopic studies, the sporophore samples were mounted on slides with 4% potassium hydroxide, visualized and photographed using Olympus CX31 and Zeiss Axiolab 5 optical microscope. Spores and capillitium were also observed using a JSM-6610 Scanning Electron Microscope (SEM) (Jeol, Tokyo, Japan) at the High-Resolution Multiuser Microscopy Laboratory (LabMic) at the Universidade Federal de Goiás. Dimensions of were estimated by averaging the measurements from 100 individual structures using Labscope 4.3.2 software (Zeiss). Cultivation in culture medium and life cycle For studies on cultivation, domestication, and life cycle of the species, we prepared a spore solution by placing 2 to 3 sporophores into a 2 mL microtube containing 0.7 mL of 0.1% Tween solution. The microtube was shaken manually until the complete disintegration of the sporophores. Spore germination was carried out on 2% water-agar medium in 9 mm Petri dishes, where 30 µL of the spore suspension was inoculated at 4 to 5 equidistant points, avoiding the edges of the plate. The plates were incubated in the dark at 26 ℃ in a BOD chamber. Spore germination was analyzed after 24 h, and myxamoeba were observed using a Zeiss Axiolab 5 optical microscope. With the plasmodial formation, sub-cultures were performed under two distinct conditions to observe its behavior: (I) on germination paper, kept constantly moist, but without water accumulation at the bottom of the plate; and (II) on 2% water-agar medium. Both cultures were incubated in the dark at 26°C in a BOD chamber. The plasmodium was fed intermittently, according to its apparent activity and movement toward the food source, using oat grains, basidioma of Favolus sp. and Auricularia sp., and lichens fragments. The mature plasmodia were then sub-cultured in a 2% water-agar medium to keep the plasmodia alive. Cultures were analyzed every 24 h for up to 15 days, and the behavior of the plasmodium, as well as the development of other life cycle stages, were recorded using a Leica EZ4HD stereomicroscope. During cultivation on water-agar, a species of filamentous fungus emerged and interacted with the plasmodium throughout the observation period. This fungus was isolated on Potato Dextrose Agar (PDA) medium and deposited in the culture collection of the laboratório de Micologia Básica, Aplicada e Divulgação Científica (FungiLab), da Universidade Estadual de Goiás, under the accession number SXS1047. DNA extraction, PCR amplification and sequencing Total DNA was extracted according to the CTAB method (Doyle and Doyle 1987; Góes-Neto et al. 2005), with adaptations. For the myxomycete samples, seven whole sporophores were macerated in three cycles of 90 s each at 3000 rpm using a Micrutube Homogeniser™ (Bead Bug) with three 3 mm glass beads, seven 1 mm silica beads and 600 uL of 2% CTAB buffer. The same process was applied to a fungal sample grown on potato dextrose agar (PDA), with DNA extracted directly from the mycelium. Extraction for both samples followed the standard CTAB protocol. The DNA was eluted in 30 uL of ultrapure H 2 O, quantified by fluorometry using the Quantus™ Fluorometer (Promega Corporation, Madison, WI, USA), and subsequently diluted to a final concentration of 20 ng/µL. DNA quality was assessed on a 1% agarose gel, where clear bands were observed for both samples. Amplification of the first intron-free region of the 18S rRNA and the mitochondrial small subunit (mtSSU) gene in the myxomycete was performed using the primer pairs S2/SU19R (Fiore-Donno et al., 2008 ; Fiore-Donno et al., 2011 ) and Kmit_F/Kmit_R (Lado et al, 2022 ), respectively (Table 1 ). For the fungal sample, the ITS region was amplified using ITS4/ITS5 primers (White et al. 1990) (Table 1 ). The thermocycling protocol used for PCR in both organisms followed the parameters listed in Table 1 . PCR reactions were carried out in a final volume of 25 µL, containing 12.5 µL of Taq Pol Master Mix Green 2x (Cellco™, Brazil), 0.5 µL of each Primer (10 ng/µL), 1 µL of DNA (diluted to 20 ng/µL), and 10.5 µL of ultra-pure H2O. PCR products were purified and sequenced with the same primers used in the amplification performed in an Applied Biosystems 3730xl DNA Analyzer (MacroGen Ltd., South Korea). Table 1 Primers and thermocycling protocol utilized in this article. Region Primers F/R Sequence (5'→3') Thermocycling protocol 18S rRNA S2 F TGGTTGATCCTGCCAGTAGTGT 5 min at 95°C, 36 cycles (30 sec at 95°C, 20 sec at 56°C, 50 sec at 72°C) and 5 min at 72°C SU19R R GACTTGTCCTCTAATTGTTACTCG mtSSU Kmit_F F AGTGTTATTCGTGATGACTGG 5 min at 95°C, 32 cycles (30 sec at 95°C, 1 min at 52°C, 90 sec at 72°C) and 10 min at 72°C Kmit_R R CGAATTAAACCACATCTCCACC ITS fungal ITS4 F TCCTCCGCTTATTGATATGC 5 min at 95° C, 25 cycles (45 sec at 95° C, 45 sec at 54° C, 1 min at 72° C) and 10 min at 72° C ITS5 R GGAAGTAAAAGTCGTAACAAGG Phylogenetic analyses Sequence chromatograms were assembled and edited using Staden Package 2.0 (Staden et al. 1998 ) and compared with the consensus sequences deposited in the GenBank database using BLAST ( http://blast.ncbi.nlm.nih.gov/ ). GenBank sequences with high similarity were extracted and aligned with the present study using the online version of MAFFT (Katoh and Standley 2013 ); these data were manually inspected using MEGA v.6 (Tamura et al. 2013 ). The genus Lamproderma Rostaf was used as an outgroup in phylogenetic analyses (García-Martín et al. 2023). The sequences generated in this study have been deposited in GenBank and are available in (Table 2 ) along with the other sequences used in the analyses. Phylogenetic analyses were inferred with Maximum Likelihood (ML) and Bayesian Inference (BI) performed in W-IQ-TREE (Kalayaanamoorthy et al. 2017 ) and MrBayes v. 3.2 (Ronquist and Huelsenbeck 2003), respectively, under the substitution model SYM + I + G for the 18S rRNA region and GTR + G for the mtSSU region estimated based on the Akaike Information Criterion (AIC). ML was determined with branch support (BS) inferred by 1000 bootstrap replications and Ultrafast bootstrap (UB). BI was performed with 6 million generations, with convergence verified in TRACER v. 1.7.1 (Rambaut et al. 2018), and the first 25% of the resulting trees were discarded as burn-in; Bayesian posterior probabilities (PP) were calculated from the remaining sampled trees. Significant support was assumed for nodes with BS and UB ≥ 70% and PP ≥ 0.95. The fungal sequences were compared with those available in the GenBank database using the BLAST search tool ( http://blast.ncbi.nlm.nih.gov/ ) to identify the isolate, based on similarity percentage. Values above 94% were considered to belong to the same genus, and above 97% to the same species (Li et al. 2016 ). Table 2 Specimens along with GenBank accession numbers used in the phylogenetic analysis. The sequences obtained in this study are marked in bold . Species Locality Voucher GenBank accesscode 18S rRNA mtSSU Diderma cor-rubrum Russia LE302473 OP621216 OR769428 Diderma cor-rubrum Russia MYX11340 OP621217.1 OR769459.1 Diderma aurantiacum Russia LE302633 OQ312104.1 OQ316576.1 Diderma aurantiacum Russia LE286478 OQ312103.1 OQ316575.1 Diderma tigrinum USA SLS17578 OP621309.1 OP616644.1 Diderma tigrinum Russia MYX17121 - OR769436.1 Diderma globosum Russia LE325799 MZ604992.1 OR769432.1 Diderma globosum Russia LE325793 MZ604991.1 OP616550.1 Diderma globosum Russia LE325132 MZ604989.1 OR769430.1 Diderma crustaceum China HMJAU M20008-2 PP165432.1 - Diderma crustaceum China HMJAU M20009-2 PP165434.1 - Diderma niveum Argentina MA-Fungi 78780 MW240313.1 MW240172.1 Diderma niveum Argentina MA-Fungi 78779 MW240312.1 MW240171.1 Diderma ochraceum Germany sc24091 MZ604997.1 OR769434.1 Diderma ochraceum Czech Republic sc24049 MZ604996.1 OR769433.1 Diderma savannica Brazil HUEG20149 Diderma effusum China HMJAU60270 OQ822775.1 - Diderma deplanatum China HMJAU60234 OQ822781.1 - Diderma deplanatum Russia LE317502a PP099460.1 PP097332.1 Diderma saundersii China HMJAU60249 OQ822785.1 - Diderma saundersii China HMJAUM20027-1 PP165461.1 - Polyschismium chailletii Germany sc31567 PP383399.1 - Polyschismium chailletii Germany sc34152 PP383739.1 - Diachea subsessilis Russia MYX14316 MZ005925.2 OR769427.1 Diachea subsessilis China HMJAUM10075 PP795191.1 PP833138.1 Diachea subsessilis Russia LE325164 MZ005926.2 OR769426.1 Diachea leucopodia China HMJAUM10005 PP795183.1 PP833130.1 Diachea leucopodia Peru MA-Fungi 90990 MG963646.1 MG963551.1 Diachea bulbillosa Russia LE297619 OP621206.1 OR769456.1 Diachea bulbillosa Russia MYX11336 OP621207.1 PP501432.1 Diachea bulbillosa China HMJAUM10037 PP795178.1 PP833125.1 Diachea muscorum Russia MYX12433 OR769402.1 OR769421.1 Diachea muscorum France MM28650 OP650744.1 OP646254.1 Didymium melanospermum Spain MA-Fungi 91238 MG963668.1 MG963577.1 Didymium melanospermum Spain MA-Fungi 62790 MG963667.1 MG963577.1 Didymium operculatum Chile MA-Fungi 80820 MG963670.1 - Didymium operculatum Chile MA-Fungi 74050 MG963669.1 MG963578.1 Lamproderma spinulosporum - MM32506 JQ031996.1 - Lamproderma ovoideum Russia LE285863 JQ812669.1 - Results Phylogenetic analyses BLASTn analysis of the 18S rRNA region revealed 92.6% similarity with D. crustaceum Peck, while the mtSSU region showed 90.68% similarity with D. cor-rubum Macbr. The sequences obtained were compared with those of other species within the family Didymiaceae, resulting in a final matrix consisting of four genera, 39 species, and two outgroup sequences (Table 2 ). The final alignment consisted of 585 characters for the 18S rRNA region and 468 for the mtSSU region, including gaps. BI analysis resulted in an average standard deviation of split frequencies of 0.007501. The ML and BI analyses returned visually congruent tree topologies. Therefore, only the ML tree is shown (Fig. 4 ). Based on the phylogenetic analysis, D. brasiliensis formed a strongly supported clade (BS = 100, UB = 100, PP = 1) with D. crustaceum and D. cor-rubrum. Taxonomy Diderma brasiliensis Toschi, Leonardo-Silva & Xavier-Santos, sp. nov. (Fig. 2 – 4 ) MycoBank: MB858520 GenBank 18S rRNA = PV389897; mtSSU = PV 611069. Etymology From the Latin brasiliensis , meaning “from Brazil” or “Brazilian”, the epithet refers to the species' country of origin. Typification : BRAZIL. GOIÁS: Anápolis, Botanical Garden 16°20'22‘S 48°56'25’W, on rotting wood waste, 08 Nov 2024, Toschi LA 118 (holotype HUEG20152/SP 529304/URM 95913). Material examined: BRAZIL. GOIÁS: Anápolis, Botanical Garden 16°20'21‘S 48°56'26’W, on rotting wood waste, 6 Apr 2024, Toschi LA 108 (HUEG20149); BRAZIL. GOIÁS: Anápolis, Botanical Garden 16°20'21‘S 48°56'26’W, on Epipremnum aureum leaf and undetermined plant residues, 4May 2024, Toschi LA 115 (HUEG20150). Description Phaneroplasmodium white (1A1) (Fig. 5 E–G); When fruiting begins, the immature sporophores are dull lilac (16C3) (Fig. 2 A), becoming white (1A1) to greyish brown (1B1) when mature with 0.4–0.8 mm in diameter. Peridium double composed of a thin, hyaline outer layer and a white inner layer (1A1) formed by calcareous granules (Fig. 4 D–F). Hypothallus white, dense and