Protective Effects of Antimicrobial Peptide Microcin J25 (MccJ25) Isolated from Escherichia coli against Breast Cancer Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Protective Effects of Antimicrobial Peptide Microcin J25 (MccJ25) Isolated from Escherichia coli against Breast Cancer Cells Saman Shalibeik, Fereshte Ghandehari, Ali-Mohammad Ahadi, Ali-Asghar Rastegari, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3984143/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Introduction: Microcins are Antimicrobial peptides (AMPs) with low molecular weight, which are produced by Enterobacterales and have broad-spectrum antibacterial activity. They can selectively replace common cancer treatments in cancer cells with less side effects and higher effectiveness. Given the aforementioned context, the present study endeavors to examine the antitumor activity of microcins isolated from of the Enterobacterales . Material and Methods In total, 120 Enterobacterales isolates were examined after identification. Subsequently, the bacteria were subjected to an agar diffusion test to assess their antibacterial efficacy. Positive isolates were further examined for the presence of Mccj25 using PCR. The cytotoxic effects of isolates harboring the microcin gene were explored using quantitative real-time PCR (RT-qPCR) and the MTT test on breast cancer cells. Additionally, the expression levels of BCL2 and STAT3 genes were evaluated, and apoptosis was quantified using flow cytometry. The repair rate of normal cells was determined using a scratch assay. Results The findings obtained from the phenotypic and biochemical assays have duly verified and established the categorization of the Enterobacterales . After conducting the agar diffusion test, a total of 25 isolates of Escherichia coli and Klebsiella pneumoniae displaying inhibition zones were chosen as suitable specimens possessing AMPs. Urinary E. coli was identified as isolate 83. The analysis conducted on the expression of the Mccj25 gene within the aforementioned isolates indicated that isolate 83 exhibited significant expression of the Mccj25 gene. Conclusion The extract obtained from this isolate on the breast cancer cell line exhibited the most significant degree of toxicity after precisely 48 h. Furthermore, the treatment of breast cancer cells with isolate 83 showed that the rate of apoptosis was about 86%, and the expression of BCL2 and STAT3 genes decreased. Moreover, it potentiated the reparative ability of normal fibroblast cells. They resulted in growth suppression of breast cancer cells and elicited an escalated rate of cellular demise via the apoptosis pathway. Antimicrobial Peptides (AMPs) Microcin Breast Cancer Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 1. Introduction Breast cancer is the most common and deadliest cancer affecting women worldwide. Despite notable advancements in treatment, the outlook for patients with metastatic breast cancer remains severely constrained. This is mainly due to the development of resistance to traditional chemotherapy for breast cancer and inadequate precision in targeting within current cancer treatment methods [ 1 , 2 ]. Accordingly, the use of medicinal drugs with fewer side effects has received considerable attention in recent years. Antimicrobial peptides (AMPs) are a class of anti-cancer peptides. AMPs have a wide range of antibacterial, antiviral, antifungal, and anticancer properties, and are part of the intrinsic resistance to microorganisms [ 3 ]. AMPs, members of the class of anticancer peptides, are among these substances. AMPs have a wide range of antibacterial, antiviral, antifungal, and anticancer properties and are part of the intrinsic resistance reaction to microorganisms [ 3 ]. Numerous studies have reported the use of AMPs against cancer cells, including breast, lung, lymphoma, leukemia, and myeloma cells [ 4 ].. E. coli bacteriocins are divided into colicins (25–80 kDa) and microcins (1–10 kDa) based on their molecular weight [ 5 , 6 ]. Microcins possess an advantage over colicins as they do not pose lethality to the strains that produce them. [ 7 ]. There are two types of microcins. Class I microcins have a molecular mass of less than 5 kDa and are highly post-translationally modified, which include microcin B17 (MccB17), MccJ25, MccC7/C51, and MccD93. In contrast, class II peptide microcins are larger (5–10 kDa) and are further divided into two subclasses, IIa and IIb. Accordingly, subclass IIa does not require post-translational modifications, but can contain disulfide bonds, including the plasmid-mediated microcins MccL, MccV, and MccS, and siderophore bacteriocins, known as class IIb microcins, including MccE492, MccM, MccI47, and MccH47 [ 8 ]. The significance of utilizing microcins as possible alternatives to antibiotics is attributable to the absence of bacterial resistance to these AMPs [ 9 ]. In addition to their antimicrobial properties, microcins have antitumor functions and can act through various mechanisms such as apoptosis, necrosis, and pore creation in the target cell membrane, thereby inhibiting angiogenesis and activating the immune system against cancer cells [ 10 ]. Recently, researchers have exhibited significant interest in the potential use of microcins for cancer treatment because of their selective nature, which results in higher efficacy and minimal adverse effects. [ 9 , 10 ]. MccJ25 is a 21-amino acid peptide produced by some Enterobacterales, especially E. coli , and has a stable structure to avoid degradation by proteases in the digestive tract [ 8 ]. MccJ25 has antimicrobial activity and as a membrane-active peptide, it causes the death of eukaryotic cells by destroying cytochrome c [ 11 , 12 ]. Against this background, in the current study, we examined how breast cancer cells respond to isolated MccJ25 from E. coli . 2. Materials and Methods 2.1. isolate collection, culture, and identification E. coli were isolated and confirmed from urine samples obtained from private laboratories. In brief, 120 Enterobacterales isolates were cultured on blood agar and eosin methylene blue at 35°C for 18–24 h. Next, E. coli isolates were identified and isolated using different phenotypic characteristics and biochemical tests, including Voges Proskauer (VP), Oxidative-Fermentative (OF), Urease, Oxidase, Methyl Red, Catalase, Simon Citrate, Triple Sugar Iron Agar, and the Sulfide Indole Motility test. 2.2. Evaluation of antimicrobial activity using the agar diffusion assay A total of 120 isolates were evaluated in terms of antimicrobial activity by the agar diffusion assay (wells, disk diffusion, and unique well diffusion). First, the E. coli ATCC 25922 strain was inoculated on LB agar plates. After the overnight culture of the bacteria, a supernatant of the clinical isolates was inoculated in the wells created in the culture medium, which was incubated at 37°C for 24 h. The supernatant of clinical isolates was obtained by centrifuging 24 h cell-free supernatants (CFS) cultures of E. coli isolates at 12,000 g for 10 m at 4°C. In addition, antibacterial activity was measured through the creation of clear zones or growth inhibition zones, using a vernier caliper, having been reported in mm [ 13 ]. 2.3. PCR-based screening for MccJ25 production and identification The microcin-producing isolate was identified using 16S rRNA gene (Pishgam Iran Company) sequencing to determine its sequence. The obtained sequence was then analyzed using Chromas v 2 software and subjected to homology analysis via the BLAST server [ 14 ]. Moreover, MccJ25-producing strains were additionally distinguished through PCR-based screening employing specific primers designed. Specifically, MccJ25 primers, MccJ25 F (ATGGAACTTCTTGTACTTGTCTG) and MccJ25 R (CATCCAGATAGCCGTTACCAGC), were formulated using Gene Runner software (V.6.5.52). To ensure precise determination of the product size obtained, acrylamide gel electrophoresis coupled with silver nitrate staining was employed. 2.4. Microcin isolation The cell-free culture supernatant (crude bacteriocin) was saturated with 70% ammonium sulfate and kept at 4°C to precipitate proteins. Following this, the pellet was obtained by centrifugation at 10,000 ×g at 4°C for 30 minutes. Additionally, the residue was dissolved in phosphate buffer (0.1 M, pH 7.0) and dialyzed overnight at 4°C using the same buffer. Subsequently, the dialyzed protein was loaded onto a Sephadex G-100 column (1.6 × 36 cm) previously equilibrated with a phosphate buffer (pH 7.0). The flow rate was set at 24 ml/h, and fractions (1 ml each) were collected. Those fractions exhibiting significant bacteriocin activity were combined and concentrated using a lyophilizer. Finally, the purity of the protein was assessed via sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), while the protein concentration was determined using the Bradford method [ 15 – 21 ]. 2.5. Cell lines The MCF-7 C135 breast cancer cell line and Fibroblast cell line L929 were procured from the Pasture Institute of Iran, Tehran. Next, MCF-7 and Fibroblast cells were cultured in the Roswell Park Memorial Institute (RPMI). Gibco RPMI 1640 Medium (Cat No: 11875093) was supplemented with FBS 10%, 100 IU. mL-1 penicillin, and 100 µg. mL-1 streptomycin in a humidified atmosphere (5% CO2) at 37°C [ 16 ]. 2.6. Cell morphology and MTT cytotoxicity assay Cytotoxicity effects of Mccj25 on MCF-7 breast cancer cells were evaluated by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay. When the cells reached 85% confluence, 1 × 10 4 cells/well were seeded in 96 well plates by the complete media and incubated at 37°C in 5% CO 2 atmosphere overnight. Next, the cells were treated with the serial dilution of semi-purified Mccj25 within the concentration range (0-2.5 µg/ml) in 24, 48 and 72 h. The control group included cells that experienced no treatment. Cell morphology was observed, followed by incubation with 20 µl of MTT solution (5 mg/mL) at 37°C for 3 h. Subsequently, dimethyl sulfoxide (DMSO) was added to dissolve the MTT-formazan crystals, and the absorbance was read at 570 nm using a microplate reader. [ 17 – 19 ]. In addition, the cell survival percentage was obtained using the following equation: % Cell viability = Absorbance in drug-treated wells/Absorbance in the negative control well × 100 2.7. Apoptosis assays The induction of apoptosis in MCF-7 cells following exposure to Mccj25 was examined by flow cytometry. For this purpose, 2 × 10^5 cells were seeded overnight in individual wells of 6-well plates. Next, the cells were incubated at the concentrations of 1.218 and 0.609 µg/mL of semi-purified Mccj25 for 48 h. After a specified time, the cells were trypsinized, rinsed, and resuspended in an appropriate volume of cold phosphate buffered saline (PBS) for analysis. The treated cells were stained using the Annexin V FITC/propidium iodide (PI) kit (from BD USA) and analyzed by FlowJo software [ 18 – 19 ]. 2.8. Measurement of STAT3 and BCL2 gene expression The expression levels of STAT3 and BCL2 genes in MCF-7 cells treated with Mccj25 were investigated using quantitative real time PCR (RT- qPCR ). After culturing cells in 6-well plates for 24 h, they were treated with Mccj25 for 48 h. At the next step, RNA extraction from the cells was performed by a kit (Cat No: 4368814) as per the manufacturer's instructions. After checking the quality of the RNA via NanoDrop and gel electrophoresis, total RNA was produced by the cDNA synthesis kit (Addbio Company) and stored at -20°C. Next, using specific primers, as Table 1 showed, which were designed by Gene Runner software, the expression of STAT3 and BCL2 genes were investigated using quantitative real time PCR (RT- qPCR ) and the SYBR-Green fluorescence method (Biofact Company) [ 19 ]. Table 1 Real-time RT-PCR primers and their specifications Name Sequence Amplicon Target gene Accession number F- β-actin 5’-CACCCGCCGCCAGCTCACC-3’ 124bp β-actin NM_001101.5 R- β-actin 5’- CACGATGGAGGGGAAGACGG-3’ F-STAT3 5’-GCCGGAGAAACAGCAGGATG-3’ 131bp STAT3 NM_001369514.1 R-STAT3 5’-AATCCAAGGGGCCAGAAACTG-3’ F-BCL2 5’- TGGCCTTCTTTGAGTTCGGTG-3’ 126bp BCL2 NM_000633.2 R-BCL2 5’- GGATCCAGGTGTGCAGGTGC-3’ 2.9. Scratch test for determining the effect of MccJ25 on normal cell migration Cell migration was assessed using the scratch assay method. Fibroblast cells were cultured in 6-well plates until they reached 95% confluence. Subsequently, the wells were scratched using a sterile pipette tip and rinsed twice with PBS. Fresh medium was then added to the wells, and the cells were stimulated with Mccj25 at concentrations of 0.14, 0.29, 0.59, 1.18, and 2.37 mg/ml at 0, 24, and 48 hours. Furthermore, images of cell migration post-treatment were captured using a phase-contrast microscope and analyzed using Image J software. [ 20 ]. 