Study on the Mechanism of HLCS Gene Deficiency and Biotin Compensation Inhibiting Skeletal Muscle Development

preprint OA: closed
Full text JSON View at publisher
Full text 200,017 characters · extracted from preprint-html · click to expand
Study on the Mechanism of HLCS Gene Deficiency and Biotin Compensation Inhibiting Skeletal Muscle Development | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Study on the Mechanism of HLCS Gene Deficiency and Biotin Compensation Inhibiting Skeletal Muscle Development Gaoxiao Xu, Han Chu, Lei Qin, Yuxing Dai, Chunguang Zhang, Yunyan Luo, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6835205/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Holocarboxylase synthetase (HLCS) facilitates the binding of biotin to biotin-dependent carboxylase enzymes (ACC, MCC, PC, and PCC) for carboxylation reactions. This research demonstrates a significant association between single nucleotide polymorphisms (SNPs) in the HLCS gene and the lean meat percentage (LEA) and growth characteristics of Duroc pigs. To deepen our understanding of HLCS functionality, we conducted validation experiments using skeletal muscle cell models. Results Interference with HLCS at the cellular level led to a significant increase in the expressions of ACC and PC, resulting in inhibited proliferation and myogenic differentiation of skeletal muscle cells. Biotin, a coenzyme of carboxylase commonly used to address HLCS deficiency, unexpectedly resulted in a notable decrease in HLCS gene expression and a significant inhibition of myogenic muscle differentiation in our experiment. To further investigate the impact of biotin on muscle development, varying concentrations of biotin were added to the mice's base diet. It was observed that the expression of the HLCS gene in muscle tissue decreased, consequently hindering muscle tissue development. Subsequent research revealed that following biotin supplementation, glycolysis and lipid catabolism in skeletal muscle cells and tissues were disrupted. Examination of the relevant signaling pathways indicated abnormal protein expression and phosphorylation in the MAPK and TGFβ signaling pathways upon the addition of biotin. Conclusions The HLCS gene plays a crucial role in skeletal muscle development in pigs, and biotin has been found to mitigate the hindrance resulting from HLCS deficiency. Conversely, under normal functioning of the HLCS gene, supplementation of biotin can impede muscle development. HLCS biotin muscle development fat deposition MAPK signaling pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction HLCS was holocarboxylase synthetase could catalyze biotin incorporation with carboxylases (which were pyruvate carboxylase (PC), 3-methylcrotonyl-CoA carboxylase (MCC), propionyl-CoA carboxylase (PCC), and acetyl-CoA carboxylase (ACC)), carboxyl group on biotin is transferred to the reaction carboxylases substrate (for examples: acetyl-CoA, propionyl-CoA, succinic acid-CoA alphacarbon of propiony-CoA etc) [ 1 ]. A genome-wide association study (GWAS) suggested that HLCS is an important candidate gene for growth performance of pigs [ 2 ]. Other similar studies have also found that quantitative trait loci (QTL) on pig chromosome 13 was related to the growth performance of pigs, which includes HLCS [ 3 ]. This suggests that HLCS gene is closely related to the growth and development of pigs. However, the association of SNPs of the HLCS gene with growth performance in pigs has not been studied in-depth, the effects of HLCS on skeletal muscle development is not entirely clear. HLCS was critical in gluconeogenesis, fatty acid synthesis and amino acid metabolism [ 4 – 6 ]. The function of HLCS is inseparable from the downstream carboxylase. PC was an important anaplerotic enzyme in skeletal muscle mitochondria, predominantly located in the mitochondrial matrix near the inner membrane, regulating mitochondrial fuel metabolism [ 7 ]. Patients with MCC deficiency have been reported to experience severe muscle pain and physical disability [ 8 ]. PC and ACC are the essential enzymes for maintaining energy homeostasis [ 9 ]. ACC primarily carboxylates acetyl-CoA to malonyl-CoA, making it a rate-limiting enzyme for fatty acid synthesis [ 10 ]. The function PC, PCC, ACC and MCC closely related to cell metabolism, but the effect of HLCS gene on muscle development with only a few reports. Biotin is a sulfur-containing water soluble B-vitamin. It binds to the carboxylase mentioned above, carboxylates the corresponding substrate, and regulates the metabolism of the animal. Individuals with severe biotin deficiency or HLCS gene dysfunction that lead to clinical symptoms such as hallucinations, depression, anorexia, dermatitis, impaired cellular and humoral immune function, hair loss, seizures, developmental delays, metabolic ketoacidosis, hearing loss, impaired vision, lethargy, muscle weakness, vomiting, and altered fatty acid composition [ 11 ]. Dramatic clinical improvement with biotin mega-dose therapy in people with HLCS deficiency [ 12 , 13 ]. In the case of HLCS deficiency, the study on the effect of biotin supplementation on muscle development will also provide a theoretical basis for biotin therapy. Biotin as a nutritional supplement, its effect on muscle development can provide guidance for its application in livestock production. Therefore, HLCS gene and biotin were important substances necessary for the process of carboxylation. In this study, the effects of HLCS gene interference on proliferation and myogenic differentiation of skeletal muscle cells will be investigate. The regulatory mechanism of HLCS and biotin on the development of muscle tissue and cells will be explore. This work will provides a theoretical basis for the study of mechanism of influence of HLCS and biotin nutrition supplementation on development of muscle, and promotes efficient pork production. 