PgtE protease enables virulentSalmonellato evade C3-mediated serum and neutrophil killing

33 34 Non-typhoidal Salmonella serovars, such as Salmonella enterica serovar Typhimurium 35 (STm), are a leading cause of inflammatory diarrhea in otherwise healthy individuals. 36 Among children, the elderly, and immunocompromised individuals, STm can spread to 37 systemic sites and cause potentially lethal bacteremia. Phagocytic cells and the immune 38 complement system are pivotal to preventing the dissemination of STm. PgtE, an STm 39 outer membrane protease, has been previously described to cleave over a dozen 40 mammalian protein substrates in vitro, including complement protein C3. However, these 41 activities have mostly been observed with mutant, avirulent strains with a truncated O-42 antigen that renders bacteria sensitive to complement killing. Here, we report that virulent 43 STm utilizes PgtE to evade complement-mediated killing in vivo. The wild-type pathogen 44 increases pgtE expression and PgtE proteolytic function within macrophages and in 45 macrophage-like in vitro growth conditions, concomitant with physiologic O -antigen 46 shortening in these environments. Furthermore, we found that wild-type STm’s resistance 47 to complement-mediated serum and neutrophil killing is PgtE -dependent. We propose 48 that PgtE promotes the systemic spread of STm by acting as a second line of defense 49 against complement when STm escapes from a macrophage. 50 51 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint

52 53 Infections with non-typhoidal Salmonella (NTS) are among the leading causes of 54 gastrointestinal disease worldwide (1). Clinically, NTS infection presents with 55 inflammatory diarrhea (2), characterized by localized gastrointestinal inflammation and 56 neutrophil influx in the intestinal mucosa (3). In healthy individuals, NTS infection remains 57 localized to the gut (2). However, approximately 5% of patients infected with NTS develop 58 bacteremia, a serious and potentially fatal complication (2). Children and the elderly are 59 at risk for developing bacteremia (4), and additional risk factors include leukemia, 60 chemotherapy, and HIV infection prior to the advent of antiretroviral therapy (5–8). In 61 recent years, invasive non -typhoidal Salmonella (iNTS) strains have emerged as a 62 prominent cause of bloodstream infection in sub -Saharan Africa (9), with serovars 63 Typhimurium (STm) and Enteritidis implicated in 91% of iNTS cases (10). Important risk 64 factors for iNTS disease in Africa are HIV infection, malaria, and malnutrition (9). 65 Furthermore, complicated iNTS infections present a challenge for antibiotic treatment due 66 to increased multidrug resistance (2, 11). It is thus imperative to elucidate mechanisms 67 by which STm can evade host immune defenses to cause bacteremia. 68 69 Neutrophils are thought to play a crucial role in preventing NTS bacteremia through 70 limiting dissemination of the pathogen from the mucosa to systemic sites. Neutropenia in 71 patients with HIV (7) or cancer (6), as well as defective production of reactive oxygen 72 species (ROS) in patients with chronic granulomatous disease (12), heightens the risk of 73 NTS bacteremia. Experiments in mice, largely conducted with STm, corroborate these 74 clinical observations, as neutrophil depletion leads to increased pathogen dissemination 75 (13). Even with a fully functional immune system, macrophages are less effective at killing 76 STm due to the pathogen’s numerous strategies for survival and replication within these 77 cells. Within the macrophage phagosome, STm uses the two -component regulatory 78 system PhoPQ to sense acidification, Mg2+-limiting conditions, and cationic antimicrobial 79 peptides, which together induce the expression of Salmonella Pathogenicity Island 2 80 (SPI2) effector genes (14–18). The SPI2 -encoded type -3 secretion system delivers a 81 plethora of effector proteins that prevent the fusion of the phagosome with lysosomes, 82 allowing STm to persist in Salmonella-containing vacuoles (SCVs) within macrophages 83 (19–21). 84 85 Protected inside the macrophage compartment, STm can spread to the liver, 86 spleen, and blood while evading extracellular host defenses (22–25). In the extracellular 87 environment, Salmonella is more vulnerable to complement opsonization, which 88 contributes to host protection during bacteremia (26, 27) by mechanisms that are not 89 completely elucidated. Long O -antigen chains of lipopolysaccharide on Salmonella play 90 a crucial role in steric inhibition of complement, reducing effective membrane attack 91 complex (MAC) formation. Consequently, STm lacking O -antigen (rough mutants) are 92 susceptible to serum complement killing (28) and are avirulent (29, 30). Resistance to 93 complement is also mediated by the outer membrane proteins TraT and Rck (31–33). A 94 third outer membrane protein, PgtE, is a promiscuous protease described to cleave a 95 dozen different substrates in vitro (34–39), including complement -associated proteins. 96 Increased expression of pgtE has also been proposed to promote survival and 97 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint dissemination of iNTS (39). Nevertheless, it is unknown whether the cleavage of 98 complement proteins promotes STm virulence in vivo. 99 100 All p revious studies investigating PgtE function in vitro used rough mutants, 101 because the long O-antigen in wild -type strains sterically inhibits PgtE function (35–37, 102 39, 40). We thus sought to unravel the in vivo role of PgtE in wild -type, virulent strains 103 with an intact O -antigen (smooth strains). Here we show that an STm pgtE mutant is 104 attenuated in wild -type mice, but is rescued in complement -deficient mice. 105 Mechanistically, we found that wild-type STm cleaves complement C3 in a PgtE -106 dependent manner when inside macrophages or cultured in media mimicking the SCV , 107 environments where STm expresses a shorter O-antigen. Unexpectedly, however, PgtE-108 mediated disruption of complement did not promote STm survival in macrophages, but 109 rather enhanced serum resistance and evasion of neutrophil killing, thereby contributing 110 to bacteremia. 111 112 113 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint

114 115 Bacterial strains and culture conditions 116 Bacterial strains used in this study are listed in Supplementary Table 1. Plasmids used in 117 this study are listed in Supplementary Table 2. Most of the in vitro and all of the in vivo 118 work was performed with Salmonella enterica serovar Typhimurium (STm) strain IR715, 119 a fully virulent, nalidixic acid -resistant derivative of strain ATCC 14028s , as well as an 120 isogenic pgtE mutant of IR715 . For some in vitro experiments, we employed the 121 Salmonella enterica serovar Typhimurium sequence type ST313 strain D23580 and its 122 isogenic pgtE mutant (39). 123 124 IR715 and D23580 strains were cultured on LB agar plates that were supplemented with 125 50 µg/ml nalidixic acid or 30 µg/ml chloramphenicol, respectively. IR715 and E. coli XL1-126 Blue strains transformed with a low -copy plasmid (pWSK29) encoding wild -type pgtE 127 (pPgtE) or a pgtE inactive mutant (pPgtE -D206A) were grown on LB agar plates 128 supplemented with 100 µg/ml carbenicillin. For each inoculum, three colonies were 129 cultured overnight in 5ml of medium without antibiotic selection. All bacteria were cultured 130 with shaking/rolling, unless otherwise stated. For animal infections, all strains were 131 cultured in L broth (LB; 10 g/L tryptone, 5 g/L yeast extract, 10 g/ L NaCl) aerobically at 132 37 °C, overnight. For in vitro experiments, strains were cultured in either LB or SPI2 -133 inducing phosphate -carbon-nitrogen (PCN) liquid media supplemented with low 134 magnesium (InSPI2 LowMg2+) (41), aerobically at 37 °C, overnight. 135 136 Generation of bacterial mutants 137 Primers used in this study are listed in Supplementary Table 3. The STm pgtE mutant 138 was constructed by allelic exchange with the plasmid pGP704 containing a tetracycline 139 resistance cassette flanked by 1 kb regions upstream and downstream of the pgtE gene. 140 Primers were used to PCR amplify 1kb upstream (left border, LB) and downstream (right 141 border, RB) of the pgtE gene. The resulting products were fused in a fusion PCR and 142 cloned into vector pCR -Blunt II-TOPO (Invitrogen). The resulting plasmid, pCRII ::pgtE-143 LBRB, was sequenced and subsequently cut with SalI and EcoRV. The pgtE-LBRB 144 fragment was gel purified and cloned into the SalI and EcoRV digested vector pGP704 145 and transformed into E. coli CC118 𝛌pir. The resulting plasmid, pGP704::pgtE-LBRB, was 146 cut with XbaI, and an NheI-digested tetracycline resistance cassette (tetRA) from pSPN23 147 was ligated into the plasmid and again transformed into CC118 𝛌pir. The resulting plasmid, 148 pGP704::pgtE-LBRB::tetRA, was transformed into E. coli S17-1 𝛌pir, then the strain was 149 conjugated with STm IR715, generating strain IR715 ΔpgtE via after selecting and 150 screening for double-crossover events from homologous recombination. The integration 151 of the resistance cassette and the deletion of the pgtE gene were confirmed by Southern 152 blot using a probe for the 1kb region upstream of pgtE, and the North2South 153 Chemiluminescent Hybridization and Detection kit (Thermo Fisher). D23580 ΔpgtE was 154 constructed by transducing the pgtE deletion from IR715 to D23580 with P22 HT105/1 155 int-201. 156 157 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint For constitutive expression of the mCherry fluorescent protein, STm strains were 158 transduced with a P22 lysate derived from STm SL1344 glmS::Ptrc-mCherryST::Cm (42), 159 followed by removal of the CmR cassette using pCP20 (43). 160 161 For clean insertion of the FLAG sequence at the C -terminus of the chromosomal pgtE 162 gene, primers for Gibson assembly were designed with the NEBuilder Assembly Tool 163 (https://nebuilder.neb.com/#!