2.10. Statistical analysis The Smirnov-Kolmograph test was performed to determine whether data were normally distributed. To calculate significance of data in normal distribution, T-Test were used. In addition, the Whitney-Mann non-parametric test was used for data with non-normal distribution. The one-way ANOVA test was used to check the results of the tests and compare the average data. Besides, the Tukey's multiple comparisons test was utilized for the one-way analysis of variance. It is worth noting that each test was repeated three times, and the values were reported as mean ± standard deviation. In fact, the results were statistically significant at P ≤ 0.05. 3. Results 3.1. Identification and characterization of isolates As previously stated, among 120 clinical isolates, 85 isolates of E. coli were identified and verified. Besides two isolates of E. coli showed by PCR the highest similarity to Mccj25. In this study, isolate 83 was examined as well [ 13 ]. Confirmatory tests for E. coli bacteria showed that clinical isolates isolated by the O/F test (positive, yellow), the citrate test (negative, green), and the TSI test (positive, acid-acid, positive gas, yellow) were identified. The other tests included the SIM test (positive, positive movement, positive indole), the MR test (positive, red), the VP test (negative), the oxidase test (negative, no color change), and the urea test (negative, yellow) [ 14 ]. 3.2. Antibacterial activity of E. coli clinical isolates Antimicrobial activity of Enterobacterales clinical isolates against the standard E. coli 25922 strain was investigated by the diffusion method in agar using wells. The results showed that 25 out of 120 Enterobacterales isolates, (17 E. coli and 8 K. pneumoniae ) were inhibited the growth of standard bacteria after 24 h. This was shown by the growth inhibition zones that indicated the antibacterial activity of this isolates. Figure 1 showed the related example. 3.3. Examining the isolates in terms of MccJ25 gene expression To identify the clinical isolates as MccJ25, the isolates with a positive well test were used to confirm the MccJ25 gene using specific primers and the PCR technique. Our results demonstrated that among 25 isolates with antibacterial activity, 2 E. coli isolates (83 and 58)expressed the MccJ25 gene, and isolate 83 was used to continue the study. In addition, the size of the obtained product using the acrylamide gel which confirmed the presence of the MccJ25 gene (Fig. 2 ). Furthermore, 16S rRNA gene sequencing, conducted to further identify the isolate producing MccJ25, showed the highest homology between isolate 83 and E. coli, which was registered in the NCBI Genome Bank under accession number OM333624 (Fig. 3 ). Besides, sequencing was performed to check the MccJ25 gene extracted from E. coli isolate 83, which was registered in the NCBI Genome Bank under accession number OP947098. 3.4. Isolated MccJ25 and its validation To isolate the crude MccJ25 protein, after culturing and lysing the desired bacterial isolate, the crude MccJ25 protein was analyzed in terms of the protein size. Our results showed that the size of the crude MccJ25 protein extracted via SDS-PAGE gel electrophoresis was about 2.1 kDa (The only band under 10 kDa). Besides, the extracted crude MccJ25 protein was dialyzed to remove ammonium sulfate salt (Fig. 4 ). Additionally, the crude concentration of the purified MccJ25 protein was 4.863 µg/mL, which was checked via the Bradford method. 3.5. Cytotoxicity effects of MccJ25 against MCF-7 cancer cell lines The examining of cell morphology showed that lethal effects of MccJ25 on MCF-7 cells reduced cell density and caused a change in cell appearance. In addition, the results showed that the amount of IC 50 of MccJ25 in breast cancer cells amounted to 1.397, 1.218, and 1.464 mg/mL in 24, 48, and 72 h, respectively. Moreover, the analysis of the cytotoxicity of MccJ25 revealed that the MCF-7 cell line exhibited the highest level of toxicity after 48 hours, with a concentration of 1.218 mg/ml. (Fig. 5 ). 3.6. Effects of MccJ25 on apoptosis of MCF-7 cells Flow cytometry was used (Fig. 6 ) to determine the percentage of apoptotic cells in the MCF-7 cell population treated with the crude MccJ25 protein extracted from the E. coli bacteria (isolate 83) at two different concentrations, which were compared with the control cell population (without treatment). The results showed that MCF-7 cells treated with the crude MccJ25 protein after 24 h, at concentrations of 0.609 and 1.218 µg/ml caused apoptosis of 45.4 and 86%, respectively. In addition, the increase in the crude concentration of the MccJ25 protein enhanced the rate of apoptosis, which could be dose-dependent. 3.7. Effects of MccJ25 on the expression of BCL2 and STAT3 genes The expression of BCL2 and STAT3 genes in MCF-7 cells treated with MccJ25 (extracted from E. coli isolate 83) was performed by the real-time PCR. Our results indicated that both BCL2 and STAT3 genes experienced a significant decrease in the cells exposed to MccJ25, compared to the control group in 48 h. 3.8. Effects of MccJ25 on the repair of damaged normal cells through migration Cell migration was investigated by the scratch method. After culturing fibroblast cells and treating them with the MccJ25 crude protein, we examined the cell migration images using phase contrast microscopy. Accordingly, after 24 and 48 h, the scratch size was measured and compared between the control and treatment groups using Image J software. The results obtained using SPSS software were compared statistically as described below.(Fig. 8 ) The results showed an increase in the migration and repair of scratched fibroblast cells after treatment with the MccJ25 crude protein purified from isolate 83, in 24 and 48 h from exposure, compared to the control sample in normal fibroblast cells. In other words, the treatment of fibroblast cells with the MccJ25 crude protein from isolate 83 reduced scratch length.(Fig. 9 ) 4. Discussion In recent years, there has been considerable focus on the anti-tumour activity of antimicrobial peptides (AMPs)[ 22 ]. Therefore, in the present study, after isolating and confirming the presence of AMPs (MccJ25), their effects on breast cancer cells as well as their regenerative activity in normal cells were investigated. Microcins originating from Enterobacteriaceae represent ribosomally synthesized and post-translationally modified peptides (RiPPs) that demonstrate antimicrobial properties through the targeting of vital biological enzymes. For instance, MccJ25, a 21-amino acid peptide, exerts its inhibitory effects on the growth of Gram-negative bacteria primarily by targeting their RNA polymerase (RNAP) activity. This peptide has been shown to possess antimicrobial efficacy against Salmonella and Shigella. Initially isolated from Escherichia coli AY25 strains obtained from neonatal feces, MccJ25 exhibits a distinctive structure characterized by an atypical 8-amino acid ring and a lasso loop configuration[ 23 ]. MccJ25 exhibits potent bactericidal activity, effectively inducing rapid mortality across various growth phases of pathogens. Its efficacy extends to combating foodborne pathogens in diverse food matrices, such as meat, dairy, and yogurt. Furthermore, MccJ25 exhibits stability in a range of biological fluids, such as serum and simulated gastrointestinal fluids. Targeting the cytoplasmic membrane of Salmonella newport cells causes the cytoplasmic membrane gradient to be disrupted, which is the mechanism of action. Its extended duration of activity in a variety of settings and biological fluids is confirmed by stability investigations. The combined results highlight MccJ25's potential as a workable substitute for conventional antibiotics in treating drug-resistant illnesses[ 24 , 25 ]. Many studies found that MccJ25 exhibited excellent activity against ETEC due to permeabilizing bacterial membranes and strong affinity. MccJ25 has also been found to inhibit ETEC-induced intestinal injury and intestinal inflammatory responses, suggesting its potential application as an excellent antimicrobial or anti-inflammation agent against pathogen infection[55].The Minimum Inhibitory Concentration (MIC) of MccJ25 against ETEC-sensitive strains is quite low, with the lowest MIC value being 0.03 µg/mL for E. coli K99 and E. coli 987P . Nevertheless, the search results do not explicitly mention the MIC variability of MccJ25 against ETEC-sensitive and Multidrug-Resistant (MDR) strains[ 26 ]. First, a total of 120 isolates were identified after being isolated from patients and identified via culture and biochemical assays. Antibacterial activity results from the E. coli and K. pneumoniae isolates indicated that 25 isolates had a clear growth-inhibiting zone. Moreover, the presence of the inhibition zone revealed the absence of standard bacteria growth in the presence of these isolates, which was considered antibacterial activity, with a variety of studies that have investigated the role of bacteriocins in inhibiting bacterial growth[ 27 ]. Examination of isolates having antibacterial activity, in terms of expression of the MccJ25 gene, showed that isolate 83 expressed this gene, so it was regarded as a microcin. Furthermore, the 16S rRNA sequence recorded in the NCBI database showed a strong homology of the selected isolate with E. coli . In alignment with our empirical research, Madboly et al accomplished the isolation and identification of a bacteriocin originating from Enterococcus thailandicus through the utilization of 16S rRNA, subsequently archiving the discovery on the NCBI database [ 28 ]. In other research, Mandal et al investigated the 16S rRNA gene of produced antimicrobial lipopeptides by Citrobacter and Enterobacter from soil isolates contaminated with feces and investigated them using HPLC analysis. The result of their study exhibited the presence of multiple antimicrobial lipopeptides [ 29 ]. Upon verification of isolate 83 for the existence of the MccJ25 gene, the designated isolate underwent a protein extraction process, followed by analysis to ascertain the presence of the MccJ25 protein. In the present study, Our SDS-PAGE analysis results showed that the MccJ25 protein was present at 4.6 kDa, confirming the presence of the MccJ25 protein. In addition, the quantity of protein was determined by the Bradford method so that suitable concentrations could be used for other experiments. Several studies have demonstrated the potential of bacterial-based therapy in overcoming tumour cell resistance, presenting it as a viable alternative to traditional treatment modalities. Investigation into the mechanisms underlying immune cell-mediated cancer cell destruction has significantly contributed to the development of novel therapies, including bacterial-based immunotherapy. The exploration of bacterial-based cancer therapy has encompassed the utilization of various strains, such as Salmonella enterica serovar Typhimurium and Clostridium novyi-NT, revealing promising efficacy in combatting cancer[ 30 ]. It is noteworthy that the