2. Materials and methods 2.1. Animals and data collection 592 Duroc pigs of the same age grew up in the same enclosure. During the trial, daily feed intake (DFI) and body weight (BW) were achieved using electronic feed intake recording equipment (FIRE, Osborne, KS, USA). The experiment lasted from 90 days of age to 180 days of age. When the pig weight reached 100 kg, BF thickness and loin eye area (LEA) were measured between the 10th and 11th ribs using an aloca ultrasonic meter (Corometrics Medical Systems, Inc., Wallingford, CT, USA). The basal diet was formulated to meet or exceed the National Research Council (NRC). ADG was calculated as body weight ratio to the test’s time. The prediction of RFI through linear regression model was described as follows [ 14 ]: RFI = DFI − [b1 × onBW + b2 × offBW + b3 × metamidBW + b4 × ADGA + b5 × offBFA + e] Where onBW was the on-test body weight, offBW was the off-test body weight, metamidBW was the metabolic mid-body weight (average weight raised to 0.75 power), ADGA was adjusted ADG to testing from 90 to 180 days old, and offBFA was the off-test BF adjusted to 100 kg of BW, the regression coefficients (b1 to b5) and regression intercept e were computed using a multiple linear regression model. The calculation formula for the age group 30 and 100 kg was described by the Canadian Swine Improvement Program (2010). FCR was calculated as the ratio of mass gain to feed intake. 592 Duroc pigs were genotyped on the Illumina Porcine SNP60 Bead Chip (Illumina, San Diego, CA, USA). Infinium II multicopy technology was used in this experiment. SNP chips were scanned using iScan and Illumina Genome Studio (Illuminia, Inc., 9885 Towne Centre Drive, San Diego, CA, USA), which was used only for analysis. 2.2. Animals and Treatment All the procedures were carried out under sodium pentobarbital anesthesia, and the pigs were executed while profoundly unconscious. The sedated animals were really put to death by transection of the carotid arteries, after which the longissimus dorsi muscle and subcutaneous adipose tissues were removed. During the pre-experimental feeding period, mice were provided with unrestricted access to standard rodent chow and sterile water. For the formal experiments, the mice were randomly assigned into three groups (n = 8 per group): a control group (control), a biotin 20 group (L), and a biotin 50 group (H). Between 10 and 11 a.m., the L group received an oral gavage of 3 mL of biotin solution at a concentration of 20 mol/L, while the H group received an oral gavage of 3 mL of biotin solution at a concentration of 50 mol/L. The control group was administered with an oral gavage of 3 mL saline solution. Biotin administration continued for a duration of four weeks, and body weight was measured every three days during this period. 2.3. C2C12 cell culture and myogenic differentiation The cells were grown in DMEM supplemented with 10% FBS and 100 units/mL penicillin-streptomycin. Cell cultures were conducted in 5% CO 2 incubator at 37℃. When 60–70% confluence was reached, trypsin was used to digest and for passage of the cells. After the cells reached confluence, DMEM contained 4% horse serum, and 100 units/mL penicillin-streptomycin was used for myogenic differentiation, and the cells were collected after 6 days of induction. 2.4. Transfection of cell with siRNA HLCS small interfering RNA (siRNA) and negative control siRNA (NC) oligonucleotides were given in Supplementary Table S1 . Cells were transfected using Lipofectamine 3000 transfection reagent following the manufacturer’s protocol. 2 h before transfection, the cell medium was replaced with an Opti-MEM medium (Gibco, Grand Island, USA). The siRNA (20 µM) was incubated with 5 µL Lipofectamine 3000 in Opti-MEM medium for 20 min at room temperature before transfection. 6 h later, the medium was replaced with a complete medium. 2.5. EdU detection EdU staining was performed 24 h after cells culture to detect cell proliferation. For this assay, 10 µM EdU was added into the growth medium and incubated for 2 h. Fixation, permeabilization, and EdU staining were required according to the manufacturer’s protocol. Cell nuclei were counterstained with Hoechst 33342 at a concentration of 5 µg/mL for 10 min. Then, EdU-positive cells were observed under a fluorescence microscope (Motic, Ximen, China) to estimate the ratio of EdU-positive cells (EdU-stained cells/total cells). 