Comparative responses to demethylating therapy in animal models of osteosarcoma | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Comparative responses to demethylating therapy in animal models of osteosarcoma Shan Huang, Ling Ren, Jessica A. Beck, Sushant Patkar, Maria Angeles Lillo Osuna, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4451060/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background The demethylating agent decitabine (DAC) effectively inhibits tumor growth and metastasis by targeting ESR1 methylation to restore estrogen receptor alpha (ERα) signaling and promoting cellular differentiation in models of human osteosarcoma (OSA). Whether this pathway can be targeted in canine OSA patients is unknown. Methods Canine OSA tumor samples were tested for ERα expression and ESR1 promoter methylation. Human (MG63.3) and canine (MC-KOS) OSA cell lines and murine xenografts were treated with DAC in vitro and in vivo , respectively. Samples were assessed using mRNA sequencing and tissue immunohistochemistry. Results ESR1 is methylated in a subset of canine OSA patient samples and the MC-KOS cell line. DAC treatment led to enhanced differentiation as demonstrated by increased ALPL expression, and suppressed tumor growth in vitro and in vivo . Metastatic progression was inhibited, particularly in the MG63.3 model, which expresses higher levels of DNA methyltransferases DNMT1 and 3B. DAC treatment induced significant alterations in immune response and cell cycle pathways. Conclusion DAC treatment activates ERα signaling, promotes bone differentiation, and inhibits tumor growth and metastasis in human and canine OSA. Additional DAC-altered pathways and species- or individual-specific differences in DNMT expression may also play a role in DAC treatment of OSA. Osteosarcoma decitabine estrogen receptor alpha canine Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background Osteosarcoma (OSA) is a rare and aggressive pediatric/adolescent/young adult primary bone malignancy, but a more common cancer in large breed dogs. Clinically, the disease exhibits a high metastatic rate regardless of treatment type. Currently, the 5-year survival rate is less than 70% for humans[ 1 ], while the three-year survival rate for dogs is less than 10%[ 2 ]. OSA is characterized by a chaotic genome, with a high incidence of structural variations rather than druggable driving mutations in specific genes[ 3 – 5 ]. Both species have experienced little improvement in clinical outcomes over the past over 30 years[ 6 , 7 ], underscoring the need for novel approaches to OSA therapy. Canine OSA shares many similarities with human disease, including gene expression, tumor biology, clinical features[ 8 – 10 ], and provides unique opportunities to test promising therapies for humans in comparative oncology clinical trials[ 10 – 13 ]. Estrogens contribute to skeleton growth and life-long bone homeostasis by acting on multiple cell types through a complicated signaling network[ 14 ]. They exert physiological functions in almost every tissue in the body in both males and females[ 15 ] by interacting with either estrogen receptors alpha (ERα) or beta (ERβ)[ 14 , 16 ]. Both receptors are well expressed in bone marrow stromal cells[ 17 , 18 ] and during osteoblast differentiation[ 19 ], but ERα mRNA was not detectable in human OSA cell lines HOS-TE85, SaOS2 and MG63[ 20 ]. Another study of 28 human OSA patient samples also showed no ERα expression by IHC[ 21 ]. A recent publication demonstrated that ERα was epigenetically silenced in several human OSA cell lines through promoter hypermethylation. DNA methylation changes are also widely seen in cancer cells[ 22 , 23 ]. Multiple genes relevant to OSA progression[ 24 ] have been shown to exhibit inactivation due to aberrant DNA methylation in OSA human patient samples and cell lines, such as SPRY2[ 25 ], CXCL12[ 26 ], and NNAT[ 27 ]. Decitabine (DAC; 5-aza-2’-deoxycytidine) is a cytidine analog. It can incorporate into DNA strands during replication and irreversibly binds to DNA methyltransferase (DNMT) to reduce the levels of DNA methylation in a division-dependent manner thus restoring gene expression[ 28 ]. Critically, by utilizing the non-selective DNMT inhibitor DAC to restore ERα expression, OSA growth and metastasis have been significantly suppressed in a human xenograft model[ 29 ]. These findings formed the basis for the work shown herein, which leverages a comparative approach through the examination of canine OSA as a naturally occurring model of human OSA to support studies of biology and drug development. Methods Cell culture studies Human MG63.3[ 30 ] and canine MC-KOS[ 31 ] OSA cells were grown at 37°C in 5% CO 2 in DMEM supplemented with 10% fetal bovine serum, 2 mM glutamine, and Pen/Strep. Both cell lines were transfected with lentiviral green fluorescent protein (GFP) constructs (pSICO-eGFP or p960-X1-685-eGFP). Decitabine (Dacogen) was purchased from Otsuka (NDC 59148-046-70). Cell proliferation assays Cell proliferation assays were performed using the IncuCyte ZOOM system (Essen BioScience Inc). Serial phase-contrast images were gathered and processed as the percentage of confluency to measure cell proliferation. Each data point represents the mean reading from sextuplicate analyses. All assays were conducted in duplicate. For drug treatment, the drug concentrations are indicated within the [ 1 ]s and text. Dimethyl sulfoxide (DMSO) was used as the control for group comparisons. EC 50 was calculated using IncuCyte software using the data collected at 7 days post treatment. In vivo orthotopic xenograft tumor growth and treatment All animal work was conducted with the approval of the Animal Care and Use Committee of the National Cancer Institute under Animal Study Protocol PB-038. Primary tumor growth was evaluated by orthotopic injection of 10 6 MG63.3 or MC-KOS cells/ 0.1 ml of Hank’s balanced salt solution (HBSS) into a parosseous site deep in the left caudal gastrocnemius of 6-week-old female SCID-Beige mice (Fox Chase CB17.B6- Prkdc scid Lyst bg /Crl) as described previously[ 32 ]. Treatment was initiated 10 days after tumor cell injection when primary tumors became palpable. For spontaneous metastasis model experiments, tumor bearing limbs were surgically amputated on Day 21, with treatment initiation 3 days after amputation. Experimental metastasis experiments were used for the MC-KOS cell line due to the protracted period of time needed for development of spontaneous metastases. 10 6 MC-KOS cells/ 0.1 ml of HBSS was injected through tail vein, and the treatment was started the day after cell injection. Mice received intraperitoneal injection (ip) of sterile saline (Control) and DAC (1mg/kg) on Monday-Wednesday-Friday with 2-week on 1-week off schedule. After 25 days, five mice from each group were euthanized to assess lung metastasis burden. The remaining mice were used for survival analysis. The volume of orthotopic tumor growth was measured once a week with digital calipers to obtain two diameters of the tumor sphere determined using the equation ( D × d 2 )/6 × 3.12 (where D = the maximum diameter and d = the minimum diameter). Pulmonary metastasis assessment Early micro-metastases of lungs were examined and imaged with fluorescence inverted microscope (Leica DM IRB) with an attached CCD camera. Whole lung images were taken using a Leica MZ FLIII fluorescence stereomicroscope. The areas of fluorescent lung metastases were quantified with ImageJ software. Lung metastases were also examined using H&E-stained paraffin-embedded sections. Canine tissue samples Treatment-naïve canine OSA tumor and normal bone samples were collected at the time of therapeutic surgical limb amputation from patients enrolled in the NCI Comparative Oncology Trials Consortium (COTC) 021/022 trials, as described previously[ 12 ]. Methylation specific PCR and bisulfite sequencing Total cellular DNA was extracted from cells by using DNeasy Blood & Tissue Kit (Qiagen) following the manufacturer's recommendations. Each DNA sample was collected in triplicate. EpiMark Bisulfite Conversion Kit (New England Biolabs, Inc.) was used following the manufacturer's recommendations. For PCR amplification of the methylated and unmethylated ESR1 promoter, PCR was performed on the bisulfite-converted DNA with the following primers: Methylated ESR1 F GAGTAGTTATAGTTACGGGGTCGTC, R AATTTTCTTCCTACTACCAAACGAA; Unmethylated ESR1 F AGTAGTTATAGTTATGGGGTTGTTG and R AATTTTCTTCCTACTACCAAACAA The PCR products were then analyzed by agarose gel electrophoresis. For bisulfite sequencing the PCR products were cloned into pCRII with the TOPO-TA Cloning Kit (Life Technologies). Individual clones were sequenced by Sanger sequencing with the T7 promoter primer. The data were analyzed with BISMA[ 33 ]. Quantitative PCR Total cellular RNA was extracted from cells with TRIzol Reagent (Invitrogen). Each RNA sample was collected in biological triplicates and each qPCR reaction was amplified in triplicate. Total RNA was converted to cDNA with Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) according to the manufacturer's instructions. cDNA was subjected to quantitative PCR using the Maxima SYBR Green qPCR Master Mix with ROX (ThermoFisher Scientific). Gene expression levels were compared after normalization to endogenous β-actin (Actb). Primers were selected using Primer-BLAST and the sequences are: Actb: TGTGTTATGTGGCCCTGGAC and TTCCATGCCCAGGAAGGAAG, and ESR1: GCATCCAGGGAAGCTCTTCTT and TCTCTTCCAGAGACTTCAGGGT, and ALPL: CCAAGGACGCTGGGAAATCT and ACGTTGTGCATGAGCTGGTA. Immunohistochemistry (IHC) Formalin-fixed, paraffin-embedded murine tissues were immunolabeled for estrogen receptor α (ERα, abcam ab259427, 1:400), alkaline phosphatase (ALP, abcam ab65834, 1:250), osteomodulin (OMD, abcam ab154249, 1:400), Sp7/Osterix (abcam ab209484, 1:400), and SOX2 (abcam ab97959, 1:800) by VitroVivo Biotech. The H-score was quantified in annotated lung metastases using HALO’s cytonuclear algorithm, which captures both the intensity and the proportion of the biomarker of interest from the IHC image. Alkaline phosphatase staining MC-KOS cells were treated with 20 µM DAC for 72 hours and then fixed with 3.7% formaldehyde and stained for alkaline phosphatase using SIGMAFAST BCIP/NBT (Sigma-Aldrich). Nucleic acid isolation and mRNA sequencing MG63.3 and MC-KOS cells treated with DAC and DMSO in vitro for 24 hours were collected, with 3 replicates for each group. mRNA was isolated from cell line pellets using Qiagen Allprep DNA/RNA Mini Kit (Cat#80204). The total mRNA quality and quantity were assessed using Nanodrop 8000 (ThermoFisher) and Agilent 4200 Tapestation with RNA Screen Tape (Cat# 5067–5576) and RNA Screen Tape sample Buffer (Cat#5067–5577). All samples forwarded for mRNA sequencing had a RIN > 8 and a total RNA quantity > 100 ng. Canine MC-KOS mRNA-Seq samples were pooled and sequenced on NovaSeq 6000 S2 using Illumina® Stranded mRNA Prep and paired-end sequencing. The samples have 136 to 185 million pass filter reads with more than 90% of bases above the quality score of Q30. Reads of the samples were trimmed for adapters and low-quality