exceptional stability of Microcin J25 is attributed to its threaded sidechain-to-backbone ring structure. The lasso configuration of Microcin J25 imparts remarkable resistance to severe thermal, pH, and protease degradation, encompassing chymotrypsin, trypsin, and pepsin[ 31 ]. Due to their unique structural characteristics, bacteriocins have strong biological properties, such as the differentiation of cancer cells from non-cancer ones as well as antitumor activity [ 32 ]. The cytotoxic effects of E. coli . The efficacy of MccJ25 obtained from E. coli on MCF-7 breast cancer cells was assessed throughout 24, 48, and 72 h. The results showed the highest cytotoxicity (lowest IC 50 ) of 1.081 µg/ml for MccJ25 concentration in 72h on MCF-7 cell lines, showing the highest significance among other concentrations at different times. As a result, microcins increased cancer cell mortality in a concentration-dependent manner. Consistent with our results, Chen et al indicated that the effect of H1-GW antimicrobial peptides inhibited the viability of liver cancer cell lines, such as (J5 HCC, Huh7, and Hep3B), in a dosage-dependent fashion. In contrast, normal fibroblast cells 3T3 exhibited markedly lower susceptibility to these antimicrobial peptides (AMPs) [66]. Additionally, the effect of 1CEa-Temporin as an antimicrobial peptides (AMPs), elicited cytotoxicity in a dose-dependant manner in human breast cancer cell lines, namely 231-MB-MDA and MCF-7 [ 33 ]. In a related investigation, MccJ25's cytotoxic effects on HT-29 human colorectal adenocarcinoma cell line were assessed via MTT assay. Results revealed that after 24 h of peptide exposure, HT-29 cell viability was at 83%, suggesting a minimal impact of the microcin on cancer cells [ 15 ]. Furthermore, an investigation regarding the treatment of RAW 264.7 and Caco-2 cells at varying levels of MccJ25 exhibited no statistically significant variations in the survival of cells and LDH-stimulating activity when compared to the control groups [56]. Soudy et al showed that MccJ25 caused no significant cytotoxicity in MCF-7 and MDA-MB-435 cells, while the MccJ25-18-4 (the breast cancer targeting peptide) conjugated to inhibit breast cancer cell growth [ 34 ]. Flow cytometry was used to determine the amount of cell apoptosis in MCF-7 breast cancer cells treated with isolate 83, in comparison with the population of control cells (without treatment). The current study's findings denote the confirmed initiation of apoptosis in MCF-7 cells upon treatment with compound 83. Within 24 hours of exposure to concentrations of 0.609 and 1.218 µg/ml, a marked induction of apoptosis occurred by 45.4% and 86%, respectively. Gaspard et al. posit that the anticancer properties of antimicrobial peptides (AMPs) can be largely attributed to their capacity for electrostatic interactions with the anionic membrane of cancer cells. This capability affords selective elimination of cancer cells[ 35 ]. Different studies have shown the effect of nisin on the induction of apoptosis into different cancer cells [ 35 ]. As an anti-apoptotic gene, the BCL2 gene regulates the apoptotic pathway. In addition, STAT3 proteins are contextually activated to respond to growth factors, cytokines or other polypeptide ligands. Moreover, they play a significant role in fundamental processes, including proliferation, development, differentiation, inflammation, and apoptosis. The findings indicated a decline in the manifestation of BCL2 and STAT3 genes relative to the control cohort, thereby validating the outcomes of the apoptotic process that instigates heightened cellular mortality[ 36 ]. After examining the effect of nisin on the stimulation of apoptosis in colon cancer cell lines, Ahmadi and colleagues discovered that the presence of nisin led to an induction of cell survival, as well as an increase in the expression of both BCL2 and BAX genes and proteins. Consequently, it was deduced that nisin has the potential to elicit apoptosis via intrinsic pathways, thereby leading to the death of cancerous cells [ 37 ]. Cell migration or the ability to repair physical damage was investigated by the scratch test in fibroblast cells. Therefore, in case of damage, normal cells of the animal's body were able to repair the physical damage, along with the capacity of cell migration. Medications capable of stimulating the motor effects of normal cells and making them perform the migration more quickly could be effective in repairing physical damage. This effect could be influenced by modifying the factors contributing to a faster division, thus filling the empty spaces at a faster pace. The results of our study demonstrate a significant upsurge in both cellular migration and repair capabilities following administration of purified proteins derived from isolate 83 in 24 and 48 h after exposure, as compared to the control sample in normal fibroblast cells. The present findings demonstrate the efficacy of the aforementioned peptide in repairing injured tissues as well as its favorable impact on viable cells. The analysis conducted by Soltani et al on hemolysis revealed that rat red blood cells were subject to lysis at concentrations exceeding 52 µg/ml by pediocin 1-PA, bactofencin A, and nisin. It was observed that MccJ25 did not exhibit any detrimental effects on these cells, which suggests that it does not pose a threat to the well-being of healthy cells. In addition, another study reported that MccJ25 had no adverse effects on normal human epidermal keratinocyte (NHEK) primary cells, with confirmed safety [ 38 ]. Pourahmadi et al , measured the impact of new BMAP27-Melittin conjugated peptide-nanoparticle against clinical isolates of Streptococcus mutans . The Biofilm Inhibitory Concentration (BIC) and Biofilm Eradication Concentration (BEC) of BMAP27-Melittin-NP against S. mutans were 2.1 and 3.8µg/mL. BMAP27-Melittin-nanoparticles demonstrated significant antibacterial and anti-biofilm effects against S. mutans [ 39 ]. 5. Conclusions The microcin isolated from the patients’ isolates that showed expression at the Microcin J25 (MccJ25) gene. BCL2 and STAT3 genes experienced a significant decrease in the cells exposed to MccJ25. However, MccJ25 inhibited the growth of cancer cells in breast cancer cells and increased their death rate in the apoptosis pathway, so that the MCF-7 cells treated with the crude MccJ25 protein. According to the present research found that MccJ25, as an antimicrobial peptide, induced a positive effect on migration and repair of normal cells, such as fibroblasts. Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Availability of data and materials: The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request Funding Not applicable. Authors' contributions SSH, FGH, AMA, AAR and MGH: Conceived, designed and supervised the study and revised the manuscript; SSH and MGH: Collected and searched the data; SSH: Drafted the manuscript. Acknowledgements Not applicable. Conflicts of Interest The authors declare that there are no conflicts of interest regarding the publication of this article. References Torre LA, Bray F, Siegel RL et al (2015) Global cancer statistics, 2012. CA Cancer J Clin 65(2):87–108 Mohammadzadeh Rostami F, Moghim S, Javdan S, Nasr Esfahani B (2023) Antimicrobial Efficacy and Prevalence of Microcins: Low Molecular Mass Bacteriocins Produced by Escherichia coli. Int J Pept Res Ther 29(5):74 Zare-Zardini H, Salehvarzi M, Ghanizadeh F et al (2018) Antimicrobial Peptides of Innate Immune System as a Suitable Compound for Cancer Treatment and Reduction of its Related Infectious Disease. Iranian J Pediatr Hematology Oncology, 8, 1 Tehrani MM, Erfani M, Amirmozafari N et al (2019) Evaluation of 99m Tc-MccJ25 peptide analog in mice bearing B16F10 melanoma tumor as a diagnostic radiotracer. Asia Ocean Journal Nuclear Med Biology, 7, 2, pp.172 Thundimadathil J (2012) Cancer treatment using peptides: current therapies and future prospects, Journal of amino acids , ;2012 Deslouches B, Di YP (2017) Antimicrobial peptides with selective antitumor mechanisms: prospect for anticancer applications. Oncotarget 8(28):46635 Budič M, Rijavec M, Petkovšek Ž et al (2011) Escherichia coli bacteriocins: antimicrobial efficacy and prevalence among isolates from patients with bacteraemia. PLoS ONE 6(12):e28769 Baquero F, Lanza VF, Baquero MR et al (2019) Microcins in Enterobacterales: peptide antimicrobials in the eco-active intestinal chemosphere. Front Microbiol 10:2261 Jafari A, Babajani A, Forooshani RS et al (2022) Clinical applications and anticancer effects of antimicrobial peptides: From bench to bedside. Frontiers Oncology, p. 819563 Marković KG, Grujović MŽ, Koraćević MG et al (2022) Colicins and Microcins Produced by Enterobacterales: Characterization, Mode of Action, and Putative Applications. Int J Environ Res Public Health 19(18):11825 Maryam MT, Mostafa E, Nour A et al (2019) Evaluation of 99m Tc-MccJ25 peptide analog in mice bearing B16F10 melanoma tumor as a diagnostic radiotracer, Asia Oceania Journal of Nuclear Medicine and Biology , vol. 7, no. 2, pp. 172 – 80 Niklison-Chirou MV, Dupuy F, Saavedra L et al (2011) Microcin J25-Ga induces apoptosis in mammalian cells by inhibiting mitochondrial RNA-polymerase. Peptides 32(4):832–834 Shalibeik S, Ghandehari F, Ahadi AM et al (2022) Antibacterial Activity of the Peptide Microcin J25 Produced by Escherichia coli , Medical Laboratory Journal , vol. 16, no. 3, pp. 14 – 8 Magray MS, Kumar A, Rawat AK et al (2011) Identification of Escherichia coli through analysis of 16S rRNA and 16S-23S rRNA internal transcribed spacer region sequences. Bioinformation 6(10):370 Sankar NR, Priyanka VD, Reddy PS et al (2012) Purification and characterization of bacteriocin produced by Lactobacillus plantarum isolated from cow milk. Int J Microbiol Res 3(2):133–137 Dhiman HK, Ray AR, Panda AK (2005) Three-dimensional chitosan scaffold-based MCF-7 cell culture for the determination of the cytotoxicity of tamoxifen. Biomaterials, 26, 9, pp. 979 – 86 Miyamura T, Sakamoto N, Kakugawa T et al (2020) Small molecule inhibitor of HSP47 prevents pro-fibrotic mechanisms of fibroblasts in vitro. Biochem Biophys Res Commun 530(3):561–565 Kamarajan P, Hayami T, Matte B et al (2015) a bacteriocin and food preservative, inhibits head and neck cancer tumorigenesis and prolongs survival. PLoS ONE 10(7):e0131008 Rahimzadeh Torabi L, Doudi M, Naghavi NS et al (2021) Bacteriophages PɸEn-CL and PɸEn-HO can eliminate MDR Enterobacter cloacae and Enterobacter hormaechei isolated from burn wound infections without toxicity for human skin cells. FEMS Microbiol Lett 368:fnab143 Fronza M, Heinzmann B, Hamburger M et al (2009) Determination of the wound healing effect of Calendula extracts using the scratch assay with 3T3 fibroblasts. J Ethnopharmacol 126(3):463–467 Varas MA, Muñoz-Montecinos C, Kallens V et al (2020) Exploiting zebrafish xenografts for testing the in vivo antitumorigenic activity of microcin E492 against human colorectal cancer cells. Front Microbiol 11:405 Tornesello AL, Borrelli A, Buonaguro L et al (2020) Antimicrobial peptides as anticancer agents: functional properties and biological activities. Molecules 25(12):2850 Acuña L, Picariello G, Sesma F et al (2012) A new hybrid bacteriocin, Ent35–MccV, displays antimicrobial activity against pathogenic Gram-positive and Gram-negative bacteria, FEBS open bio , vol. 2, pp. 12 – 9 Gasu EN, Ahor HS, Borquaye LS (2018) Peptide extract from Olivancillaria hiatula exhibits broad-spectrum antibacterial activity. BioMed Res International, p. 6010572 Khay EO, Idaomar M, Castro LP et al (2011) Antimicrobial activities of the bacteriocin-like substances produced by lactic acid bacteria isolated from Moroccan dromedary milk. Afr J Biotechnol 10(51):10447–10455 Al-Madboly LA, El-Deeb NM, Kabbash A et al (2020) Purification, characterization, identification, and anticancer activity of a circular bacteriocin from Enterococcus thailandicus . Front Bioeng Biotechnol 8:450 Mandal SM, Sharma S, Pinnaka AK et al (2013) Isolation and characterization of diverse antimicrobial lipopeptides produced by Citrobacter and Enterobacter. BMC Microbiol 13(1):1–9 Hoskin DW, Ramamoorthy A (2008) Studies on anticancer activities of antimicrobial peptides, Biochimica et Biophysica Acta (BBA)-Biomembranes , vol. 1778, no. 2, pp. 357 – 75 Chen YLS, Li JH, Yu CY et al (2012) Novel cationic antimicrobial peptide GW-H1 induced caspase-dependent apoptosis of hepatocellular carcinoma cell lines, Peptides , vol. 36, no. 2, pp. 257 – 65 Wang C, Tian LL, Li S et al (2013) Rapid cytotoxicity of antimicrobial peptide tempoprin-1CEa in breast cancer cells through membrane destruction and intracellular calcium mechanism. PLoS ONE 8(4):e60462 Yu H, Shang L, Yang G et al (2022) Biosynthetic microcin J25 exerts strong antibacterial, anti-inflammatory activities, low cytotoxicity without increasing drug-resistance to bacteria target. Frontiers immunology 13:811378 Gaspar D, Veiga AS, Castanho MA (2013) J.F.i.m.: ‘From antimicrobial to anticancer peptides. review’, 4, pp. 294 Acuña L, Picariello G, Sesma F, Morero RD, Bellomio (2012) A.J.F.o.b.: ‘A new hybrid bacteriocin, Ent35–MccV, displays antimicrobial activity against pathogenic Gram-positive and Gram-negative bacteria’. 