2.6. RNA extraction and quantitative real-time PCR (qRT-PCR) Total RNA was extracted using the RNA extraction kit (TRIzol reagent; TaKaRa Company) and the extraction steps were performed according to the instructions of the kit. The resulting RNA solution was stored at a temperature of -80°C. Then the RNA was immediately reversed into cDNA by a reverse transcription kit (TaKaRa). The reverse transcription operation was conducted according to the instructions provided by the kit. The synthesized cDNA was stored at -20℃ or directly at -80℃ for later use. Table 1 Primer sequences for qRT-PCR Gene Primer sequence(5′→3′) Product length/bp HLCS F: AGGAACTCGGCAAAGC R: CAGACGCAGACCTCACC 294 PFKM F: TGTGGTCCGAGTTGGTAT R: CGTGGCCTCCCTGAT 100 PKM F: GCGTCCGCAGGTTTG R: GCCTCCCGAGCTATCAG 328 PRKAG3 F: TTCCGAGATTTGGCTGTA R: CACTCATGTCTAGGTGGTTGT 184 GSK3β F: TTTGGAGCCACTGATTACA R: CGGAAGACCCGCACT 272 HK2 F: CGACGAGGGACGGAT R: TTCGGATGTCATTGAGTGT 74 CDK2 F: ACTCTTGGTCTGTTCATCGTGGT R: GCAAAGTCCTGGGTGTAGC 109 Cyclin B F: TCTTGCTTGGCTTCATTCATAG R: TTCTTTTCCAGGTGGCATTAC 124 P21 F: GGTGGTGGAGACCTGATGAT R: ATTCTGCTGGCAAAGTGGGA 108 CEBPα F: GCAAAGCCAAGAAGTCGGTG R: TCACTGGTCAACTCCAGCAC 145 PPARγ F: GACGCGGAAGAAGAGACCTG R: TCACCTTGTCGTCACACTCG 84 FAS F: GGGTCTATGCCACGATTC R: GTGTCCCATGTTGGATTTG 272 HSL F: ACTCACCGCTGACTTCC R: GTCTCGTTGCGTTTGTAG 159 LPL F: TGGCGTAGCAGGAAGTCTGA R: TGCAATCACACGGATGGC 163 MyoD F: CGGCTCTCTCTGCTCCTTTG R: GTCGAAACACGGGTCATCA 182 MyoG F: GACCCTACAGACGCCCACAA R: CCGTGATGCTGTCCACGAT 94 Myh3 F: CCACCTGAACGAGCCC R: TGGTAGGCGTTGTCGG 207 ACC1 F: ATTGTGGCTCAAACTGCAGGT R: GCCAATCCACTCGAAGACCA 70 ACC2 F: TTCATGGACAGTGGCTTCTC R: GCACGCCTTACTGAAGAGAAG 150 PC F: CGCAAGATGGGAGACAAG R: AATAGGGAAGCCGTAGGTG 135 PCC F: ACCCACTCAGGCACAA R: TCCTCTTCAGGGCTTCT 258 MCC F: ATGGACTCAAGGCACAAT R: CCAGTTTCAATCCTCGTAG 264 Gapdh F: AGGAGAGTGTTTCCTCGTCC R: TGCCGTGAGTGGAGTCATAC 60 Primers were designed by primer software, and the primer sequences were shown in Table 1 . qRT-RCR was used to detect gene expression. In the qRT-PCR eight-row tube, the following components were added in sequence: 2 × All-in-One qPCR Mix 7.5 µL, cDNA 1 µL, upstream primer 0.75 µL, downstream primer 0.75 µL, ddH 2 O 5 µL, prepared into qRT-PCR reaction solution, centrifuged and mixed qRT-PCR reaction solution. Perform PCR reaction: pre-denaturation: 95°C for 10 min, denaturation: 95°C for 30 s, annealing: 58°C for 30 s, extension: 72°C for 30 s, 45 cycles of denaturation, annealing, and extension were completed for melting curve analysis. Melting curve analysis: 95°C for 2 min, 72°C for 1 min, 95°C for 30 s. 2.7. Immunofluorescence assay Cells were fixed with 4% paraformaldehyde for 15 min at room temperature and permeabilized with 0.1% Triton X-100 for 10 min. After blocking with bovine serum albumin for 30 min, the cells were incubated with primary antibody (MyHC) in blocking solution overnight at 4°C. 1. After undergoing three rounds of washing the following day, the cells were incubated with a secondary antibody (anti-rabbit FITC-conjugated) for 2 h at 4°C in a dark chamber. Afterward, the cell nuclei were stained with 1 mg/mL DAPI for 5 min at room temperature. Subsequently, fluorescence were detected using Motic fluorescence microscope (Motic, Ximen, China). 2.8. Western blotting analysis Cells were harvested and lysed in RIPA buffer, which supplemented with protease inhibitor (Roche Complete mini tablet) and phosphatase inhibitor (Pierce Halt phosphatase inhibitor cocktail) to prepare whole-cell extracts. The lysates were centrifuged at 12000 rpm for 10 min, and the supernatant was boiled in sodium dodecyl sulfate (SDS) loading buffer (Beyotime, Shanghai, China). Proteins were separated by using 12.5% SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to immobilon (polyvinylidene difluoride) transfer membrane (PVDF) (Solarbio, Beijing, China). The membrane was blocked with 5% defatted milk and incubated at 4°C overnight with primary antibodies, followed by horseradish peroxidase-conjugated secondary antibody. Blots were visualized by a commercial enhanced chemiluminescence (ECL) detection kit (Solarbio, Beijing, China), with GAPDH as an internal control for normalization. 2.9. Data analysis The genetic haplotype definition was defined as several genes or SNPs statistically associated with each other and formed a gene locus or common patterns of genetic variation. Haploview 4.2 ( http://www.broadinstitute.org/mpg/haploview ) was used to detect the haplotype block in all the SNPs of HLCS gene [ 15 ]. The generalized Linear Model (GLM) program in SAS9.2 was used to conduct most minor square variance analysis with the following models to compare the significance of SNP and growth performance. Y = µ + G + S + W + e Where Y is the observation of the traits, µ is the population mean, G is the genotype effect, S is the gender fixation effect, W is the initial weight, e is the random error. The MTDFREML program was used to obtain EBV. Depending on the trait, the mixed model for a single trait is: y ijk = µ + S i +P i +b i +O j +S j +e ijk Where y is observations of the traits, µ is the population mean, S i is the gender fixation effect, P i is the parity fixation effect, b i is the batch fixation effect, O j is the individual animal random effects, S j is the second