/). FLAG_Downstream_Fwd and FLAG_Upstream_Rev 164 primers respectively carried the FLAG sequence extension ( GAC TAC AAG GAC GAC 165 GAT GAC AAG) and the reverse complement of the FLAG sequence. Chromosomal 166 IR715 DNA was PCR-amplified with the primer pairs of FLAG_Upstream_Fwd and 167 FLAG_Upstream_Rev, and FLAG_Downstream_Fwd and FLAG_Downstream_Rev by 168 PCR with High-Fidelity PCR Master Mix with HF buffer (New England Biolabs #M0531S) 169 per manufacturer’s instructions. The plasmid pRDH10 was digested with the restriction 170 enzymes Nru I (New England Biolabs #R3192S) and SphI -HF (New England Biolabs 171 #R3182S) per manufacturer’s instructions. All three products were then run on a 1% 172 agarose gel, purified with a Zymoclean Gel DNA recovery kit (Zymo Research #D4001), 173 and assembled with NEBuilder Hifi DNA assembly master mix at a 2:1 molar ratio (New 174 England Biolabs #E5520S) following manufacturer’s instructions. 175 176 An aliquot of 100 µL of chemically competent CC118 𝛌pir was thawed on ice then 177 incubated with 2 µL of Gibson assembly product on ice for 30 minutes. Cells were then 178 incubated at 42  °C in a water bath for 45 seconds, incubated on ice for 5 minutes, diluted 179 with 1 mL of LB, and cultured for 1 hour aerobically at 37 °C. Cells were the n spread-180 plated on LB agar plates that were supplemented with 30 µg/ml chloramphenicol , 181 incubated overnight at 37 °C, then screened for tetracycline resistance the following day. 182 After confirming correct Gibson assembly via sequencing of the plasmid by Primordium 183 Labs, chemically competent S17 -1 𝛌pir cells were transformed as above with 184 pRDH10::pgtE-FLAG isolated via QIAprep Spin Miniprep kit (Qiagen #27106) from 185 CC118 𝛌pir pRDH10::pgtE-FLAG. The resulting strain was used to conjugate the plasmid 186 to STm IR715. Following conjugation, cells were incubated on LB agar plates to screen 187 for resistance to both nalidixic acid and chloramphenicol . Cells that had undergone 188 plasmid integration into the chromosome (single crossover events) were then counter -189 selected using Nutrient Broth with 7% sucrose (sacB gene residing in pRDH10) . Clean 190 insertion of chromosomal pgtE-FLAG was confirmed by PCR with primer pair 191 FLAG_Verification_Fwd and FLAG_Verification_Rev , followed by sequencing by 192 Primordium. 193 194 Complementation and reporter plasmids 195 To construct the PgtE complementation plasmid, the pgtE region was PCR-amplified from 196 STm genomic DNA. A 300 bp region upstream of the coding sequence was amplified to 197 include relevant regulatory elements. The PCR product was cloned into plasmid pCR -198 Blunt II -TOPO using the Zero Blunt TOPO PCR Cloning Kit (Invitrogen) following the 199 manufacturer’s protocol. The product was then subcloned into the multiple cloning site of 200 low-copy plasmid pWSK29 using XhoI and EcoRV to generate plasmid pWSK29:: pgtE 201 (pPgtE). A m issense point mutation was introduced into pWSK29:: pgtE using the 202 QuikChange Site -Directed Mutagenesis Kit (Agilent) to create pWSK29::pgtE-D206A. 203 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint Sequences were confirmed by Sanger sequencing (Eton Bioscience) or Oxford Nanopore 204 Technology (Primordium Labs). 205 206 To construct the pgtE reporter plasmid, the pgtE promoter was amplified from STm 207 SL1344 genomic DNA with the oligos PpgtE -XbaI-F (engineered restriction sites are 208 underlined) and PpgtE-SmaI-R. The amplicon was digested with XbaI/SmaI and ligated 209 into XbaI/SmaI-digested pGFPmut3.1, then the pgtE-gfpmut3.1 cassette was excised by 210 XbaI/ApaI digestion, and ligated into the corresponding sites of pMPM-A3∆Plac. 211 212 Serum and serum treatments 213 Normal human serum (NHS; #NHS), C3 -depleted human serum (#A314), and cobra 214 venom factor (CVF ; #A150) were procured from Complement Technology. For mouse 215 serum, blood was collected from uninfected C3+/+ and C3-/- mice through cardiac puncture 216 with a 25-gauge needle. Mouse serum was subsequently recovered by centrifugation of 217 blood for 5 minutes at 10,000 x g using Serum Gel Polypropylene Microtubes (Sarstedt, 218 #41.1378.005). The serum was then pooled from several mice, aliquoted, and stored at -219 80 °C. Both human and mouse sera were used after thawing a maximum of one time. 220 221 Mice 222 The Institutional Animal Care and Use Committee (IACUC) at UC San Diego approved 223 all mouse experiments perfomed at the institution (protocol #S17107). The IACUC at 224 Washington State University approved mouse bone marrow collection for the generation 225 of bone marrow-derived macrophages (protocol #6785). Mice were housed under specific 226 pathogen-free conditions and were provided with an irradiated 2020X Teklad diet 227 (Envigo). Furthermore, mice were randomly grouped in cages, with a maximum of five 228 animals per cage. 229 230 The study utilized C57BL/6 wild-type mice, C3-/- mice (44), and Cybb-deficient mice (The 231 Jackson Laboratory #002365) (45). For in vivo experiments depleting complement with 232 CVF, six -to-eight-week-old female C57BL/6J mice (The Jackson Laboratory) were 233 intraperitoneally injected with 0.1ml of phosphate-buffered saline ( PBS) or 12.5 (one 234 experiment) or 25 (two experiments) µg/ml CVF one day before bacterial infection (46). 235 For all other experiments, six-to-ten-week-old female and male mice, bred and housed at 236 UC San Diego, were used in the experiments, with similar numbers of female and male 237 mice in each experimental group. For experiments with C3-/- mice, we used wild -type 238 littermate control mice from the same colony (C57BL/6 background). Cybb-deficient mice 239 were bred homozygous (CybbX-/X- females) or hemizygous (CybbX-/Y males). 240 241 For all in vivo experiments, STm strains were cultured aerobically in LB at 37 °C overnight. 242 Mice were intraperitoneally infected with 1x10 4 colony-forming units ( CFUs) of STm. 243 Blood was collected via cardiac puncture with a 25-gauge needle and syringe pre-coated 244 with 0.5M EDTA to prevent coagulation. Liver and spleen tissues were homogenized in 245 PBS, and samples were plated on LB agar supplemented with 50 µg/ml nalidixic acid. 246 247 Cell culture reagents 248 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint For cell culture media, we primarily used RPMI 1640 medium with L -glutamine and 249 Phenol Red (Gibco #11875093). In luminol assays, we employed RPMI 1640 medium 250 with no glutamine and no phenol red (Gibco #32404014). As indicated in the respective 251 sections, RPMI was supplemented with the following components, depending on the 252 experiment: heat-inactivated Fetal Bovine Serum (HI -FBS) (Gibco #A3840001), 253 Antibiotic-Antimycotic solution (Gibco #15240062), Gentamicin (Gibco #15710064), 254 HEPES (Gibco #15630080), EDTA (Fisher Scientific #S311 -500). D ulbecco’s PBS 255 (DPBS; Gibco #14190) was used for dislodging bone marrow-derived macrophages and 256 for the neutrophil Enrichment Kit isolation medium. 257 258 Bone marrow isolation and bone marrow-derived macrophage culture conditions 259 Murine bone marrow-derived macrophages (BMDMs) were prepared by maturing freshly 260 isolated bone marrow cells from femurs and tibias. Bone marrow cells were isolated with 261 a 21-gauge needle, filtered through a 70 µm filter, then subjected to Ammonium-Chloride-262 Potassium (ACK) lysis (150 mM NH 4Cl, 10 mM KHCO 3, 0.1 mM Na 2EDTA) buffer to 263 remove excess red blood cells. For BMDMs used in fluorescent microscopy, cells were 264 cultured for 5 days in RPMI 1640 medium with L -glutamine supplemented with 20% 265 supernatant from L929 cells, and 10% HI-FBS. BMDMs were then re -seeded two days 266 prior to infection. For BMDMs used to assess Salmonella burden and PgtE function, cells 267 were then cultured for 7 days in RPMI 1640 medium with L-glutamine supplemented with 268 30% supernatant from L929 cells, 10% HI -FBS, and 1x Antibiotic -Antimycotic in Sigma 269 culture dishes (Z358762). 18 hours prior to infection, cold DPBS was used to dislodge the 270 cells, and BMDMs were seeded in RPMI 1640 medium with L -glutamine supplemented 271 with 10% HI-FBS in 24-well plates (Corning #3524) at a density of 5x10 5 cells/well or 6-272 well plates at a density of 2x106 cells/well (Corning #3516). 273 274 Murine macrophage infection for bacterial enumeration 275 For macrophage infection experiments, STm strains were grown statically in LB media in 276 an aerobic environment at 37 °C overnight. A concentration of 1.67x10 7 CFU/ml of STm 277 was incubated in 20% mouse serum (opsonized) or PBS (non-opsonized) for 30 minutes 278 at room temperature. Subsequently, STm was diluted 1:10 in RPMI 1640 medium with L-279 glutamine supplemented with 10% HI -FBS for an inoculum of 2% mouse serum with 280 1.67x106 CFU/ml STm. An aliquot of 300uL of this inoculum was added to BMDMs in a 281 24-well plate to reach an MOI of 1. The plate was centrifuged at 360 x g for 5 minutes at 282 room temperature then transferred to a 37 °C tissue culture incubator. After 30 minutes 283 of infection, BMDMs were washed with PBS then treated with RPMI 1640 medium with 284 L-glutamine supplemented with 10% HI-FBS and 100 µg/ml gentamicin for 30 min before 285 replacement with RPMI 1640 medium with L -glutamine supplemented with 10% HI-FBS 286 and 20 µg/ml gentamicin for the remainder of the assay. BMDMs were washed with PBS 287 then lysed with 1% Triton X -100 surfactant (EMD Millipore #EM -9400) in PBS at 30 288 minutes, 8 hours, and 24 hours post-infection. CFUs were enumerated by plating aliquots 289 of serially diluted lysates onto LB agar supplemented with 50 µg/ml nalidixic acid. 290 291 Western blot detection of PgtE-FLAG and PgtE-dependent C3 cleavage 292 To assess PgtE-dependent cleavage of C3 in vitro, strains of STm and E. coli XL1-Blue 293 were cultured overnight in LB or in InSPI2 LowMg 2+ media in an aerobic environment at 294 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint 37 °C. Bacteria were then incubated with 20% normal human serum (NHS) in PBS at 295 1.67x109 CFU/ml for 8 hours. Samples were subsequently centrifuged at 10,000 x g for 5 296 minutes, and supernatants were collected for Western blotting. 