membranous (1A1). Columella white (1A1), 0.1–0.3 mm, composed of calcareous granules of 0.03–1.7 µm. Spores globose or subglobose, dark brown (7F4), (8.2) 10.3–11.5 (13.04) × (8.7) 9.5–10.0 (14.5) µm in diameter (including the reticulum), with reticula (0.5) 1.9–2.5 (3.1) µm thick (Fig. 3 A, B; 4 A, B). Capillitium brown and tortuous, (1.2)1.5–3.4(5.1) µm, with nodular insets (Fig. 3 C-G; Fig. 4 C, E) of variable size and arrangement, measuring approximately (1.4) 1.6–3.5 (8.4) µm, anastomosed near the end (Fig. 3 C, E, G). The capillitium is attached perpendicularly between the columella and the peridium, becoming more hyaline when close to close to its attachment points (Fig. 2 G). Substrate and habitat Diderma brasiliensis was found abundantly on the trunks of dead trees that had fallen to the ground and were already in an advanced state of decomposition, on leaf litter and on the living stems and leaves of climbing plant Epipremnum aureum (Linden & André) G.S.Bunting. Cultivation and life cycle Spore germination began within 10 h of inoculation. Myxamoeba (Fig. 5 A) were observed to be active within the first 20 h, preying on bacilliform organisms (Fig. 6 C). The first zygote (Fig. 5 C) was observed within two days, and the young plasmodium (Fig. 5 D-F) became visible under the stereoscope within eight days. The plasmodium was white, compact, and with advancing edges, where protoplasmic streaming was observed under an optical microscope. As soon as the first zygotes appeared, some were observed engulfing myxamoeba, which enables the phagocytosis of smaller cells. Additionally, young plasmodia were observed to ingest entire ungerminated spores (Supplementary Vid. 1), presumably using them as a nutrient source. At this point, the plasmodium was fed small fragments of autoclaved oat grains. After further growth, it was transferred to a humid chamber and fed with whole oat flakes. To induce fruiting, the plate was exposed to natural ambient light, and two to three small fragments of autoclaved wood were placed in the plate, which the plasmodium climbed and where it eventually fruited (Fig. 5 H). The species has aggregated fruiting; however, in some cases, fruiting was observed in the moist chamber with isolated formation of sporophores. In these cases, the peridium and columella were found to be poorly developed or absent, resulting in a spore mass with intertwined capillitia that did not follow the typical orientation of the columella and peridium. We believe that this condition is due to chemical stress or microbial activity that compromises the plasmodium development. Another possible factor is nutritional deficiency, caused by a limited quantity and diversity of available food. To address this, we provided the plasmodium with food sources more representative of its natural environment, including small fragments of lichens, and dehydrated basidiomata of the fungi Favolus sp. and Auricularia sp., all previously autoclaved. Under this varied diet, the plasmodium exhibited improved development. The water-agar cultures were constantly contaminated by Fusarium cf. decemcellulare (Fig. 7 A), which was partially identified with a corresponding sequence using the BLASTn tool, showing 99.64% similarity with the ITS region. We believe that the sporophores of D. brasiliensis were contaminated in the field by conidia of this fungus, as cultures of other myxomycete species maintained under the same laboratory conditions did not show its presence. Contamination was noticeable to the naked eye since the first days of cultivation, initially appearing as small magenta spots at the inoculation site and expanding radially over the surface of the culture medium. In the presence of the fungus, the plasmodium changed its color from the characteristic white to a gradually purplish tone, eventually becoming orange when mature (Fig. 7 C). This color change may be due to the incorporation of fungal metabolites or even to the phagocytosis of the fungus by the plasmodium. A certain degree of attraction between the plasmodium and the fungus was also observed, reinforcing the possibility of a predatory relationship. In cultures without fungal contamination, the plasmodium showed normal development and maintained its typical color, just as when the plasmodium with the alteration was transferred to another plate with new culture medium (Fig. 7 D and E), its color gradually returned to the conventional white (Fig. 7 E). Although fungal contamination can hinder myxomycete growth—particularly during the myxamoeba stage, this effect was not evident in the present study. Due to the low nutrient content of the water-agar medium, the growth of F. cf. decemcellulare was initially limited; however, over time, its colonization became more extensive. Discussion Diderma brasiliensis was recorded at different sites in the Anápolis Botanical Garden. This urban green space covers an area of around 25,000 m² and is crossed by the Ipiranga stream, whose bed is dammed within the park. The vegetation of the park includes native species from the Cerrado and Atlantic Forest, including large trees. These features give rise to a mosaic of microhabitats characterized by shading, high moisture and abundant organic matter, like as dense litter, ideal conditions for the development of the myxomycetes (Stephenson & Rojas 2017 ). The species described here is morphologically distinguished by its globose to subglobose sporophores, nodular capillitium and deeply reticulate spores. These characteristics set it apart from closely related species such as D. cor-rubrum T. Macbr. and D. crustaceum Peck, which form a clade with D. brasiliensis in our phylogenetic analysis but differ in spore ornamentation and capillitial architecture. D. brasiliensis also shares traits with D. subdictyospermum Rostaf, particularly the conspicuous spore spore reticula and robust, anastomosing capillitia (vide Liy and Chen 1999; Sánchez et al. 2002 ; Li et al. 2024 ; Yamamoto et al. 2006 ). However, D. brasiliensis can be easily differentiated by its more tortuous capillitia, a higher frequency of amorphous nodules, and slightly smaller spores that lack subreticula. Phylogenetic inference based on 18S rRNA and mtSSU sequences confirmed the distinct position of D. brasiliensis from known taxa, reinforcing the importance of integrating morphological and molecular data in species delimitation (Fiore-Donno et al., 2008 ; García-Martín et al., 2023). However, the latter lacks molecular data in public repositories, precluding its inclusion in the phylogenetic tree and reinforcing the novelty of Notably, D. subdictyospermum lacks molecular data in public repositories, which precluded its inclusion in our phylogenetic tree and underscores the novelty of our findings. Importantly, our study goes beyond taxonomic delineation by documenting the complete life cycle of D. brasiliensis under controlled conditions, a rare approach in the literature, despite its importance for understanding species biology (Borg Dahl et al. 2019 ; Poulain et al. 2011 ). Observations of phagocytosis of myxamoebae by early formed zygotes, and of ungerminated spores by juvenile plasmodia, highlight trophic plasticity and suggest adaptive mechanisms such as predation and autophagy. These behaviors may confer ecological advantages under resource-limited or competitive environments (Bloomfield 2018 . Fiore-Donno et al. 2011 ) and raise new questions about the survival strategies of myxomycetes. We also observed the assimilation by the plasmodium of pigment from Fusarium cf. decemcellulare . The plasmodium appeared attracted to fungal hyphae and underwent visible color changes, indicating a possible predatory interaction. This observation opens promising avenues for biotechnological research, particularly concerning the potential of myxomycetes in fungal control, a field still underexplored within protistology. This is especially relevant considering that the genus Fusarium includes species with high phytopathogenic potential (Geiser et al., 2013 ). Although scarcely documented in the literature, myxomycete–fungus interactions such as those observed here may represent a novel and valuable line of investigation for the development of biocontrol strategies. Finally, the ability to cultivate the species, maintain it in culture, and induce sporulation under laboratory conditions represents a methodological advance that facilitates experimental designs, genomic analysis and studies on physiological and behavioral myxomycete research. This is particularly relevant given the underrepresentation of Neotropical taxa in molecular databases such as GenBank and MycoBank (Fiore-Donno et al., 2008 ; García-Martín et al., 2023). By including DNA sequences from D. brasiliensis , this study contributes to expanding the known myxodiversity and mitigating gaps in phylogenetic and biogeographic studies. Conclusion This study describes Diderma brasiliensis as a new species of myxomycete, supported by both morphological distinctiveness and robust phylogenetic evidence. Beyond contributing to the taxonomy of the genus Diderma , the research offers original insights into its life cycle, trophic behavior, and ecological interactions, including signs of autophagy and a possible predatory relationship with a fungus. The successful cultivation and induction of sporulation under controlled laboratory conditions represent a methodological advancement, paving the way for future studies on the physiology, genomics, and experimental ecology of this species. Moreover, the deposition of DNA sequences in public databases helps address the underrepresentation of tropical taxa in molecular repositories, thereby strengthening phylogenetic and biogeographic analyses of myxomycetes and contributing to global efforts to map this biodiversity. Altogether, this work highlights the ecological and scientific relevance of D. brasiliensis and reinforces the importance of continuing to explore the rich, yet still poorly documented, myxomycete diversity of the Neotropics. Declarations Acknowlegments We are grateful to the Coordenação de Aperfeiçoamento de Pessoal de Ensino Superior (CAPES), for the funding (Convênio n° 21-2022) and for Master’s scholarship provided to LAT; to the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and to Fundação de Amparo à Pesquisa do Estado de Goiás (FAPEG) for providing the PDJ scholarship to LL-S, and to CNPq for the productivity grants to SX-S. Ethical approval: Not applicable Consent to participate: Not applicable Consent to publish: All authors authorise publication Competing interests: The authors declare no competing interests. Funding: Not applicable Author contributions: LAT: specimen collection, morphological description, molecular biology and phylogeny, writing; LLS: writing, molecular biology and phylogeny; SXS: writing, morphological description. Data availability statement: Voucher is deposited in Fungarium HUEG. The sequences generated in this study are deposited in NCBI GenBank ( https://www.ncbi.nlm.nih.gov/genbank/ ). References Alfaro ME, Zoller S, Lutzoni F (2003) Bayes or bootstrap? A simulation study comparing the performance of Bayesian Markov chain Monte Carlo sampling and bootstrapping in assessing phylogenetic confidence. Mol Biol Evol. 20(2):255–266. https://doi.org/10.1093/molbev/msg028 Barbosa DÍ, Melo TEO, Brayner FA, Cavalcanti LH (2021) Diderma aglomerospora (Didymiaceae, Physarales, Myxomycetes), a new species from Brazil. Phytotaxa. 