animal effect (father number), e ijk is the random error. Three biological replicates were set up in each experiment. To analyze the qRT-PCR and the Western blotting results for cellular experiments, the 2 −ΔΔCt method was used. Data analysis was performed using an independent sample t -test and one-way analysis of variance using SPSS 25 software, and differences were performed. In the significance test, P < 0.01 means highly significant difference, P < 0.05 means significant difference, means no significant difference. The data in tables were presented as the mean ± standard error, while the data in figures were expressed as the mean ± standard error. Proteins were analyzed in a grayscale using Image J software to obtain quantitative data. 3. Results 3.1. SNPs of HLCS association with feed efficiency traits Our research team found that the intron region of HLCS gene DNA contains five SNPs. The five SNPs were located in the two haplotype block, indicating that the SNPs were highly linked. The results of the information from five SNPs of HLCS were presented in other articles of the team. In Duroc population, the five SNPs were linkage genotypes, and haplotype analysis results showed that five SNPs of HLCS were distributed in two block haplotype. ASGA0089950 and ASGA0097399 were contained in block one, ALGA0073814, ASGA0059961 and ALGA0073818 were contained in block two (Table 2 ,Table 3 ). This experiment involved a joint analysis of phenotype values and estimated breeding values (EBV) to study the correlation between SNPs of haplotype linked phenotype the HLCS gene and growth performance in 592 Duroc pigs. The results of correlation analysis were demonstrated in Table 4 and Table 5 .The statistical results has shown that individuals with genotype G6 and G7 had larger LEA and higher ADFI. (P < 0.01) (Table 4 , Table 5 ). Table 2 Genotype frequencies of five SNPs in 592 Duroc pigs in block one Haplotype block 1 ASGA0089950-ASGA0097399 (Genotype Sequence) Num Frequency(%) G1 TT-GG 26 4.4% G2 TC-CG 182 30.7% G3 CC-CC 382 64.5% G4 CC-CG 2 0.3% Table 3 Genotype frequencies of five SNPs in 592 Duroc pigs in block two Haplotype block 2 ALGA0073814-ASGA0059961-ALGA0073818 (Genotype Sequence) Num Frequency(%) G5 TT-GG-GG 25 4.2% G6 TG-AG-TG 221 37.3% G7 GG-AA-TT 345 58.3% G8 GG-NN-NN 1 0.2% Table 4 Association of genotype of HLCS with different feed efficiency related traits in block one Trait Genotype Num.(592) Phenotypic value 1) Genotype Num.(592) EBV 1) LEA (cm 2 ) G1 26 37.93 ± 1.11 G1 26 -0.12 ± 0.40 G2 182 37.42 ± 0.37 G2 182 -0.37 ± 0.14 G3 382 37.88 ± 0.27 G3 382 -0.27 ± 0.10 ADG (kg/d) G1 26 0.62 ± 0.02 G1 26 0.01 ± 0.01 G2 182 0.64 ± 0.01 G2 182 0.01 ± 0.00 G3 382 0.64 ± 0.01 G3 382 0.00 ± 0.00 ADFI (kg/d) G1 26 1.64 ± 0.05 G1 26 0.03 ± 0.02 G2 182 1.68 ± 0.02 G2 182 0.01 ± 0.01 G3 382 1.68 ± 0.01 G3 382 0.01 ± 0.00 RFI (g/d) G1 26 -17.93 ± 30.03 G1 26 0.08 ± 0.03 G2 182 25.72 ± 12.8 G2 182 0.01 ± 0.02 G3 382 32.71 ± 8.57 G3 382 -0.01 ± 0.01 FCR G1 26 2.68 ± 0.09 G1 26 0.08 ± 0.03 G2 182 2.70 ± 0.04 G2 182 0.02 ± 0.20 G3 382 2.68 ± 0.03 G3 382 0.03 ± 0.11 Table 5 Association of genotype of HLCS with different feed efficiency related traits in block two Trait Genotype Num.(592) Phenotypic value 1) Genotype Num.(592) EBV 1) LEA (cm 2 ) G5 25 34.7 ± 0.82 a G5 25 -1.45 ± 0.34 a G6 221 37.7 ± 0.36 b G6 221 -0.32 ± 0.13 b G7 345 38.03 ± 0.27 b G7 345 -0.18 ± 0.10 b ADG (kg/d) G5 25 0.61 ± 0.02 G5 25 -0.01 ± 0.01 G6 221 0.65 ± 0.01 G6 221 0.01 ± 0.00 G7 345 0.64 ± 0.01 G7 345 0.01 ± 0.00 ADFI (kg/d) G5 25 1.61 ± 0.05 a G5 25 -0.02 ± 0.03 G6 221 1.71 ± 0.02 b G6 221 0.01 ± 0.01 G7 345 1.66 ± 0.01 ab G7 345 0.01 ± 0.01 RFI (g/d) G5 25 11.20 ± 37.42 G5 25 0.01 ± 0.01 G6 221 43.69 ± 10.63 G6 221 -0.01 ± 0.01 G7 345 21.43 ± 9.37 G7 345 -0.01 ± 0.01 FCR G5 25 2.69 ± 0.09 G5 25 0.01 ± 0.01 G6 221 2.69 ± 0.03 G6 221 -0.01 ± 0.01 G7 345 2.69 ± 0.03 G7 345 -0.01 ± 0.01 1) The value of each trait was expressed as the mean ± standard error. (a, b) mean P < 0.05. Therefore, this study suggested that HLCS gene mutation was closely related to pig growth performance. The effect of HLCS on skeletal muscle cells development was elucidated by interfering with HLCS on C2C12 cells. 3.2. siHLCS inhibited the proliferation of C2C12 cells To investigate the potential role of HLCS in skeletal muscle cells proliferation, we employed qRT-PCR to detect HLCS mRNA expression in a proliferation of C2C12 cells at 0, 12, 24, 36, 48, and 60 h, HLCS was expressed at all stages but the highest level of expression at the 24 h proliferation stages, and there was a trend of increasing first and then decreasing (Fig. 1 A). To screen the interference fragment of HLCS , we designed two siRNA oligonucleotides to specifically interfered the HLCS gene. The siRNA-2 fragments had the highest interference efficiency (Fig. 1 B). As a protein-coding gene, HLCS encoded an enzyme that can catalyze the binding of biotin to ACC2, ACC1, PC, MCC and PCC carboxylases. The expressions levels of ACC1 , ACC2 , and PC significantly increased when HLCS was interfered with in C2C12 cells. (Fig. 1 C-D). The effects of siHLCS on skeletal muscle cell proliferation were analyzed using EdU staining. The