2:12–19 Soudy R, Wang L, Kaur K (2012) Synthetic peptides derived from the sequence of a lasso peptide microcin J25 show antibacterial activity, Bioorganic & medicinal chemistry , vol. 20, no. 5, pp. 1794 – 800 Gaspar D, Veiga AS, Castanho MA (2013) From antimicrobial to anticancer peptides. A review. Front Microbiol 4:294 Ahmadi S, Ghollasi M, Hosseini HM (2017) The apoptotic impact of nisin as a potent bacteriocin on the colon cancer cells. Microbial pathogenesis 111:193–197 Joo NE, Ritchie K, Kamarajan P et al (2012) Nisin, an apoptogenic bacteriocin and food preservative, attenuates HNSCC tumorigenesis via CHAC 1. Cancer Med 1(3):295–305 Soltani S, Zirah S (2021) Gastrointestinal Stability and Cytotoxicity of Bacteriocins From Gram-Positive and Gram-Negative Bacteria: A Comparative in vitro Study. Front Microbiol 12:780355 Pourahmadi M, Pourahmadi K, Modaresi F et al (2022) The Antibacterial and Anti-biofilm Traits of the Novel BMAP-27-Melittin Conjugated Peptide Nanoparticle Against Streptococcus mutans : Clinical Isolates from Oral Cavity. Iran J Pathol 17(3):294–302 Additional Declarations No competing interests reported. Supplementary Files floatimage1.jpeg Graphical Abstract Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3984143","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":274765976,"identity":"25cb4db6-a88a-4736-808d-7014d9aef7ea","order_by":0,"name":"Saman Shalibeik","email":"","orcid":"","institution":"Islamic Azad University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Saman","middleName":"","lastName":"Shalibeik","suffix":""},{"id":274765977,"identity":"d790a08a-b6ae-452c-9a5d-1bab29d13dee","order_by":1,"name":"Fereshte Ghandehari","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABD0lEQVRIie3Pv0sDMRTA8XcE4pJ4a8oV+y+8Q7B2KP1XrtzQpeBWOogcCM+l4prh/ohOzimBTuJ8g8OJ0OkGu0jFHxgQRcRU3BzyHd4SPrwXgFDoHxZrNwQYAMaMm3uw+/6gvERVn4Rnbu4D/42g+iAgEL4Qf5icrupmetPpnom1eSTs8B0T3W/g8MhL2stuWl6t0tLK+eKcMCWRsdYMVK/wkLTKDhJJNtJMzo2k54ggg8T9Bb1bqtFDIl/tQDNRL14IBxTX7Gk7GbsthR06AlYSDkllfOsWVY0nrXJpc8042vY15qRuqTdDP4n16FI1x7avY3u3bibYv4hzW22mJ17yU1HhDv4LCIVCodD33gDEz1O83VkP2wAAAABJRU5ErkJggg==","orcid":"","institution":"Islamic Azad University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Fereshte","middleName":"","lastName":"Ghandehari","suffix":""},{"id":274765978,"identity":"90fc689d-b863-42c3-a157-c9ce642630e3","order_by":2,"name":"Ali-Mohammad Ahadi","email":"","orcid":"","institution":"Shahrekord University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ali-Mohammad","middleName":"","lastName":"Ahadi","suffix":""},{"id":274765979,"identity":"0dbc2811-b7b0-4bee-9d04-80a4dee102aa","order_by":3,"name":"Ali-Asghar Rastegari","email":"","orcid":"","institution":"Islamic Azad University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ali-Asghar","middleName":"","lastName":"Rastegari","suffix":""},{"id":274765980,"identity":"7fb97c48-16ce-460b-8bd3-d714d64bb0ad","order_by":4,"name":"Mojgan Ghiasian","email":"","orcid":"","institution":"Islamic Azad University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mojgan","middleName":"","lastName":"Ghiasian","suffix":""}],"badges":[],"createdAt":"2024-02-24 06:44:37","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3984143/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3984143/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":51766030,"identity":"87177db4-18b2-4951-9324-eb56deee6568","added_by":"auto","created_at":"2024-02-28 18:47:30","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":48474,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe well assay of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eE coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eclinical urine isolate 83 with a growth inhibition zone\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3984143/v1/2d00e3b96b7c2319298f183e.jpeg"},{"id":51766028,"identity":"428e622c-a395-4167-ac0b-98c60f8cc102","added_by":"auto","created_at":"2024-02-28 18:47:30","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":31385,"visible":true,"origin":"","legend":"\u003cp\u003eElectrophoresis image in the acrylamide gel related to the PCR colony for the MccJ25 gene; the 470 bp (between 400 and 500 0f Marker)fragment shows the presence of the MccJ25 gene and its exact size; M: 50 pairs of markers, NC: negative control\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3984143/v1/75a66bca6e661868ffb41a77.jpeg"},{"id":51766641,"identity":"27cdb5de-a593-49ff-9a6d-832d73d06b87","added_by":"auto","created_at":"2024-02-28 18:55:33","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":94515,"visible":true,"origin":"","legend":"\u003cp\u003eThe 16srRNA gene sequence of \u003cem\u003eE. coli\u003c/em\u003e bacteria registered under number OM 333624 in NCBI\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3984143/v1/70bda2bfb7d3734c121b0595.jpeg"},{"id":51766031,"identity":"cbb74ea3-fe93-4ad5-bf05-9471cfe0abc4","added_by":"auto","created_at":"2024-02-28 18:47:30","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":522745,"visible":true,"origin":"","legend":"\u003cp\u003ePrimary examination of the extracted protein in SDS-PAGE gel electrophoresis; M: protein size marker; \u003cem\u003eE. coli\u003c/em\u003e strain top10F was used as the negative control isolate; D: the isolates after dialysis; the crude protein size of MccJ25 was about 4.6 kDa.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-3984143/v1/cdc4933b62b94091d54cf022.png"},{"id":51766034,"identity":"f5e2780a-4119-4857-8b18-1c7dd0e0d1a6","added_by":"auto","created_at":"2024-02-28 18:47:30","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":701731,"visible":true,"origin":"","legend":"\u003cp\u003eA: Morphology of MCF-7 with and without exposure to MccJ25; B: Toxicity of MccJ25 extracted from the \u003cem\u003eE. coli\u003c/em\u003e bacteria isolate 83 in different times of 24, 48, and 72 h on MCF-7 cell lines\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3984143/v1/6db4d7bd6d91cffbd4c9d60e.jpeg"},{"id":51766035,"identity":"bdc020c6-7ef7-4da3-9751-f3b5b9e5e41b","added_by":"auto","created_at":"2024-02-28 18:47:30","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":57254,"visible":true,"origin":"","legend":"\u003cp\u003eTwo-dimensional plot of Annexin V-FITC versus PI in flow cytometry; MCF-7 cells treated with the crude MccJ25 protein extracted from bacterial isolate 83 after 24 h at two concentrations of 0.609 and 1.218 µg/ml caused apoptosis by 45.4 and 86%, respectively. Q1 represents necrotic cells (Annexin V-/PI+), Q2 represents late apoptotic cells (Annexin V+/PI+), Q3 represents early apoptotic cells (Annexin V+/PI-), and Q4 represents live cells (Annexin V- /PI-). The percentage of apoptosis is shown in each region of this figure.\u003c/p\u003e","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3984143/v1/ad3f50e53261111a60e1ab16.jpeg"},{"id":51766032,"identity":"36c43478-d20b-4e42-b90f-0d27f8ad28ad","added_by":"auto","created_at":"2024-02-28 18:47:30","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":66387,"visible":true,"origin":"","legend":"\u003cp\u003eThe quantitative real-time RT-PCR analysis of \u003cem\u003eBCL2\u003c/em\u003eand \u003cem\u003eSTAT3\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3984143/v1/10efa6d5bd172b2a2d34639d.jpeg"},{"id":51766036,"identity":"c2c31447-f684-4706-b49d-23bcf99f0c30","added_by":"auto","created_at":"2024-02-28 18:47:30","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1405154,"visible":true,"origin":"","legend":"\u003cp\u003eScratch test: 0 h after treating fibroblast cells with the MccJ25 protein crude isolate 83, compared with the non-treated control group; 24 h after treating fibroblast cells with the MccJ25 protein crude isolate 83, compared with the non-treated control group; 48 h after the treatment of fibroblast cells with the crude MccJ25 protein isolate 83, compared with the non-treated control group\u003c/p\u003e","description":"","filename":"floatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-3984143/v1/9c8146b00951314f61ed50d2.png"},{"id":51766038,"identity":"06baf864-b9c4-48ab-aaa0-9c1700e9b8fa","added_by":"auto","created_at":"2024-02-28 18:47:31","extension":"jpeg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":37416,"visible":true,"origin":"","legend":"\u003cp\u003eScratch length in fibroblast cells treated with the crude MccJ25 protein extracted from \u003cem\u003eE. coli\u003c/em\u003e isolate 83 in 24 and 48 h; difference observed between the treatment and the control groups was significant in 48 h.\u003c/p\u003e","description":"","filename":"floatimage10.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3984143/v1/44f02d975e6988e8ae2eb4b0.jpeg"},{"id":52000119,"identity":"850037fd-c1cb-4557-9af5-5433cecdee2a","added_by":"auto","created_at":"2024-03-05 07:21:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2743788,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3984143/v1/b8a4e8b3-f2a1-4dc5-bdd9-680afe828741.pdf"},{"id":51766661,"identity":"dc7d79d1-2ba2-4077-ad0e-142a89e780ab","added_by":"auto","created_at":"2024-02-28 18:55:47","extension":"jpeg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":337167,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGraphical Abstract\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3984143/v1/1c9002f328ac68f33f23f9e0.jpeg"}],"financialInterests":"No competing interests reported.","formattedTitle":"Protective Effects of Antimicrobial Peptide Microcin J25 (MccJ25) Isolated from Escherichia coli against Breast Cancer Cells","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eBreast cancer is the most common and deadliest cancer affecting women worldwide. Despite notable advancements in treatment, the outlook for patients with metastatic breast cancer remains severely constrained. This is mainly due to the development of resistance to traditional chemotherapy for breast cancer and inadequate precision in targeting within current cancer treatment methods [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Accordingly, the use of medicinal drugs with fewer side effects has received considerable attention in recent years. Antimicrobial peptides (AMPs) are a class of anti-cancer peptides. AMPs have a wide range of antibacterial, antiviral, antifungal, and anticancer properties, and are part of the intrinsic resistance to microorganisms [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. AMPs, members of the class of anticancer peptides, are among these substances. AMPs have a wide range of antibacterial, antiviral, antifungal, and anticancer properties and are part of the