494(2):231–236. https://doi.org/10.11646/phytotaxa.494.2.6 Bezerra ACC, Cavalcanti LH (2010) Diderma albo-columella (Myxomycetes), a new species in the Brazilian Atlantic Forest. Rodriguésia. 61(1):105–108. https://doi.org/10.1590/2175-7860201061111 Bloomfield G (2018) The evolution of ogres: cannibalistic growth in giant phagotrophs. bioRxiv. 262378. https://doi.org/10.1101/262378 Borg Dahl M, Brejnrod AD, Russel J, Sørensen SJ, Schnittler M (2019) Different degrees of niche differentiation for bacteria, fungi, and myxomycetes within an elevational transect in the German Alps. Microb Ecol. 78(3):764–780. https://doi.org/10.1007/s00248-019-01347-1 Fiore-Donno AM, Meyer M, Baldauf SL, Pawlowski J (2008) Evolution of dark-spored Myxomycetes (slime-molds): molecules versus morphology. Mol Phylogenet Evol. 46:878–889. https://doi.org/10.1111/j.1550-7408.2005.00032.x Fiore-Donno AM, Novozhilov YK, Meyer M, Schnittler M (2011) Genetic structure of two protist species (Myxogastria, Amoebozoa) suggests asexual reproduction in sexual amoebae. PLoS ONE. 6(8):e22872. https://doi.org/10.1371/journal.pone.0022872 García-Martin JM, Zamora JC, Lado C (2023) Multigene phylogeny of the order Physarales (Myxomycetes, Amoebozoa): Shedding light on the dark-spored clade. Persoonia. 51:89–124. https://doi.org/10.3767/persoonia.2023.51.02 Geiser DM, Aoki T, Bacon CW, Baker SE, Bhattacharyya MK, Brandt ME, Zhang N (2013) One fungus, one name: defining the genus Fusarium in a scientifically robust way that preserves longstanding use. Phytopathology. 103(5):400–408. https://doi.org/10.1094/PHYTO-07-12-0150-LE Kalayaanamoorthy S, Minh BQ, Wong TKF, Von Haeseler A, Jermiin LS (2017) ModelFinder: fast model selection for accurate phylogenetic estimates. Nat Methods. 14(6):587–589. https://doi.org/10.1038/nmeth.4285 Katoh K, Standley DM (2013) MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol Biol Evol. 30(4):772–780. https://doi.org/10.1093/molbev/mst010 Kornerup A, Wanscher JH (1978) Methuen Handbook of Colour. 3ª ed. Methuen, Londres Lado C, Treviño-Zevallos I, García-Martín JM, Wrigley de Basanta D (2022) Diachea mitchellii : a new myxomycete species from high elevation forests in the tropical Andes of Peru. Mycologia. 114(4):798–811 Li P, Wu Z, Liu T, Wang Y (2016) Biodiversity, phylogeny, and antifungal functions of Endophytic Fungi associated with Zanthoxylum bungeanum . Int J Mol Sci. 17:1541. https://doi.org/10.3390/ijms17091541 Li X, Tuo Y, Hu J, Li Y, Dai D, Sossah FL, Wang J, Guo Y, Liu S, Ma H, Zhang B, Li X, Li Y (2024) New species, new records, and common species of Diderma (Physarales, Didymiaceae) from China. Microbiol Spectr. 0:e01265-24. https://doi.org/10.1128/spectrum.01265-24 Liu CH, Chen YF (1999) Myxomycetes of Taiwan—XII. New records and newly rediscovered species. Taiwania. 44(3):368–375. https://doi.org/10.6165/tai.1999.44(3).368 Moreira IC, Leonardo-Silva L, Xavier Santos S (2025) Diderma laiseae (Didymiaceae, Physarales), a new species of Myxomycetes from Brazil. Phytotaxa. 682(2). https://doi.org/10.11646/phytotaxa.682.2.8 Novozhilov YK, Rollins AW, Shchepin ON, Schnittler M (2022) Ecology and distribution of Myxomycetes. Em: Rojas C, Stephenson SL (orgs.) Myxomycetes: Biology, Systematics, Biogeography, and Ecology. 2ª ed. Academic Press, pp. 325–376. https://doi.org/10.1016/B978-0-12-824281-0.00010-5 Persoon CH (1794) Neues Magazin für die Botanik in ihrem ganzen Umfange - Diderma . 1:89. p. 336 Poulain M, Meyer M, Bozonnet J (2011) Les Myxomycetes. Fédération mycologique et botanique Dauphiné-Savoie, Sévrier Prikhodko IS, Shchepin ON, Bortnikova NA, Novozhilov YK, Gmoshinskiy VI, Moreno G, Lopez-Villalba A, Stephenson SL, Schnittler M (2023) A three-gene phylogeny supports taxonomic rearrangements in the family Didymiaceae (Myxomycetes). Mycol Prog. 22:11. https://doi.org/10.1007/s11557-022-01858-1 Sánchez A, Moreno G, Illana C (2002) Diderma cristatosporum , a nivicolous Myxomycete from Spain. Persoonia. 17(4):643–647 Schrader HA (1797) Nova Genera Plantarum - Didymium . p. 1–32. Disponível em: https://www.biodiversitylibrary.org/page/12930554 Staden R, Beal KF, Bonfield JK (1998) The Staden package. Em: Misener S, Krawetz SA (orgs.) Bioinformatics Methods and Protocols. The Humana Press, pp. 115–130 Stephenson SL, Rojas C (2017) Myxomycetes: Biology, Systematics, Biogeography and Ecology. Academic Press Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0 . Mol Biol Evol. 30(12):2725–2729. https://doi.org/10.1093/molbev/mst197 Yamamoto Y, Kimura T, Degawa Y (2006) A tropical slime mold, Diderma subdictyospermum, new to Japan. Bull Kanagawa Prefect Mus Nat Sci. (35):33–34 Supplementary Files VIDEO1MACRO.mp4 VIDEO2MICRO.mp4 Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 09 Aug, 2025 Reviewers invited by journal 07 Aug, 2025 Editor invited by journal 07 Aug, 2025 Editor assigned by journal 31 Jul, 2025 First submitted to journal 28 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7222482","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":497179538,"identity":"3e5705d0-b599-4b9a-9678-834d11d2c509","order_by":0,"name":"Lucca Araujo Toschi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBElEQVRIiWNgGAWjYBACPgSTh+EAY4MEAz+InVCAWwsbhDJAaJFsAGkxIFILAyNQucEBmAAuLRLJDz/8YPgjJ99+9uABxh0WcsbnVyd+eGDAIM8vdgCHljRjyR4GA2ODM3kJBxjPSBib3Xi7WQLoMMOZsxNwaMlhAzrJIHGDBI/BAcY2icRtN85uAGlJMLiNWwvjH6CW+TOgWjbPOLv5ByEtzCBbGm5AtWzg792G3xaeZ8bSMgbGQL/kGBxIBPpF4gbvNosEAwmcfuFnT3748U2FHDDEzhh/+LijTo6//+zmmz8qbOT5pbFrgQBYLIDVSEBIPMoxLT5AiupRMApGwSgYAQAA/aRW5qWV2J4AAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-6106-5081","institution":"Universidade Estadual de Goias - Campus de Ciencias Exatas e Tecnologicas Henrique Santillo","correspondingAuthor":true,"prefix":"","firstName":"Lucca","middleName":"Araujo","lastName":"Toschi","suffix":""},{"id":497179539,"identity":"959a5035-83f9-4fdf-ac9a-e1c96f913a71","order_by":1,"name":"Lucas Leonardo-Silva","email":"","orcid":"","institution":"Universidade Estadual de Goias - Campus de Ciencias Exatas e Tecnologicas Henrique Santillo","correspondingAuthor":false,"prefix":"","firstName":"Lucas","middleName":"","lastName":"Leonardo-Silva","suffix":""},{"id":497179540,"identity":"fe1d84fb-2d76-4a4a-81e1-9ff5e598c932","order_by":2,"name":"Solange Xavier-Santos","email":"","orcid":"","institution":"Universidade Estadual de Goias - Campus de Ciencias Exatas e Tecnologicas Henrique Santillo","correspondingAuthor":false,"prefix":"","firstName":"Solange","middleName":"","lastName":"Xavier-Santos","suffix":""}],"badges":[],"createdAt":"2025-07-26 16:57:36","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7222482/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7222482/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":88968106,"identity":"19c4974c-9d24-454e-81ff-a8a5303b0b63","added_by":"auto","created_at":"2025-08-13 09:11:09","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":187798,"visible":true,"origin":"","legend":"\u003cp\u003eMaximum likelihood tree inferred from concatenated 18S rRNA and mtSSU sequences for the phylogenetic relationship of the Didymiaceae family, with members of the \u003cem\u003eLamproderma\u003c/em\u003e genus as an outgroup. Supports are shown for maximum likelihood ultrafast bootstrap replicates (UB)/branch support (BS)/Bayesian Posterior probabilities (PP), respectively. Sequence of \u003cem\u003eDiderma brasiliensis\u003c/em\u003e is in \u003cstrong\u003ebold\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"image1.tiff.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7222482/v1/46e2a6e8cc0a1d7b35f9c448.jpg"},{"id":88968113,"identity":"5b10dd19-ba84-472c-be4a-1a659c1404eb","added_by":"auto","created_at":"2025-08-13 09:11:09","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1790513,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eDiderma brasiliensis \u003c/em\u003esporophores (Toschi LA 118, HUEG2052)\u003cstrong\u003e.\u003c/strong\u003e (A–E) Intact sporophores. (F, G) Sporophores with apical dehiscence, exposing the columella, spore mass, and capillitium network (Toschi LA 117, HUEG 20151). Bars: A = 3 mm; B, D = 0.5 mm; C = 0.25 mm; E = 0.3 mm; F = 0.2 mm; G = 0.05 mm\u003c/p\u003e","description":"","filename":"image2.tiff.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7222482/v1/495f638358e2243a3a910220.jpg"},{"id":88968111,"identity":"55a5a595-96eb-4cac-accd-42164dfc64c4","added_by":"auto","created_at":"2025-08-13 09:11:09","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1119193,"visible":true,"origin":"","legend":"\u003cp\u003eMicrostructures of \u003cem\u003eDiderma brasiliensis\u003c/em\u003e (Toschi LA 118, HUEG20152). (A, B) Spores and calcareous granules in different foci. (C–E, G) Capillitium. (F) General view of the spores and capillitium. Bars: A, B = 10 μm; C, D, E, G = 4.5 μm; F = 15 μm\u003c/p\u003e","description":"","filename":"image3.tiff.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7222482/v1/73276d55a4ffb7363c5e1955.jpg"},{"id":88968119,"identity":"6733eb34-3a06-4ecb-8499-3ae37b1e5589","added_by":"auto","created_at":"2025-08-13 09:11:09","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1537222,"visible":true,"origin":"","legend":"\u003cp\u003eScanning electron micrographs of \u003cem\u003eDiderma brasiliensis \u003c/em\u003e(Toschi LA 118, HUEG 20152). (A) Spore. (B) Spores in aggregation. (C) Capillitium. (D) Calcareous granules. (E) Capillitium. (F) Fragment of the peridium showing its layer of calcareous granules. Bars: A = 1 μm; B = 4 μm; C = 2 μm; D = 1 μm; E = 1.5 μm; F = 3 μm\u003c/p\u003e","description":"","filename":"image4.tiff.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7222482/v1/5fe02a9fd9fdf7b6bbc41120.jpg"},{"id":88969519,"identity":"6a19e53e-160f-475c-a2f8-e6f7edf8b4bb","added_by":"auto","created_at":"2025-08-13 09:27:09","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1585698,"visible":true,"origin":"","legend":"\u003cp\u003eLife cycle of \u003cem\u003eDiderma brasiliensis\u003c/em\u003e. (A) Myxamoeba of 20 h in intense activity. (B) Unicellular cyst. (C) Zygote of 2 d in intense activity (time-lapse video accelerated 15 times available in Supplementary Vid. 2). (D) Young plasmodium. (E–G). Plasmodium already developed. (H) Sporophores obtained in moist chamber. Bars: A, B = 5 μm; C = 10 μm; D = 0.2 mm; E = 0.5 mm; F = 0.05 mm; G = 1 cm; H = 0.2 mm\u003c/p\u003e","description":"","filename":"image5.tiff.