result revealed that transfection with siHLCS significantly inhibited the proliferation of skeletal muscle cells (Fig. 1 E). Furthermore, cell cycle-related genes ( Cyclin B and CDK2 ) were down-regulated and cell cycle repressor gene ( P21 ) was up-regulated in the siHLCS group (Fig. 1 F). Western blotting result indicated that the expression level of CDK2 decreased significantly (Fig. 1 G). Taken together, these data demonstrated that proliferation of C2C12 cells can be inhibited by transfection with siHLCS . In order to understand the effect of siHLCS on MAPK signaling pathway in C2C12 cells, the protein levels of p-JNK Thr183/Tyr185 , JNK, p-p38 Thr180/Tyr182 , p38, p-ERK1/2 Thr202/Tyr204 and ERK were analyzed by Western blotting analysis. The results showed that the protein expression levels of ERK, p38, JNK, and their phosphorylated forms were down-regulated in the siHLCS group, while the ratios of p-ERK1/2 Thr202/Tyr204 /ERK and p-JNK Thr183/Tyr185 /JNK were up-regulated in the siHLCS group. (Fig. 1 H). 3.3. siHLCS inhibited myogenic differentiation of C2C12 cell To research the roles of the HLCS gene in skeletal muscle cells myogenic differentiation, the current study examined the mRNA expression of HLCS throughout the myogenic differentiation process of C2C12 cells, and found that the HLCS expression tended to rise first and then fall with C2C12 cell myogenic differentiation (Fig. 2 A). The myogenic differentiation of muscle cell was evaluated by employing immunofluorescence staining targeting MyHC, a widely recognized marker indicative of cellular myogenic differentiation. Immunofluorescence assay result has shown that interfering with HLCS in C2C12 cells reduced the percentage of cells expressing MyHC, which resulted in the decrease of myogenic differentiation index and fusion index (Fig. 2 B). The expressions levels of ACC1 , PC , MCC , and PCC were significantly down-regulated when HLCS was interfered in C2C12 cells (Fig. 2 C) (Fig. 2 E). The interference of HLCS resulted in a reduction in the mRNA expression levels of the myogenic genes MyoD , MyoG , and Myh3 , as demonstrated by qRT-PCR analysis (Fig. 2 F). Protein expressions levels of MyoG, Myh3 were also significantly down-regulated (Fig. 2 G). Collectively, our results indicated that the myogenic differentiation of C2C12 cells were inhibited after interfering with HLCS . To explore the involvement of the MAPK signaling pathway when interfered with HLCS in C2C12 cells. The protein levels of p-JNK Thr183/Tyr185 , JNK, p-p38 Thr180/Tyr182 , p38, p-ERK1/2 Thr202/Tyr204 and ERK1/2 were analyzed by Western blotting (Fig. 2 H). The siHLCS group exhibited a distinct down-regulation of p-ERK1/2 Thr202/Tyr204 and ERK levels, and the ratios of p-ERK1/2 Thr202/Tyr204 /ERK and p-p38/p38 were also down-regulated in the siHLCS group (Fig. 2 H).. 3.4. Effect of biotin supplementation on C2C12 myogenic differentiation To investigate the role of biotin in myogenic differentiation, C2C12 cells were induced to differentiate and supplemented with different concentrations of biotin (0, 0.1, 1.0, 10 µM/L) in the myogenic differentiation medium. The q-PCR results showed that the mRNA expression levels of HLCS , MyoD and MyoG were significantly decreased and the expression levels of Myh3 were significantly increased when C2C12 myoblasts were incubated with 0.1 µM/L biotin concentration. The mRNA expression levels of HLCS , MyoD , MyoG and Myh3 were decreased when C2C12 myoblasts were incubated with a biotin concentration of 1.0 µM/L. The Western blotting analysis revealed a significant reduction in the protein levels of MyoG and Myh3 when C2C12 myoblasts were incubated with biotin at concentrations of 0.1, 1, and 10 µM/L (Fig. 3 A-B). Considering the above experimental result, this paper chose to add 1 µM/L concentration of biotin to carry out the follow-up mechanism study. The effectiveness of biotin as the main treatment for HLCS deficiency has been proven in multiple studies. Supplementation with high doses of biotin can partially or completely compensate for the disruption in biotin circulation caused by HLCS deficiency. To further elucidate the specific mechanism underlying biotin's impact on myogenic differentiation, we introduced siHLCS . Considering the potential influence of siHLCS on biotin metabolism, we designed a controlled experiment incorporating both conditions with and without additional biotin supplementation. The mRNA expression levels of MyoD and MyoG were significantly reduced after biotin treatment, as shown by qRT-PCR (Fig. 3 C) and the proteins expression levels of Myh3 and MyoG were significantly reduced after biotin treatment, as shown by Western blotting analysis (Fig. 3 D). Compared with siHLCS group, the mRNA expression levels of MyoD , MyoG in siHLCS + biotin group has shown a downward trend (Fig. 3 C), and the proteins expression levels of Myh3 was significantly increased (Fig. 3 D). 