bases using Cutadapt before alignment with the reference genome (GSD_1.0, also referred to as canfam4)[ 34 ] and the annotated transcripts using STAR. The average mapping rate of all samples was 95%, with unique alignment above 75%. There were 3.35 to 10.99% unmapped reads. The mapping statistics were calculated using Picard software. The samples have 3.14% ribosomal bases. Percent coding bases are between 49–60%. Percent UTR bases are 24–28%, and mRNA bases are between 76–87% for all the samples. Library complexity was measured in terms of unique fragments in the mapped reads using Picard’s MarkDuplicate utility. The samples had 68–76% non-duplicate reads. Human MG63.3 mRNA-Seq samples were pooled and sequenced on NovaSeq 6000 S2 using Illumina® Stranded mRNA Prep and paired-end sequencing. The samples had 105 to 159 million pass filter reads with more than 91% of bases above the quality score of Q30. Reads of the samples were trimmed for adapters and low-quality bases using Cutadapt before alignment with the reference genome (hg38) and the annotated transcripts using STAR. The average mapping rate of all samples is 93%, with unique alignment above 85%. There were 5.25 to 8.72% unmapped reads. The mapping statistics were calculated using Picard software. The samples have 0.75% ribosomal bases. Percent coding bases are between 57–63%. Percent UTR bases are 31–37%, and mRNA bases are between 94–95% for all the samples. Library complexity was measured in terms of unique fragments in the mapped reads using Picard’s MarkDuplicate utility. The samples had 59–72% non-duplicate reads. Differential expression and gene set enrichment analysis Raw read count data from untreated and DAC-treated osteosarcoma cell lines are provided as input to edgeR[ 35 ] (v3.40.2) using default parameter settings for differential expression analysis. This analysis was done independently for both canine and human osteosarcoma cell lines. Following differential expression analysis, all genes were ranked by their log fold change in expression estimated by edgeR. Genes ranked at the top of the list with high positive log fold change correspond to genes that had relatively higher expression in DAC-treated compared to untreated cell lines, whereas genes with high negative log fold change in expression had relatively lower expression in DAC treated compared to untreated cell lines. The ranked list of all genes based on the log-fold change was then provided as input to the standard Gene Set Enrichment Analysis (GSEA) pipeline implemented in clusterProfiler[ 36 ] (v4.6.2) with the following parameters specified: (nPermSimple: 100000, minGSSize = 10, maxGSSize = 500) to estimate the relative enrichment of cancer hallmark pathways in DAC treated and untreated cell lines. Visualization of gene expression data in heatmaps Normalized read count data (TPM) for MC-KOS and MG63.3 osteosarcoma cell lines were log2 transformed and scaled to obtain Z scores. The Z scores are then visualized in heatmaps as shown in Fig. 5 . Statistical analysis Unpaired T-test was used to compare the difference between the groups using GraphPad 10.0.3. Data within the figures are presented as mean ± standard error of the mean. Pathway enrichment p-values were estimated using the hypergeometric test. P-values and all pathways with false discovery rates (FDR) < 0.05 were considered significant. Results DAC inhibits human OSA growth and metastasis DAC treatment was first tested on the highly metastatic human OSA cell line MG63.3. MG63.3 was sensitive to DAC (Fig. 1 a), with a half maximal effective concentration (EC 50 ) = 0.66 µM at Day 7 (Fig. S1 a). Primary tumor growth in vivo was significantly slowed after one week of DAC treatment (Fig. 1 b), with minimal increase over the four-week regimen (Fig. 1 c-d). Lungs were collected and observed under fluorescence microscopy to identify and quantify GFP-positive pulmonary metastases. Compared to the control group which developed multiple lung metastatic nodules, DAC-treated mice developed fewer pulmonary micro-metastases (Fig. S1 b). To study DAC effect on early lung metastasis, another primary tumor model group was generated (Fig. S1 c) which developed early lung metastasis by Day 19 (Fig. S1 d) followed by surgical limb amputation (Day 21) and DAC treatment (Day 24). After 45 days, this early metastasis model also identified significantly fewer metastases in DAC-treated mice showed compared to control (Fig. 1 e-f) underscoring the effectiveness of DAC on metastatic progression. The ESR1 promoter is methylated in canine OSA samples The effects of DAC in human osteosarcoma have been in part attributed to its demethylating effects on the ESR1 promoter in human tumors[ 29 ]. Little is known about the role and status of ESR1 in canine osteosarcoma. Methylation-specific PCR was performed on normal canine bone and the MC-KOS canine OSA cell line to assess methylation of the ESR1 promoter region (Fig. 2 a). Normal canine ovarian tissue was also tested as a positive control for unmethylated DNA, as there is high expression of ESR1. The specific methylation locations at ESR1 promoter region were explored using bisulfite sequencing (Fig. 2 b). The methylation percentage of the canine OSA cell line (MC-KOS) was significantly higher than normal bone tissue at approximately 60% (Fig. 2 c). Finally, 15 canine OSA patients’ tumor samples were examined for ESR1 promoter methylation (Fig. 2 d). Five (33%) presented complete methylation; seven (47%) were partial; only one sample was totally unmethylated. ESR1 expression varied in canine osteosarcomas but was low to undetectable in over half of the samples (n = 12; Fig. 2 e). DAC restores ERα and promotes cellular differentiation of canine OSA Since a subset of canine patients demonstrate ESR1 hypermethylation (Fig. 2 ) similar to that described in human OSA patients, we next investigated DAC treatment in canine OSA cells to determine whether they respond similarly to human OSA cells[ 29 ] including restoration of ERα and enhanced cellular differentiation. Canine and human OSA cells were exposed to DAC in vitro and collected after 24 hours for mRNA sequencing. Markers of bone mineralization, alkaline phosphatase (ALPL) and osteomodulin (OMD), were increased in MG63.3 (logFC = 3.21, FDR < 0.0001) and MC-KOS (logFC = 1.51, FDR < 0.0001) respectively (Fig. 3 a-b). Although not significantly different at this timepoint, ESR1 mRNA levels of both cell lines were slightly increased after 24-hour treatment with DAC, with logFC = 2.70 and 1.59 for MG63.3 and MC-KOS respectively. After 72 hours, canine OSA cells treated with DAC demonstrated increased ERα cDNA (Fig. 3 c) which was associated with increased expression and activity of the bone differentiation marker ALPL in vitro (Fig. 3 d-e). DAC inhibits canine OSA growth and metastasis We next aimed to investigate the effects of DAC treatment on canine OSA progression. In vitro cell proliferation testing showed DAC suppressed MC-KOS growth (Fig. 4 a) with an EC50 = 4.69 µM at Day 7 (Fig. S2 a). In vivo , primary tumor growth inhibition was observed as early as one week after treatment, but in contrast to MG63.3(Fig. 4 b, Fig. S2 b), the effect did not amplify much over time for MC-KOS. We next aimed to investigate the effects of DAC on metastasis, the primary determinant of prognosis in canine and human OSA patients[ 1 , 7 ]. In an experimental metastasis model, DAC-treated mice developed significantly fewer metastases than the control group (Fig. 4 c-d, p < 0.0001). The median survival for control and DAC-treated groups were 31 and 42 days respectively (p = 0.002, Fig. 4 e). Although the differences were minimal, increased immunolabeling of ERα, ALP, OMD, Sp7, SOX2 was observed in DAC-treated lung metastases in vivo (Fig. S2 c); no differences in immunoexpression were identified between DAC-exposed and control primary tumors (PT). DAC exposure in human and canine OSA leads to significant alterations in pathways including immune function and cell cycle progression DAC exposure restores ESR1 in canine OSA cells (Fig. 3 c); however, DAC is a non-specific demethylating agent which may have additional anti-tumor activities. Gene set enrichment analysis (GSEA) showed more significantly altered pathways following DAC exposure in MG63.3 cells (Fig. 5 a) compared to MC-KOS (Fig. 5 b). These early alterations included activation of immune/inflammation-related pathways, and activation or suppression of cell cycle relevant mechanisms. Because we identified immune-related pathways, we next aimed to interrogate the Melanoma Antigen Gene (MAGE) family which is composed of cancer biomarkers and targets of immunotherapies[ 37 , 38 ]. Multiple genes in this family showed greatly increased mRNA expression after DAC treatment in MG63.3 and MC-KOS (Fig. 5 c-d). Alterations in other genes with known association with OSA such as NNAT and CXCL12 demonstrated favorable changes under DAC treatment (Table S1 ). Finally, although we were able to demonstrate that DAC was effective in both canine and human OSA models, we identified increased effectiveness of DAC in MG63.3 in vitro (Fig. S1 a, S2a, S2b) and in metastatic progression in vivo compared to MC-KOS (Fig. 1 f, Fig. 4 d). Based on these data, we investigated the expression of DAC’s target, DNMT, in the MG63.3 and MC-KOS cell lines. Compared to MG63.3, MC-KOS had significantly lower expression of DNMT1 and DNMT3B, but a higher level of DNMT3A (Fig. 5 e). Discussion ESR1 has been shown to be hypermethylated in human OSA. Use of the DNMT inhibitor DAC restores ERα expression with subsequent inhibition of OSA growth and metastasis in three human OSA cell lines[ 29 ]. These findings provided rationale for our experiments in a fourth human cell line (MG63.3). DAC-treated MG63.3 demonstrated reduced primary tumor growth and significantly fewer pulmonary metastases. After confirming DAC’s activity in human OSA, our study focused on the comparative value of DAC in canine OSA. Canine OSA presents a favorable patient model for drug testing due to its clinical, pathological, and molecular similarities to human OSA[ 8 – 10 ]. Bolstered by the higher annual incidence of OSA in dogs, the canine model is also a rational bridge to future comparative oncology trials conducted in pet dogs with naturally occurring OSA[ 10 – 13 ]. Using the canine patient-derived MC-KOS cell line[ 31 ], DAC was demonstrated to inhibit tumor growth and metastasis in canine OSA. When compared, DAC decreased MG63.3 spontaneous metastasis more effectively (99.6%) compared to MC-KOS experimental metastasis (reduced by 76%). This difference may suggest that DAC is more effective in the spontaneous metastasis setting. Alternatively, differences in the DAC-targeted DNMTs were also observed. Namely, MG63.3 had higher expression of DNMT1 and 3B compared to MC-KOS. Future studies aimed at further investigating the roles of DNMTs in DAC treatment of canine OSA are warranted and should consider species and individual tumor differences in DNMTs expression. There is a paucity of data on estrogen signaling in canine OSA. Using patient tumor samples derived from an NCI-sponsored canine