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7222482/v1/2bc87eb96c37d3c7a5c3f25d.jpg"},{"id":88968112,"identity":"ea971c71-5279-4874-8992-1eb4b901e5e3","added_by":"auto","created_at":"2025-08-13 09:11:09","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":71157,"visible":true,"origin":"","legend":"\u003cp\u003eMyxamoeba of approximately 24 h at different times. (A, B) showing emission of pseudopod, with 5 seconds apart between the photos; (C) with bacilliform organisms in digestive vesicle (arrow). Bars: A–C = 1.5 µm\u003c/p\u003e","description":"","filename":"image6.tiff.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7222482/v1/73861ade158f19a2bbe1a5d7.jpg"},{"id":88969522,"identity":"cc07b83e-5d0b-4583-86dc-61d1ef15c802","added_by":"auto","created_at":"2025-08-13 09:27:09","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":131303,"visible":true,"origin":"","legend":"\u003cp\u003eCultures in the presence of the fungus \u003cem\u003eFusarium \u003c/em\u003ecf.\u003cem\u003e decemcellulare\u003c/em\u003e. (A) Colony of \u003cem\u003eF. decemcellulare\u003c/em\u003ein PDA medium; (B) Conidia of \u003cem\u003eF. decemcellulare\u003c/em\u003e; (C) Plasmodium in contaminated with the fungus water agar culture; (D) Plasmodium transferred to new water agar culture medium after ca. 48 h; (E) The same plasmodium after 7 days. B= 15 µm; C, D= 1 mm; E= 0.5 cm; C-1=0.5 mm; D-1, E-1= 1 mm\u003c/p\u003e","description":"","filename":"image7.tiff.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7222482/v1/acc393efedd9087bc6aeb48e.jpg"},{"id":88971572,"identity":"686b04b9-3d28-477a-9d42-338105b8287b","added_by":"auto","created_at":"2025-08-13 09:43:11","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7253014,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7222482/v1/c8d3d6cc-954e-4a99-a4c8-716044f27f02.pdf"},{"id":88968125,"identity":"79ce1e2a-627b-4b4f-b325-b268ca074d98","added_by":"auto","created_at":"2025-08-13 09:11:09","extension":"mp4","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":19127122,"visible":true,"origin":"","legend":"","description":"","filename":"VIDEO1MACRO.mp4","url":"https://assets-eu.researchsquare.com/files/rs-7222482/v1/f5bafbdf3a749fb857733a8c.mp4"},{"id":88968116,"identity":"3c25f3cd-e28a-4ee9-a24c-80b7367af0f1","added_by":"auto","created_at":"2025-08-13 09:11:09","extension":"mp4","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":1983095,"visible":true,"origin":"","legend":"","description":"","filename":"VIDEO2MICRO.mp4","url":"https://assets-eu.researchsquare.com/files/rs-7222482/v1/deef0c0f5683f38ee9dc31a8.mp4"}],"financialInterests":"","formattedTitle":"Phylogeny, taxonomy and life cycle of Diderma brasiliensis (Physarales, Didymiaceae): a new species of myxomycete","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePhysarales is a large order of dark-spored myxomycetes, comprising approximately 450 species (Lado 2005-2025), currently divided into two families: Physaraceae and Didymiaceae. The order includes the genera \u003cem\u003eDidymium\u003c/em\u003e Schrad, the most representative, \u003cem\u003eDiderma\u003c/em\u003e Persoon, both described at the end of the 18th century (Persoon 1794; Schrad 1797), \u003cem\u003eDiachea\u003c/em\u003e Fries and \u003cem\u003ePolyschismium\u003c/em\u003e Corda, formerly \u003cem\u003eLepidoderma\u003c/em\u003e de Bary ex Rostaf (Garc\u0026iacute;a-Mart\u0026iacute;n et al. 2023). The genus \u003cem\u003eDiderma\u003c/em\u003e currently includes approximately 90 valid species, with \u003cem\u003eD. globosum\u0026nbsp;\u003c/em\u003ePersoon as the type species (Lado 2005-2025; Novozhilov et al. 2022). It is characterized by a one-, two- or three-layered peridium with granular lime and filamentous capillitia (Persoon 1794; Poulant et al. 2011).\u003c/p\u003e\n\u003cp\u003eIn the past two decades, three species of the genus \u003cem\u003eDiderma\u003c/em\u003e have been described in Brazil: \u003cem\u003eD. albo-columella\u003c/em\u003e Bezerra \u0026amp; Cavalcanti (Bezerra et al. 2010), \u003cem\u003eD. aglomerospora\u003c/em\u003e Barbosa \u0026amp; Cavalcanti (Barborsa et al. 2021) and \u003cem\u003eD. laiseae\u0026nbsp;\u003c/em\u003eMoreira, Leonardo-Silva \u0026amp; Xavier-Santos (Moreira et al. 2024). In this context, we describe \u003cem\u003eDiderma brasiliensis\u003c/em\u003e, a new species from Brazil, based on both morphological and phylogenetic evidence. Furthermore, we investigate the species\u0026rsquo; life cycle and present strategies for cultivating and domesticating phaneroplasmodia \u0026ndash; the vegetative phase \u0026ndash; which has yielded interesting observations to be presented and discussed, such as the plasmodium\u0026apos;s interaction preferences with \u003cem\u003eFusarium\u003c/em\u003e cf. \u003cem\u003edecemcellulare\u0026nbsp;\u003c/em\u003eBrick.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cb\u003eSpecimens and morphological characterization\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSpecimens were collected over a six-month period in the Botanical Garden of An\u0026aacute;polis, Goi\u0026aacute;s, Brazil. The vouchers were deposited in the fungal collection of the fungarium of the Universidade Estadual de Goi\u0026aacute;s (HUEG-Fungi) and isotypes sent to the URM herbarium and SP herbarium (Thiers 2025 [updated continuously]).\u003c/p\u003e\u003cp\u003eFor macroscopic characterization, sporophores were photographed using a Leica EZ4HD stereoscope, and their size was estimated from the diameter measured at two different points on 50 individuals. The color indication for the characters was based on Kornerup \u0026amp; Wansher (1978) color cards. For the microscopic studies, the sporophore samples were mounted on slides with 4% potassium hydroxide, visualized and photographed using Olympus CX31 and Zeiss Axiolab 5 optical microscope. Spores and capillitium were also observed using a JSM-6610 Scanning Electron Microscope (SEM) (Jeol, Tokyo, Japan) at the High-Resolution Multiuser Microscopy Laboratory (LabMic) at the Universidade Federal de Goi\u0026aacute;s. Dimensions of were estimated by averaging the measurements from 100 individual structures using Labscope 4.3.2 software (Zeiss).\u003c/p\u003e\u003cp\u003e\u003cb\u003eCultivation in culture medium and life cycle\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFor studies on cultivation, domestication, and life cycle of the species, we prepared a spore solution by placing 2 to 3 sporophores into a 2 mL microtube containing 0.7 mL of 0.1% Tween solution. The microtube was shaken manually until the complete disintegration of the sporophores. Spore germination was carried out on 2% water-agar medium in 9 mm Petri dishes, where 30 \u0026micro;L of the spore suspension was inoculated at 4 to 5 equidistant points, avoiding the edges of the plate. The plates were incubated in the dark at 26 ℃ in a BOD chamber. Spore germination was analyzed after 24 h, and myxamoeba were observed using a Zeiss Axiolab 5 optical microscope.\u003c/p\u003e\u003cp\u003eWith the plasmodial formation, sub-cultures were performed under two distinct conditions to observe its behavior: (I) on germination paper, kept constantly moist, but without water accumulation at the bottom of the plate; and (II) on 2% water-agar medium. Both cultures were incubated in the dark at 26\u0026deg;C in a BOD chamber. The plasmodium was fed intermittently, according to its apparent activity and movement toward the food source, using oat grains, basidioma of \u003cem\u003eFavolus\u003c/em\u003e sp. and \u003cem\u003eAuricularia\u003c/em\u003e sp., and lichens fragments. The mature plasmodia were then sub-cultured in a 2% water-agar medium to keep the plasmodia alive.\u003c/p\u003e\u003cp\u003eCultures were analyzed every 24 h for up to 15 days, and the behavior of the plasmodium, as well as the development of other life cycle stages, were recorded using a Leica EZ4HD stereomicroscope. During cultivation on water-agar, a species of filamentous fungus emerged and interacted with the plasmodium throughout the observation period. This fungus was isolated on Potato Dextrose Agar (PDA) medium and deposited in the culture collection of the laborat\u0026oacute;rio de Micologia B\u0026aacute;sica, Aplicada e Divulga\u0026ccedil;\u0026atilde;o Cient\u0026iacute;fica (FungiLab), da Universidade Estadual de Goi\u0026aacute;s, under the accession number SXS1047.\u003c/p\u003e\u003cp\u003e\u003cb\u003eDNA extraction, PCR amplification and sequencing\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTotal DNA was extracted according to the CTAB method (Doyle and Doyle 1987; G\u0026oacute;es-Neto et al. 2005), with adaptations. For the myxomycete samples, seven whole sporophores were macerated in three cycles of 90 s each at 3000 rpm using a Micrutube Homogeniser\u0026trade; (Bead Bug) with three 3 mm glass beads, seven 1 mm silica beads and 600 uL of 2% CTAB buffer. The same process was applied to a fungal sample grown on potato dextrose agar (PDA), with DNA extracted directly from the mycelium. Extraction for both samples followed the standard CTAB protocol. The DNA was eluted in 30 uL of ultrapure H\u003csub\u003e2\u003c/sub\u003eO, quantified by fluorometry using the Quantus\u0026trade; Fluorometer (Promega Corporation, Madison, WI, USA), and subsequently diluted to a final concentration of 20 ng/\u0026micro;L. DNA quality was assessed on a 1% agarose gel, where clear bands were observed for both samples.\u003c/p\u003e\u003cp\u003eAmplification of the first intron-free region of the 18S rRNA and the mitochondrial small subunit (mtSSU) gene in the myxomycete was performed using the primer pairs S2/SU19R (Fiore-Donno et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Fiore-Donno et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) and Kmit_F/Kmit_R (Lado et al, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), respectively (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). For the fungal sample, the ITS region was amplified using ITS4/ITS5 primers (White et al. 1990) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The thermocycling protocol used for PCR in both organisms followed the parameters listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. PCR reactions were carried out in a final volume of 25 \u0026micro;L, containing 12.5 \u0026micro;L of Taq Pol Master Mix Green 2x (Cellco\u0026trade;, Brazil), 0.5 \u0026micro;L of each Primer (10 ng/\u0026micro;L), 1 \u0026micro;L of DNA (diluted to 20 ng/\u0026micro;L), and 10.5 \u0026micro;L of ultra-pure H2O. PCR products were purified and sequenced with the same primers used in the amplification performed in an Applied Biosystems 3730xl DNA Analyzer (MacroGen Ltd., South Korea).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimers and thermocycling protocol utilized in this article.