intrinsic resistance reaction to microorganisms [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Numerous studies have reported the use of AMPs against cancer cells, including breast, lung, lymphoma, leukemia, and myeloma cells [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].. E. coli bacteriocins are divided into colicins (25\u0026ndash;80 kDa) and microcins (1\u0026ndash;10 kDa) based on their molecular weight [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Microcins possess an advantage over colicins as they do not pose lethality to the strains that produce them. [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. There are two types of microcins. Class I microcins have a molecular mass of less than 5 kDa and are highly post-translationally modified, which include microcin B17 (MccB17), MccJ25, MccC7/C51, and MccD93. In contrast, class II peptide microcins are larger (5\u0026ndash;10 kDa) and are further divided into two subclasses, IIa and IIb. Accordingly, subclass IIa does not require post-translational modifications, but can contain disulfide bonds, including the plasmid-mediated microcins MccL, MccV, and MccS, and siderophore bacteriocins, known as class IIb microcins, including MccE492, MccM, MccI47, and MccH47 [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The significance of utilizing microcins as possible alternatives to antibiotics is attributable to the absence of bacterial resistance to these AMPs [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In addition to their antimicrobial properties, microcins have antitumor functions and can act through various mechanisms such as apoptosis, necrosis, and pore creation in the target cell membrane, thereby inhibiting angiogenesis and activating the immune system against cancer cells [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Recently, researchers have exhibited significant interest in the potential use of microcins for cancer treatment because of their selective nature, which results in higher efficacy and minimal adverse effects. [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. MccJ25 is a 21-amino acid peptide produced by some Enterobacterales, especially \u003cem\u003eE. coli\u003c/em\u003e, and has a stable structure to avoid degradation by proteases in the digestive tract [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. MccJ25 has antimicrobial activity and as a membrane-active peptide, it causes the death of eukaryotic cells by destroying cytochrome c [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Against this background, in the current study, we examined how breast cancer cells respond to isolated MccJ25 from \u003cem\u003eE. coli\u003c/em\u003e.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. isolate collection, culture, and identification\u003c/b\u003e\u003c/h2\u003e \u003cp\u003e \u003cem\u003eE. coli\u003c/em\u003e were isolated and confirmed from urine samples obtained from private laboratories. In brief, 120 \u003cem\u003eEnterobacterales\u003c/em\u003e isolates were cultured on blood agar and eosin methylene blue at 35\u0026deg;C for 18\u0026ndash;24 h. Next, \u003cem\u003eE. coli\u003c/em\u003e isolates were identified and isolated using different phenotypic characteristics and biochemical tests, including Voges Proskauer (VP), Oxidative-Fermentative (OF), Urease, Oxidase, Methyl Red, Catalase, Simon Citrate, Triple Sugar Iron Agar, and the Sulfide Indole Motility test.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Evaluation of antimicrobial activity using the agar diffusion assay\u003c/h2\u003e \u003cp\u003eA total of 120 isolates were evaluated in terms of antimicrobial activity by the agar diffusion assay (wells, disk diffusion, and unique well diffusion). First, the \u003cem\u003eE. coli\u003c/em\u003e ATCC 25922 strain was inoculated on LB agar plates. After the overnight culture of the bacteria, a supernatant of the clinical isolates was inoculated in the wells created in the culture medium, which was incubated at 37\u0026deg;C for 24 h. The supernatant of clinical isolates was obtained by centrifuging 24 h cell-free supernatants (CFS) cultures of \u003cem\u003eE. coli\u003c/em\u003e isolates at 12,000 g for 10 m at 4\u0026deg;C. In addition, antibacterial activity was measured through the creation of clear zones or growth inhibition zones, using a vernier caliper, having been reported in mm [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. PCR-based screening for MccJ25 production and identification\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe microcin-producing isolate was identified using 16S rRNA gene (Pishgam Iran Company) sequencing to determine its sequence. The obtained sequence was then analyzed using Chromas v 2 software and subjected to homology analysis via the BLAST server [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Moreover, MccJ25-producing strains were additionally distinguished through PCR-based screening employing specific primers designed. Specifically, MccJ25 primers, MccJ25 F (ATGGAACTTCTTGTACTTGTCTG) and MccJ25 R (CATCCAGATAGCCGTTACCAGC), were formulated using Gene Runner software (V.6.5.52). To ensure precise determination of the product size obtained, acrylamide gel electrophoresis coupled with silver nitrate staining was employed.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Microcin isolation\u003c/h2\u003e \u003cp\u003eThe cell-free culture supernatant (crude bacteriocin) was saturated with 70% ammonium sulfate and kept at 4\u0026deg;C to precipitate proteins. Following this, the pellet was obtained by centrifugation at 10,000 \u0026times;g at 4\u0026deg;C for 30 minutes. Additionally, the residue was dissolved in phosphate buffer (0.1 M, pH 7.0) and dialyzed overnight at 4\u0026deg;C using the same buffer. Subsequently, the dialyzed protein was loaded onto a Sephadex G-100 column (1.6 \u0026times; 36 cm) previously equilibrated with a phosphate buffer (pH 7.0). The flow rate was set at 24 ml/h, and fractions (1 ml each) were collected. Those fractions exhibiting significant bacteriocin activity were combined and concentrated using a lyophilizer. Finally, the purity of the protein was assessed via sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), while the protein concentration was determined using the Bradford method [\u003cspan additionalcitationids=\"CR16 CR17 CR18 CR19 CR20\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Cell lines\u003c/h2\u003e \u003cp\u003eThe MCF-7 C135 breast cancer cell line and Fibroblast cell line L929 were procured from the Pasture Institute of Iran, Tehran. Next, MCF-7 and Fibroblast cells were cultured in the Roswell Park Memorial Institute (RPMI). Gibco RPMI 1640 Medium (Cat No: 11875093) was supplemented with FBS 10%, 100 IU. mL-1 penicillin, and 100 \u0026micro;g. mL-1 streptomycin in a humidified atmosphere (5% CO2) at 37\u0026deg;C [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Cell morphology and MTT cytotoxicity assay\u003c/h2\u003e \u003cp\u003eCytotoxicity effects of Mccj25 on MCF-7 breast cancer cells were evaluated by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay. When the cells reached 85% confluence, 1 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells/well were seeded in 96 well plates by the complete media and incubated at 37\u0026deg;C in 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere overnight. Next, the cells were treated with the serial dilution of semi-purified Mccj25 within the concentration range (0-2.5 \u0026micro;g/ml) in 24, 48 and 72 h. The control group included cells that experienced no treatment. Cell morphology was observed, followed by incubation with 20 \u0026micro;l of MTT solution (5 mg/mL) at 37\u0026deg;C for 3 h. Subsequently, dimethyl sulfoxide (DMSO) was added to dissolve the MTT-formazan crystals, and the absorbance was read at 570 nm using a microplate reader. [\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. In addition, the cell survival percentage was obtained using the following equation:\u003c/p\u003e \u003cp\u003e% Cell viability\u0026thinsp;=\u0026thinsp;Absorbance in drug-treated wells/Absorbance in the negative control well \u0026times; 100\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Apoptosis assays\u003c/h2\u003e \u003cp\u003eThe induction of apoptosis in MCF-7 cells following exposure to Mccj25 was examined by flow cytometry. For this purpose, 2 \u0026times; 10^5 cells were seeded overnight in individual wells of 6-well plates. Next, the cells were incubated at the concentrations of 1.218 and 0.609 \u0026micro;g/mL of semi-purified Mccj25 for 48 h. After a specified time, the cells were trypsinized, rinsed, and resuspended in an appropriate volume of cold phosphate buffered saline (PBS) for analysis. The treated cells were stained using the Annexin V FITC/propidium iodide (PI) kit (from BD USA) and analyzed by FlowJo software [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Measurement of \u003cem\u003eSTAT3\u003c/em\u003e and \u003cem\u003eBCL2\u003c/em\u003e gene expression\u003c/h2\u003e \u003cp\u003eThe expression levels of \u003cem\u003eSTAT3\u003c/em\u003e and \u003cem\u003eBCL2\u003c/em\u003e genes in MCF-7 cells treated with Mccj25 were investigated using quantitative real time PCR (RT- qPCR ). After culturing cells in 6-well plates for 24 h, they were treated with Mccj25 for 48 h. At the next step, RNA extraction from the cells was performed by a kit (Cat No: \u003cb\u003e4368814)\u003c/b\u003e as per the manufacturer's instructions. After checking the quality of the RNA via NanoDrop and gel electrophoresis, total RNA was produced by the cDNA synthesis kit (Addbio Company) and stored at -20\u0026deg;C. Next, using specific primers, as Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e showed, which were designed by Gene Runner software, the expression of \u003cem\u003eSTAT3\u003c/em\u003e and \u003cem\u003eBCL2\u003c/em\u003e genes were investigated using quantitative real time PCR (RT- qPCR ) and the SYBR-Green fluorescence method (Biofact Company) [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eReal-time RT-PCR primers and their specifications\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAmplicon\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTarget gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAccession number\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eF- β-actin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;-CACCCGCCGCCAGCTCACC-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e124bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eβ-actin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_001101.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eR- β-actin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;- CACGATGGAGGGGAAGACGG-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eF-STAT3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;-GCCGGAGAAACAGCAGGATG-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e131bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eSTAT3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_001369514.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eR-STAT3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;-AATCCAAGGGGCCAGAAACTG-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eF-BCL2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;- TGGCCTTCTTTGAGTTCGGTG-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e126bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eBCL2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_000633.