297 298 To assess PgtE-dependent cleavage of C3 by intracellular STm isolated from BMDMs, 299 STm strains were cultured by rotating in LB media in an aerobic environment at 37 °C 300 overnight. STm was incubated in 20% mouse serum in PBS for 30 minutes at 37 °C at a 301 concentration of 2x107 CFU/ml. STm was then diluted 1:40 in RPMI 1640 medium with L-302 glutamine supplemented with 10% HI-FBS, then added to BMDMs in a 6-well plate at an 303 MOI of 10. Plates were centrifuged at 360 x g for 5 minutes at room temperature and then 304 transferred to a 37 °C tissue culture incubator. After 30 minutes of infection, BMDMs were 305 washed with PBS then treated with RPMI 1640 medium with L -glutamine supplemented 306 with 10% HI -FBS and 100 µg/ml gentamicin for 30 min before replacement with RPMI 307 1640 medium with L-glutamine supplemented with 10% HI-FBS and 20 µg/ml gentamicin 308 for 7.5 hours. Infected BMDMs were then washed with PBS and lysed with water for 10 309 minutes at 37 °C. Six infected wells were pooled together for each group, washed, 310 resuspended in 100 µl of 20% NHS in PBS, then shaken at 300 rpm at 37 °C for 13 hours. 311 Samples were then centrifuged at 10,000 x g for 5 minutes , and supernatants were 312 collected for western blotting. 313 314 To assess PgtE protein production by in vitro cultures, STm WT and STm pgtE-FLAG 315 (strain ML27) were cultured overnight in LB or in InSPI2 LowMg 2+ media in an aerobic 316 environment at 37 °C. 5x108 CFUs were washed twice in PBS ; pellets were frozen at -317 80 °C for 30 minutes, then resuspended in 50 µl of lysis buffer (2% 2 -Mercaptoethanol, 318 2% SDS, 10% glycerol, and 0.1M TrizmaHCl in water adjusted to pH 6.8). Samples were 319 incubated at 95 °C for 20 minutes then spun down for 10 minutes at 10,000 x g. 320 321 For electrophoresis, samples were prepared with RunBlue LDS Sample Buffer (Expedeon 322 #NXB31010) and 5mM dithiothreitol (Thermo Scientific #R0861). Electrophoresis was 323 conducted using a Mini Gel Tank (Invitrogen #A25977), Novex Tris -Glycine Mini Protein 324 Gel 4 -12% (Invitrogen #XP04125BOX), WesternSure Pre -stained Chemiluminescent 325 Protein ladder (Li-Cor #926-98000) and MES SDS Running Buffer (Invitrogen #B0002) at 326 90 volts for 80 minutes. Semi-dry transfer was performed with a Trans-Blot SD Semi-Dry 327 Transfer Cell (Bio -Rad), Immun -Blot PVDF membrane (Bio -Rad #1620177), and 328 Whatman GB003 gel blotting papers (Whatman #10427806) at 20 volts for 1 hour. 329 330 Membranes were blocked with 5% (w/v) Nonfat dry milk (LabScientific #M0841) in Tris-331 buffered saline with 0.1% (w/v) Tween 20 (TBST) rocking for 2 hours at room temperature. 332 For PgtE -dependent complement cleavage, membranes were then incubated with 333 purified anti -complement C3/C3b/iC3b/C3d antibody (BioLegend #846302 clone 334 1H8/C3b) diluted to 1:5,000 in 5% milk in TBST rocking overnight at 4 °C. After 5 washes 335 with TBST, membranes were then incubated with HRP goat anti-mouse IgG (BioLegend 336 #405306) diluted to 1:20,000 in 5% milk in TBST rocking overnight at 4 °C. For detection, 337 membranes were washed 5 times with TBST, incubated for 10 minutes in the dark with 338 ECL Prime Western Blotting Detection Reagents (Amersham #RPN2232), and then 339 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint imaged with an Azure 300 Chemiluminescent Western Blot Imager (Azure Biosystems 340 #AZ1300-01). 341 342 For PgtE-FLAG tag analysis, after semi -dry transfer, PVDF membranes were cut in half 343 at the 50 kDa protein ladder mark. The bottom half of the membrane was then incubated 344 with purified rat anti-DYKDDDDK Tag antibody (anti-FLAG tag; BioLegend #637319 clone 345 L5) diluted to 1:5,000 in 5% milk in TBST rocking overnight at 4 °C. After 5 washes with 346 TBST, membranes were then incubated with HRP goat anti-rat IgG (BioLegend #405405) 347 diluted to 1:5,000 in 5% milk in TBST rocking overnight at 4 °C. The top half of the 348 membrane was incubated with mouse anti-DnaK (E. coli) antibody (Enzo #ADI-SPA-880-349 D clone 8E2/2) diluted to 1:10,000 in 5% milk in TBST, rocking overnight at 4 °C. After 5 350 washes with TBST, membranes were then incubated with HRP goat anti -mouse IgG 351 antibody (BioLegend #405306) diluted to 1:10,000 in 5% milk in TBST rocking overnight 352 at 4 °C. For detection, membranes were washed 5 times with TBST, incubated for 10 353 minutes in the dark with ECL Prime Western Blotting Detection Reagents (Amersham 354 #RPN2232), and then imaged with a GeneGnome (Synoptics). 355 356 O-Antigen Staining 357 STm and E. coli XL1-Blue strains were cultured overnight in LB or in InSPI2 LowMg 2+ 358 media in an aerobic environment at 37 °C. 5x108 CFU was washed twice in PBS and then 359 resuspended in 100 µl of lysis buffer (2% 2-Mercaptoethanol, 2% SDS, 10% glycerol, and 360 0.1M TrizmaHCl in water adjusted to pH 6.8). Samples were incubated at 95 °C for 10 361 minutes and then incubated with 1.25 µl of Proteinase K ( 20mg/ml; Viagen #501-PK) 362 overnight at 55 °C. Lysates were prepared for electrophoresis with Laemmli Sample 363 Buffer (Bio-Rad #1610747) and 7.5% 2-Mercaptoethanol. Electrophoresis was conducted 364 using a Mini Gel Tank (Invitrogen #A25977), Novex Tris-Glycine Mini Protein Gel 4-12% 365 (Invitrogen #XP04125BOX), and MES SDS Running Buffer (Invitrogen #B0002) at 25 mA 366 for 2 hours. O -antigen staining was then performed with Pro -Q Emerald 300 367 Lipopolysaccharide Gel Stain Kit (Invitrogen #P20495) following the manufacturer’s 368 instructions. Gels were imaged with the 302 nm UV transilluminator of an Azure 200 369 (Azure Biosystems #AZ1200-01). 370 371 Mouse neutrophil isolation 372 Fresh femur- and tibia-isolated bone marrow cells were isolated with a 21-gauge needle 373 and filtered through a 70 µm filter. Neutrophils were isolated with the EasySep Mouse 374 Neutrophil Enrichment Kit (Stemcell Technologies #19762) following the manufacturer’s 375 instructions for the EasySep Magnet (Stemcell Technologies #18000). The isolation 376 medium consisted of DPBS supplemented with 2% HI-FBS and 1 mM EDTA. 377 378 Neutrophil killing assay 379 Murine bone marrow neutrophils were resuspended in RPMI 1640 medium with L -380 glutamine supplemented with 10% HI -FBS and 1mM HEPES, then plated at 5x10 5 381 cells/well in a 96 -well round bottom cell culture plate (Costar #3799). Neutrophils were 382 incubated in a 37 °C tissue culture incubator for 30 minutes prior to infection. 383 384 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint STm strains were cultured overnight in LB or in InSPI2 LowMg 2+ media in an aerobic 385 environment at 37 °C. A concentration of 5x10 8 CFU/ml of STm was incubated in 20% 386 mouse serum from C3 +/+ and C3 -/- mice (opsonized) or PBS (non -opsonized) for 30 387 minutes at room temperature. STm was then diluted 1:10 in RPMI 1640 medium with L -388 glutamine supplemented with 10% HI-FBS and 1mM HEPES, resulting in an inoculum of 389 5x107 CFU/ml STm with 2% mouse serum. Subsequently, 100 µl of inoculum was added 390 to wells with 100 µl of medium or 100 µl of 5x10 5 neutrophils for an MOI of 10. After 2.5 391 hours in a 37 °C tissue culture incubator, 100 µl of 2% Triton X-100 surfactant in PBS was 392 added to 100 µl of culture. CFUs were enumerated by plating aliquots of serially diluted 393 lysates onto LB agar supplemented with 50 µg/ml nalidixic acid. 394 395 Luminol Assay 396 STm strains were grown aerobically overnight at 37 °C, then sub-cultured in LB (1:100 397 dilution) or in InSPI2 LowMg2+ media (1:10 dilution) and grown aerobically at 37 °C for 3 398 hours. A concentration of 1x108 CFU/ml of STm was then incubated in 20% mouse serum 399 from C3 +/+ and C3 -/- mice for 30 minutes at room temperature. Murine bone marrow 400 neutrophils were resuspended in RPMI 1640 medium with no glutamine and no phenol 401 red supplemented with 2% HI-FBS and 1mM Luminol (Millipore Sigma #123072-2.5g) at 402 1.11x106 neutrophils/ml. 90 µl of 1.11x106 neutrophils/ml were added to a white opaque 403 96-well microplate ( OptiPlate-96; Revvity #6005290). The plate was sealed with a 404 Breathe-Easy sealing membrane ( Diversified Biotek #BEM-1), and baseline 405 luminescence was measured with a Synergy HTX Multi-Mode Microplate Reader (Agilent, 406 formerly BioTek) at 37 °C. An aliquot of 10 µl of opsonized STm was then quickly added 407 to each well for a final concentration of 10 6 neutrophils/ml, an MOI of 10 , and a final 408 concentration of 2% mouse serum, then resealed with Breathe-Easy sealing membrane. 409 Luminescence was recorded every 2 minutes for 120 minutes. 410 411 Fluorescence Microscopy 412 Infected macrophages were fixed in 2.5% (w/v) paraformaldehyde at 37 °C for 10 min 413 then washed three times in PBS. Monolayers were permeabilized in 10% (v/v) normal 414 goat serum (Life Technologies), 0.2% (w/v) saponin in PBS for 20 min at room 415 temperature, incubated with primary antibodies for 45 min at room temperature, washed 416 three times with 0.2% (w/v) saponin in PBS, then incubated with secondary antibodies for 417 45 min at room temperature. Coverslips were washed in PBS, incubated with Hoechst 418 33342 (ThermoFisher Scientific) for 1 min to stain DNA, and then mounted onto glass 419 slides in Mowiol (Calbiochem). Samples were viewed with a Leica DM4000 420 epifluorescence upright microscope for quantitative analysis or a Leica SP8 confocal 421 laser-scanning microscope for image acquisition. Samples were blinded during the 422 experiment. Representative confocal micrographs of 1024x1024 pixels were acquired 423 and assembled using Adobe Photoshop CS6. 424 425 Statistical analysis of data 426 The experiments were not randomized. No statistical methods were used to predetermine 427 the sample size. Prism 10 software (GraphPad) was used for statistical analysis. For in 428 vivo experiments, outliers found by ROUT outlier analysis Q= 1% are removed. Data were 429 analyzed by Kruskal-Wallis test (non-parametric, no pairing) followed by Dunn’s multiple 430 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint comparison test. Serum killing assays were analyzed with a Two-way ANOVA followed 431 by Sidak multiple comparison test. Neutrophil killing assays were analyzed with a One-432 way ANOVA Kruskal-Wallis test followed by Dunn’s comparison test. For luminol assays, 433 Two-way ANOVA analysis was performed; the source of variation for significance is the 434 Time x Column Factor. 435 436 437 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint

438 439 PgtE promotes immune complement resistance in vivo. 440 441 Prior studies identified a potential role for PgtE in promoting STm colonization in mice 442 and chicken s (37, 39, 47) and described several potential proteolytic targets in vitro , 443 including complement factor B, complement factor H, C3, C3b, C4b, and C5 (36, 38, 39). 444 445 All three immune complement pathways converge at C3 (48). To elucidate whether PgtE 446 enables STm to evade immune complement in vivo, we infected C3-/- mice and their C3+/+ 447 littermates intraperitoneally with STm WT (strain IR715, a fully virulent NalR derivative of 448 ATCC 14028s) or an isogenic Δ pgtE mutant (Fig. 1A-E). After 24 hours, we assessed 449 bacterial burden in the blood ( Fig. 1B), liver (Fig. 1C), and spleen (Fig. 1D). The ΔpgtE 450 mutant was recovered at significantly lower levels than STm WT in the blood, but was 451 fully rescued in C3-/- mice (Fig. 1B). Similar differences between STm WT and the ΔpgtE 452 mutant were observed in the liver and spleen of C3+/+ mice, although they did not reach 453 statistical significance. In all cases, while STm WT equally infected C3+/+ and C3-/- mice, 454 the ΔpgtE mutant was recovered at much higher levels in the spleen and liver of C3-/- 455 mice when compared to C3+/+ littermates (Fig. 1C, D). Furthermore, C3-/- mice infected 456 with the Δ pgtE mutant exhibited significantly higher weight loss than the infected C3+/+ 457 mice (Fig. 1E). Thus, PgtE enables STm to evade immune complement defense in vivo, 458 particularly in the blood. 459 460 We further investigated PgtE-dependent evasion of complement by infecting mice treated 461 with cobra venom factor (CVF), a C3 convertase homolog which depletes complement 462 (46) (Fig. 1F -J). Mice treated with PBS (control) or CVF for 24 hours were infected 463 intraperitoneally with STm WT or the Δ pgtE mutant (Fig. 1F), and bacterial burden was 464 assessed in the blood (Fig. 1G), liver (Fig. 1H), and spleen (Fig. 1I) at 24 hours. Similar 465 to C3+/+ mice, the ΔpgtE mutant was recovered at significantly lower levels than STm WT 466 in the blood of control -treated mice but was rescued in CVF -treated mice (Fig. 1G). No 467 significant differences were observed in the liver (Fig. 1H) and spleen (Fig. 1I). To confirm 468 that CVF treatment effectively depleted complement C3, we determined serum C3 469 concentration by ELISA. As expected, mice treated with CVF had reduced serum C3 470 compared to control -treated mice ( Fig. 1J ). Within the control -treated group, mice 471 infected with STm WT had significantly less serum C3 compared to mice infected with the 472 ΔpgtE mutant (Fig. 1J), suggesting that PgtE reduced serum C3 concentrations. Thus, 473 PgtE enables STm to defend against immune complement in vivo. 474 475 Wild-type STm cleaves complement C3 in a PgtE -dependent manner when grown 476 in conditions that mimic the phagosome or grown in macrophages 477 478 Previous in vitro studies used strains with a defective O-antigen, and thus were avirulent, 479 to show PgtE-dependent cleavage of immune complement (36, 38, 39). As we identified 480 a potential role for PgtE in cleaving C3 in vivo, we hypothesized that PgtE act s by a 481 different mechanism in fully virulent STm. 482 483 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint Transcriptome analysis has revealed that STm increases pgtE expression in infected 484 murine macrophages (49), indicating that PgtE may function in these cells. To elucidate 485 the time course of pgtE expression, we infected bone marrow -derived macrophages 486 (BMDMs) with a n STm strain carrying a chromosomally encoded P trc::mCherry, for 487 constitutive expression of mCherry fluorescent protein and a plasmid encoding a 488 PpgtE::gfp transcriptional reporter fusion ( Fig. 2A). Monitoring GFP fluorescence over 489 time by fluorescence microscopy revealed that 4.3% and 80% of bacteria were GFP -490 positive at 30 minutes and 8 hours post -infection, respectively ( Fig. 2B). These results 491 indicated a temporal induction of pgtE expression following STm infection of BMDMs. 492 493 The phagosome’s environment can be modeled in vitro using minimal phosphate-carbon-494 nitrogen (PCN) media supplemented with low magnesium. This medium induces SPI2 495 expression and is thus referred to as “InSPI2 LowMg 2+”. In alignment with the 496 macrophage results, pgtE expression is also increased in this medium (41). We thus 497 investigated whether PgtE activity in vitro was dependent on culture conditions. We grew 498 the following strains in standard LB or in InSPI2 LowMg 2+ media: STm WT, the Δ pgtE 499 mutant, and the ΔpgtE mutant complemented with a plasmid encoding pgtE (STm ΔpgtE 500 pPgtE). As controls, we used an O -antigen-deficient E. coli strain expressing either 501 functional pgtE (E. coli pPgtE) or nonfunctional pgtE with a missense point mutation ( E. 502 coli pPgtE D206A). Each culture was then incubated with normal human serum (NHS), 503 which contains complement, to investigate C3 cleavage by Western blot. 504 505 In line with previous studies (35, 36, 40), STm WT grown in LB was unable to cleave C3 506 in a PgtE-dependent manner (Fig. 2C, Left). The O-antigen-deficient E. coli cleaved C3 507 when expressing functional PgtE, consistent with the hypothesis that long O -antigen 508 sterically inhibits PgtE function ( Fig. 2C, Left). Strikingly, however, STm WT cultured in 509 InSPI2 LowMg2+ media cleaved C3 in a PgtE -dependent manner, as shown by two C3 510 cleavage products that were absent from sera incubated with STm Δ pgtE (Fig. 2C, 511 Right). Genetic complementation in trans recovered PgtE-dependent C3 cleavage, albeit 512 to a lesser extent than STm WT. 513 514 As InSPI2 LowMg2+ media models the intraphagosomal environment , we next 515 investigated whether STm WT could cleave C3 when grown inside macrophages. We 516 infected BMDMs with STm strains (WT, the ΔpgtE mutant, and the complemented strain) 517 for 8 hours, then lysed the infected cells to retrieve STm. Bacteria isolated from 518 macrophages were then incubated with NHS to detect their ability to cleave C3. We 519 detected a C3 fragment in serum incubated with STm WT isolated from macrophages, 520 but not in serum incubated with the ΔpgtE mutant (Fig. 2D). In this experimental setting, 521 genetic complementation did not restore detectable PgtE-dependent C3 cleavage. 522 Comparing these results with those generated with STm cultured in InSPI2 LowMg 2+ 523 media (Fig. 2C, Right), where also one additional fragment was detected, we speculate 524 that this discrepancy is attributable to the technical limitation of isolating substantially 525 fewer STm from infected BMDMs than from overnight cultures. Nevertheless, our results 526 demonstrate that PgtE is functional in STm with an intact O -antigen depending on the 527 growth conditions, enabling the pathogen to cleave C3 when cultured in InSPI2 LowMg2+ 528 media or when isolated from macrophages. 529 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint 530 Growth conditions that model the phagosome’s environment increase PgtE 531 expression and decrease O-antigen length 532 533 PgtE activity can be observed in vitro among strains with an intact O-antigen as long as 534 they are cultured in media that mimic s the intraphagosomal environment. As avirulent 535 mutants lacking an O-antigen have previously been shown to exhibit PgtE function, and 536 as in vitro culture conditions and growth in macrophages can alter O-antigen length in 537 wild-type strains (50, 51), we sought to determine whether the O -antigen length of our 538 virulent, smooth strains was being altered by these growth conditions. To this end, we 539 extracted and stained the O-antigen from STm strains cultured in LB or in InSPI2 LowMg2+ 540 media. All STm strains cultured in InSPI2 LowMg 2+ media had shorter O -antigen 541 compared to STm cultured in LB ( Fig. 2E). As expected, the rough E. coli strain that we 542 used to express PgtE lacked O-antigen polysaccharides. Consistent with the observation 543 that steric hindrance conferred by the presence of an O-antigen impacts PgtE function, 544 PgtE activity was greatest when the protease was expressed by the rough E. coli strain 545 (Fig. 2C). By contrast, although t he shorter O -antigen detected in smooth STm strains 546 cultured in InSPI2 LowMg 2+ media likely enable d PgtE’s ability to function at all , the 547 intermediary PgtE activity observed is likely the consequence of lingering steric hindrance 548 conferred by the still present, albeit shorter, O -antigen. Nevertheless, these results are 549 consistent with the idea that the shorter O-antigen induced by growth in InSPI2 LowMg2+ 550 media enables complement C3 cleavage by PgtE (Fig. 2C, E). 551 552 The absence of PgtE activity when wild-type STm is cultured in LB could be due to a lack 553 of PgtE expression or it could be solely explained by the steric hindrance caused by the 554 long O-antigen. To assess whether PgtE is expressed in LB , we constructed a n STm 555 strain with a chromosomal pgtE allele harboring a FLAG tag at the C-terminus (STm pgtE-556 FLAG). We found that the FLAG tag was detectable when STm pgtE-FLAG was cultured 557 in InSPI2 LowMg 2+ medium, but not in LB ( Fig. 2F ). As expected, no FLAG tag was 558 detected in STm WT in either condition. Thus, growth in InSPI2 LowMg 2+ media has a 559 two-pronged effect: 1) increasing PgtE expression; 2) shortening O-antigen length, which 560 enables PgtE function and cleavage of complement C3. 561 562 PgtE appears dispensable for STm survival in primary macrophages under tested 563 conditions 564 565 Our findings suggest a role for PgtE to enable Salmonella survival inside of macrophages. 