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRegion\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimers\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eF/R\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSequence (5'\u0026rarr;3')\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eThermocycling protocol\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e18S rRNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eS2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eTGGTTGATCCTGCCAGTAGTGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e5 min at 95\u0026deg;C, 36 cycles (30 sec at 95\u0026deg;C, 20 sec at 56\u0026deg;C, 50 sec at 72\u0026deg;C) and 5 min at 72\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSU19R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGACTTGTCCTCTAATTGTTACTCG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003emtSSU\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eKmit_F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAGTGTTATTCGTGATGACTGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e5 min at 95\u0026deg;C, 32 cycles (30 sec at 95\u0026deg;C, 1 min at 52\u0026deg;C, 90 sec at 72\u0026deg;C) and 10 min at 72\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eKmit_R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCGAATTAAACCACATCTCCACC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eITS fungal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eITS4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eTCCTCCGCTTATTGATATGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e5 min at 95\u0026deg; C, 25 cycles (45 sec at 95\u0026deg; C, 45 sec at 54\u0026deg; C, 1 min at 72\u0026deg; C) and 10 min at 72\u0026deg; C\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eITS5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGGAAGTAAAAGTCGTAACAAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003ePhylogenetic analyses\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSequence chromatograms were assembled and edited using Staden Package 2.0 (Staden et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e1998\u003c/span\u003e) and compared with the consensus sequences deposited in the GenBank database using BLAST (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://blast.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"http://blast.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). GenBank sequences with high similarity were extracted and aligned with the present study using the online version of MAFFT (Katoh and Standley \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2013\u003c/span\u003e); these data were manually inspected using MEGA v.6 (Tamura et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The genus \u003cem\u003eLamproderma\u003c/em\u003e Rostaf was used as an outgroup in phylogenetic analyses (Garc\u0026iacute;a-Mart\u0026iacute;n et al. 2023). The sequences generated in this study have been deposited in GenBank and are available in (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) along with the other sequences used in the analyses.\u003c/p\u003e\u003cp\u003ePhylogenetic analyses were inferred with Maximum Likelihood (ML) and Bayesian Inference (BI) performed in W-IQ-TREE (Kalayaanamoorthy et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) and MrBayes v. 3.2 (Ronquist and Huelsenbeck 2003), respectively, under the substitution model SYM\u0026thinsp;+\u0026thinsp;I\u0026thinsp;+\u0026thinsp;G for the 18S rRNA region and GTR\u0026thinsp;+\u0026thinsp;G for the mtSSU region estimated based on the Akaike Information Criterion (AIC). ML was determined with branch support (BS) inferred by 1000 bootstrap replications and Ultrafast bootstrap (UB). BI was performed with 6\u0026nbsp;million generations, with convergence verified in TRACER v. 1.7.1 (Rambaut et al. 2018), and the first 25% of the resulting trees were discarded as burn-in; Bayesian posterior probabilities (PP) were calculated from the remaining sampled trees. Significant support was assumed for nodes with BS and UB\u0026thinsp;\u0026ge;\u0026thinsp;70% and PP\u0026thinsp;\u0026ge;\u0026thinsp;0.95.\u003c/p\u003e\u003cp\u003eThe fungal sequences were compared with those available in the GenBank database using the BLAST search tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://blast.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"http://blast.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to identify the isolate, based on similarity percentage. Values above 94% were considered to belong to the same genus, and above 97% to the same species (Li et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eSpecimens along with GenBank accession numbers used in the phylogenetic analysis. The sequences obtained in this study are marked in \u003cb\u003ebold\u003c/b\u003e.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSpecies\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLocality\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eVoucher\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003eGenBank accesscode\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e18S rRNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003emtSSU\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma cor-rubrum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRussia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLE302473\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eOP621216\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eOR769428\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma cor-rubrum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRussia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMYX11340\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eOP621217.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eOR769459.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma aurantiacum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRussia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLE302633\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eOQ312104.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eOQ316576.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma aurantiacum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRussia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLE286478\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eOQ312103.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eOQ316575.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma\u0026nbsp;tigrinum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eUSA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSLS17578\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eOP621309.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eOP616644.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma\u0026nbsp;tigrinum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRussia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMYX17121\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eOR769436.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma globosum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRussia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLE325799\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMZ604992.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eOR769432.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma globosum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRussia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLE325793\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMZ604991.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eOP616550.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma globosum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRussia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLE325132\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMZ604989.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eOR769430.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma crustaceum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eChina\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHMJAU M20008-2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePP165432.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma crustaceum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eChina\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHMJAU M20009-2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePP165434.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma\u0026nbsp;niveum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eArgentina\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMA-Fungi 78780\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMW240313.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eMW240172.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma\u0026nbsp;niveum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eArgentina\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMA-Fungi 78779\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMW240312.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eMW240171.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma ochraceum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGermany\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003esc24091\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMZ604997.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eOR769434.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma ochraceum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCzech Republic\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003esc24049\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMZ604996.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eOR769433.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eDiderma savannica\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eBrazil\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHUEG20149\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma effusum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eChina\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHMJAU60270\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eOQ822775.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma deplanatum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eChina\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHMJAU60234\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eOQ822781.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma deplanatum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRussia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLE317502a\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePP099460.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePP097332.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma saundersii\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eChina\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHMJAU60249\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eOQ822785.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiderma saundersii\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eChina\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHMJAUM20027-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePP165461.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ePolyschismium chailletii\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGermany\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003esc31567\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePP383399.