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eR-BCL2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;- GGATCCAGGTGTGCAGGTGC-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Scratch test for determining the effect of MccJ25 on normal cell migration\u003c/h2\u003e \u003cp\u003eCell migration was assessed using the scratch assay method. Fibroblast cells were cultured in 6-well plates until they reached 95% confluence. Subsequently, the wells were scratched using a sterile pipette tip and rinsed twice with PBS. Fresh medium was then added to the wells, and the cells were stimulated with Mccj25 at concentrations of 0.14, 0.29, 0.59, 1.18, and 2.37 mg/ml at 0, 24, and 48 hours. Furthermore, images of cell migration post-treatment were captured using a phase-contrast microscope and analyzed using Image J software. [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003ch2\u003e 2.10. Statistical analysis\u003c/h2\u003e \u003cp\u003eThe Smirnov-Kolmograph test was performed to determine whether data were normally distributed. To calculate significance of data in normal distribution, T-Test were used. In addition, the Whitney-Mann non-parametric test was used for data with non-normal distribution. The one-way ANOVA test was used to check the results of the tests and compare the average data. Besides, the Tukey's multiple comparisons test was utilized for the one-way analysis of variance. It is worth noting that each test was repeated three times, and the values were reported as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. In fact, the results were statistically significant at P\u0026thinsp;\u0026le;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Identification and characterization of isolates\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eAs previously stated, among 120 clinical isolates, 85 isolates of \u003cem\u003eE. coli\u003c/em\u003e were identified and verified. Besides two isolates of \u003cem\u003eE. coli\u003c/em\u003e showed by PCR the highest similarity to Mccj25. In this study, isolate 83 was examined as well [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Confirmatory tests for \u003cem\u003eE. coli\u003c/em\u003e bacteria showed that clinical isolates isolated by the O/F test (positive, yellow), the citrate test (negative, green), and the TSI test (positive, acid-acid, positive gas, yellow) were identified. The other tests included the SIM test (positive, positive movement, positive indole), the MR test (positive, red), the VP test (negative), the oxidase test (negative, no color change), and the urea test (negative, yellow) [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Antibacterial activity of \u003cem\u003eE. coli\u003c/em\u003e clinical isolates\u003c/h2\u003e \u003cp\u003eAntimicrobial activity of \u003cem\u003eEnterobacterales\u003c/em\u003e clinical isolates against the standard \u003cem\u003eE. coli\u003c/em\u003e 25922 strain was investigated by the diffusion method in agar using wells. The results showed that 25 out of 120 \u003cem\u003eEnterobacterales\u003c/em\u003e isolates, (17 \u003cem\u003eE. coli\u003c/em\u003e and 8 \u003cem\u003eK. pneumoniae\u003c/em\u003e) were inhibited the growth of standard bacteria after 24 h. This was shown by the growth inhibition zones that indicated the antibacterial activity of this isolates. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e showed the related example.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Examining the isolates in terms of MccJ25 gene expression\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eTo identify the clinical isolates as MccJ25, the isolates with a positive well test were used to confirm the MccJ25 gene using specific primers and the PCR technique. Our results demonstrated that among 25 isolates with antibacterial activity, 2 E. coli isolates (83 and 58)expressed the MccJ25 gene, and isolate 83 was used to continue the study. In addition, the size of the obtained product using the acrylamide gel which confirmed the presence of the MccJ25 gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Furthermore, 16S rRNA gene sequencing, conducted to further identify the isolate producing MccJ25, showed the highest homology between isolate 83 and E. coli, which was registered in the NCBI Genome Bank under accession number OM333624 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Besides, sequencing was performed to check the MccJ25 gene extracted from E. coli isolate 83, which was registered in the NCBI Genome Bank under accession number OP947098.\u003c/p\u003e\u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Isolated MccJ25 and its validation\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eTo isolate the crude MccJ25 protein, after culturing and lysing the desired bacterial isolate, the crude MccJ25 protein was analyzed in terms of the protein size. Our results showed that the size of the crude MccJ25 protein extracted via SDS-PAGE gel electrophoresis was about 2.1 kDa (The only band under 10 kDa). Besides, the extracted crude MccJ25 protein was dialyzed to remove ammonium sulfate salt (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Additionally, the crude concentration of the purified MccJ25 protein was 4.863 \u0026micro;g/mL, which was checked via the Bradford method.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Cytotoxicity effects of MccJ25 against MCF-7 cancer cell lines\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eThe examining of cell morphology showed that lethal effects of MccJ25 on MCF-7 cells reduced cell density and caused a change in cell appearance. In addition, the results showed that the amount of IC\u003csub\u003e50\u003c/sub\u003e of MccJ25 in breast cancer cells amounted to 1.397, 1.218, and 1.464 mg/mL in 24, 48, and 72 h, respectively. Moreover, the analysis of the cytotoxicity of MccJ25 revealed that the MCF-7 cell line exhibited the highest level of toxicity after 48 hours, with a concentration of 1.218 mg/ml. (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.6. Effects of MccJ25 on apoptosis of MCF-7 cells\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eFlow cytometry was used (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e) to determine the percentage of apoptotic cells in the MCF-7 cell population treated with the crude MccJ25 protein extracted from the E. coli bacteria (isolate 83) at two different concentrations, which were compared with the control cell population (without treatment). The results showed that MCF-7 cells treated with the crude MccJ25 protein after 24 h, at concentrations of 0.609 and 1.218 \u0026micro;g/ml caused apoptosis of 45.4 and 86%, respectively. In addition, the increase in the crude concentration of the MccJ25 protein enhanced the rate of apoptosis, which could be dose-dependent.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.7. Effects of MccJ25 on the expression of \u003cem\u003eBCL2\u003c/em\u003e and \u003cem\u003eSTAT3\u003c/em\u003e genes\u003c/h2\u003e \u003cp\u003eThe expression of \u003cem\u003eBCL2\u003c/em\u003e and \u003cem\u003eSTAT3\u003c/em\u003e genes in MCF-7 cells treated with MccJ25 (extracted from \u003cem\u003eE. coli\u003c/em\u003e isolate 83) was performed by the real-time PCR. Our results indicated that both \u003cem\u003eBCL2\u003c/em\u003e and \u003cem\u003eSTAT3\u003c/em\u003e genes experienced a significant decrease in the cells exposed to MccJ25, compared to the control group in 48 h.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.8. Effects of MccJ25 on the repair of damaged normal cells through migration\u003c/h2\u003e \u003cp\u003eCell migration was investigated by the scratch method. After culturing fibroblast cells and treating them with the MccJ25 crude protein, we examined the cell migration images using phase contrast microscopy. Accordingly, after 24 and 48 h, the scratch size was measured and compared between the control and treatment groups using Image J software. The results obtained using SPSS software were compared statistically as described below.(Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eThe results showed an increase in the migration and repair of scratched fibroblast cells after treatment with the MccJ25 crude protein purified from isolate 83, in 24 and 48 h from exposure, compared to the control sample in normal fibroblast cells. In other words, the treatment of fibroblast cells with the MccJ25 crude protein from isolate 83 reduced scratch length.(Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e)\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn recent years, there has been considerable focus on the anti-tumour activity of antimicrobial peptides (AMPs)[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Therefore, in the present study, after isolating and confirming the presence of AMPs (MccJ25), their effects on breast cancer cells as well as their regenerative activity in normal cells were investigated. Microcins originating from Enterobacteriaceae represent ribosomally synthesized and post-translationally modified peptides (RiPPs) that demonstrate antimicrobial properties through the targeting of vital biological enzymes. For instance, MccJ25, a 21-amino acid peptide, exerts its inhibitory effects on the growth of Gram-negative bacteria primarily by targeting their RNA polymerase (RNAP) activity. This peptide has been shown to possess antimicrobial efficacy against Salmonella and Shigella. Initially isolated from \u003cem\u003eEscherichia coli\u003c/em\u003e AY25 strains obtained from neonatal feces, MccJ25 exhibits a distinctive structure characterized by an atypical 8-amino acid ring and a lasso loop configuration[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. MccJ25 exhibits potent bactericidal activity, effectively inducing rapid mortality across various growth phases of pathogens. Its efficacy extends to combating foodborne pathogens in diverse food matrices, such as meat, dairy, and yogurt. Furthermore, MccJ25 exhibits stability in a range of biological fluids, such as serum and simulated gastrointestinal fluids. Targeting the cytoplasmic membrane of Salmonella newport cells causes the cytoplasmic membrane gradient to be disrupted, which is the mechanism of action. Its extended duration of activity in a variety of settings and biological fluids is confirmed by stability investigations. The combined results highlight MccJ25's potential as a workable substitute for conventional antibiotics in treating drug-resistant illnesses[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMany studies found that MccJ25 exhibited excellent activity against ETEC due to permeabilizing bacterial membranes and strong affinity. MccJ25 has also been found to inhibit ETEC-induced intestinal injury and intestinal inflammatory responses, suggesting its potential application as an excellent antimicrobial or anti-inflammation agent against pathogen infection[55].The Minimum Inhibitory Concentration (MIC) of MccJ25 against ETEC-sensitive strains is quite low, with the lowest MIC value being 0.03 \u0026micro;g/mL for \u003cem\u003eE. coli K99\u003c/em\u003e and \u003cem\u003eE. coli 987P\u003c/em\u003e. Nevertheless, the search results do not explicitly mention the MIC variability of MccJ25 against ETEC-sensitive and Multidrug-Resistant (MDR) strains[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFirst, a total of 120 isolates were identified after being isolated from patients and identified via culture and biochemical assays. Antibacterial activity results from the \u003cem\u003eE. coli\u003c/em\u003e and \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates indicated that 25 isolates had a clear growth-inhibiting zone. Moreover, the presence of the inhibition zone revealed the absence of standard bacteria growth in the presence of these isolates, which was considered antibacterial activity, with a variety of studies that have investigated the role of bacteriocins in inhibiting bacterial growth[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eExamination of isolates having antibacterial activity, in terms of expression of the MccJ25 gene, showed that isolate 83 expressed this gene, so it was regarded as a microcin. Furthermore, the 16S rRNA sequence recorded in the NCBI database showed a strong homology of the selected isolate with \u003cem\u003eE. coli\u003c/em\u003e. In alignment with our empirical research, Madboly \u003cem\u003eet al\u003c/em\u003e accomplished the isolation and identification of a bacteriocin originating from \u003cem\u003eEnterococcus thailandicus\u003c/em\u003e through the utilization of 16S rRNA, subsequently archiving the discovery on the NCBI database [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In other research, Mandal \u003cem\u003eet al\u003c/em\u003e investigated the 16S rRNA gene of produced antimicrobial lipopeptides by \u003cem\u003eCitrobacter\u003c/em\u003e and \u003cem\u003eEnterobacter\u003c/em\u003e from soil isolates contaminated with feces and investigated them using HPLC analysis. The result of their study exhibited the presence of multiple antimicrobial lipopeptides [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Upon verification of isolate 83 for the existence of the MccJ25 gene, the designated isolate underwent a protein extraction process, followed by analysis to ascertain the presence of the MccJ25 protein. In the present study, Our SDS-PAGE analysis results showed that the MccJ25 protein was present at 4.6 kDa, confirming the presence of the MccJ25 protein. In addition, the quantity of protein was determined by the Bradford method so that suitable concentrations could be used for other experiments.