3.5. Effect of Biotin Supplementation at Varying Concentrations on C2C12 Cell Differentiation The specific role of biotin in myogenic differentiation was investigated by supplementing C2C12 cells with varying concentrations of biotin during differentiation, followed by quantification of mRNA and protein expression levels. At a concentration of 0.1 µM/L, mRNA expression levels of ACC1 , MCC , and PCC were significantly increased (Fig. 4 A). Western blot analysis revealed that at 0.1 µM/L, protein levels of ACC1, ACC2, and PC were significantly elevated. However, at concentrations of 1 µM/L and 10 µM/L, protein expression of ACC1 decreased significantly, while that of PC increased significantly (Fig. 4 B). The expression of adipogenesis-related genes was also assessed. It was found that, with the exception of LPL and FAS , whose mRNA levels were significantly elevated at 0.1 µM/L biotin, HSL , CEBPα , and PPARγ exhibited varying degrees of downregulation at different biotin concentrations (Fig. 4 C). Western blot analysis showed that HSL and CEBPα were significantly reduced at 1 µM/L, while PPARγ was significantly upregulated at 0.1 µM/L and significantly downregulated at both 1 µM/L and 10 µM/L (Fig. 4 D). Additionally, the expression levels of glycolysis-related genes in C2C12 cells were explored. After treatment with 0.1 µM/L biotin, GSK3β expression was significantly upregulated, while PFKM expression was significantly downregulated. At 1 µM/L and 10 µM/L, the expression of PKM, PFKM, PRKAG3, and GSK3β was further altered (Fig. 4 E).The protein expression level of PKM decreased progressively with increasing biotin concentration (Fig. 4 F). This result suggests that lower concentrations of biotin promote the expression of glycolysis-related genes, while higher concentrations of biotin exert an inhibitory effect. To further explore the involvement of the MAPK signaling pathway, we analyzed the impact of different biotin concentrations on MAPK activation in C2C12 cells. Protein levels of p-JNK Thr183/Tyr185 , JNK, p-p38 Thr180/Tyr182 , p38, p-ERK1/2 Thr202/Tyr204 , and ERK1/2 were assessed through Western blotting. The results indicated that as the biotin concentration increased, the levels of p-ERK1/2 Thr202/Tyr204 , p-p38 Thr180/Tyr182 and p38 were significantly upregulated. The p-ERK1/2 Thr202/Tyr204 /ERK ratio increased significantly with the increase of biotin concentration, and the p-p38/p38 ratio decreased significantly after biotin concentration increased (Fig. 4 G). This suggests that biotin may regulate the metabolic activity and differentiation of C2C12 cells by activating the ERK1/2 and p38 signaling pathways. 3.6. Impact of Different Doses of Biotin on Muscle Generation in Mice To further validate the inhibitory effects of biotin on muscle development, we conducted an experiment using mice divided into three groups: the control group received 0.3 mL of physiological saline daily via gavage, the low-dose biotin group received 20 mg/kg body weight/day (Biotin low), and the high-dose biotin group received 50 mg/kg body weight/day (Biotin high). The results showed that the relative weight and cross-sectional area of longissimus dorsi muscle of mice were significantly reduced when low-dose biotin was added (Fig. 5 A). The qRT-PCR analysis revealed a significant downregulation in the expression levels of myogenesis-related genes, specifically MyoD , MyoG , and Myh3 , indicating suppression of muscle development (Fig. 5 B). Western blotting analysis showed that the protein expression level of Myh3 in the Biotin high group was significantly increased, while the protein expression level of MyoG was down-regulated (Fig. 5 C). The expression of genes associated with fat formation was also evaluated. The results showed that HSL and FAS mRNA levels were significantly increased in the Biotin low group, and HSL mRNA levels were still increased in the Biotin high group (Fig. 5 D). The changes of HSL protein expression levels in Western blotting analysis results were consistent with the qRT-PCR results (Fig. 5 E). Furthermore, qRT-PCR result has shown that ACC1 and PCC expression were significantly elevated in the low-dose group but returned to control levels in the high-dose group (Fig. 5 F), which was consistent with the trend of Western blotting results (Fig. 5 G). Regarding glycolysis-related genes, the mRNA expression levels of PKM , PRKAG3 , and GSK3β were significantly elevated in the low-dose biotin group but showed no significant changes in the high-dose group (Fig. 5 H). The protein expression level of PKM was decreased in high-dose biotin group (Fig. 5 I). To further explore the involvement of MAPK signaling pathways, Western blotting analysis was used to detect the protein levels of p-JNK Thr183/Tyr185 , JNK, p-p38 Thr180/Tyr182 , p38, p-ERK1/2 Thr202/Tyr204 , and ERK1/2 in the muscle of mice. The results showed that the protein levels of p-ERK1/2 Thr202/Tyr204 , ERK1/2 and p38 were significantly up-regulated in the high-dose group, while the protein levels of p38 were significantly down-regulated in the low-dose biotin group. p-ERK1/2 Thr202/Tyr204 /ERK1/2 and p-p38/p38 ratios were significantly up-regulated in the low-dose biotin group and significantly down-regulated in the high-dose group (Fig. 5 J). 