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ePolyschismium chailletii\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGermany\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003esc34152\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePP383739.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiachea subsessilis\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRussia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMYX14316\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMZ005925.2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eOR769427.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiachea subsessilis\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eChina\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHMJAUM10075\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePP795191.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePP833138.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiachea subsessilis\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRussia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLE325164\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMZ005926.2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eOR769426.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiachea leucopodia\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eChina\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHMJAUM10005\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePP795183.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePP833130.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiachea leucopodia\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePeru\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMA-Fungi 90990\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMG963646.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eMG963551.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiachea bulbillosa\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRussia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLE297619\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eOP621206.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eOR769456.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiachea bulbillosa\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRussia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMYX11336\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eOP621207.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePP501432.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiachea bulbillosa\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eChina\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHMJAUM10037\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePP795178.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePP833125.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiachea muscorum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRussia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMYX12433\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eOR769402.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eOR769421.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDiachea muscorum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eFrance\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMM28650\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eOP650744.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eOP646254.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDidymium melanospermum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSpain\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMA-Fungi 91238\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMG963668.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eMG963577.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDidymium melanospermum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSpain\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMA-Fungi 62790\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMG963667.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eMG963577.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDidymium operculatum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eChile\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMA-Fungi 80820\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMG963670.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDidymium operculatum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eChile\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMA-Fungi 74050\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMG963669.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eMG963578.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLamproderma spinulosporum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMM32506\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eJQ031996.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLamproderma ovoideum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRussia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLE285863\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eJQ812669.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003ePhylogenetic analyses\u003c/b\u003e\u003c/p\u003e\u003cp\u003eBLASTn analysis of the 18S rRNA region revealed 92.6% similarity with \u003cem\u003eD. crustaceum\u003c/em\u003e Peck, while the mtSSU region showed 90.68% similarity with \u003cem\u003eD. cor-rubum\u003c/em\u003e Macbr. The sequences obtained were compared with those of other species within the family Didymiaceae, resulting in a final matrix consisting of four genera, 39 species, and two outgroup sequences (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The final alignment consisted of 585 characters for the 18S rRNA region and 468 for the mtSSU region, including gaps. BI analysis resulted in an average standard deviation of split frequencies of 0.007501. The ML and BI analyses returned visually congruent tree topologies. Therefore, only the ML tree is shown (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Based on the phylogenetic analysis, \u003cem\u003eD. brasiliensis\u003c/em\u003e formed a strongly supported clade (BS\u0026thinsp;=\u0026thinsp;100, UB\u0026thinsp;=\u0026thinsp;100, PP\u0026thinsp;=\u0026thinsp;1) with \u003cem\u003eD. crustaceum\u003c/em\u003e and \u003cem\u003eD. cor-rubrum.\u003c/em\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eTaxonomy\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eDiderma brasiliensis\u003c/b\u003e Toschi, Leonardo-Silva \u0026amp; Xavier-Santos, sp. nov. (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e)\u003c/p\u003e\u003cp\u003eMycoBank: MB858520\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eGenBank\u003c/strong\u003e\u003cp\u003e18S rRNA\u0026thinsp;=\u0026thinsp;PV389897; mtSSU\u0026thinsp;=\u0026thinsp;PV 611069.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eEtymology\u003c/strong\u003e\u003cp\u003eFrom the Latin \u003cem\u003ebrasiliensis\u003c/em\u003e, meaning \u0026ldquo;from Brazil\u0026rdquo; or \u0026ldquo;Brazilian\u0026rdquo;, the epithet refers to the species' country of origin.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eTypification\u003c/b\u003e: BRAZIL. GOI\u0026Aacute;S: An\u0026aacute;polis, Botanical Garden 16\u0026deg;20'22\u0026lsquo;S 48\u0026deg;56'25\u0026rsquo;W, on rotting wood waste, 08 Nov 2024, Toschi LA 118 (holotype HUEG20152/SP 529304/URM 95913).\u003c/p\u003e\u003cp\u003eMaterial examined: BRAZIL. GOI\u0026Aacute;S: An\u0026aacute;polis, Botanical Garden 16\u0026deg;20'21\u0026lsquo;S 48\u0026deg;56'26\u0026rsquo;W, on rotting wood waste, 6 Apr 2024, Toschi LA 108 (HUEG20149); BRAZIL. GOI\u0026Aacute;S: An\u0026aacute;polis, Botanical Garden 16\u0026deg;20'21\u0026lsquo;S 48\u0026deg;56'26\u0026rsquo;W, on \u003cem\u003eEpipremnum aureum\u003c/em\u003e leaf and undetermined plant residues, 4May 2024, Toschi LA 115 (HUEG20150).\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eDescription\u003c/strong\u003e\u003cp\u003ePhaneroplasmodium white (1A1) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE\u0026ndash;G); When fruiting begins, the immature sporophores are dull lilac (16C3) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), becoming white (1A1) to greyish brown (1B1) when mature with 0.4\u0026ndash;0.8 mm in diameter. Peridium double composed of a thin, hyaline outer layer and a white inner layer (1A1) formed by calcareous granules (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD\u0026ndash;F). Hypothallus white, dense and membranous (1A1). Columella white (1A1), 0.1\u0026ndash;0.3 mm, composed of calcareous granules of 0.03\u0026ndash;1.7 \u0026micro;m. Spores globose or subglobose, dark brown (7F4), (8.2) 10.3\u0026ndash;11.5 (13.04) \u0026times; (8.7) 9.5\u0026ndash;10.0 (14.5) \u0026micro;m in diameter (including the reticulum), with reticula (0.5) 1.9\u0026ndash;2.5 (3.1) \u0026micro;m thick (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B; \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e A, B). Capillitium brown and tortuous, (1.2)1.5\u0026ndash;3.4(5.1) \u0026micro;m, with nodular insets (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-G; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC, E) of variable size and arrangement, measuring approximately (1.4) 1.6\u0026ndash;3.5 (8.4) \u0026micro;m, anastomosed near the end (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, E, G). The capillitium is attached perpendicularly between the columella and the peridium, becoming more hyaline when close to close to its attachment points (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG).\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eSubstrate and habitat\u003c/strong\u003e\u003cp\u003e\u003cem\u003eDiderma brasiliensis\u003c/em\u003e was found abundantly on the trunks of dead trees that had fallen to the ground and were already in an advanced state of decomposition, on leaf litter and on the living stems and leaves of climbing plant \u003cem\u003eEpipremnum aureum\u003c/em\u003e (Linden \u0026amp; Andr\u0026eacute;) G.S.Bunting.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eCultivation and life cycle\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSpore germination began within 10 h of inoculation. Myxamoeba (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA) were observed to be active within the first 20 h, preying on bacilliform organisms (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). The first zygote (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC) was observed within two days, and the young plasmodium (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD-F) became visible under the stereoscope within eight days. The plasmodium was white, compact, and with advancing edges, where protoplasmic streaming was observed under an optical microscope. As soon as the first zygotes appeared, some were observed engulfing myxamoeba, which enables the phagocytosis of smaller cells. Additionally, young plasmodia were observed to ingest entire ungerminated spores (Supplementary Vid. 1), presumably using them as a nutrient source.