\u003c/p\u003e \u003cp\u003eSeveral studies have demonstrated the potential of bacterial-based therapy in overcoming tumour cell resistance, presenting it as a viable alternative to traditional treatment modalities. Investigation into the mechanisms underlying immune cell-mediated cancer cell destruction has significantly contributed to the development of novel therapies, including bacterial-based immunotherapy. The exploration of bacterial-based cancer therapy has encompassed the utilization of various strains, such as \u003cem\u003eSalmonella enterica\u003c/em\u003e serovar Typhimurium and Clostridium novyi-NT, revealing promising efficacy in combatting cancer[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIt is noteworthy that the exceptional stability of Microcin J25 is attributed to its threaded sidechain-to-backbone ring structure. The lasso configuration of Microcin J25 imparts remarkable resistance to severe thermal, pH, and protease degradation, encompassing chymotrypsin, trypsin, and pepsin[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDue to their unique structural characteristics, bacteriocins have strong biological properties, such as the differentiation of cancer cells from non-cancer ones as well as antitumor activity [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The cytotoxic effects of \u003cem\u003eE. coli\u003c/em\u003e. The efficacy of MccJ25 obtained from \u003cem\u003eE. coli\u003c/em\u003e on MCF-7 breast cancer cells was assessed throughout 24, 48, and 72 h. The results showed the highest cytotoxicity (lowest IC\u003csub\u003e50\u003c/sub\u003e) of 1.081 \u0026micro;g/ml for MccJ25 concentration in 72h on MCF-7 cell lines, showing the highest significance among other concentrations at different times. As a result, microcins increased cancer cell mortality in a concentration-dependent manner. Consistent with our results, Chen \u003cem\u003eet al\u003c/em\u003e indicated that the effect of H1-GW antimicrobial peptides inhibited the viability of liver cancer cell lines, such as (J5 HCC, Huh7, and Hep3B), in a dosage-dependent fashion. In contrast, normal fibroblast cells 3T3 exhibited markedly lower susceptibility to these antimicrobial peptides (AMPs) [66]. Additionally, the effect of 1CEa-Temporin as an antimicrobial peptides (AMPs), elicited cytotoxicity in a dose-dependant manner in human breast cancer cell lines, namely 231-MB-MDA and MCF-7 [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn a related investigation, MccJ25's cytotoxic effects on HT-29 human colorectal adenocarcinoma cell line were assessed via MTT assay. Results revealed that after 24 h of peptide exposure, HT-29 cell viability was at 83%, suggesting a minimal impact of the microcin on cancer cells [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Furthermore, an investigation regarding the treatment of RAW 264.7 and Caco-2 cells at varying levels of MccJ25 exhibited no statistically significant variations in the survival of cells and LDH-stimulating activity when compared to the control groups [56]. Soudy \u003cem\u003eet al\u003c/em\u003e showed that MccJ25 caused no significant cytotoxicity in MCF-7 and MDA-MB-435 cells, while the MccJ25-18-4 (the breast cancer targeting peptide) conjugated to inhibit breast cancer cell growth [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFlow cytometry was used to determine the amount of cell apoptosis in MCF-7 breast cancer cells treated with isolate 83, in comparison with the population of control cells (without treatment). The current study's findings denote the confirmed initiation of apoptosis in MCF-7 cells upon treatment with compound 83. Within 24 hours of exposure to concentrations of 0.609 and 1.218 \u0026micro;g/ml, a marked induction of apoptosis occurred by 45.4% and 86%, respectively. Gaspard et al. posit that the anticancer properties of antimicrobial peptides (AMPs) can be largely attributed to their capacity for electrostatic interactions with the anionic membrane of cancer cells. This capability affords selective elimination of cancer cells[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Different studies have shown the effect of nisin on the induction of apoptosis into different cancer cells [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. As an anti-apoptotic gene, the \u003cem\u003eBCL2\u003c/em\u003e gene regulates the apoptotic pathway. In addition, \u003cem\u003eSTAT3\u003c/em\u003e proteins are contextually activated to respond to growth factors, cytokines or other polypeptide ligands. Moreover, they play a significant role in fundamental processes, including proliferation, development, differentiation, inflammation, and apoptosis. The findings indicated a decline in the manifestation of \u003cem\u003eBCL2\u003c/em\u003e and \u003cem\u003eSTAT3\u003c/em\u003e genes relative to the control cohort, thereby validating the outcomes of the apoptotic process that instigates heightened cellular mortality[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAfter examining the effect of nisin on the stimulation of apoptosis in colon cancer cell lines, Ahmadi and colleagues discovered that the presence of nisin led to an induction of cell survival, as well as an increase in the expression of both \u003cem\u003eBCL2\u003c/em\u003e and \u003cem\u003eBAX\u003c/em\u003e genes and proteins. Consequently, it was deduced that nisin has the potential to elicit apoptosis via intrinsic pathways, thereby leading to the death of cancerous cells [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCell migration or the ability to repair physical damage was investigated by the scratch test in fibroblast cells. Therefore, in case of damage, normal cells of the animal's body were able to repair the physical damage, along with the capacity of cell migration. Medications capable of stimulating the motor effects of normal cells and making them perform the migration more quickly could be effective in repairing physical damage. This effect could be influenced by modifying the factors contributing to a faster division, thus filling the empty spaces at a faster pace. The results of our study demonstrate a significant upsurge in both cellular migration and repair capabilities following administration of purified proteins derived from isolate 83 in 24 and 48 h after exposure, as compared to the control sample in normal fibroblast cells. The present findings demonstrate the efficacy of the aforementioned peptide in repairing injured tissues as well as its favorable impact on viable cells. The analysis conducted by Soltani et al on hemolysis revealed that rat red blood cells were subject to lysis at concentrations exceeding 52 \u0026micro;g/ml by pediocin 1-PA, bactofencin A, and nisin. It was observed that MccJ25 did not exhibit any detrimental effects on these cells, which suggests that it does not pose a threat to the well-being of healthy cells. In addition, another study reported that MccJ25 had no adverse effects on normal human epidermal keratinocyte (NHEK) primary cells, with confirmed safety [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Pourahmadi \u003cem\u003eet al\u003c/em\u003e, measured the impact of new BMAP27-Melittin conjugated peptide-nanoparticle against clinical isolates of \u003cem\u003eStreptococcus mutans\u003c/em\u003e. The Biofilm Inhibitory Concentration (BIC) and Biofilm Eradication Concentration (BEC) of BMAP27-Melittin-NP against \u003cem\u003eS. mutans\u003c/em\u003e were 2.1 and 3.8\u0026micro;g/mL. BMAP27-Melittin-nanoparticles demonstrated significant antibacterial and anti-biofilm effects against \u003cem\u003eS. mutans\u003c/em\u003e [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eThe microcin isolated from the patients\u0026rsquo; isolates that showed expression at the Microcin J25 (MccJ25) gene. \u003cem\u003eBCL2\u003c/em\u003e and \u003cem\u003eSTAT3\u003c/em\u003e genes experienced a significant decrease in the cells exposed to MccJ25. However, MccJ25 inhibited the growth of cancer cells in breast cancer cells and increased their death rate in the apoptosis pathway, so that the MCF-7 cells treated with the crude MccJ25 protein. According to the present research found that MccJ25, as an antimicrobial peptide, induced a positive effect on migration and repair of normal cells, such as fibroblasts.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSSH, FGH, AMA, AAR and MGH: Conceived, designed and supervised the study and revised the manuscript; SSH and MGH: Collected and searched the data; SSH: Drafted the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that there are no conflicts of interest regarding the publication of this article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eTorre LA, Bray F, Siegel RL et al (2015) Global cancer statistics, 2012. CA Cancer J Clin 65(2):87\u0026ndash;108\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohammadzadeh Rostami F, Moghim S, Javdan S, Nasr Esfahani B (2023) Antimicrobial Efficacy and Prevalence of Microcins: Low Molecular Mass Bacteriocins Produced by Escherichia coli. Int J Pept Res Ther 29(5):74\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZare-Zardini H, Salehvarzi M, Ghanizadeh F et al (2018) Antimicrobial Peptides of Innate Immune System as a Suitable Compound for Cancer Treatment and Reduction of its Related Infectious Disease. Iranian J Pediatr Hematology Oncology, 8, 1\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTehrani MM, Erfani M, Amirmozafari N et al (2019) Evaluation of 99m Tc-MccJ25 peptide analog in mice bearing B16F10 melanoma tumor as a diagnostic radiotracer. Asia Ocean Journal Nuclear Med Biology, 7, 2, pp.172\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThundimadathil J (2012) Cancer treatment using peptides: current therapies and future prospects, \u003cem\u003eJournal of amino acids\u003c/em\u003e, ;2012\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeslouches B, Di YP (2017) Antimicrobial peptides with selective antitumor mechanisms: prospect for anticancer applications. Oncotarget 8(28):46635\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBudič M, Rijavec M, Petkovšek Ž et al (2011) \u003cem\u003eEscherichia coli\u003c/em\u003e bacteriocins: antimicrobial efficacy and prevalence among isolates from patients with bacteraemia. PLoS ONE 6(12):e28769\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaquero F, Lanza VF, Baquero MR et al (2019) Microcins in Enterobacterales: peptide antimicrobials in the eco-active intestinal chemosphere. Front Microbiol 