clinical trial[ 12 ], ESR1 was examined. Hypermethylation of ESR1 was observed in a subset of canine OSA patients. DAC treatment of MC-KOS was associated with increased ESR1 and enhanced cellular differentiation. This is consistent with previous studies in human OSA[ 29 ] and underscores a shared pathway that could be targeted therapeutically. Interestingly, the finding of downregulated SOX2 after 24 hours of exposure to DAC in vitro was also consistent with the previous study[ 29 ]. But the importance of elevated SOX2 immunoexpression in metastases is unclear. This may be due to non-specific demethylation by DAC. Additional experimental work to better characterize cells that form early-stage micrometastases in DAC-treated mice is warranted. Prior research has provided strong evidence that the restoration of ESR1 in human OSA cell lines significantly inhibits tumor progression[ 29 ]. But since DAC is a non-selective DNMT inhibitor, affecting broadly on numerous genes, it remains possible that other pathways/genes are impacted as well. By collecting cell samples 24h after DAC treatment, we were able to observe a window of time before ERα expression is fully restored. Several pathways and bone mineralization markers were already significantly altered at this timepoint. In addition, GSEA revealed enrichment in the MG63.3 treated group of pathways involved in innate immunity and inflammation, such as interferon response and complement system, suggesting the importance of immune processes in disease progression. These immune based gene signatures have also been reported in other human and canine OSA studies with enrichment associated with better disease outcomes[ 13 , 39 ]. The MAGE family Cancer-testis antigens (CTAs) are primarily expressed in testicular germ cells and placental tissue, but aberrantly present on a wide variety of solid tumors due to CpG islands demethylation[ 38 ]. These proteins are immunogenic, especially for A10[ 40 ] and A3[ 41 , 42 ], and are potential targets for cancer immunotherapy. Our data indicates that DAC effectively boost MAGE expression, which is consistent with findings described elsewhere[ 43 – 45 ]. It is possible that clinical use of DAC in conjunction with other immune therapies could result in improved outcomes and are rational candidate strategies for future studies[ 43 – 45 ]. Conclusions DAC treatment reduces primary tumor growth in canine and human OSA models. The development of pulmonary metastases was dramatically reduced in both models suggesting that metastatic lesions may be more vulnerable to epigenetic treatment. Although DAC significantly reduced canine OSA growth, the effects were more significant in the MG63.3 human OSA model which has higher expression of DAC-targeted DNMTs compared to MC-KOS. Finally, in addition to its effects on ER signaling, multiple pathways including immune activation are altered following DAC treatment. Future studies investigating the impact of DAC on DNMTs and immune pathways in canine OSA models are warranted. Declarations Competing interests The authors declare no conflicts of interest. Funding This work was supported by the Intramural Program of the National Cancer Institute, NIH (Z01-BC006161). The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the U.S. Government. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Author Contribution SH, SAK, LR, JAB were involved in project conceptualization, investigation, in vitro and in vivo methodology, assay validation, formal analysis, and writing. SP was involved in computational investigation, method validation, formal analysis and writing. AKL was involved in conceptualization, writing, and supervised the project. AC and MO provided investigational support for in vitro assays. CM provided project administration and supervisory support. All authors reviewed the manuscript. Acknowledgement Nucleic acid isolation and QA/QC was performed by the NCI CCR Genomics Technology Laboratory, with mRNA sequencing and initial data analysis conducted at the NCI CCR Sequencing Facility, through the Frederick National Laboratory for Cancer Research (FNLCR), Frederick, MD 21701. Data Availability Data is provided within the manuscript or supplementary information files. mRNA sequence data generated in this study will be deposited into the Gene Expression Omnibus (GEO) prior to manuscript publication. References Roberts RD et al (2019) Provocative questions in osteosarcoma basic and translational biology: A report from the Children's Oncology Group. Cancer 125(20):3514–3525 Selmic LE et al (2014) Comparison of carboplatin and doxorubicin-based chemotherapy protocols in 470 dogs after amputation for treatment of appendicular osteosarcoma. J Vet Intern Med 28(2):554–563 Bridge JA et al (1997) Cytogenetic findings in 73 osteosarcoma specimens and a review of the literature. Cancer Genet Cytogenet 95(1):74–87 Squire JA et al (2003) High-resolution mapping of amplifications and deletions in pediatric osteosarcoma by use of CGH analysis of cDNA microarrays. Genes Chromosomes Cancer 38(3):215–225 Rajan S et al (2023) Structurally Complex Osteosarcoma Genomes Exhibit Limited Heterogeneity within Individual Tumors and across Evolutionary Time. Cancer Res Commun 3(4):564–575 Fenger JM, London CA, Kisseberth WC (2014) Canine osteosarcoma: a naturally occurring disease to inform pediatric oncology. ILAR J 55(1):69–85 Bielack SS et al (2016) Advances in the management of osteosarcoma. F1000Res 5:2767 Mueller F, Fuchs B, Kaser-Hotz B (2007) Comparative biology of human and canine osteosarcoma. Anticancer Res 27 1A): 155 – 64 Morrow JJ, Khanna C (2015) Osteosarcoma Genetics and Epigenetics: Emerging Biology and Candidate Therapies. Crit Rev Oncog 20 3–4): 173 – 97 LeBlanc AK, Mazcko CN (2020) Improving human cancer therapy through the evaluation of pet dogs. Nat Rev Cancer 20(12):727–742 LeBlanc AK, Mazcko CN, Khanna C (2016) Defining the Value of a Comparative Approach to Cancer Drug Development. Clin Cancer Res 22(9):2133–2138 LeBlanc AK et al (2021) Adjuvant Sirolimus Does Not Improve Outcome in Pet Dogs Receiving Standard-of-Care Therapy for Appendicular Osteosarcoma: A Prospective, Randomized Trial of 324 Dogs. Clin Cancer Res 27(11):3005–3016 Mannheimer JD et al (2023) Transcriptional profiling of canine osteosarcoma identifies prognostic gene expression signatures with translational value for humans. Commun Biol 6(1):856 Manolagas SC, O'Brien CA, Almeida M (2013) The role of estrogen and androgen receptors in bone health and disease. Nat Rev Endocrinol 9(12):699–712 Wend K, Wend P, Krum SA (2012) Tissue-Specific Effects of Loss of Estrogen during Menopause and Aging. Front Endocrinol (Lausanne) 3:19 Khalid AB, Krum SA (2016) Estrogen receptors alpha and beta in bone. Bone 87:130–135 Oreffo RO et al (1999) Human bone marrow osteoprogenitors express estrogen receptor-alpha and bone morphogenetic proteins 2 and 4 mRNA during osteoblastic differentiation. J Cell Biochem 75(3):382–392 Dieudonne SC et al (1998) Immortalization and characterization of bone marrow stromal fibroblasts from a patient with a loss of function mutation in the estrogen receptor-alpha gene. J Bone Min Res 13(4):598–608 Arts J et al (1997) Differential expression of estrogen receptors alpha and beta mRNA during differentiation of human osteoblast SV-HFO cells. Endocrinology 138(11):5067–5070 Komm BS, Cheskis B, Bodine PVN (2008) Regulation of Bone Cell Function by Estrogens. Osteoporosis, Vols I and Ii, 3rd Edition: 383–423 Dohi O et al (2008) Sex steroid receptors expression and hormone-induced cell proliferation in human osteosarcoma. Cancer Sci 99(3):518–523 Locke WJ et al (2019) DNA Methylation Cancer Biomarkers: Translation to the Clinic. Front Genet 10:1150 Ross JP, Rand KN, Molloy PL (2010) Hypomethylation of repeated DNA sequences in cancer. Epigenomics 2(2):245–269 Twenhafel L et al (2023) Epigenetic Changes Associated with Osteosarcoma: A Comprehensive Review. Cells 12 12) Parker AC, Quinteros BI, Piccolo SR (2022) The DNA methylation landscape of five pediatric-tumor types. PeerJ 10:e13516 Li B et al (2018) Epigenetic Regulation of CXCL12 Plays a Critical Role in Mediating Tumor Progression and the Immune Response In Osteosarcoma. Cancer Res 78(14):3938–3953 Saeed H et al (2020) Aberrant epigenetic silencing of neuronatin is a frequent event in human osteosarcoma. Oncotarget 11(20):1876–1893 Asano N et al (2019) Epigenetic reprogramming underlies efficacy of DNA demethylation therapy in osteosarcomas. Sci Rep 9(1):20360 Lillo Osuna MA et al (2019) Activation of Estrogen Receptor Alpha by Decitabine Inhibits Osteosarcoma Growth and Metastasis. Cancer Res 79(6):1054–1068 Ren L et al (2015) Characterization of the metastatic phenotype of a panel of established osteosarcoma cells. Oncotarget 6(30):29469–29481 Hong SH et al (2011) Protein kinase C regulates ezrin-radixin-moesin phosphorylation in canine osteosarcoma cells. Vet Comp Oncol 9(3):207–218 Ren L et al (2017) Metabolomics uncovers a link between inositol metabolism and osteosarcoma metastasis. Oncotarget 8(24):38541–38553 Rohde C et al (2010) BISMA–fast and accurate bisulfite sequencing data analysis of individual clones from unique and repetitive sequences. BMC Bioinformatics 11:230 Wang C et al (2021) A novel canine reference genome resolves genomic architecture and uncovers transcript complexity. Commun Biol 4(1):185 Robinson MD, McCarthy DJ, Smyth GK (2010) edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26(1):139–140 Wu T et al (2021) clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innov (Camb) 2(3):100141 Weon JL, Potts PR (2015) The MAGE protein family and cancer. Curr Opin Cell Biol 37:1–8 Simpson AJ et al (2005) Cancer/testis antigens, gametogenesis and cancer. Nat Rev Cancer 5(8):615–625 Scott MC et al (2018) Comparative Transcriptome Analysis Quantifies Immune Cell Transcript Levels, Metastatic Progression, and Survival in Osteosarcoma. Cancer Res 78(2):326–337 Schultz-Thater E et al (2011) MAGE-A10 is a nuclear protein frequently expressed in high percentages of tumor cells in lung, skin and urothelial malignancies. Int J Cancer 129(5):1137–1148 Krishnadas DK, Shapiro T, Lucas K (2013) Complete remission following decitabine/dendritic cell vaccine for relapsed neuroblastoma. Pediatrics 131(1):e336–e341 Esfandiary A, Ghafouri-Fard S (2015) MAGE-A3: an immunogenic target used in clinical practice. Immunotherapy-Uk 7(6):683–704 Bao L, Dunham K, Lucas K (2011) MAGE-A1, MAGE-A3, and NY-ESO-1 can be upregulated on neuroblastoma cells to facilitate cytotoxic T lymphocyte-mediated tumor cell killing. Cancer Immunol Immun 60(9):1299–1307 Cruz CR et al (2011) Improving T-cell therapy for relapsed EBV-negative Hodgkin lymphoma by targeting upregulated MAGE-A4. Clin Cancer Res 17(22):7058–7066 Krishnadas DK et al (2014) Decitabine facilitates immune recognition of sarcoma cells by upregulating CT antigens, MHC molecules, and ICAM-1. Tumour Biol 35(6):5753–5762 Additional Declarations No competing interests reported. Supplementary Files DACinOSmodelsSupplDatafinal.pptx Fig. S1 DAC inhibited MG63.3 growth and progression a EC 50 of DAC on Day 7. b DAC inhibited spontaneous lung metastasis, observed at Day 38. c Study design of testing DAC effect on purely lung metastasis. d Fluorescence microscopy confirmed early metastases established at lung on Day 19 after primary tumor initiation Fig. S2 DAC inhibited MC-KOS growth and progression a EC 50 of DAC on Day 7. b Relative growth inhibition percentage of MC-KOS and MG63.3 primary tumors. c Immunolabeling (H-score) of lung metastases and primary tumors (PT) derived from control (CTL) and DAC-treated mice. * p<0.05; *** p<0.001; **** p<0.0001 Table S1. Expression of osteosarcoma-relevant genes in control vs. DAC-treated human (MG63.3) and canine (MC-KOS) OSA. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4451060","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":308190818,"identity":"353348ff-fcaa-4690-b5a3-317f66024417","order_by":0,"name":"Shan Huang","email":"","orcid":"","institution":"National Cancer Institute, NIH","correspondingAuthor":false,"prefix":"","firstName":"Shan","middleName":"","lastName":"Huang","suffix":""},{"id":308190819,"identity":"1bff7f5a-303f-4357-be17-a0ecf46d7525","order_by":1,"name":"Ling Ren","email":"","orcid":"","institution":"National Cancer Institute, NIH","correspondingAuthor":false,"prefix":"","firstName":"Ling","middleName":"","lastName":"Ren","suffix":""},{"id":308190820,"identity":"b7ce59df-0e84-4cf5-a66b-a6b2eda217a6","order_by":2,"name":"Jessica A. Beck","email":"","orcid":"","institution":"National Cancer Institute, NIH","correspondingAuthor":false,"prefix":"","firstName":"Jessica","middleName":"A.","lastName":"Beck","suffix":""},{"id":308190821,"identity":"f602e34b-22c3-4d62-b314-c0e330a2f8eb","order_by":3,"name":"Sushant Patkar","email":"","orcid":"","institution":"National Cancer Institute, NIH","correspondingAuthor":false,"prefix":"","firstName":"Sushant","middleName":"","lastName":"Patkar","suffix":""},{"id":308190825,"identity":"dfeebb24-c474-41f8-9342-952def6ba879","order_by":4,"name":"Maria Angeles Lillo Osuna","email":"","orcid":"","institution":"University of Tennessee Health Science Center","correspondingAuthor":false,"prefix":"","firstName":"Maria","middleName":"Angeles Lillo","lastName":"Osuna","suffix":""},{"id":308190826,"identity":"cd47eb9d-fed2-43eb-91ca-debe9b8081c9","order_by":5,"name":"Aswini Cherukuri","email":"","orcid":"","institution":"National Cancer Institute, NIH","correspondingAuthor":false,"prefix":"","firstName":"Aswini","middleName":"","lastName":"Cherukuri","suffix":""},{"id":308190827,"identity":"9df0f04e-0e70-448b-b6b0-1d312fb2509c","order_by":6,"name":"Christina Mazcko","email":"","orcid":"","institution":"National Cancer Institute, NIH","correspondingAuthor":false,"prefix":"","firstName":"Christina","middleName":"","lastName":"Mazcko","suffix":""},{"id":308190832,"identity":"0de5cd86-255d-4a15-a2bc-d2feceb243bb","order_by":7,"name":"Susan A. Krum","email":"","orcid":"","institution":"University of Tennessee Health Science Center","correspondingAuthor":false,"prefix":"","firstName":"Susan","middleName":"A.","lastName":"Krum","suffix":""},{"id":308190836,"identity":"49239600-39cc-4b37-9738-8f7d5f238226","order_by":8,"name":"Amy K. LeBlanc","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2UlEQVRIie3RMQrCQBBA0REhWgykDSjZK0wQvILXiARSpQjYCFpEBG2sJeApvMHCQqocILApYpNasBVxky7NGjvB/c0wxWOKATCZfrUK+FSNQQXEexIfOKoxpK+J5QD0IPY5J/DXJdqXfb2J4xLY4kRa4shIkbxGp8zmMqUavDzXE2jI8iAQisiSSAK8NPS1grXkJZApsupFqCWJQFJk2BDmBFxLPBnG3M9q9IpwNlEECYWeuDK4Vvdt6bpFcHvgU7jsuEu0BGDcfR/2+Oao6u7s0w2TyWT6u95njkrZ4iK48gAAAABJRU5ErkJggg==","orcid":"","institution":"National Cancer Institute, NIH","correspondingAuthor":true,"prefix":"","firstName":"Amy","middleName":"K.","lastName":"LeBlanc","suffix":""}],"badges":[],"createdAt":"2024-05-20 21:11:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4451060/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4451060/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":58152307,"identity":"3903b1eb-faae-4d19-9b4a-8761a3df7bd7","added_by":"auto","created_at":"2024-06-11 20:19:49","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":638314,"visible":true,"origin":"","legend":"\u003cp\u003eDecitabine (DAC) therapy inhibits human OSA growth and metastasis\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e\u003cem\u003e In vitro\u003c/em\u003egrowth inhibition of MG63.3 human OSA cells (initial plating of 500 cell/well) over a range of decitabine exposures, exhibiting a dose-response relationship. MG63.3 vehicle control is depicted by the red curve. \u003cstrong\u003eb\u003c/strong\u003e \u003cem\u003eIn vivo\u003c/em\u003egrowth inhibition of MG63.3 xenografted primary tumors with decitabine therapy. \u003cstrong\u003ec\u003c/strong\u003e Depiction of MG63.3 gross primary tumor sizes at experimental endpoint, with and without DAC therapy. \u003cstrong\u003ed\u003c/strong\u003e Quantification of MG63.3 primary tumor size measurements, with and without DAC therapy. \u003cstrong\u003ee\u003c/strong\u003eRepresentative fluorescent stereomicroscopy images of MG63.3 lung metastasis, with and without DAC therapy. \u003cstrong\u003ef\u003c/strong\u003e Fluorescence quantification of lungs depicted in Fig. 1e. ** p\u0026lt;0.01; *** p\u0026lt;0.001; **** p\u0026lt;0.0001\u003c/p\u003e","description":"","filename":"211891ALeBLANCfigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4451060/v1/fdea5da3780d901432bfb0b3.png"},{"id":58151530,"identity":"444f58dc-6561-4ed7-86e0-71f586f815e4","added_by":"auto","created_at":"2024-06-11 20:11:49","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":753769,"visible":true,"origin":"","legend":"\u003cp\u003eESR1 is methylated in canine osteosarcoma\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea \u003c/strong\u003eComparison of ESR1 methylation status via methylation-specific PCR between normal canine bone, normal canine ovary, and the OSA cell line MC-KOS. \u003cstrong\u003eb \u003c/strong\u003eComparative location mapping of methylation of the ESR1 promoter determined through bisulfite sequencing. \u003cstrong\u003ec\u003c/strong\u003e ESR1 methylation quantification of Fig. 2b. \u003cstrong\u003ed\u003c/strong\u003e ESR1 methylation status of canine OSA patients’ primary tumor samples and the MC-KOS cell line. \u003cstrong\u003ee\u003c/strong\u003e Relative quantification (RQ) of ESR1 expression by mRNA in canine patient osteosarcoma samples (represented by patient ID number on the x-axis). **** p\u0026lt;0.0001\u003c/p\u003e","description":"","filename":"211891ALeBLANCfigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4451060/v1/7fb23e8f2f1076c181710421.png"},{"id":58152308,"identity":"944fcbfc-3522-4e95-a697-5b5934a5928c","added_by":"auto","created_at":"2024-06-11 20:19:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":411782,"visible":true,"origin":"","legend":"\u003cp\u003eDAC restores ERα and promotes cellular differentiation of canine OSA\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e Gene expression heatmap demonstrating increased expression of ESR1 and bone mineralization markers in control and DAC treated MG63.3 and \u003cstrong\u003e(b)\u003c/strong\u003e MC-KOS cell lines. \u003cstrong\u003ec \u003c/strong\u003eRelative cDNA levels of ESR1 and \u003cstrong\u003e(d)\u003c/strong\u003e ALPL after 72 hrs DAC treatment in MC-KOS. \u003cstrong\u003ee\u003c/strong\u003e Alkaline phosphastase staining in control and DAC-exposed MC-KOS cells (72 hrs). ** p\u0026lt;0.01; *** p\u0026lt;0.001\u003c/p\u003e","description":"","filename":"211891ALeBLANCfigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4451060/v1/37b8f6b8b6156fea2178f233.png"},{"id":58151528,"identity":"55dff20d-567a-44e6-bfac-d031b8b95707","added_by":"auto","created_at":"2024-06-11 20:11:49","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":570529,"visible":true,"origin":"","legend":"\u003cp\u003eDAC inhibits canine OS primary tumor growth and metastasis\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e \u003cem\u003eIn vitro\u003c/em\u003e growth inhibition of MC-KOS canine OSA cells (initial plating of 500 cell/well) over a range of decitabine exposures, exhibiting a dose-response relationship. MC-KOS vehicle control is depicted by the red curve. \u003cstrong\u003eb\u003c/strong\u003e Modest \u003cem\u003ein vivo\u003c/em\u003e growth inhibition of MC-KOS xenografted primary tumors with decitabine therapy. \u003cstrong\u003ec\u003c/strong\u003eDepiction of MC-KOS gross and fluorescent stereomicroscopy images of experimental lung metastases with and without DAC therapy, with quantification of fluorescent images given in panel \u003cstrong\u003e(d)\u003c/strong\u003e. \u003cstrong\u003ee\u003c/strong\u003e Kaplan-Meier survival curve of MC-KOS experiment metastasis mice treated with DAC. ** p\u0026lt;0.01; *** p\u0026lt;0.001; **** p\u0026lt;0.0001\u003c/p\u003e","description":"","filename":"211891ALeBLANCfigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4451060/v1/b4bee114b206c06f7f1dcb6d.png"},{"id":58152309,"identity":"a7aba5df-cab9-43c0-b108-8cd69ab8083c","added_by":"auto","created_at":"2024-06-11 20:19:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":697950,"visible":true,"origin":"","legend":"\u003cp\u003eDAC exposure in human and canine OSA leads to significant alterations in pathways including immune function and cell cycle progression\u003c/p\u003e\n\u003cp\u003eGene set enrichment analysis (GSEA) of \u003cstrong\u003e(a)\u003c/strong\u003e MG63.3 and \u003cstrong\u003e(b)\u003c/strong\u003e MC-KOS cells after DAC treatment. Gene expression changes of MAGE family in \u003cstrong\u003e(c)\u003c/strong\u003eMG63.3 and \u003cstrong\u003e(d)\u003c/strong\u003e MC-KOS. \u003cstrong\u003ee\u003c/strong\u003e DNMTs expression level given as log Fold Change (FC) of MC-KOS / MG63.3. MC = MC-KOS, MG = MG63.3. *** p\u0026lt;0.001\u003c/p\u003e","description":"","filename":"211891ALeBLANCfigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4451060/v1/c58c0526671b1428439f176e.png"},{"id":61655776,"identity":"7c0dddef-90e2-4f29-a6c9-5b662f5b398e","added_by":"auto","created_at":"2024-08-02 13:37:23","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3841658,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4451060/v1/09526e3b-8e0b-4c8a-81d9-fda468bb1738.pdf"},{"id":58151533,"identity":"e8d04060-5c75-4e56-a23e-e438c6993a04","added_by":"auto","created_at":"2024-06-11 20:11:49","extension":"pptx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":10799420,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig. S1\u003c/strong\u003e DAC inhibited MG63.3 growth and progression\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e EC\u003csub\u003e50\u003c/sub\u003e of DAC on Day 7. \u003cstrong\u003eb\u003c/strong\u003e DAC inhibited spontaneous lung metastasis, observed at Day 38. \u003cstrong\u003ec\u003c/strong\u003e Study design of testing DAC effect on purely lung metastasis. \u003cstrong\u003ed\u003c/strong\u003e Fluorescence microscopy confirmed early metastases established at lung on Day 19 after primary tumor initiation\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFig. S2\u003c/strong\u003e DAC inhibited MC-KOS growth and progression\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e EC\u003csub\u003e50\u003c/sub\u003e of DAC on Day 7. \u003cstrong\u003eb\u003c/strong\u003e Relative growth inhibition percentage of MC-KOS and MG63.3 primary tumors. \u003cstrong\u003ec\u003c/strong\u003e Immunolabeling (H-score) of lung metastases and primary tumors (PT) derived from control (CTL) and DAC-treated mice. * p\u0026lt;0.05; *** p\u0026lt;0.001; **** p\u0026lt;0.0001\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable S1.