\u003c/p\u003e\u003cp\u003eAt this point, the plasmodium was fed small fragments of autoclaved oat grains. After further growth, it was transferred to a humid chamber and fed with whole oat flakes. To induce fruiting, the plate was exposed to natural ambient light, and two to three small fragments of autoclaved wood were placed in the plate, which the plasmodium climbed and where it eventually fruited (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH).\u003c/p\u003e\u003cp\u003eThe species has aggregated fruiting; however, in some cases, fruiting was observed in the moist chamber with isolated formation of sporophores. In these cases, the peridium and columella were found to be poorly developed or absent, resulting in a spore mass with intertwined capillitia that did not follow the typical orientation of the columella and peridium. We believe that this condition is due to chemical stress or microbial activity that compromises the plasmodium development. Another possible factor is nutritional deficiency, caused by a limited quantity and diversity of available food. To address this, we provided the plasmodium with food sources more representative of its natural environment, including small fragments of lichens, and dehydrated basidiomata of the fungi \u003cem\u003eFavolus\u003c/em\u003e sp. and \u003cem\u003eAuricularia\u003c/em\u003e sp., all previously autoclaved. Under this varied diet, the plasmodium exhibited improved development.\u003c/p\u003e\u003cp\u003eThe water-agar cultures were constantly contaminated by \u003cem\u003eFusarium\u003c/em\u003e cf. \u003cem\u003edecemcellulare\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA), which was partially identified with a corresponding sequence using the BLASTn tool, showing 99.64% similarity with the ITS region. We believe that the sporophores of \u003cem\u003eD. brasiliensis\u003c/em\u003e were contaminated in the field by conidia of this fungus, as cultures of other myxomycete species maintained under the same laboratory conditions did not show its presence. Contamination was noticeable to the naked eye since the first days of cultivation, initially appearing as small magenta spots at the inoculation site and expanding radially over the surface of the culture medium. In the presence of the fungus, the plasmodium changed its color from the characteristic white to a gradually purplish tone, eventually becoming orange when mature (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). This color change may be due to the incorporation of fungal metabolites or even to the phagocytosis of the fungus by the plasmodium. A certain degree of attraction between the plasmodium and the fungus was also observed, reinforcing the possibility of a predatory relationship.\u003c/p\u003e\u003cp\u003eIn cultures without fungal contamination, the plasmodium showed normal development and maintained its typical color, just as when the plasmodium with the alteration was transferred to another plate with new culture medium (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD and E), its color gradually returned to the conventional white (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE). Although fungal contamination can hinder myxomycete growth\u0026mdash;particularly during the myxamoeba stage, this effect was not evident in the present study. Due to the low nutrient content of the water-agar medium, the growth of \u003cem\u003eF.\u003c/em\u003e cf. \u003cem\u003edecemcellulare\u003c/em\u003e was initially limited; however, over time, its colonization became more extensive.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e\u003cem\u003eDiderma brasiliensis\u003c/em\u003e was recorded at different sites in the An\u0026aacute;polis Botanical Garden. This urban green space covers an area of around 25,000 m\u0026sup2; and is crossed by the Ipiranga stream, whose bed is dammed within the park. The vegetation of the park includes native species from the Cerrado and Atlantic Forest, including large trees. These features give rise to a mosaic of microhabitats characterized by shading, high moisture and abundant organic matter, like as dense litter, ideal conditions for the development of the myxomycetes (Stephenson \u0026amp; Rojas \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The species described here is morphologically distinguished by its globose to subglobose sporophores, nodular capillitium and deeply reticulate spores. These characteristics set it apart from closely related species such as D. \u003cem\u003ecor-rubrum\u003c/em\u003e T. Macbr. and \u003cem\u003eD. crustaceum\u003c/em\u003e Peck, which form a clade with \u003cem\u003eD. brasiliensis\u003c/em\u003e in our phylogenetic analysis but differ in spore ornamentation and capillitial architecture.\u003c/p\u003e\u003cp\u003e\u003cem\u003eD. brasiliensis\u003c/em\u003e also shares traits with \u003cem\u003eD. subdictyospermum\u003c/em\u003e Rostaf, particularly the conspicuous spore spore reticula and robust, anastomosing capillitia (vide Liy and Chen 1999; S\u0026aacute;nchez et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Yamamoto et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). However, \u003cem\u003eD. brasiliensis\u003c/em\u003e can be easily differentiated by its more tortuous capillitia, a higher frequency of amorphous nodules, and slightly smaller spores that lack subreticula.\u003c/p\u003e\u003cp\u003ePhylogenetic inference based on 18S rRNA and mtSSU sequences confirmed the distinct position of \u003cem\u003eD. brasiliensis\u003c/em\u003e from known taxa, reinforcing the importance of integrating morphological and molecular data in species delimitation (Fiore-Donno et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Garc\u0026iacute;a-Mart\u0026iacute;n et al., 2023). However, the latter lacks molecular data in public repositories, precluding its inclusion in the phylogenetic tree and reinforcing the novelty of Notably, \u003cem\u003eD. subdictyospermum\u003c/em\u003e lacks molecular data in public repositories, which precluded its inclusion in our phylogenetic tree and underscores the novelty of our findings.\u003c/p\u003e\u003cp\u003eImportantly, our study goes beyond taxonomic delineation by documenting the complete life cycle of \u003cem\u003eD. brasiliensis\u003c/em\u003e under controlled conditions, a rare approach in the literature, despite its importance for understanding species biology (Borg Dahl et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Poulain et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Observations of phagocytosis of myxamoebae by early formed zygotes, and of ungerminated spores by juvenile plasmodia, highlight trophic plasticity and suggest adaptive mechanisms such as predation and autophagy. These behaviors may confer ecological advantages under resource-limited or competitive environments (Bloomfield \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2018\u003c/span\u003e. Fiore-Donno et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) and raise new questions about the survival strategies of myxomycetes.\u003c/p\u003e\u003cp\u003eWe also observed the assimilation by the plasmodium of pigment from \u003cem\u003eFusarium\u003c/em\u003e cf. \u003cem\u003edecemcellulare\u003c/em\u003e. The plasmodium appeared attracted to fungal hyphae and underwent visible color changes, indicating a possible predatory interaction. This observation opens promising avenues for biotechnological research, particularly concerning the potential of myxomycetes in fungal control, a field still underexplored within protistology. This is especially relevant considering that the genus \u003cem\u003eFusarium\u003c/em\u003e includes species with high phytopathogenic potential (Geiser et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Although scarcely documented in the literature, myxomycete\u0026ndash;fungus interactions such as those observed here may represent a novel and valuable line of investigation for the development of biocontrol strategies.\u003c/p\u003e\u003cp\u003eFinally, the ability to cultivate the species, maintain it in culture, and induce sporulation under laboratory conditions represents a methodological advance that facilitates experimental designs, genomic analysis and studies on physiological and behavioral myxomycete research. This is particularly relevant given the underrepresentation of Neotropical taxa in molecular databases such as GenBank and MycoBank (Fiore-Donno et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Garc\u0026iacute;a-Mart\u0026iacute;n et al., 2023). By including DNA sequences from \u003cem\u003eD. brasiliensis\u003c/em\u003e, this study contributes to expanding the known myxodiversity and mitigating gaps in phylogenetic and biogeographic studies.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study describes \u003cem\u003eDiderma brasiliensis\u003c/em\u003e as a new species of myxomycete, supported by both morphological distinctiveness and robust phylogenetic evidence. Beyond contributing to the taxonomy of the genus \u003cem\u003eDiderma\u003c/em\u003e, the research offers original insights into its life cycle, trophic behavior, and ecological interactions, including signs of autophagy and a possible predatory relationship with a fungus.\u003c/p\u003e\u003cp\u003eThe successful cultivation and induction of sporulation under controlled laboratory conditions represent a methodological advancement, paving the way for future studies on the physiology, genomics, and experimental ecology of this species. Moreover, the deposition of DNA sequences in public databases helps address the underrepresentation of tropical taxa in molecular repositories, thereby strengthening phylogenetic and biogeographic analyses of myxomycetes and contributing to global efforts to map this biodiversity.\u003c/p\u003e\u003cp\u003eAltogether, this work highlights the ecological and scientific relevance of \u003cem\u003eD. brasiliensis\u003c/em\u003e and reinforces the importance of continuing to explore the rich, yet still poorly documented, myxomycete diversity of the Neotropics.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eAcknowlegments\u003c/h2\u003e\u003cp\u003eWe are grateful to the Coordena\u0026ccedil;\u0026atilde;o de Aperfei\u0026ccedil;oamento de Pessoal de Ensino Superior (CAPES), for the funding (Conv\u0026ecirc;nio n\u0026deg; 21-2022) and for Master\u0026rsquo;s scholarship provided to LAT; to the Conselho Nacional de Desenvolvimento Cient\u0026iacute;fico e Tecnol\u0026oacute;gico (CNPq) and to Funda\u0026ccedil;\u0026atilde;o de Amparo \u0026agrave; Pesquisa do Estado de Goi\u0026aacute;s (FAPEG) for providing the PDJ scholarship to LL-S, and to CNPq for the productivity grants to SX-S.