4. Discussions Pork is an important source of meat for human beings. The growth performance of pig determines the economic benefits of pig farms. Growth performance of pig includes the LEA, ADG, FCR and RFI traits, which were the critical points of genetic breeding improvement [ 16 – 19 ]. This study found that five SNPs were identified within HLCS , which were located on chromosome 13. five SNPs of HLCS had a high linkage and were found to be correlated with LEA and RFI. Pigs with low RFI have been found to have larger LEA. LEA is the cross-sectional area of the longissimus dorsi muscle, which represents the muscles development [ 20 , 21 ]. The expression of HLCS gene was significantly different in longissimus dorsi muscle of individuals with different HLCS genotypes. It is confident that the HLCS gene may play a key role in influencing the growth performance of pigs, particularly in muscle development. Cellular level experiments were conducted to further investigate the impact of the HLCS gene on skeletal muscle cell development. ACC1, ACC2, PC, PCC and MCC are the carboxylases downstream of HLCS. There are many studies on the functions of HLCS-related carboxylase in fatty acid metabolism and glucose metabolism, but few studies on the role of HLCS gene in skeletal muscle cell development [ 22 – 24 ]. In this study, proliferation in skeletal skeletal muscle cells was inhibited after interfering with HLCS . The ability of skeletal muscle cell proliferation is related to the cell cycle, which includes the inter-division phase (G1, S, G2) and the division phase (M), Cyclin B was an important regulator of cellular proliferation that assistted to initiate the transition from the G2 to the M phase of the cell cycle [ 25 – 27 ]. In this study, the expression of Cyclin B was suppressed upon interfering with HLCS . Consistent with C2C12 cells, knockdown of HLCS in MCF-7 cell lines resulted in a 40–50% reduction in proliferation, accompanied by G1 cell cycle arrest-induced apoptosis [ 5 ].after interfering with HLCS , and further research found that the expressions of ACC1 , ACC2 and PC gene increased during proliferation of C2C12 cells. Zhao et al., 2024 found that down-regulating ACC2 promoted the proliferation and migration of ovarian cancer cells in vivo and in vitro [ 28 ]. In accordance with the aforementioned studies, results from our study demonstrated that the expression of PC was inhibited when HLCS interfered, G2/M cell cycle arrest was induced and leading to apoptosis, thereby the proliferative ability of C2C12 cells was decreased. ACC1 and ACC2 are key regulators of fatty acid metabolism, controlling the rate-limiting step in the synthesis of malonyl-CoA, which is pivotal for fatty acid biosynthesis and cellular energy homeostasis. Dysregulation of ACC1 and ACC2 activity can lead to altered lipid metabolism, affecting membrane synthesis and energy production, thereby impacting cell proliferation. These enzymes collectively ensure the proper supply of metabolic intermediates required for cell cycle progression. These changes in carboxylase activity can upset the balance of metabolic flux, resulting in cell cycle stagnation or reduced proliferation. MyoG, MyoD and Myh3 were hallmark of myotube formation [ 29 ]. It has been reported that down-regulation of MyoG , MyoD , and Myh3 decreased myotube formation in C2C12 cells [ 30 – 32 ]. Our results found that the expressions of MyoG , MyoD and Myh3 were decreased, myogenic differentiation and fusion were attenuated after interfering with HLCS . The present studies have demonstrated that interference with HLCS resulted in a reduction in the expressions of ACC1 , PC , PCC , and MCC . Furthermore, decreased ACC expression led to delayed cell fusion and myosin formation [ 33 ]. This result is consistent with the results of this study. By exploring the connection between HLCS and MAPK signaling pathway, it was observed that the p-p38 and p-ERK1/2 decreased significantly during the proliferation and myogenic differentiation of C2C12 cells. Previous studies have shown that downregulation of p-ERK1/2 and p-p38 MAPK can diminish the proliferation and differentiation of C2C12 cells, which aligns with our results [ 34 – 35 ]. It indicated that interference with HLCS inhibited the proliferation and myogenic differentiation of C2C12 cells through regulation of p38 MAPK and ERK signaling pathway. Therefore, we considered that proliferation and myogenic differentiation ability of skeletal muscle cells were decreased when HLCS was inferenced, pig muscle development was affected, and lead to the decrease of pig weight. Large doses of biotin were often used to treat HLCS deficiency [ 12 ]. Therefore, we speculated that biotin addition would affect the expression of HLCS gene. Interestingly, we found that biotin supplementation did not increase the expression of HLCS gene. It is worth noting that biotin addition inhibited the expression of HLCS gene, which may have some negative feedback mechanism. Our results indicated that myogenic differentiation was inhibited further by the addition of biotin and siHLCS at same. In order to further confirm the effect of biotin on muscle development, this study added biotin to the basal diet of mice, the muscle development of the mice was inhibited, the weight of the longissimus dorsi muscle was reduced, the cross-sectional area of longissimus dorsi