\u003c/strong\u003e Expression of osteosarcoma-relevant genes in control vs. DAC-treated human (MG63.3) and canine (MC-KOS) OSA.\u003c/p\u003e","description":"","filename":"DACinOSmodelsSupplDatafinal.pptx","url":"https://assets-eu.researchsquare.com/files/rs-4451060/v1/e58a48be8bef0b5413a5e22d.pptx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Comparative responses to demethylating therapy in animal models of osteosarcoma","fulltext":[{"header":"Background","content":"\u003cp\u003eOsteosarcoma (OSA) is a rare and aggressive pediatric/adolescent/young adult primary bone malignancy, but a more common cancer in large breed dogs. Clinically, the disease exhibits a high metastatic rate regardless of treatment type. Currently, the 5-year survival rate is less than 70% for humans[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], while the three-year survival rate for dogs is less than 10%[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. OSA is characterized by a chaotic genome, with a high incidence of structural variations rather than druggable driving mutations in specific genes[\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Both species have experienced little improvement in clinical outcomes over the past over 30 years[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], underscoring the need for novel approaches to OSA therapy. Canine OSA shares many similarities with human disease, including gene expression, tumor biology, clinical features[\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], and provides unique opportunities to test promising therapies for humans in comparative oncology clinical trials[\u003cspan additionalcitationids=\"CR11 CR12\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eEstrogens contribute to skeleton growth and life-long bone homeostasis by acting on multiple cell types through a complicated signaling network[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. They exert physiological functions in almost every tissue in the body in both males and females[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] by interacting with either estrogen receptors alpha (ERα) or beta (ERβ)[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Both receptors are well expressed in bone marrow stromal cells[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] and during osteoblast differentiation[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], but ERα mRNA was not detectable in human OSA cell lines HOS-TE85, SaOS2 and MG63[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Another study of 28 human OSA patient samples also showed no ERα expression by IHC[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. A recent publication demonstrated that ERα was epigenetically silenced in several human OSA cell lines through promoter hypermethylation. DNA methylation changes are also widely seen in cancer cells[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Multiple genes relevant to OSA progression[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] have been shown to exhibit inactivation due to aberrant DNA methylation in OSA human patient samples and cell lines, such as SPRY2[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], CXCL12[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], and NNAT[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Decitabine (DAC; 5-aza-2\u0026rsquo;-deoxycytidine) is a cytidine analog. It can incorporate into DNA strands during replication and irreversibly binds to DNA methyltransferase (DNMT) to reduce the levels of DNA methylation in a division-dependent manner thus restoring gene expression[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Critically, by utilizing the non-selective DNMT inhibitor DAC to restore ERα expression, OSA growth and metastasis have been significantly suppressed in a human xenograft model[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. These findings formed the basis for the work shown herein, which leverages a comparative approach through the examination of canine OSA as a naturally occurring model of human OSA to support studies of biology and drug development.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture studies\u003c/h2\u003e \u003cp\u003eHuman MG63.3[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] and canine MC-KOS[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] OSA cells were grown at 37\u0026deg;C in 5% CO\u003csub\u003e2\u003c/sub\u003e in DMEM supplemented with 10% fetal bovine serum, 2 mM glutamine, and Pen/Strep. Both cell lines were transfected with lentiviral green fluorescent protein (GFP) constructs (pSICO-eGFP or p960-X1-685-eGFP). Decitabine (Dacogen) was purchased from Otsuka (NDC 59148-046-70).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCell proliferation assays\u003c/h2\u003e \u003cp\u003eCell proliferation assays were performed using the IncuCyte ZOOM system (Essen BioScience Inc). Serial phase-contrast images were gathered and processed as the percentage of confluency to measure cell proliferation. Each data point represents the mean reading from sextuplicate analyses. All assays were conducted in duplicate. For drug treatment, the drug concentrations are indicated within the [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]s and text. Dimethyl sulfoxide (DMSO) was used as the control for group comparisons. EC\u003csub\u003e50\u003c/sub\u003e was calculated using IncuCyte software using the data collected at 7 days post treatment.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vivo\u003c/b\u003e \u003cb\u003eorthotopic xenograft tumor growth and treatment\u003c/b\u003e\u003c/p\u003e \u003cp\u003e All animal work was conducted with the approval of the Animal Care and Use Committee of the National Cancer Institute under Animal Study Protocol PB-038. Primary tumor growth was evaluated by orthotopic injection of 10\u003csup\u003e6\u003c/sup\u003e MG63.3 or MC-KOS cells/ 0.1 ml of Hank\u0026rsquo;s balanced salt solution (HBSS) into a parosseous site deep in the left caudal gastrocnemius of 6-week-old female SCID-Beige mice (Fox Chase CB17.B6-\u003cem\u003ePrkdc\u003c/em\u003e\u003csup\u003e\u003cem\u003escid\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eLyst\u003c/em\u003e\u003csup\u003e\u003cem\u003ebg\u003c/em\u003e\u003c/sup\u003e/Crl) as described previously[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Treatment was initiated 10 days after tumor cell injection when primary tumors became palpable. For spontaneous metastasis model experiments, tumor bearing limbs were surgically amputated on Day 21, with treatment initiation 3 days after amputation. Experimental metastasis experiments were used for the MC-KOS cell line due to the protracted period of time needed for development of spontaneous metastases. 10\u003csup\u003e6\u003c/sup\u003e MC-KOS cells/ 0.1 ml of HBSS was injected through tail vein, and the treatment was started the day after cell injection. Mice received intraperitoneal injection (ip) of sterile saline (Control) and DAC (1mg/kg) on Monday-Wednesday-Friday with 2-week on 1-week off schedule. After 25 days, five mice from each group were euthanized to assess lung metastasis burden. The remaining mice were used for survival analysis. The volume of orthotopic tumor growth was measured once a week with digital calipers to obtain two diameters of the tumor sphere determined using the equation (\u003cem\u003eD\u003c/em\u003e \u0026times; \u003cem\u003ed\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e)/6 \u0026times; 3.12 (where \u003cem\u003eD\u003c/em\u003e\u0026thinsp;=\u0026thinsp;the maximum diameter and d\u0026thinsp;=\u0026thinsp;the minimum diameter).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePulmonary metastasis assessment\u003c/h2\u003e \u003cp\u003eEarly micro-metastases of lungs were examined and imaged with fluorescence inverted microscope (Leica DM IRB) with an attached CCD camera. Whole lung images were taken using a Leica MZ FLIII fluorescence stereomicroscope. The areas of fluorescent lung metastases were quantified with ImageJ software. Lung metastases were also examined using H\u0026amp;E-stained paraffin-embedded sections.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eCanine tissue samples\u003c/h2\u003e \u003cp\u003eTreatment-na\u0026iuml;ve canine OSA tumor and normal bone samples were collected at the time of therapeutic surgical limb amputation from patients enrolled in the NCI Comparative Oncology Trials Consortium (COTC) 021/022 trials, as described previously[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eMethylation specific PCR and bisulfite sequencing\u003c/h2\u003e \u003cp\u003eTotal cellular DNA was extracted from cells by using DNeasy Blood \u0026amp; Tissue Kit (Qiagen) following the manufacturer's recommendations. Each DNA sample was collected in triplicate. EpiMark Bisulfite Conversion Kit (New England Biolabs, Inc.) was used following the manufacturer's recommendations. For PCR amplification of the methylated and unmethylated ESR1 promoter, PCR was performed on the bisulfite-converted DNA with the following primers: Methylated ESR1 F GAGTAGTTATAGTTACGGGGTCGTC, R AATTTTCTTCCTACTACCAAACGAA; Unmethylated ESR1 F AGTAGTTATAGTTATGGGGTTGTTG and R AATTTTCTTCCTACTACCAAACAA\u003c/p\u003e \u003cp\u003eThe PCR products were then analyzed by agarose gel electrophoresis. For bisulfite sequencing the PCR products were cloned into pCRII with the TOPO-TA Cloning Kit (Life Technologies). Individual clones were sequenced by Sanger sequencing with the T7 promoter primer. The data were analyzed with BISMA[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eQuantitative PCR Total cellular RNA was extracted from cells with TRIzol Reagent (Invitrogen). Each RNA sample was collected in biological triplicates and each qPCR reaction was amplified in triplicate. Total RNA was converted to cDNA with Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) according to the manufacturer's instructions. cDNA was subjected to quantitative PCR using the Maxima SYBR Green qPCR Master Mix with ROX (ThermoFisher Scientific). Gene expression levels were compared after normalization to endogenous β-actin (Actb). Primers were selected using Primer-BLAST and the sequences are: Actb: TGTGTTATGTGGCCCTGGAC and TTCCATGCCCAGGAAGGAAG, and ESR1: GCATCCAGGGAAGCTCTTCTT and TCTCTTCCAGAGACTTCAGGGT, and ALPL: CCAAGGACGCTGGGAAATCT and ACGTTGTGCATGAGCTGGTA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry (IHC)\u003c/h2\u003e \u003cp\u003eFormalin-fixed, paraffin-embedded murine tissues were immunolabeled for estrogen receptor α (ERα, abcam ab259427, 1:400), alkaline phosphatase (ALP, abcam ab65834, 1:250), osteomodulin (OMD, abcam ab154249, 1:400), Sp7/Osterix (abcam ab209484, 1:400), and SOX2 (abcam ab97959, 1:800) by VitroVivo Biotech. The H-score was quantified in annotated lung metastases using HALO\u0026rsquo;s cytonuclear algorithm, which captures both the intensity and the proportion of the biomarker of interest from the IHC image.