10:2261\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJafari A, Babajani A, Forooshani RS et al (2022) Clinical applications and anticancer effects of antimicrobial peptides: From bench to bedside. Frontiers Oncology, p. 819563\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarković KG, Grujović MŽ, Koraćević MG et al (2022) Colicins and Microcins Produced by Enterobacterales: Characterization, Mode of Action, and Putative Applications. Int J Environ Res Public Health 19(18):11825\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaryam MT, Mostafa E, Nour A et al (2019) Evaluation of 99m Tc-MccJ25 peptide analog in mice bearing B16F10 melanoma tumor as a diagnostic radiotracer, \u003cem\u003eAsia Oceania Journal of Nuclear Medicine and Biology\u003c/em\u003e, vol. 7, no. 2, pp. 172\u0026thinsp;\u0026ndash;\u0026thinsp;80\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiklison-Chirou MV, Dupuy F, Saavedra L et al (2011) Microcin J25-Ga induces apoptosis in mammalian cells by inhibiting mitochondrial RNA-polymerase. Peptides 32(4):832\u0026ndash;834\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShalibeik S, Ghandehari F, Ahadi AM et al (2022) Antibacterial Activity of the Peptide Microcin J25 Produced by \u003cem\u003eEscherichia coli\u003c/em\u003e, \u003cem\u003eMedical Laboratory Journal\u003c/em\u003e, vol. 16, no. 3, pp. 14\u0026thinsp;\u0026ndash;\u0026thinsp;8\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMagray MS, Kumar A, Rawat AK et al (2011) Identification of \u003cem\u003eEscherichia coli\u003c/em\u003e through analysis of 16S rRNA and 16S-23S rRNA internal transcribed spacer region sequences. Bioinformation 6(10):370\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSankar NR, Priyanka VD, Reddy PS et al (2012) Purification and characterization of bacteriocin produced by Lactobacillus plantarum isolated from cow milk. Int J Microbiol Res 3(2):133\u0026ndash;137\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDhiman HK, Ray AR, Panda AK (2005) Three-dimensional chitosan scaffold-based MCF-7 cell culture for the determination of the cytotoxicity of tamoxifen. Biomaterials, 26, 9, pp. 979\u0026thinsp;\u0026ndash;\u0026thinsp;86\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiyamura T, Sakamoto N, Kakugawa T et al (2020) Small molecule inhibitor of HSP47 prevents pro-fibrotic mechanisms of fibroblasts in vitro. Biochem Biophys Res Commun 530(3):561\u0026ndash;565\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamarajan P, Hayami T, Matte B et al (2015) a bacteriocin and food preservative, inhibits head and neck cancer tumorigenesis and prolongs survival. PLoS ONE 10(7):e0131008\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRahimzadeh Torabi L, Doudi M, Naghavi NS et al (2021) Bacteriophages PɸEn-CL and PɸEn-HO can eliminate MDR \u003cem\u003eEnterobacter cloacae\u003c/em\u003e and \u003cem\u003eEnterobacter hormaechei\u003c/em\u003e isolated from burn wound infections without toxicity for human skin cells. FEMS Microbiol Lett 368:fnab143\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFronza M, Heinzmann B, Hamburger M et al (2009) Determination of the wound healing effect of Calendula extracts using the scratch assay with 3T3 fibroblasts. J Ethnopharmacol 126(3):463\u0026ndash;467\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVaras MA, Mu\u0026ntilde;oz-Montecinos C, Kallens V et al (2020) Exploiting zebrafish xenografts for testing the in vivo antitumorigenic activity of microcin E492 against human colorectal cancer cells. Front Microbiol 11:405\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTornesello AL, Borrelli A, Buonaguro L et al (2020) Antimicrobial peptides as anticancer agents: functional properties and biological activities. Molecules 25(12):2850\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAcu\u0026ntilde;a L, Picariello G, Sesma F et al (2012) A new hybrid bacteriocin, Ent35\u0026ndash;MccV, displays antimicrobial activity against pathogenic Gram-positive and Gram-negative bacteria, \u003cem\u003eFEBS open bio\u003c/em\u003e, vol. 2, pp. 12\u0026thinsp;\u0026ndash;\u0026thinsp;9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGasu EN, Ahor HS, Borquaye LS (2018) Peptide extract from \u003cem\u003eOlivancillaria hiatula\u003c/em\u003e exhibits broad-spectrum antibacterial activity. BioMed Res International, p. 6010572\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhay EO, Idaomar M, Castro LP et al (2011) Antimicrobial activities of the bacteriocin-like substances produced by lactic acid bacteria isolated from Moroccan dromedary milk. Afr J Biotechnol 10(51):10447\u0026ndash;10455\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAl-Madboly LA, El-Deeb NM, Kabbash A et al (2020) Purification, characterization, identification, and anticancer activity of a circular bacteriocin from \u003cem\u003eEnterococcus thailandicus\u003c/em\u003e. Front Bioeng Biotechnol 8:450\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMandal SM, Sharma S, Pinnaka AK et al (2013) Isolation and characterization of diverse antimicrobial lipopeptides produced by Citrobacter and Enterobacter. BMC Microbiol 13(1):1\u0026ndash;9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoskin DW, Ramamoorthy A (2008) Studies on anticancer activities of antimicrobial peptides, \u003cem\u003eBiochimica et Biophysica Acta (BBA)-Biomembranes\u003c/em\u003e, vol. 1778, no. 2, pp. 357\u0026thinsp;\u0026ndash;\u0026thinsp;75\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen YLS, Li JH, Yu CY et al (2012) Novel cationic antimicrobial peptide GW-H1 induced caspase-dependent apoptosis of hepatocellular carcinoma cell lines, \u003cem\u003ePeptides\u003c/em\u003e, vol. 36, no. 2, pp. 257\u0026thinsp;\u0026ndash;\u0026thinsp;65\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang C, Tian LL, Li S et al (2013) Rapid cytotoxicity of antimicrobial peptide tempoprin-1CEa in breast cancer cells through membrane destruction and intracellular calcium mechanism. PLoS ONE 8(4):e60462\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu H, Shang L, Yang G et al (2022) Biosynthetic microcin J25 exerts strong antibacterial, anti-inflammatory activities, low cytotoxicity without increasing drug-resistance to bacteria target. Frontiers immunology 13:811378\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGaspar D, Veiga AS, Castanho MA (2013) J.F.i.m.: \u0026lsquo;From antimicrobial to anticancer peptides. review\u0026rsquo;, 4, pp. 294\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAcu\u0026ntilde;a L, Picariello G, Sesma F, Morero RD, Bellomio (2012) A.J.F.o.b.: \u0026lsquo;A new hybrid bacteriocin, Ent35\u0026ndash;MccV, displays antimicrobial activity against pathogenic Gram-positive and Gram-negative bacteria\u0026rsquo;. 2:12\u0026ndash;19\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoudy R, Wang L, Kaur K (2012) Synthetic peptides derived from the sequence of a lasso peptide microcin J25 show antibacterial activity, \u003cem\u003eBioorganic\u003c/em\u003e \u0026amp; \u003cem\u003emedicinal chemistry\u003c/em\u003e, vol. 20, no. 5, pp. 1794\u0026thinsp;\u0026ndash;\u0026thinsp;800\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGaspar D, Veiga AS, Castanho MA (2013) From antimicrobial to anticancer peptides. A review. Front Microbiol 4:294\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhmadi S, Ghollasi M, Hosseini HM (2017) The apoptotic impact of nisin as a potent bacteriocin on the colon cancer cells. Microbial pathogenesis 111:193\u0026ndash;197\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJoo NE, Ritchie K, Kamarajan P et al (2012) Nisin, an apoptogenic bacteriocin and food preservative, attenuates HNSCC tumorigenesis via CHAC 1. Cancer Med 1(3):295\u0026ndash;305\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoltani S, Zirah S (2021) Gastrointestinal Stability and Cytotoxicity of Bacteriocins From Gram-Positive and Gram-Negative Bacteria: A Comparative in vitro Study. Front Microbiol 12:780355\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePourahmadi M, Pourahmadi K, Modaresi F et al (2022) The Antibacterial and Anti-biofilm Traits of the Novel BMAP-27-Melittin Conjugated Peptide Nanoparticle Against \u003cem\u003eStreptococcus mutans\u003c/em\u003e: Clinical Isolates from Oral Cavity. Iran J Pathol 17(3):294\u0026ndash;302\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Antimicrobial Peptides (AMPs), Microcin, Breast Cancer","lastPublishedDoi":"10.21203/rs.3.rs-3984143/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3984143/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eIntroduction:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMicrocins are Antimicrobial peptides (AMPs) with low molecular weight, which are produced by \u003cem\u003eEnterobacterales\u003c/em\u003e and have broad-spectrum antibacterial activity. They can selectively replace common cancer treatments in cancer cells with less side effects and higher effectiveness. Given the aforementioned context, the present study endeavors to examine the antitumor activity of microcins isolated from of the \u003cem\u003eEnterobacterales\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMaterial and Methods\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn total, 120 Enterobacterales isolates were examined after identification. Subsequently, the bacteria were subjected to an agar diffusion test to assess their antibacterial efficacy. Positive isolates were further examined for the presence of Mccj25 using PCR. The cytotoxic effects of isolates harboring the microcin gene were explored using quantitative real-time PCR (RT-qPCR) and the MTT test on breast cancer cells. Additionally, the expression levels of BCL2 and STAT3 genes were evaluated, and apoptosis was quantified using flow cytometry. The repair rate of normal cells was determined using a scratch assay.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe findings obtained from the phenotypic and biochemical assays have duly verified and established the categorization of the \u003cem\u003eEnterobacterales\u003c/em\u003e. After conducting the agar diffusion test, a total of 25 isolates of \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e displaying inhibition zones were chosen as suitable specimens possessing AMPs. Urinary \u003cem\u003eE. coli\u003c/em\u003e was identified as isolate 83. The analysis conducted on the expression of the Mccj25 gene within the aforementioned isolates indicated that isolate 83 exhibited significant expression of the Mccj25 gene.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe extract obtained from this isolate on the breast cancer cell line exhibited the most significant degree of toxicity after precisely 48 h. Furthermore, the treatment of breast cancer cells with isolate 83 showed that the rate of apoptosis was about 86%, and the expression of \u003cem\u003eBCL2\u003c/em\u003e and \u003cem\u003eSTAT3\u003c/em\u003e genes decreased. Moreover, it potentiated the reparative ability of normal fibroblast cells. They resulted in growth suppression of breast cancer cells and elicited an escalated rate of cellular demise via the apoptosis pathway.\u003c/p\u003e","manuscriptTitle":"Protective Effects of Antimicrobial Peptide Microcin J25 (MccJ25) Isolated from Escherichia coli against Breast Cancer Cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-28 18:47:25","doi":"10.21203/rs.3.rs-3984143/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0d196348-af20-4106-b4ac-cb78acd9bed0","owner":[],"postedDate":"February 28th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-03-05T07:21:27+00:00","versionOfRecord":[],"versionCreatedAt":"2024-02-28 18:47:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3984143","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3984143","identity":"rs-3984143","version":["v1"]},"buildId":"omnImTCwR2MFx8CMYfrG7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.