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eEthical approval:\u003c/strong\u003e\u003cp\u003eNot applicable\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConsent to participate:\u003c/strong\u003e\u003cp\u003eNot applicable\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConsent to publish:\u003c/strong\u003e\u003cp\u003eAll authors authorise publication\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003ch2\u003eCompeting interests:\u003c/h2\u003e\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding:\u003c/h2\u003e\u003cp\u003eNot applicable\u003c/p\u003e\u003ch2\u003eAuthor contributions:\u003c/h2\u003e\u003cp\u003eLAT: specimen collection, morphological description, molecular biology and phylogeny, writing; LLS: writing, molecular biology and phylogeny; SXS: writing, morphological description.\u003c/p\u003e\u003ch2\u003eData availability statement:\u003c/h2\u003e\u003cp\u003eVoucher is deposited in Fungarium HUEG. The sequences generated in this study are deposited in NCBI GenBank (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/genbank/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/genbank/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAlfaro ME, Zoller S, Lutzoni F (2003) Bayes or bootstrap? A simulation study comparing the performance of Bayesian Markov chain Monte Carlo sampling and bootstrapping in assessing phylogenetic confidence. Mol Biol Evol. 20(2):255\u0026ndash;266. https://doi.org/10.1093/molbev/msg028\u003c/li\u003e\n\u003cli\u003eBarbosa D\u0026Iacute;, Melo TEO, Brayner FA, Cavalcanti LH (2021) \u003cem\u003eDiderma aglomerospora\u003c/em\u003e (Didymiaceae, Physarales, Myxomycetes), a new species from Brazil. Phytotaxa. 494(2):231\u0026ndash;236. https://doi.org/10.11646/phytotaxa.494.2.6\u003c/li\u003e\n\u003cli\u003eBezerra ACC, Cavalcanti LH (2010) \u003cem\u003eDiderma albo-columella\u003c/em\u003e (Myxomycetes), a new species in the Brazilian Atlantic Forest. Rodrigu\u0026eacute;sia. 61(1):105\u0026ndash;108. https://doi.org/10.1590/2175-7860201061111\u003c/li\u003e\n\u003cli\u003eBloomfield G (2018) The evolution of ogres: cannibalistic growth in giant phagotrophs. bioRxiv. 262378. https://doi.org/10.1101/262378\u003c/li\u003e\n\u003cli\u003eBorg Dahl M, Brejnrod AD, Russel J, S\u0026oslash;rensen SJ, Schnittler M (2019) Different degrees of niche differentiation for bacteria, fungi, and myxomycetes within an elevational transect in the German Alps. Microb Ecol. 78(3):764\u0026ndash;780. https://doi.org/10.1007/s00248-019-01347-1\u003c/li\u003e\n\u003cli\u003eFiore-Donno AM, Meyer M, Baldauf SL, Pawlowski J (2008) Evolution of dark-spored Myxomycetes (slime-molds): molecules versus morphology. Mol Phylogenet Evol. 46:878\u0026ndash;889. https://doi.org/10.1111/j.1550-7408.2005.00032.x\u003c/li\u003e\n\u003cli\u003eFiore-Donno AM, Novozhilov YK, Meyer M, Schnittler M (2011) Genetic structure of two protist species (Myxogastria, Amoebozoa) suggests asexual reproduction in sexual amoebae. PLoS ONE. 6(8):e22872. https://doi.org/10.1371/journal.pone.0022872\u003c/li\u003e\n\u003cli\u003eGarc\u0026iacute;a-Martin JM, Zamora JC, Lado C (2023) Multigene phylogeny of the order Physarales (Myxomycetes, Amoebozoa): Shedding light on the dark-spored clade. Persoonia. 51:89\u0026ndash;124. https://doi.org/10.3767/persoonia.2023.51.02\u003c/li\u003e\n\u003cli\u003eGeiser DM, Aoki T, Bacon CW, Baker SE, Bhattacharyya MK, Brandt ME, Zhang N (2013) One fungus, one name: defining the genus Fusarium in a scientifically robust way that preserves longstanding use. Phytopathology. 103(5):400\u0026ndash;408. https://doi.org/10.1094/PHYTO-07-12-0150-LE\u003c/li\u003e\n\u003cli\u003eKalayaanamoorthy S, Minh BQ, Wong TKF, Von Haeseler A, Jermiin LS (2017) ModelFinder: fast model selection for accurate phylogenetic estimates. Nat Methods. 14(6):587\u0026ndash;589. https://doi.org/10.1038/nmeth.4285\u003c/li\u003e\n\u003cli\u003eKatoh K, Standley DM (2013) MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol Biol Evol. 30(4):772\u0026ndash;780. https://doi.org/10.1093/molbev/mst010\u003c/li\u003e\n\u003cli\u003eKornerup A, Wanscher JH (1978) Methuen Handbook of Colour. 3\u0026ordf; ed. Methuen, Londres\u003c/li\u003e\n\u003cli\u003eLado C, Trevi\u0026ntilde;o-Zevallos I, Garc\u0026iacute;a-Mart\u0026iacute;n JM, Wrigley de Basanta D (2022) \u003cem\u003eDiachea mitchellii\u003c/em\u003e: a new myxomycete species from high elevation forests in the tropical Andes of Peru. Mycologia. 114(4):798\u0026ndash;811\u003c/li\u003e\n\u003cli\u003eLi P, Wu Z, Liu T, Wang Y (2016) Biodiversity, phylogeny, and antifungal functions of Endophytic Fungi associated with \u003cem\u003eZanthoxylum bungeanum\u003c/em\u003e. Int J Mol Sci. 17:1541. https://doi.org/10.3390/ijms17091541\u003c/li\u003e\n\u003cli\u003eLi X, Tuo Y, Hu J, Li Y, Dai D, Sossah FL, Wang J, Guo Y, Liu S, Ma H, Zhang B, Li X, Li Y (2024) New species, new records, and common species of \u003cem\u003eDiderma\u003c/em\u003e (Physarales, Didymiaceae) from China. Microbiol Spectr. 0:e01265-24. https://doi.org/10.1128/spectrum.01265-24\u003c/li\u003e\n\u003cli\u003eLiu CH, Chen YF (1999) Myxomycetes of Taiwan\u0026mdash;XII. New records and newly rediscovered species. Taiwania. 44(3):368\u0026ndash;375. https://doi.org/10.6165/tai.1999.44(3).368\u003c/li\u003e\n\u003cli\u003eMoreira IC, Leonardo-Silva L, Xavier Santos S (2025) \u003cem\u003eDiderma laiseae\u003c/em\u003e (Didymiaceae, Physarales), a new species of Myxomycetes from Brazil. Phytotaxa. 682(2). https://doi.org/10.11646/phytotaxa.682.2.8\u003c/li\u003e\n\u003cli\u003eNovozhilov YK, Rollins AW, Shchepin ON, Schnittler M (2022) Ecology and distribution of Myxomycetes. Em: Rojas C, Stephenson SL (orgs.) Myxomycetes: Biology, Systematics, Biogeography, and Ecology. 2\u0026ordf; ed. Academic Press, pp. 325\u0026ndash;376. https://doi.org/10.1016/B978-0-12-824281-0.00010-5\u003c/li\u003e\n\u003cli\u003ePersoon CH (1794) Neues Magazin f\u0026uuml;r die Botanik in ihrem ganzen Umfange - \u003cem\u003eDiderma\u003c/em\u003e. 1:89. p. 336\u003c/li\u003e\n\u003cli\u003ePoulain M, Meyer M, Bozonnet J (2011) Les Myxomycetes. F\u0026eacute;d\u0026eacute;ration mycologique et botanique Dauphin\u0026eacute;-Savoie, S\u0026eacute;vrier\u003c/li\u003e\n\u003cli\u003ePrikhodko IS, Shchepin ON, Bortnikova NA, Novozhilov YK, Gmoshinskiy VI, Moreno G, Lopez-Villalba A, Stephenson SL, Schnittler M (2023) A three-gene phylogeny supports taxonomic rearrangements in the family Didymiaceae (Myxomycetes). Mycol Prog. 22:11. https://doi.org/10.1007/s11557-022-01858-1\u003c/li\u003e\n\u003cli\u003eS\u0026aacute;nchez A, Moreno G, Illana C (2002) \u003cem\u003eDiderma cristatosporum\u003c/em\u003e, a nivicolous Myxomycete from Spain. Persoonia. 17(4):643\u0026ndash;647\u003c/li\u003e\n\u003cli\u003eSchrader HA (1797) Nova Genera Plantarum - \u003cem\u003eDidymium\u003c/em\u003e. p. 1\u0026ndash;32. Dispon\u0026iacute;vel em: https://www.biodiversitylibrary.org/page/12930554\u003c/li\u003e\n\u003cli\u003eStaden R, Beal KF, Bonfield JK (1998) The Staden package. Em: Misener S, Krawetz SA (orgs.) Bioinformatics Methods and Protocols. The Humana Press, pp. 115\u0026ndash;130\u003c/li\u003e\n\u003cli\u003eStephenson SL, Rojas C (2017) Myxomycetes: Biology, Systematics, Biogeography and Ecology. Academic Press\u003c/li\u003e\n\u003cli\u003eTamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular evolutionary genetics analysis version \u003cem\u003e6.0\u003c/em\u003e. Mol Biol Evol. 30(12):2725\u0026ndash;2729. https://doi.org/10.1093/molbev/mst197\u003c/li\u003e\n\u003cli\u003eYamamoto Y, Kimura T, Degawa Y (2006) A tropical slime mold,\u003cem\u003e Diderma subdictyospermum,\u003c/em\u003e new to Japan. Bull Kanagawa Prefect Mus Nat Sci. (35):33\u0026ndash;34\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"mycological-progress","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mypr","sideBox":"Learn more about [Mycological Progress](https://www.springer.com/journal/11557)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mypr/default.aspx","title":"Mycological Progress","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Cultivation, dark spores, myxodiversity, new taxa, ribosomal RNA","lastPublishedDoi":"10.21203/rs.3.rs-7222482/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7222482/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003eDiderma brasiliensis\u003c/em\u003e was found during a myxodiversity survey in Central Brazil, occurring abundantly on decomposing fallen trunks, leaf litter, and on the stems and leaves of the climbing plant \u003cem\u003eEpipremnum aureum\u003c/em\u003e. It has globose to subglobose sporophores with reticulate spores and tortuous capillitia with nodular insertions, the latter two being very distinctive features of the species. In addition to these unique morphological traits, the proposal of this new species is phylogenetically supported by the 18S rRNA and mtSSU DNA regions. We also investigated its life cycle and cultivation strategies, recording the different stages of development and behavior, and we report a possible predatory interaction between the plasmodium of D. brasiliensis and the fungus Fusarium cf. decemcellulare. Although it shares similarities with other species of the genus, such as \u003cem\u003eD. cor-rubrum\u003c/em\u003e, \u003cem\u003eD. crustaceum\u003c/em\u003e, and \u003cem\u003eD. subdictyospermum\u003c/em\u003e, \u003cem\u003eD. brasiliensis\u003c/em\u003e is distinguished by the shape of its sporophore and capillitium, characterized by the presence of amorphous nodules and deeply reticulated spores. This study expands the knowledge of Neotropical myxomycetes and provides new insights into cultivation methods and ecological interactions.\u003c/p\u003e","manuscriptTitle":"Phylogeny, taxonomy and life cycle of Diderma brasiliensis (Physarales, Didymiaceae): a new species of myxomycete","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-13 09:11:04","doi":"10.21203/rs.3.rs-7222482/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-08-09T06:02:14+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-08-07T13:00:04+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"Mycological Progress","date":"2025-08-07T11:32:06+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-31T15:10:41+00:00","index":"","fulltext":""},{"type":"submitted","content":"Mycological Progress","date":"2025-07-28T10:47:27+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"mycological-progress","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mypr","sideBox":"Learn more about [Mycological Progress](https://www.springer.com/journal/11557)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mypr/default.aspx","title":"Mycological Progress","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"39d635bf-05cf-428a-8208-deda0a0306a3","owner":[],"postedDate":"August 13th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2025-08-13T09:11:04+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-13 09:11:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7222482","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7222482","identity":"rs-7222482","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00