566 Even though complement is generally known to opsonize and lyse pathogens in 567 extracellular spaces, recent studies have identified a role for complement in intracellular 568 compartments (52–54). We thus tested whether PgtE disrupts intracellular C3 signaling 569 and promotes STm survival within macrophages by infecting BMDMs with STm WT, the 570 ΔpgtE mutant, or the complemented ΔpgtE mutant. The strains were either nonopsonized 571 (Fig. 2G-I) or opsonized with normal mouse serum ( Fig. 2J-L). We recovered a similar 572 number of each STm strain at each of the time points analyzed, from 30 minutes post -573 infection (when pgtE is not highly expressed; Fig. 2A, B) to 8 hours (high pgtE induction) 574 and even 24 hours post -infection, in both the non -opsonized and the opsonized groups 575 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint (Fig. 2G-I and Fig. 2 J -L). As such, PgtE did not enhance STm survival in BMDMs in 576 these conditions, even though it is highly produced and cleaves C3 in these cells. 577 578 PgtE increases STm serum resistance 579 580 To determine whether PgtE promotes STm resistance to serum killing, we cultured STm 581 WT, the Δ pgtE mutant, and the complemented Δ pgtE mutant in either LB or InSPI2 582 LowMg2+ media and exposed them to 20% normal human serum (NHS). When STm was 583 cultured overnight in LB ( Fig. 3A), all strains showed similar survival. However, when 584 STm was cultured overnight in InSPI2 LowMg 2+ media, STm WT survived significantly 585 more than the Δ pgtE mutant, with the complemented strain showing an intermediate 586 phenotype (Fig. 3B). To test whether the differences in serum resistance were dependent 587 on PgtE-mediated C3 cleavage, the strains were incubated with C3 -depleted human 588 serum after overnight culture in InSPI2 LowMg 2+ media. In the absence of C3, serum 589 survival of the PgtE mutant was fully restored, and no difference in survival was detected 590 between the three strains ( Fig. 3C). Thus, PgtE enhance d STm serum survival by 591 inhibiting the function of complement. 592 593 Many iNTS isolates display increased expression of pgtE (39). We next tested if PgtE 594 played a similar role in increasing serum survival of iNTS sequence type ST313, a 595 predominant etiologic agent of iNTS disease (55). Similar to what we observed with the 596 ATCC 14028s strain IR715 (sequence type ST19) , no significant difference in serum 597 survival was seen between the ST313 strain D23580 wild-type and an isogenic Δ pgtE 598 mutant when the strains were cultured overnight in LB (Fig. 4A). However, when cultured 599 overnight in InSPI2 LowMg 2+ media, D23580 WT survived significantly better than the 600 isogenic ΔpgtE mutant in normal human serum ( Fig. 4B) but not in C3-depleted human 601 serum ( Fig. 4C). Both D23580 WT and Δ pgtE strains exhibited shortened O -antigen 602 chains when cultured overnight in InSPI2 LowMg2+ media compared to growth in LB (Fig. 603 4D), whereas only WT was able to cleave C3 ( Fig. 4E). Thus, akin to the results with 604 ST19 strains (Fig. 2C, 3), when an ST313 strain is cultured in media mimicking the SCV, 605 PgtE-dependent inhibition of complement results in elevated serum survival (Fig. 4). 606 607 PgtE expression enables STm to evade complement-mediated neutrophil killing 608 609 An important function of complement is to enhance neutrophil killing (48). To test whether 610 PgtE-mediated complement cleavage enhance s STm resistance to neutrophils, we 611 cultured STm WT or the ΔpgtE mutant overnight in either LB (Fig. 5A) or InSPI2 LowMg2+ 612 media (Fig. 5B-C) and infected neutrophils isolated from murine bone marrow. There was 613 no difference in survival when the strains were grown in LB and either non -opsonized or 614 opsonized with normal mouse serum (NMS) prior to the neutrophil infection (Fig. 5A). In 615 contrast, when the strains were grown in InSPI2 LowMg2+ media and opsonized in NMS, 616 STm WT survived significantly better than the Δ pgtE mutant in neutrophil killing assays 617 (Fig. 5B). To assess if complement was the determinant factor in NMS for the difference 618 in survival between STm WT and the Δ pgtE mutant, we opsonized the strains (cultured 619 in InSPI2 LowMg2+ media) with serum from C3+/+ or C3-/- littermate mice. Here, the survival 620 defect of the ΔpgtE mutant in neutrophils was rescued to STm WT levels when the strains 621 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint were opsonized in serum from C3-/- mice (Fig. 5C), indicating that PgtE enables STm to 622 evade complement-mediated neutrophil killing. 623 624 PgtE disrupts C3-induced neutrophil ROS production, helping STm to evade ROS-625 dependent neutrophil killing 626 627 Complement enhances the neutrophil respiratory burst in response to STm (56, 57). To 628 determine if PgtE disrupts C3 -mediated reactive oxygen species (ROS) production by 629 neutrophils, we performed a luminol assay with STm WT and the ΔpgtE mutant opsonized 630 with serum from C3+/+ or C3-/- mice (Fig. 5D). No differences were seen in neutrophil ROS 631 production when the strains were grown in LB prior to opsonization with serum from C3+/+ 632 mice ( Fig. 5D ). In contrast, neutrophils infected with the Δ pgtE mutant exhibited 633 prolonged ROS production compared to neutrophils infected with STm WT when the 634 strains were cultured in InSPI2 LowMg2+ media and were opsonized with serum from C3+/+ 635 mice (Fig. 5D). Strains opsonized with complement-deficient serum induced lower levels 636 of neutrophil ROS production, independent o f PgtE expression ( Fig. 5D ). Thus, PgtE 637 enables STm to evade the heightened ROS production that is triggered by C3 638 opsonization. 639 640 Next, we infected neutrophils isolated from wild -type or Cybb-deficient mice ( Fig. 5E), 641 which have defective ROS production (45). The Δ pgtE mutant exhibited comparable 642 survival as STm WT in neutrophils from Cybb-deficient mice, indicating that PgtE 643 promotes STm resistance to ROS -dependent neutrophil killing ( Fig. 5E ). When we 644 infected Cybb-deficient mice intraperitoneally with STm WT or the Δ pgtE mutant (Fig. 645 5F), we recovered approximately 1-2 log more bacteria in comparison to WT mice in the 646 blood, liver, and spleen (Fig 5; compare to Fig. 1). However, in Cybb-deficient mice, the 647 ΔpgtE mutant was recovered to a similar level as STm WT in the blood ( Fig. 5G), liver 648 (Fig. 5H ), and spleen ( Fig. 5I ). Thus, by disrupting C3 -induced neutrophil ROS 649 production, PgtE helps STm to evade ROS-dependent killing by neutrophils. 650 651 652 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint

653 654 Bacteremia is a major complication of NTS infection, and the mechanisms by which the 655 pathogen evades host immune defenses are not fully understood. Here , we show that 656 PgtE is a virulence factor that helps STm to overcome complement -mediated host 657 defenses, survive in serum, and evade ROS-dependent neutrophil killing. 658 659 PgtE is an outer membrane protease that has been hypothesized to promote STm 660 virulence through multiple mechanisms. For instance, PgtE expressed in rough strains 661 of bacteria has previously been shown to promote adhesion to matrigel (35), suggesting 662 a role for PgtE in enhancing invasion. PgtE also inactivates α2 -antiplasmin while 663 activating plasmin (40) and mammalian matrix metalloproteinase -9 (MMP-9) (37). 664 Macrophages use plasmin and MMP-9 to migrate through tissues, and therefore PgtE 665 was hypothesized to promote the dissemination of STm within infected macrophages (37, 666 40). Furthermore, STm can cleave cationic antimicrobial peptides (34), and multiple 667 components of immune complement in a PgtE -dependent manner (36, 38, 39) . Using 668 immortalized human macrophage-like cells, a recent study showed increased localization 669 of human bactericidal/permeability-increasing protein to SCVs containing PgtE -deficient 670 STm, suggesting that PgtE promotes STm persistence in SCVs (47). 671 672 Collectively, studies with data generated mostly in vitro have proposed that PgtE enables 673 STm to evade antimicrobial peptides and immune complement while promoting an 674 intracellular lifestyle within macrophages. However, to our knowledge, no prior studies 675 have linked these observations to in vivo phenotypes and specific components of host 676 immunity, which requires the use of knock-out mice. Our results show that a STm ΔpgtE 677 mutant is attenuated in the blood of wild -type mice, but fully rescued in C3-/- mice (Fig. 678 1), in mice treated with CVF ( Fig. 1 ), and in Cybb-deficient mice ( Fig. 5 ), thus 679 demonstrating that PgtE promotes STm evasion of complement component C3 and ROS 680 in vivo. 681 682 Identifying where and how PgtE plays a role in vivo was not trivial, as virulent STm has 683 multiple virulence factors that modulate resistance to immune complement. For instance, 684 long O-antigen chains confer serum resistance , but also sterically inhibit PgtE function 685 (40, 58) . Therefore, prior studies used rough STm and rough E. coli mutants when 686 studying PgtE in vitro (36, 38, 39) . Additional mechanisms of STm serum resistance 687 include Rck and TraT, outer membrane proteins that confer serum resistance in vitro to 688 either smooth or rough E. coli and Salmonella (31, 32, 59) by disrupting the complement 689 membrane attack complex (MAC) (60). The many proposed functions of PgtE, by 690 contrast, were observed in rough, avirulent strains. 691 692 Our study indicates that PgtE in fact does function in vitro and in vivo with fully virulent, 693 smooth strains, albeit only after the physiologic O-antigen shortening that follows growth 694 inside the SCV (40, 50, 51) (Figs. 2, 4). A long O-antigen is a primary defense against an 695 array of environmental insults, including immune complement activity. In environments 696 where STm has a shortened O-antigen, such as in the SCV or having recently exited a 697 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint phagocytic cell, PgtE likely represents a secondary line of defense to assist in protecting 698 the more susceptible outer membrane. 699 700 Expression of pgtE and PgtE’s proteolytic function are enhanced in macrophages as well 701 as in media that mimic the SCV lumen (40, 41, 49) (Figs. 2, 4). However, PgtE did not 702 enhance STm survival in primary murine macrophages (Fig. 2), but did protect STm from 703 C3-dependent serum killing (Figs. 3, 4). We obtained comparable results with the iNTS 704 strain D23580 (clade ST313). When cultured in InSPI2 LowMg 2+ media (mimicking the 705 SCV lumen), strain D23580 exhibited reduced O-antigen length, cleaved C3 in a PgtE -706 dependent manner, and surviv ed better in human serum ( Fig. 4). These results are in 707 agreement with a prior study that hypothesized that the increased expression of pgtE, 708 due to a SNP in its promoter region, could enhance iNTS survival and dissemination (39). 709 710 A different study showed that, in response to serum exposure, multiple ST313 strains 711 (including D23580 ), when cultured in LB, increased the expression of long O -antigen 712 regulators but not of pgtE, rck, and traT (61). This suggests that when long O-antigen is 713 present, STm continues to rely on the long O -antigen to resist complement killing. 714 However, when the O-antigen is shortened (Fig. 2, 4), we demonstrate that PgtE defends 715 against complement killing (Fig. 3, 4) and reduces neutrophil ROS production and killing 716 (Fig. 5), thereby promoting bacteremia. Future studies will reveal whether PgtE also has 717 other functions in vivo , and whether cleavage of other substrates contributes to STm 718 pathogenesis. 719 720 721 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint

722 723 This work was funded by the NIH grant AI145325. Additional support was provided by 724 AMED grant JP233fa627003, by the Chiba University-University of California-San Diego 725 (UCSD) Center for Mucosal Immunology, Allergy, and Vaccines, and by the UCSD 726 Department of Pediatrics. M.H.L. was supported by T32 DK007202 and F32 AI169989. 727 JC was supported by NIH grant AI129992. LAK was supported, in part, by a Burroughs 728 Wellcome PATH award. APL was supported by the NIAID Mucosal Immunology Studies 729 Team (MIST). GTW was supported by NIH training grant T32AI007036. We would like to 730 thank Ferric Fang for sending us the D23580 wild-type strain. 731 732 733 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint 734 735 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint Figure 1. PgtE promotes smooth STm survival in vivo by evading complement C3. 736 (A-E) 6-10-week-old C3+/+ and C3-/- littermates were infected intraperitoneally (IP) with 737 104 CFU wild-type (WT) or isogenic PgtE-deficient (ΔpgtE) Salmonella strain IR715. Mice 738 were euthanized 24 hours after infection and bacterial burden in the ( B) blood, (C) liver, 739 and (D) spleen were quantified. (E) Weight loss = (weight at 24 hours / weight at time of 740 infection)*100%. (F-J) 6-8-week-old C57B6/J mice were IP -injected with PBS (Control) 741 or Cobra Venom Factor (CVF). 24 hours after treatment, mice were infected IP with 10 4 742 CFU of either IR715 WT or IR715 ΔpgtE. Mice were euthanized 24 hours after infection 743 and bacterial burden was assessed in the ( G) blood, ( H) liver, and ( I) spleen. ( J) 744 Concentration of complement C3 in plasma measured by ELISA : dotted line represents 745 average from 3 uninfected control mice. (B, G) Dotted line represents the limit of detection 746 of STm CFU in blood. (B-E) N = 16-17 per group pooled from 6 independent experiments. 747 (G-I) N = 15 per group pooled from 3 independent experiments. ( J) ELISA from 1 748 representative experiment. (B-E, G-I) Outliers found by ROUT outlier analysis Q= 1% are 749 removed. Data were analyzed by Kruskal -Wallis test (non -parametric, no n-paired) 750 followed by Dunn’s multiple comparison test. Adjusted p values from Dunn’s multiple 751 comparison test: * p < 0.05. ** p < 0.01. *** p < 0.001. ns = not significant. Symbols 752 represent data from individual mice. Bars represent the ( B-D, G-I) geometric means or 753 (E, J) mean. 754 755 756 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint 757 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint Figure 2. PgtE expression and function are increased in macrophages but do not 758 increase smooth STm survival in macrophages. 759 (A, B) Temporal and spatial distribution of PgtE-positive STm inside BMDMs. (A) BMDMs 760 were infected with mCherry -STm carrying a plasmid encoding for a P pgtE::gfp 761 transcriptional reporter fusion. Representative confocal microscopy images from 1 h and 762 8 h post-infection are displayed. GFP-positive bacteria (green), Salmonella (red), and the 763 cell nuclei (DAPI; blue) are shown. Inset panels show 2x enlarged regions; scale bars are 764 10 μm. ( B) Kinetics of intracellular pgtE expression in BMDMs. The number of GFP -765 positive bacteria at each timepoint was scored by fluorescence microscopy and reported 766 as a percentage of total (red) bacteria (n = 3 experiments). ( C, E) Smooth STm IR715 767 wild-type (WT) , isogenic PgtE -deficient ( ΔpgtE), and ΔpgtE complemented in trans 768 (ΔpgtE pPgtE) or rough E. coli with a pWSK29 plasmid containing a functional pgtE gene 769 (pPgtE) or a pgtE gene with a single point mutation PgtE (pPgtE D206A) were cultured 770 overnight in (Left) LB or (Right) InSPI2 LowMg2+ minimal media. (D) Alternatively, STm 771 was isolated from BMDMs 8 hours after infection. STm and E. coli were then incubated 772 with normal human serum for (C) 8 hours or (D) 13 hours. PgtE-dependent complement 773 cleavage in supernatants was assessed by western blot analysis with anti -complement 774 C3/C3b/iC3b/C3d antibody. ( E) Alternatively, after overnight culture, STm and E. coli 775 were lysed, run on a 4 -12% Tris -Glycine gel, and stained with Pro -Q Emerald 300 776 Lipopolysaccharide Gel Stain Kit to assess O -antigen chain length. ( F) Western blot 777 analysis of STm WT or STm pgtE-FLAG cultured overnight in LB or InSPI2 LowMg 2+ 778 minimal media. The bottom half of the membrane was stained with anti -FLAG tag 779 antibody. The top half of the membrane was stained with anti-DnaK as a loading control. 780 (G-L) BMDMs were infected at an MOI = 1 with IR715 WT, ΔpgtE, and ΔpgtE pPgtE that 781 were either (G-I) not opsonized or ( J-L) opsonized with normal mouse serum. ( G, J) 30 782 minutes after infection, BMDM were lysed with 1% Triton -X 100 and STm CFUs were 783 enumerated. Alternatively, BMDM were incubated with 100 µg/mL gentamicin for 30 784 minutes, followed by (H, K) 7 hours or (I, L) 23 hours with 20 µg/mL gentamicin then lysed 785 with 1% Triton-X 100. (G-L) N = 21 or 7 from 10 or 3 independent experiments. Symbols 786 represent data from BMDMs from individual mice, bars represent the geometric means. 787 788 789 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint 790 Figure 3. PgtE promotes survival of smooth, virulent STm in serum 791 (A-C) Serum killing assays were performed with smooth STm IR715 wild-type (WT) , 792 isogenic PgtE -deficient ( ΔpgtE), and ΔpgtE complemented in trans (ΔpgtE pPgtE). 793 Strains were cultured overnight ( A) in LB or ( B, C) in InSPI2 LowMg 2+ minimal media. 794 STm at 106 CFU/mL was then incubated with (A, B) 20% normal human serum (NHS) or 795 (C) 20% C3-depleted human serum at 37 °C shaking at 300 rpm. CFU were enumerated 796 at 0 minutes, 45 minutes, and 90 minutes. % survival = (CFU at 45 minutes or 90 minutes 797 / CFU at 0 minutes)*100%. (A, C) n = 2, (B) n = 6 from 2-3 independent experiments. Bar 798 and error represent geometric mean and standard deviation. Data were analyzed by 2 -799 way ANOVA followed by Sidak multiple comparison test. Adjusted p values from Sidak 800 multiple comparison test: * p < 0.05. 801 802 803 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint 804 805 Figure 4. PgtE promotes survival of iNTS strain D23580 in serum when cultured in 806 media mimicking the SCV luminal environment. 807 (A-C) Serum killing assays were performed with smooth STm D23580 wild-type (WT) and 808 an isogenic PgtE-deficient mutant (ΔpgtE). Strains were cultured overnight ( A) in LB or 809 (B, C) in InSPI2 LowMg2+ minimal media. STm at 10 6 CFU/mL was then incubated with 810 (A, B) 20% normal human serum (NHS) or (C) 20% C3-depleted human serum at 37 °C 811 shaking at 300 rpm. CFUs were enumerated at 0 minutes, 45 minutes, and 90 minutes. 812 % survival = (CFU at 45 minutes or 90 minutes / CFU at 0 minutes)*100%. ( A, C) n = 2-813 3, (B) n = 6. Bar and error represent geometric mean and standard deviation. Data were 814 analyzed by 2-way ANOVA followed by Sidak multiple comparison test. Adjusted p values 815 from Sidak multiple comparison test: * p < 0.05. ( D, E ) D23580 WT and ΔpgtE were 816 cultured overnight in ( Left) LB or ( Right) InSPI2 LowMg 2+ minimal media. ( D) After 817 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint overnight culture, STm was lysed, supernatants were run on a 4 -12% Tris-Glycine gel, 818 and the gel was stained with Pro -Q Emerald 300 Lipopolysaccharide Gel Stain Kit to 819 assess O-antigen chain length. (E) Alternatively, STm was then incubated with NHS for 820 8 hours. PgtE -dependent complement cleavage in supernatants was assessed by 821 western blot analysis with anti-complement C3/C3b/iC3b/C3d antibody. 822 823 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint 824 825 826 827 828 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint Figure 5. PgtE enhances STm survival in neutrophil killing assays and reduces 829 complement-mediated neutrophil ROS response. 830 Neutrophils were isolated (Stem Cell EasySep kit) from bone marrow of ( A-E) C57BL/6 831 mice and (E) Cybb-deficient mice. For neutrophil killing assays, smooth STm IR715 wild-832 type (WT) and an isogenic PgtE-deficient (ΔpgtE) strain were cultured overnight in (A) LB 833 or (B-C, E) InSPI2 LowMg2+ minimal media. STm was then (A-B: Left) not opsonized or 834 (A-B: Right, E) opsonized with normal mouse serum (NMS). (C) Alternatively, STm was 835 opsonized with serum from C3+/+ and C3-/- littermates. (A-C, E) Neutrophils were then 836 infected at an MOI = 10. STm CFU was enumerated 2.5 hours post-infection. % Survival 837 in neutrophils = (CFU in wells with neutrophils at 2.5 hours/ CFU in control wells at 2.5 838 hours)*100%. (D) To determine neutrophil reactive oxygen species production, luminol 839 assays were performed with STm cultured overnight in ( Left) LB or ( Right) InSPI2 840 LowMg2+ minimal media then opsonized with serum from (Top) C3+/+ and (Bottom) C3-/- 841 littermates. Neutrophils were infected at an MOI = 10. Relative Light Unit reads were 842 performed every 2 minutes with a BioTek Synergy HTX. Error bars represent mean + SD 843 from 3 biological replicates from 1 of 3 representative experiments. ( F-I) 8 -week-old 844 CybbX-/X- females or CybbX-/Y hemizygous males were infected IP with 104 CFU WT and 845 ΔpgtE STm. Mice were euthanized 24 hours after infection and bacterial burden in the 846 (G) blood, (H) liver, and (I) spleen was assessed. (A-C, E) N = 5-10 from 3-4 independent 847 experiments. Symbols represent data with neutrophils from individual mice, bars 848 represent the means. (A-C, E) Data were analyzed by One -way ANOVA Kruskal-Wallis 849 test followed by Dunn’s comparison test. Adjusted p values from Dunn’s multiple 850 comparison test: * p < 0.05, ** p < 0.01. (D) Data was analyzed by 2-way ANOVA. Time 851 x Column Factor: **** p < 0.0001. (D) bar and error represent mean + SD. (G-I) Symbols 852 represent data from individual mice, bars represent the geometric means. (G) Dotted line 853 represents the limit of detection. (G-I) N = 7-8 from 2 independent experiments. 854 855 856 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint