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eAlkaline phosphatase staining\u003c/h2\u003e \u003cp\u003eMC-KOS cells were treated with 20 \u0026micro;M DAC for 72 hours and then fixed with 3.7% formaldehyde and stained for alkaline phosphatase using SIGMAFAST BCIP/NBT (Sigma-Aldrich).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eNucleic acid isolation and mRNA sequencing\u003c/h2\u003e \u003cp\u003eMG63.3 and MC-KOS cells treated with DAC and DMSO \u003cem\u003ein vitro\u003c/em\u003e for 24 hours were collected, with 3 replicates for each group. mRNA was isolated from cell line pellets using Qiagen Allprep DNA/RNA Mini Kit (Cat#80204). The total mRNA quality and quantity were assessed using Nanodrop 8000 (ThermoFisher) and Agilent 4200 Tapestation with RNA Screen Tape (Cat# 5067\u0026ndash;5576) and RNA Screen Tape sample Buffer (Cat#5067\u0026ndash;5577). All samples forwarded for mRNA sequencing had a RIN\u0026thinsp;\u0026gt;\u0026thinsp;8 and a total RNA quantity\u0026thinsp;\u0026gt;\u0026thinsp;100 ng.\u003c/p\u003e \u003cp\u003eCanine MC-KOS mRNA-Seq samples were pooled and sequenced on NovaSeq 6000 S2 using Illumina\u0026reg; Stranded mRNA Prep and paired-end sequencing. The samples have 136 to 185\u0026nbsp;million pass filter reads with more than 90% of bases above the quality score of Q30. Reads of the samples were trimmed for adapters and low-quality bases using Cutadapt before alignment with the reference genome (GSD_1.0, also referred to as canfam4)[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] and the annotated transcripts using STAR. The average mapping rate of all samples was 95%, with unique alignment above 75%. There were 3.35 to 10.99% unmapped reads. The mapping statistics were calculated using Picard software. The samples have 3.14% ribosomal bases. Percent coding bases are between 49\u0026ndash;60%. Percent UTR bases are 24\u0026ndash;28%, and mRNA bases are between 76\u0026ndash;87% for all the samples. Library complexity was measured in terms of unique fragments in the mapped reads using Picard\u0026rsquo;s MarkDuplicate utility. The samples had 68\u0026ndash;76% non-duplicate reads.\u003c/p\u003e \u003cp\u003eHuman MG63.3 mRNA-Seq samples were pooled and sequenced on NovaSeq 6000 S2 using Illumina\u0026reg; Stranded mRNA Prep and paired-end sequencing. The samples had 105 to 159\u0026nbsp;million pass filter reads with more than 91% of bases above the quality score of Q30. Reads of the samples were trimmed for adapters and low-quality bases using Cutadapt before alignment with the reference genome (hg38) and the annotated transcripts using STAR. The average mapping rate of all samples is 93%, with unique alignment above 85%. There were 5.25 to 8.72% unmapped reads. The mapping statistics were calculated using Picard software. The samples have 0.75% ribosomal bases. Percent coding bases are between 57\u0026ndash;63%. Percent UTR bases are 31\u0026ndash;37%, and mRNA bases are between 94\u0026ndash;95% for all the samples. Library complexity was measured in terms of unique fragments in the mapped reads using Picard\u0026rsquo;s MarkDuplicate utility. The samples had 59\u0026ndash;72% non-duplicate reads.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eDifferential expression and gene set enrichment analysis\u003c/h2\u003e \u003cp\u003eRaw read count data from untreated and DAC-treated osteosarcoma cell lines are provided as input to edgeR[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e] (v3.40.2) using default parameter settings for differential expression analysis. This analysis was done independently for both canine and human osteosarcoma cell lines. Following differential expression analysis, all genes were ranked by their log fold change in expression estimated by edgeR. Genes ranked at the top of the list with high positive log fold change correspond to genes that had relatively higher expression in DAC-treated compared to untreated cell lines, whereas genes with high negative log fold change in expression had relatively lower expression in DAC treated compared to untreated cell lines. The ranked list of all genes based on the log-fold change was then provided as input to the standard Gene Set Enrichment Analysis (GSEA) pipeline implemented in clusterProfiler[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] (v4.6.2) with the following parameters specified: (nPermSimple: 100000, minGSSize\u0026thinsp;=\u0026thinsp;10, maxGSSize\u0026thinsp;=\u0026thinsp;500) to estimate the relative enrichment of cancer hallmark pathways in DAC treated and untreated cell lines.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eVisualization of gene expression data in heatmaps\u003c/h2\u003e \u003cp\u003eNormalized read count data (TPM) for MC-KOS and MG63.3 osteosarcoma cell lines were log2 transformed and scaled to obtain Z scores. The Z scores are then visualized in heatmaps as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e5\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eUnpaired T-test was used to compare the difference between the groups using GraphPad 10.0.3. Data within the figures are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean. Pathway enrichment p-values were estimated using the hypergeometric test. P-values and all pathways with false discovery rates (FDR)\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eDAC inhibits human OSA growth and metastasis\u003c/h2\u003e \u003cp\u003eDAC treatment was first tested on the highly metastatic human OSA cell line MG63.3. MG63.3 was sensitive to DAC (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003ea), with a half maximal effective concentration (EC\u003csub\u003e50\u003c/sub\u003e)\u0026thinsp;=\u0026thinsp;0.66 \u0026micro;M at Day 7 (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ea). Primary tumor growth \u003cem\u003ein vivo\u003c/em\u003e was significantly slowed after one week of DAC treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eb), with minimal increase over the four-week regimen (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003ec-d). Lungs were collected and observed under fluorescence microscopy to identify and quantify GFP-positive pulmonary metastases. Compared to the control group which developed multiple lung metastatic nodules, DAC-treated mice developed fewer pulmonary micro-metastases (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eb). To study DAC effect on early lung metastasis, another primary tumor model group was generated (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ec) which developed early lung metastasis by Day 19 (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ed) followed by surgical limb amputation (Day 21) and DAC treatment (Day 24). After 45 days, this early metastasis model also identified significantly fewer metastases in DAC-treated mice showed compared to control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003ee-f) underscoring the effectiveness of DAC on metastatic progression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eThe ESR1 promoter is methylated in canine OSA samples\u003c/h2\u003e \u003cp\u003eThe effects of DAC in human osteosarcoma have been in part attributed to its demethylating effects on the ESR1 promoter in human tumors[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Little is known about the role and status of ESR1 in canine osteosarcoma. Methylation-specific PCR was performed on normal canine bone and the MC-KOS canine OSA cell line to assess methylation of the ESR1 promoter region (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). Normal canine ovarian tissue was also tested as a positive control for unmethylated DNA, as there is high expression of ESR1. The specific methylation locations at ESR1 promoter region were explored using bisulfite sequencing (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). The methylation percentage of the canine OSA cell line (MC-KOS) was significantly higher than normal bone tissue at approximately 60% (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). Finally, 15 canine OSA patients\u0026rsquo; tumor samples were examined for ESR1 promoter methylation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003ed). Five (33%) presented complete methylation; seven (47%) were partial; only one sample was totally unmethylated. ESR1 expression varied in canine osteosarcomas but was low to undetectable in over half of the samples (n\u0026thinsp;=\u0026thinsp;12; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003ee).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eDAC restores ERα and promotes cellular differentiation of canine OSA\u003c/h2\u003e \u003cp\u003eSince a subset of canine patients demonstrate ESR1 hypermethylation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003e) similar to that described in human OSA patients, we next investigated DAC treatment in canine OSA cells to determine whether they respond similarly to human OSA cells[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] including restoration of ERα and enhanced cellular differentiation. Canine and human OSA cells were exposed to DAC \u003cem\u003ein vitro\u003c/em\u003e and collected after 24 hours for mRNA sequencing. Markers of bone mineralization, alkaline phosphatase (ALPL) and osteomodulin (OMD), were increased in MG63.3 (logFC\u0026thinsp;=\u0026thinsp;3.21, FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and MC-KOS (logFC\u0026thinsp;=\u0026thinsp;1.51, FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003ea-b). Although not significantly different at this timepoint, ESR1 mRNA levels of both cell lines were slightly increased after 24-hour treatment with DAC, with logFC\u0026thinsp;=\u0026thinsp;2.70 and 1.59 for MG63.3 and MC-KOS respectively. After 72 hours, canine OSA cells treated with DAC demonstrated increased ERα cDNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003ec) which was associated with increased expression and activity of the bone differentiation marker ALPL \u003cem\u003ein vitro\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003ed-e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eDAC inhibits canine OSA growth and metastasis\u003c/h2\u003e \u003cp\u003eWe next aimed to investigate the effects of DAC treatment on canine OSA progression. \u003cem\u003eIn vitro\u003c/em\u003e cell proliferation testing showed DAC suppressed MC-KOS growth (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003ea) with an EC50\u0026thinsp;=\u0026thinsp;4.69 \u0026micro;M at Day 7 (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003ea). \u003cem\u003eIn vivo\u003c/em\u003e, primary tumor growth inhibition was observed as early as one week after treatment, but in contrast to MG63.3(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eb, Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eb), the effect did not amplify much over time for MC-KOS. We next aimed to investigate the effects of DAC on metastasis, the primary determinant of prognosis in canine and human OSA patients[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. In an experimental metastasis model, DAC-treated mice developed significantly fewer metastases than the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003ec-d, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). The median survival for control and DAC-treated groups were 31 and 42 days respectively (p\u0026thinsp;=\u0026thinsp;0.002, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003ee). Although the differences were minimal, increased immunolabeling of ERα, ALP, OMD, Sp7, SOX2 was observed in DAC-treated lung metastases \u003cem\u003ein vivo\u003c/em\u003e (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003ec); no differences in immunoexpression were identified between DAC-exposed and control primary tumors (PT).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eDAC exposure in human and canine OSA leads to significant alterations in pathways including immune function and cell cycle progression\u003c/b\u003e \u003c/p\u003e \u003cp\u003eDAC exposure restores ESR1 in canine OSA cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003ec); however, DAC is a non-specific demethylating agent which may have additional anti-tumor activities. Gene set enrichment analysis (GSEA) showed more significantly altered pathways following DAC exposure in MG63.3 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e5\u003c/span\u003ea) compared to MC-KOS (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). These early alterations included activation of immune/inflammation-related pathways, and activation or suppression of cell cycle relevant mechanisms. Because we identified immune-related pathways, we next aimed to interrogate the Melanoma Antigen Gene (MAGE) family which is composed of cancer biomarkers and targets of immunotherapies[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Multiple genes in this family showed greatly increased mRNA expression after DAC treatment in MG63.3 and MC-KOS (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e5\u003c/span\u003ec-d). Alterations in other genes with known association with OSA such as NNAT and CXCL12 demonstrated favorable changes under DAC treatment (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Finally, although we were able to demonstrate that DAC was effective in both canine and human OSA models, we identified increased effectiveness of DAC in MG63.3 \u003cem\u003ein vitro\u003c/em\u003e (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ea, S2a, S2b) and in metastatic progression \u003cem\u003ein vivo\u003c/em\u003e compared to MC-KOS (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003ef, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003ed). Based on these data, we investigated the expression of DAC\u0026rsquo;s target, DNMT, in the MG63.3 and MC-KOS cell lines. Compared to MG63.3, MC-KOS had significantly lower expression of DNMT1 and DNMT3B, but a higher level of DNMT3A (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e5\u003c/span\u003ee).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eESR1 has been shown to be hypermethylated in human OSA. Use of the DNMT inhibitor DAC restores ERα expression with subsequent inhibition of OSA growth and metastasis in three human OSA cell lines[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. These findings provided rationale for our experiments in a fourth human cell line (MG63.3). DAC-treated MG63.3 demonstrated reduced primary tumor growth and significantly fewer pulmonary metastases. After confirming DAC\u0026rsquo;s activity in human OSA, our study focused on the comparative value of DAC in canine OSA. Canine OSA presents a favorable patient model for drug testing due to its clinical, pathological, and molecular similarities to human OSA[\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Bolstered by the higher annual incidence of OSA in dogs, the canine model is also a rational bridge to future comparative oncology trials conducted in pet dogs with naturally occurring OSA[\u003cspan additionalcitationids=\"CR11 CR12\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eUsing the canine patient-derived MC-KOS cell line[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], DAC was demonstrated to inhibit tumor growth and metastasis in canine OSA. When compared, DAC decreased MG63.3 spontaneous metastasis more effectively (99.6%) compared to MC-KOS experimental metastasis (reduced by 76%). This difference may suggest that DAC is more effective in the spontaneous metastasis setting. Alternatively, differences in the DAC-targeted DNMTs were also observed. Namely, MG63.3 had higher expression of DNMT1 and 3B compared to MC-KOS. Future studies aimed at further investigating the roles of DNMTs in DAC treatment of canine OSA are warranted and should consider species and individual tumor differences in DNMTs expression.\u003c/p\u003e \u003cp\u003eThere is a paucity of data on estrogen signaling in canine OSA. Using patient tumor samples derived from an NCI-sponsored canine clinical trial[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], ESR1 was examined. Hypermethylation of ESR1 was observed in a subset of canine OSA patients. DAC treatment of MC-KOS was associated with increased ESR1 and enhanced cellular differentiation. This is consistent with previous studies in human OSA[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] and underscores a shared pathway that could be targeted therapeutically. Interestingly, the finding of downregulated SOX2 after 24 hours of exposure to DAC \u003cem\u003ein vitro\u003c/em\u003e was also consistent with the previous study[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. But the importance of elevated SOX2 immunoexpression in metastases is unclear. This may be due to non-specific demethylation by DAC. Additional experimental work to better characterize cells that form early-stage micrometastases in DAC-treated mice is warranted.\u003c/p\u003e \u003cp\u003ePrior research has provided strong evidence that the restoration of ESR1 in human OSA cell lines significantly inhibits tumor progression[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. But since DAC is a non-selective DNMT inhibitor, affecting broadly on numerous genes, it remains possible that other pathways/genes are impacted as well. By collecting cell samples 24h after DAC treatment, we were able to observe a window of time before ERα expression is fully restored. Several pathways and bone mineralization markers were already significantly altered at this timepoint. In addition, GSEA revealed enrichment in the MG63.3 treated group of pathways involved in innate immunity and inflammation, such as interferon response and complement system, suggesting the importance of immune processes in disease progression. These immune based gene signatures have also been reported in other human and canine OSA studies with enrichment associated with better disease outcomes[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. The MAGE family Cancer-testis antigens (CTAs) are primarily expressed in testicular germ cells and placental tissue, but aberrantly present on a wide variety of solid tumors due to CpG islands demethylation[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. These proteins are immunogenic, especially for A10[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e] and A3[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], and are potential targets for cancer immunotherapy. Our data indicates that DAC effectively boost MAGE expression, which is consistent with findings described elsewhere[\u003cspan additionalcitationids=\"CR44\" citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. It is possible that clinical use of DAC in conjunction with other immune therapies could result in improved outcomes and are rational candidate strategies for future studies[\u003cspan additionalcitationids=\"CR44\" citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e].\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eDAC treatment reduces primary tumor growth in canine and human OSA models. The development of pulmonary metastases was dramatically reduced in both models suggesting that metastatic lesions may be more vulnerable to epigenetic treatment. Although DAC significantly reduced canine OSA growth, the effects were more significant in the MG63.3 human OSA model which has higher expression of DAC-targeted DNMTs compared to MC-KOS. Finally, in addition to its effects on ER signaling, multiple pathways including immune activation are altered following DAC treatment. Future studies investigating the impact of DAC on DNMTs and immune pathways in canine OSA models are warranted.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eCompeting interests\u003c/h2\u003e\n\u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e\n\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by the Intramural Program of the National Cancer Institute, NIH (Z01-BC006161). The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the U.S. Government. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eSH, SAK, LR, JAB were involved in project conceptualization, investigation, in vitro and in vivo methodology, assay validation, formal analysis, and writing. SP was involved in computational investigation, method validation, formal analysis and writing. AKL was involved in conceptualization, writing, and supervised the project. AC and MO provided investigational support for in vitro assays. CM provided project administration and supervisory support. All authors reviewed the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eNucleic acid isolation and QA/QC was performed by the NCI CCR Genomics Technology Laboratory, with mRNA sequencing and initial data analysis conducted at the NCI CCR Sequencing Facility, through the Frederick National Laboratory for Cancer Research (FNLCR), Frederick, MD 21701.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eData is provided within the manuscript or supplementary information files. mRNA sequence data generated in this study will be deposited into the Gene Expression Omnibus (GEO) prior to manuscript publication.