857 858 1. Majowicz SE, Musto J, Scallan E, Angulo FJ, Kirk M, O’Brien SJ, Jones TF, Fazil A, 859 Hoekstra RM, International Collaboration on Enteric Disease “Burden of Illness” Studies. 860 2010. The global burden of nontyphoidal Salmonella gastroenteritis. Clin Infect Dis 50:882–861 889. 862 2. Hohmann EL. 2001. Nontyphoidal salmonellosis. Clin Infect Dis 32:263–269. 863 3. Santos RL, Raffatellu M, Bevins CL, Adams LG, Tükel C, Tsolis RM, Bäumler AJ. 2009. 864 Life in the inflamed intestine, Salmonella style. Trends Microbiol 17:498–506. 865 4. Turgeon P, Ng V, Murray R, Nesbitt A. 2018. Forecasting the incidence of salmonellosis in 866 seniors in Canada: A trend analysis and the potential impact of the demographic shift. 867 PLoS One 13:e0208124. 868 5. Lester A, Eriksen NH, Nielsen H, Nielsen PB, Friis-Møller A, Bruun B, Scheibel J, Gaarslev 869 K, Kolmos HJ. 1991. Non-typhoid Salmonella bacteraemia in Greater Copenhagen 1984 to 870 1988. Eur J Clin Microbiol Infect Dis 10:486–490. 871 6. Noriega LM, Van der Auwera P, Daneau D, Meunier F, Aoun M. 1994. Salmonella 872 infections in a cancer center. Support Care Cancer 2:116–122. 873 7. Tumbarello M, Tacconelli E, Caponera S, Cauda R, Ortona L. 1995. The impact of 874 bacteraemia on HIV infection. Nine years experience in a large Italian university hospital. J 875 Infect 31:123–131. 876 8. Hung C-C, Hung M-N, Hsueh P-R, Chang S-Y, Chen M-Y, Hsieh S-M, Sheng W-H, Sun H-877 Y, Huang Y-T, Lo Y-C, Hsiao C-F, Chang S-C. 2007. Risk of recurrent nontyphoid 878 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint Salmonella bacteremia in HIV-infected patients in the era of highly active antiretroviral 879 therapy and an increasing trend of fluoroquinolone resistance. Clin Infect Dis 45:e60-7. 880 9. Feasey NA, Dougan G, Kingsley RA, Heyderman RS, Gordon MA. 2012. Invasive non-881 typhoidal salmonella disease: an emerging and neglected tropical disease in Africa. Lancet 882 379:2489–2499. 883 10. Uche IV, MacLennan CA, Saul A. 2017. A Systematic Review of the Incidence, Risk 884 Factors and Case Fatality Rates of Invasive Nontyphoidal Salmonella (iNTS) Disease in 885 Africa (1966 to 2014). PLoS Negl Trop Dis 11:e0005118. 886 11. Van Puyvelde S, Pickard D, Vandelannoote K, Heinz E, Barbé B, de Block T, Clare S, 887 Coomber EL, Harcourt K, Sridhar S, Lees EA, Wheeler NE, Klemm EJ, Kuijpers L, Mbuyi 888 Kalonji L, Phoba M-F, Falay D, Ngbonda D, Lunguya O, Jacobs J, Dougan G, 889 Deborggraeve S. 2019. An African Salmonella Typhimurium ST313 sublineage with 890 extensive drug-resistance and signatures of host adaptation. Nat Commun 10:4280. 891 12. van den Berg JM, van Koppen E, Ahlin A, Belohradsky BH, Bernatowska E, Corbeel L, 892 Español T, Fischer A, Kurenko-Deptuch M, Mouy R, Petropoulou T, Roesler J, Seger R, 893 Stasia M-J, Valerius NH, Weening RS, Wolach B, Roos D, Kuijpers TW. 2009. Chronic 894 granulomatous disease: the European experience. PLoS One 4:e5234. 895 13. Conlan JW. 1996. Neutrophils prevent extracellular colonization of the liver 896 microvasculature by Salmonella typhimurium. Infect Immun 64:1043–1047. 897 14. Alpuche Aranda CM, Swanson JA, Loomis WP, Miller SI. 1992. Salmonella typhimurium 898 activates virulence gene transcription within acidified macrophage phagosomes. Proc Natl 899 Acad Sci U S A 89:10079–10083. 900 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint 15. Dalebroux ZD, Miller SI. 2014. Salmonellae PhoPQ regulation of the outer membrane to 901 resist innate immunity. Curr Opin Microbiol 17:106–113. 902 16. Hensel M. 2000. Salmonella pathogenicity island 2. Mol Microbiol 36:1015–1023. 903 17. Gal-Mor O, Elhadad D, Deng W, Rahav G, Finlay BB. 2011. The Salmonella enterica PhoP 904 directly activates the horizontally acquired SPI-2 gene sseL and is functionally different 905 from a S. bongori ortholog. PLoS One 6:e20024. 906 18. Groisman EA, Duprey A, Choi J. 2021. How the PhoP/PhoQ System Controls Virulence 907 and Mg2+ Homeostasis: Lessons in Signal Transduction, Pathogenesis, Physiology, and 908 Evolution. Microbiol Mol Biol Rev 85:e0017620. 909 19. Steele-Mortimer O. 2008. The Salmonella-containing vacuole: moving with the times. Curr 910 Opin Microbiol 11:38–45. 911 20. Buchmeier NA, Heffron F. 1991. Inhibition of macrophage phagosome-lysosome fusion by 912 Salmonella typhimurium. Infect Immun 59:2232–2238. 913 21. Gerlach RG, Hensel M. 2007. Salmonella pathogenicity islands in host specificity, host 914 pathogen-interactions and antibiotics resistance of Salmonella enterica. Berl Munch 915 Tierarztl Wochenschr 120:317–327. 916 22. Vazquez-Torres A, Jones-Carson J, Bäumler AJ, Falkow S, Valdivia R, Brown W, Le M, 917 Berggren R, Parks WT, Fang FC. 1999. Extraintestinal dissemination of Salmonella by 918 CD18-expressing phagocytes. Nature 401:804–808. 919 23. Hoffman D, Tevet Y, Trzebanski S, Rosenberg G, Vainman L, Solomon A, Hen-Avivi S, 920 Ben-Moshe NB, Avraham R. 2021. A non-classical monocyte-derived macrophage subset 921 provides a splenic replication niche for intracellular Salmonella. Immunity 54:2712-2723.e6. 922 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint 24. Grant AJ, Restif O, McKinley TJ, Sheppard M, Maskell DJ, Mastroeni P. 2008. Modelling 923 within-host spatiotemporal dynamics of invasive bacterial disease. PLoS Biol 6:e74. 924 25. Gogoi M, Shreenivas MM, Chakravortty D. 2019. Hoodwinking the Big-Eater to Prosper: 925 The Salmonella-Macrophage Paradigm. J Innate Immun 11:289–299. 926 26. MacLennan CA, Gondwe EN, Msefula CL, Kingsley RA, Thomson NR, White SA, Goodall 927 M, Pickard DJ, Graham SM, Dougan G, Hart CA, Molyneux ME, Drayson MT. 2008. The 928 neglected role of antibody in protection against bacteremia caused by nontyphoidal strains 929 of Salmonella in African children. J Clin Invest 118:1553–1562. 930 27. Gondwe EN, Molyneux ME, Goodall M, Graham SM, Mastroeni P, Drayson MT, 931 MacLennan CA. 2010. Importance of antibody and complement for oxidative burst and 932 killing of invasive nontyphoidal Salmonella by blood cells in Africans. Proc Natl Acad Sci U 933 S A 107:3070–3075. 934 28. Grossman N, Schmetz MA, Foulds J, Klima EN, Jimenez-Lucho VE, Leive LL, Joiner KA. 935 1987. Lipopolysaccharide size and distribution determine serum resistance in Salmonella 936 montevideo. J Bacteriol 169:856–863. 937 29. Lalsiamthara J, Kim JH, Lee JH. 2018. Engineering of a rough auxotrophic mutant 938 Salmonella Typhimurium for effective delivery. Oncotarget 9:25441–25457. 939 30. Nagy G, Dobrindt U, Hacker J, Emödy L. 2004. Oral immunization with an rfaH mutant 940 elicits protection against salmonellosis in mice. Infect Immun 72:4297–4301. 941 31. Rhen M, Sukupolvi S. 1988. The role of the traT gene of the Salmonella typhimurium 942 virulence plasmid for serum resistance and growth within liver macrophages. Microb 943 Pathog 5:275–285. 944 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint 945 32. Heffernan EJ, Reed S, Hackett J, Fierer J, Roudier C, Guiney D. 1992. Mechanism of 946 resistance to complement-mediated killing of bacteria encoded by the Salmonella 947 typhimurium virulence plasmid gene rck. J Clin Invest 90:953–964. 948 33. Pramoonjago P, Kaneko M, Kinoshita T, Ohtsubo E, Takeda J, Hong KS, Inagi R, Inoue K. 949 1992. Role of TraT protein, an anticomplementary protein produced in Escherichia coli by 950 R100 factor, in serum resistance. J Immunol 148:827–836. 951 34. Guina T, Yi EC, Wang H, Hackett M, Miller SI. 2000. A PhoP-regulated outer membrane 952 protease of Salmonella enterica serovar typhimurium promotes resistance to alpha-helical 953 antimicrobial peptides. J Bacteriol 182:4077–4086. 954 35. Kukkonen M, Suomalainen M, Kyllönen P, Lähteenmäki K, Lång H, Virkola R, Helander IM, 955 Holst O, Korhonen TK. 2004. Lack of O-antigen is essential for plasminogen activation by 956 Yersinia pestis and Salmonella enterica. Mol Microbiol 51:215–225. 957 36. Ramu P, Tanskanen R, Holmberg M, Lähteenmäki K, Korhonen TK, Meri S. 2007. The 958 surface protease PgtE of Salmonella enterica affects complement activity by proteolytically 959 cleaving C3b, C4b and C5. FEBS Lett 581:1716–1720. 960 37. Ramu P, Lobo LA, Kukkonen M, Bjur E, Suomalainen M, Raukola H, Miettinen M, Julkunen 961 I, Holst O, Rhen M, Korhonen TK, Lähteenmäki K. 2008. Activation of pro-matrix 962 metalloproteinase-9 and degradation of gelatin by the surface protease PgtE of Salmonella 963 enterica serovar Typhimurium. Int J Med Microbiol 298:263–278. 964 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint 38. Riva R, Korhonen TK, Meri S. 2015. The outer membrane protease PgtE of Salmonella 965 enterica interferes with the alternative complement pathway by cleaving factors B and H. 966 Front Microbiol 6:63. 967 39. Hammarlöf DL, Kröger C, Owen SV, Canals R, Lacharme-Lora L, Wenner N, Schager AE, 968 Wells TJ, Henderson IR, Wigley P, Others. 2018. Role of a single noncoding nucleotide in 969 the evolution of an epidemic African clade of Salmonella. Proceedings of the National 970 Academy of Sciences 115:E2614–E2623. 971 40. Lähteenmäki K, Kyllönen P, Partanen L, Korhonen TK. 2005. Antiprotease inactivation by 972 Salmonella enterica released from infected macrophages. Cell Microbiol 7:529–538. 