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eRoberts RD et al (2019) Provocative questions in osteosarcoma basic and translational biology: A report from the Children's Oncology Group. Cancer 125(20):3514\u0026ndash;3525\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelmic LE et al (2014) Comparison of carboplatin and doxorubicin-based chemotherapy protocols in 470 dogs after amputation for treatment of appendicular osteosarcoma. J Vet Intern Med 28(2):554\u0026ndash;563\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBridge JA et al (1997) Cytogenetic findings in 73 osteosarcoma specimens and a review of the literature. Cancer Genet Cytogenet 95(1):74\u0026ndash;87\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSquire JA et al (2003) High-resolution mapping of amplifications and deletions in pediatric osteosarcoma by use of CGH analysis of cDNA microarrays. Genes Chromosomes Cancer 38(3):215\u0026ndash;225\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRajan S et al (2023) Structurally Complex Osteosarcoma Genomes Exhibit Limited Heterogeneity within Individual Tumors and across Evolutionary Time. Cancer Res Commun 3(4):564\u0026ndash;575\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFenger JM, London CA, Kisseberth WC (2014) Canine osteosarcoma: a naturally occurring disease to inform pediatric oncology. ILAR J 55(1):69\u0026ndash;85\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBielack SS et al (2016) Advances in the management of osteosarcoma. F1000Res 5:2767\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMueller F, Fuchs B, Kaser-Hotz B (2007) Comparative biology of human and canine osteosarcoma. Anticancer Res 27 1A): 155\u0026thinsp;\u0026ndash;\u0026thinsp;64\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorrow JJ, Khanna C (2015) Osteosarcoma Genetics and Epigenetics: Emerging Biology and Candidate Therapies. Crit Rev Oncog 20 3\u0026ndash;4): 173\u0026thinsp;\u0026ndash;\u0026thinsp;97\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeBlanc AK, Mazcko CN (2020) Improving human cancer therapy through the evaluation of pet dogs. Nat Rev Cancer 20(12):727\u0026ndash;742\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeBlanc AK, Mazcko CN, Khanna C (2016) Defining the Value of a Comparative Approach to Cancer Drug Development. Clin Cancer Res 22(9):2133\u0026ndash;2138\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeBlanc AK et al (2021) Adjuvant Sirolimus Does Not Improve Outcome in Pet Dogs Receiving Standard-of-Care Therapy for Appendicular Osteosarcoma: A Prospective, Randomized Trial of 324 Dogs. Clin Cancer Res 27(11):3005\u0026ndash;3016\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMannheimer JD et al (2023) Transcriptional profiling of canine osteosarcoma identifies prognostic gene expression signatures with translational value for humans. Commun Biol 6(1):856\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManolagas SC, O'Brien CA, Almeida M (2013) The role of estrogen and androgen receptors in bone health and disease. Nat Rev Endocrinol 9(12):699\u0026ndash;712\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWend K, Wend P, Krum SA (2012) Tissue-Specific Effects of Loss of Estrogen during Menopause and Aging. Front Endocrinol (Lausanne) 3:19\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhalid AB, Krum SA (2016) Estrogen receptors alpha and beta in bone. Bone 87:130\u0026ndash;135\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOreffo RO et al (1999) Human bone marrow osteoprogenitors express estrogen receptor-alpha and bone morphogenetic proteins 2 and 4 mRNA during osteoblastic differentiation. J Cell Biochem 75(3):382\u0026ndash;392\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDieudonne SC et al (1998) Immortalization and characterization of bone marrow stromal fibroblasts from a patient with a loss of function mutation in the estrogen receptor-alpha gene. J Bone Min Res 13(4):598\u0026ndash;608\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArts J et al (1997) Differential expression of estrogen receptors alpha and beta mRNA during differentiation of human osteoblast SV-HFO cells. Endocrinology 138(11):5067\u0026ndash;5070\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKomm BS, Cheskis B, Bodine PVN (2008) Regulation of Bone Cell Function by Estrogens. Osteoporosis, Vols I and Ii, 3rd Edition: 383\u0026ndash;423\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDohi O et al (2008) Sex steroid receptors expression and hormone-induced cell proliferation in human osteosarcoma. Cancer Sci 99(3):518\u0026ndash;523\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLocke WJ et al (2019) DNA Methylation Cancer Biomarkers: Translation to the Clinic. Front Genet 10:1150\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoss JP, Rand KN, Molloy PL (2010) Hypomethylation of repeated DNA sequences in cancer. Epigenomics 2(2):245\u0026ndash;269\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTwenhafel L et al (2023) Epigenetic Changes Associated with Osteosarcoma: A Comprehensive Review. Cells 12 12)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParker AC, Quinteros BI, Piccolo SR (2022) The DNA methylation landscape of five pediatric-tumor types. PeerJ 10:e13516\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi B et al (2018) Epigenetic Regulation of CXCL12 Plays a Critical Role in Mediating Tumor Progression and the Immune Response In Osteosarcoma. Cancer Res 78(14):3938\u0026ndash;3953\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaeed H et al (2020) Aberrant epigenetic silencing of neuronatin is a frequent event in human osteosarcoma. Oncotarget 11(20):1876\u0026ndash;1893\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAsano N et al (2019) Epigenetic reprogramming underlies efficacy of DNA demethylation therapy in osteosarcomas. Sci Rep 9(1):20360\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLillo Osuna MA et al (2019) Activation of Estrogen Receptor Alpha by Decitabine Inhibits Osteosarcoma Growth and Metastasis. Cancer Res 79(6):1054\u0026ndash;1068\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRen L et al (2015) Characterization of the metastatic phenotype of a panel of established osteosarcoma cells. Oncotarget 6(30):29469\u0026ndash;29481\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHong SH et al (2011) Protein kinase C regulates ezrin-radixin-moesin phosphorylation in canine osteosarcoma cells. Vet Comp Oncol 9(3):207\u0026ndash;218\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRen L et al (2017) Metabolomics uncovers a link between inositol metabolism and osteosarcoma metastasis. Oncotarget 8(24):38541\u0026ndash;38553\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRohde C et al (2010) BISMA\u0026ndash;fast and accurate bisulfite sequencing data analysis of individual clones from unique and repetitive sequences. BMC Bioinformatics 11:230\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang C et al (2021) A novel canine reference genome resolves genomic architecture and uncovers transcript complexity. Commun Biol 4(1):185\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRobinson MD, McCarthy DJ, Smyth GK (2010) edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26(1):139\u0026ndash;140\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu T et al (2021) clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innov (Camb) 2(3):100141\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeon JL, Potts PR (2015) The MAGE protein family and cancer. Curr Opin Cell Biol 37:1\u0026ndash;8\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSimpson AJ et al (2005) Cancer/testis antigens, gametogenesis and cancer. Nat Rev Cancer 5(8):615\u0026ndash;625\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScott MC et al (2018) Comparative Transcriptome Analysis Quantifies Immune Cell Transcript Levels, Metastatic Progression, and Survival in Osteosarcoma. Cancer Res 78(2):326\u0026ndash;337\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchultz-Thater E et al (2011) MAGE-A10 is a nuclear protein frequently expressed in high percentages of tumor cells in lung, skin and urothelial malignancies. Int J Cancer 129(5):1137\u0026ndash;1148\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrishnadas DK, Shapiro T, Lucas K (2013) Complete remission following decitabine/dendritic cell vaccine for relapsed neuroblastoma. Pediatrics 131(1):e336\u0026ndash;e341\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEsfandiary A, Ghafouri-Fard S (2015) MAGE-A3: an immunogenic target used in clinical practice. Immunotherapy-Uk 7(6):683\u0026ndash;704\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBao L, Dunham K, Lucas K (2011) MAGE-A1, MAGE-A3, and NY-ESO-1 can be upregulated on neuroblastoma cells to facilitate cytotoxic T lymphocyte-mediated tumor cell killing. Cancer Immunol Immun 60(9):1299\u0026ndash;1307\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCruz CR et al (2011) Improving T-cell therapy for relapsed EBV-negative Hodgkin lymphoma by targeting upregulated MAGE-A4. Clin Cancer Res 17(22):7058\u0026ndash;7066\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrishnadas DK et al (2014) Decitabine facilitates immune recognition of sarcoma cells by upregulating CT antigens, MHC molecules, and ICAM-1. Tumour Biol 35(6):5753\u0026ndash;5762\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Osteosarcoma, decitabine, estrogen receptor alpha, canine","lastPublishedDoi":"10.21203/rs.3.rs-4451060/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4451060/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eThe demethylating agent decitabine (DAC) effectively inhibits tumor growth and metastasis by targeting ESR1 methylation to restore estrogen receptor alpha (ERα) signaling and promoting cellular differentiation in models of human osteosarcoma (OSA). Whether this pathway can be targeted in canine OSA patients is unknown.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eCanine OSA tumor samples were tested for ERα expression and ESR1 promoter methylation. Human (MG63.3) and canine (MC-KOS) OSA cell lines and murine xenografts were treated with DAC \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e, respectively. Samples were assessed using mRNA sequencing and tissue immunohistochemistry.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eESR1 is methylated in a subset of canine OSA patient samples and the MC-KOS cell line. DAC treatment led to enhanced differentiation as demonstrated by increased ALPL expression, and suppressed tumor growth \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. Metastatic progression was inhibited, particularly in the MG63.3 model, which expresses higher levels of DNA methyltransferases DNMT1 and 3B. DAC treatment induced significant alterations in immune response and cell cycle pathways.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eDAC treatment activates ERα signaling, promotes bone differentiation, and inhibits tumor growth and metastasis in human and canine OSA. Additional DAC-altered pathways and species- or individual-specific differences in DNMT expression may also play a role in DAC treatment of OSA.\u003c/p\u003e","manuscriptTitle":"Comparative responses to demethylating therapy in animal models of osteosarcoma","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-11 20:11:44","doi":"10.21203/rs.3.rs-4451060/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7d2a506e-5630-4c80-8bb4-3c39bd44be42","owner":[],"postedDate":"June 11th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-09-16T02:08:19+00:00","versionOfRecord":[],"versionCreatedAt":"2024-06-11 20:11:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4451060","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4451060","identity":"rs-4451060","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.