973 41. Kröger C, Colgan A, Srikumar S, Händler K, Sivasankaran SK, Hammarlöf DL, Canals R, 974 Grissom JE, Conway T, Hokamp K, Hinton JCD. 2013. An infection-relevant transcriptomic 975 compendium for Salmonella enterica Serovar Typhimurium. Cell Host Microbe 14:683–695. 976 42. Knodler LA, Crowley SM, Sham HP, Yang H, Wrande M, Ma C, Ernst RK, Steele-Mortimer 977 O, Celli J, Vallance BA. 2014. Noncanonical inflammasome activation of caspase-978 4/caspase-11 mediates epithelial defenses against enteric bacterial pathogens. Cell Host 979 Microbe 16:249–256. 980 43. Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in 981 Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:6640–6645. 982 44. Wessels MR, Butko P, Ma M, Warren HB, Lage AL, Carroll MC. 1995. Studies of group B 983 streptococcal infection in mice deficient in complement component C3 or C4 demonstrate 984 an essential role for complement in both innate and acquired immunity. Proc Natl Acad Sci 985 U S A 92:11490–11494. 986 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint 45. Pollock JD, Williams DA, Gifford MA, Li LL, Du X, Fisherman J, Orkin SH, Doerschuk CM, 987 Dinauer MC. 1995. Mouse model of X-linked chronic granulomatous disease, an inherited 988 defect in phagocyte superoxide production. Nat Genet 9:202–209. 989 46. Belzer C, Liu Q, Carroll MC, Bry L. 2011. THE ROLE OF SPECIFIC IgG AND 990 COMPLEMENT IN COMBATING A PRIMARY MUCOSAL INFECTION OF THE GUT 991 EPITHELIUM. Eur J Microbiol Immunol 1:311–318. 992 47. Chatterjee R, Chowdhury AR, Nair AV, Hajra D, Kar A, Datey A, Shankar S, Mishra RK, 993 Chandra N, Chakravortty D. 2023. Salmonella Typhimurium PgtE is an essential arsenal to 994 defend against the host resident antimicrobial peptides. Microbiol Res 271:127351. 995 48. Bjanes E, Nizet V. 2021. More than a Pore: Nonlytic Antimicrobial Functions of 996 Complement and Bacterial Strategies for Evasion. Microbiol Mol Biol Rev 85. 997 49. Canals R, Hammarlöf DL, Kröger C, Owen SV, Fong WY, Lacharme-Lora L, Zhu X, 998 Wenner N, Carden SE, Honeycutt J, Monack DM, Kingsley RA, Brownridge P, Chaudhuri 999 RR, Rowe WPM, Predeus AV, Hokamp K, Gordon MA, Hinton JCD. 2019. Adding function 1000 to the genome of African Salmonella Typhimurium ST313 strain D23580. PLoS Biol 1001 17:e3000059. 1002 50. Ellis MJ, Tsai CN, Johnson JW, French S, Elhenawy W, Porwollik S, Andrews-Polymenis 1003 H, McClelland M, Magolan J, Coombes BK, Brown ED. 2019. A macrophage-based screen 1004 identifies antibacterial compounds selective for intracellular Salmonella Typhimurium. Nat 1005 Commun 10:197. 1006 51. da Silva P, Manieri FZ, Herrera CM, Trent MS, Moreira CG. 2018. Novel Role of VisP and 1007 the Wzz System during O-Antigen Assembly in Salmonella enterica Serovar Typhimurium 1008 Pathogenesis. Infect Immun 86. 1009 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint 52. Lalli PN, Strainic MG, Yang M, Lin F, Medof ME, Heeger PS. 2008. Locally produced C5a 1010 binds to T cell-expressed C5aR to enhance effector T-cell expansion by limiting antigen-1011 induced apoptosis. Blood 112:1759–1766. 1012 53. Tam JCH, Bidgood SR, McEwan WA, James LC. 2014. Intracellular sensing of 1013 complement C3 activates cell autonomous immunity. Science 345:1256070. 1014 54. Liszewski MK, Kolev M, Le Friec G, Leung M, Bertram PG, Fara AF, Subias M, Pickering 1015 MC, Drouet C, Meri S, Arstila TP, Pekkarinen PT, Ma M, Cope A, Reinheckel T, Rodriguez 1016 de Cordoba S, Afzali B, Atkinson JP, Kemper C. 2013. Intracellular complement activation 1017 sustains T cell homeostasis and mediates effector differentiation. Immunity 39:1143–1157. 1018 55. Okoro CK, Barquist L, Connor TR, Harris SR, Clare S, Stevens MP, Arends MJ, Hale C, 1019 Kane L, Pickard DJ, Hill J, Harcourt K, Parkhill J, Dougan G, Kingsley RA. 2015. 1020 Signatures of adaptation in human invasive Salmonella Typhimurium ST313 populations 1021 from sub-Saharan Africa. PLoS Negl Trop Dis 9:e0003611. 1022 56. Westerman TL, Bogomolnaya L, Andrews-Polymenis HL, Sheats MK, Elfenbein JR. 2018. 1023 The Salmonella type-3 secretion system-1 and flagellar motility influence the neutrophil 1024 respiratory burst. PLoS One 13:e0203698. 1025 57. van Bruggen R, Zweers D, van Diepen A, van Dissel JT, Roos D, Verhoeven AJ, Kuijpers 1026 TW. 2007. Complement receptor 3 and Toll-like receptor 4 act sequentially in uptake and 1027 intracellular killing of unopsonized Salmonella enterica serovar Typhimurium by human 1028 neutrophils. Infect Immun 75:2655–2660. 1029 58. Hölzer SU, Schlumberger MC, Jäckel D, Hensel M. 2009. Effect of the O-antigen length of 1030 lipopolysaccharide on the functions of Type III secretion systems in Salmonella enterica. 1031 Infect Immun 77:5458–5470. 1032 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint 59. Hackett J, Wyk P, Reeves P, Mathan V. 1987. Mediation of serum resistance in Salmonella 1033 typhimurium by an 11-kilodalton polypeptide encoded by the cryptic plasmid. J Infect Dis 1034 155:540–549. 1035 60. Krukonis ES, Thomson JJ. 2020. Complement evasion mechanisms of the systemic 1036 pathogens Yersiniae and Salmonellae. FEBS Lett 594:2598–2620. 1037 61. Ondari EM, Klemm EJ, Msefula CL, El Ghany MA, Heath JN, Pickard DJ, Barquist L, 1038 Dougan G, Kingsley RA, MacLennan CA. 2019. Rapid transcriptional responses to serum 1039 exposure are associated with sensitivity and resistance to antibody-mediated complement 1040 killing in invasive Salmonella Typhimurium ST313. Wellcome Open Res 4:74. 1041 1042 1043 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint Supplementary Table 1 1044 1045 Designation Genotype Reference or Source Salmonella enterica serovar Typhimurium IR715 ATCC 14028s wild-type, spontaneous NalR Stojiljkovic et al, J. Bacteriol. 177(5):1357-1366 (1995) JB10 IR715 DpgtE::tetRA (NalR, TetR) This study ML27 IR715 pgtE-FLAG (NalR) This study LAKglmS SL1344 glmS::Ptrc-mCherryST::FCF (StrepR, CmR) Knodler et al, Cell Host Microbe. 16(2):249-256 (2014) LAKML2 IR715 glmS::Ptrc-mCherrryST::FRT (NalR) This study D23580 D23580 wild-type Kingsley et al, Genome Research. 19:2279–2287 (2009) SPN1113 D23580 ΔpgtE::tetRA This study Escherichia coli CC118 lpir F- araD139 Δ(ara, leu)7697 ΔlacX74 phoAD20 galE galK thi rpsE rpoB argEam recA1 lpir Herrero et al, J Bacteriol. 172(11):6557-67 (1990) S17-1 lpir F- recA thi pro rK- mK+ RP4:2-Tc::MuKm Tn7 lpir Herrero et al, J Bacteriol. 172(11):6557-67 (1990) XL1-Blue recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F proAB lacIqZΔM15 Tn10 (TetR)] Agilent DH5aMCR F- mcrA D(mrr-hsdRMS-mcrBC) f80dlacZDM15 D(lacZYA-argF)U169 deoR recA1 endA1 phoA supE44l- thi-1 gyrA96 relA1 Gibco BRL One Shot TOP10 F- mcrA D(mrr-hsdRMS-mcrBC) f80lacZDM15 DlacX74 recA1 araD139 D(ara, leu)7697 galU galK rpsL(StrR) endA1 nupG Invitrogen 1046 1047 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint Supplementary Table 2 1048 1049 Designation Relevant characteristics Reference or Source pCP20 ApR, temperature-sensitive, FLP recombinase system Datsenko et al, Proc. Natl. Acad. Sci. USA. 97, 6640-6645 (2000) pWSK29 ApR, MCS, lacZa Wang et al, Gene. 100, 195-199 (1991) pWSK29::pgtE ApR TetR, pWSK29::pgtE (pgtE complementation) This study pWSK29::pgtE- D206A ApR TetR, pWSK29::pgtE(D206A) (PgtE inactive allele) This study pRDH10 CmR TetR, SacB (levansucrase: Sucrose sensitivity) Kingsley et al, Applied and Environmental Microbiology, 1610-1618 (1999) pRDH10::pgtE- FLAG CmR TetS, SacB, pRDH10::pgtE-FLAG (pgtE- FLAG Tag) This study pCR-Blunt II-TOPO KanR, MCS Invitrogen pGP704 ApR, MCS, oriR6K, mobRP4 Miller et al, J. Bacteriology. 170(6):2575-2583 (1988) pSPN23 ApR TetR, pBluescriptII KS+::tetRA (tetRA cassette) Raffatellu et al, Cell Host Microbe. 5(5):476-86 (2009) pCRII::pgtE-LBRB KanR, pCR-Blunt II- TOPO::pgtE-LBRB (DpgtE cassette) This study pGP704::pgtE-LBRB ApR, pGP704::pgtE-LBRB (DpgtE cassette) This study pGP704::pgtE- LBRB::tetRA ApR TetR, pGP704_pgtE_LBRB::tetRA (DpgtE::tetRA cassette) This study pPpgtE-gfp ApR, PpgtE-gfpmut3.1 (pgtE transcriptional reporter plasmid) This study pMPM-A3∆Plac ApR, P15A ori Ibarra et al., Microbiology Apr;156(Pt 4):1120- 1133 (2010) 1050 1051 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint Supplementary Table 3 1052 Designation Purpose Primer sequence (5' to 3') Referen ce or Source pgtE_LB_for Amplifying pgtE upstream region ATCAGCAGAGATCATCATGG This study pgtE_RB_rev Amplifying pgtE downstream region AATTGAAGACGCGCTACG This study pgtE_LB_r_fus* pCRII_pgtE_LBRB fusion TGACAAGATGGCTTCTAGACCACATCGG This study pgtE_RB_f_fus * GTCTAGAAGCCATCTTGTCAAATCGTCGG This study pgtE_LB_f_SalI* pWSK29_pgtE_co mpl GTCGACAATCTCGGCTATACCTTTGG This study pgtE_RB_r_EcoRO* GATTCCCGTTATCTCCATCAACTGG This study pgtE_RB_r_seq pCRII_pgtE_LBRB sequencing CGTTGAAGAGTATGAGCGAC This study pgtE_pres_for Colony PCR screening CACCGCTGGTTTTATCTATG This study pgtE_pres_rev ACGTCTCTCCTGATAGCGTC This study tetRA_pres_for PCR confirmation of tetRA cassette presence TTCGGAAGATATCGCTAACC This study tetRA_pres_rev TAAAGCACCTTGCTGATGAC This study tetR_int_rev tetRA cassette presence CAGAGCCAGCCTTCTTATTC This study tetA_int_for GATGACCTTCATGTTAACCC This study pgtE_for_compl pgtE complementation TTATGACCGATGACATCCC This study pgtE_rev_compl AATGCGTCAAGTTCTCTGG This study PpgtE-XbaI-F* pgtE transcriptional reporter plasmid GCTCTAGAACGAATTAATGAAAGTGGC This study PpgtE-SmaI-R* TCCCCCGGGATCATCATTACTGCAATAGCA This study FLAG_Upstream_Fwd* * Amplify upstream of pgtE stop codon gggcgccatctccttgcatgACAAGGCGGGCGTAAC AG This study .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint FLAG_Upstream_Rev* ** for FLAG tag Gibson assembly cttgtcatcgtcgtccttgtagtcGAAGCGATACTG CAACCCC This study FLAG_Downstream_F wd*** Amplify pgtE stop codon and downstream for FLAG tag Gibson assembly gactacaaggacgacgatgacaagTAGACCACATCG GGATGTC This study FLAG_Downstream_R ev** ggccatccagcctcgcgtcgCCTGGAGCGACTTTCT CTG This study FLAG_Verification_Fwd Verify clean insertion of FLAG tag in pgtE TTCCGGACGTCTCTCCTGAT This study FLAG_Verification_Rev ACGCGATTATCTCTGGCTGG This study * = restriction sites are underlined ** = engineered sequence for pRDH10 homology are underlined *** = engineered sequence for FLAG Tag are underlined 1053 1054 .CC-BY-NC-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted November 5, 2024. ; https://doi.org/10.1101/2024.11.05.622138doi: bioRxiv preprint