muscle was reduced. Addition of biotin in the diet can alleviate the oxidative stress of Japanese quail and promote the growth of muscles [ 36 ]. The expressions of myogenic genes were decreased in muscle tissue. This study can provide theoretical basis for the study of biotin overdose contraindications. In order to further clarify the reason why biotin inhibits muscle development, we further studied glucose metabolism, lipid metabolism and related signaling pathways in cells and muscle tissue in this study. This study found that the addition of biotin promoted the increase the expressions of ACC and PC , and the decrease of MCC . The expression of genes associated with adipogenesis in muscle tissue exhibited a decrease, while the expression of genes involved in lipolysis showed abnormal elevation. Additionally, there was an increase observed in the expression of genes related to glycolysis. The result of this experiment is similar with previous research which found that biotin can accelerate the glycolysis process by promoting glucose absorption [ 37 – 38 ]. Supra-physiological levels of biotin could induce the increased expression of glucokinase, and suppressed the key gluconeogenic enzyme phosphoenolpyruvate carboxykinase [ 39 ]. Biotin and chromium histidinate improve glucose metabolism and proteins expression levels of IRS-1 , PPARγ , and NF-kappaB in exercise-trained rats [ 40 ]. Biotin increases pancreatic glucokinase expression, glucokinase plays an important role in the initiation of glucose sensing and glucose metabolism in cells [ 41 , 42 ]. The present study investigates how biotin affects the expressions of PKM , PRKAG3 , and GSK3β genes involved in glycolysis, which provides another example for biotin to promote glucose metabolism. Abnormal glucose metabolism will affect the metabolism of amino acids, and the content of branched-chain amino acids (BCAA) in diabetic patients were increased [ 43 , 44 ]. BCAA catabolism does begin in muscle, aminotransferase activity is high in muscle [ 44 , 45 ]. BCAA increasing was contributes to greater skeletal muscle cross sectional area [ 46 ]. Abnormal glycolysis causes C2C12 muscle atrophy [ 37 , 38 ]. We speculated that biotin inhibited muscle development by accelerating the glycolysis and lead to lipid metabolism disorders. More tricarboxylic acid cycle products are degraded and consumed, inhibiting amino acid synthesis. Perhaps this process also promotes the degradation of branched-chain amino acids, which ultimately inhibits the development of muscle tissue and cells. Through further study of possible signaling pathways, it was found that the addition of biotin had certain effects on MAPK signaling pathway and TGFβ signaling pathway of skeletal muscle cells and muscle tissue. The above studies give us an important reminder that excessive dietary addition of biotin may reduce the muscle content. For exercisers who want to build muscle, additional biotin intake may not be a good option [ 12 ]. In summary, our findings demonstrated that five SNPs of the HLCS gene were significantly linked to LEA, and RFI in Duroc pigs. After interfering with HLCS , C2C12 cell proliferation was reduced, and p-ERK and p-p38 levels were decrease. Myogenic differentiation was inhibited, and p-ERK1/2 and p-p38 levels were decrease after interfering with HLCS in C2C12 cells. Exogenous biotin can further inhibit the expression of HLCS gene and the development of skeletal muscle cells and muscle tissues. These findings provided insight into the relationship between the HLCS gene and pig growth performance, and the effects of HLCS and biotin compensation on muscle tissue and skeletal muscle cell development were clarified (Fig. 6 ). 5. Conclusion In summary, our findings demonstrated that five SNPs of the HLCS gene were significantly linked to LEA, 100 kg BF, and RFI in Duroc pigs. Further validated at the cellular level and in vivo in mice, HLCS gene is a necessary gene for muscle development. In the case of siHLCS , proliferation and myogenic differentiation of skeletal muscle cells were suppressed. Biotin supplementation relieved the effects of HLCS deficiency. However, when the HLCS gene is not deficient, the addition of biotin could repressed muscle development both at the cellular level and in vivo level of mice. These findings provided insight into the relationship between the HLCS gene and pig growth performance, as well as highlighting the regulatory effects of HLCS deficiency and biotin compensation on skeletal muscle cells at the cellular level (Fig. 6 ). This study can provide theoretical basis for the functional study of HLCS and biotin and provide reference for the efficient production of pork. Declarations Acknowledgments The authors thank the Fuyang Normal University, Tianjin Key Laboratory of Green Ecological Feed teachers and students gave me a lot of guidance and help. Authorship contribution Gaoxiao Xu: Writing-original draft, Methodology, Software,Visualization, Funding acquisition. Han Chu: Writing-original draft, Methodology, Data curation, Formal analysis,Validation. Lei Qin: Writing–original draft, Data curation, Methodology. Yuxing Dai: Writing-original draft, Investigation, Methodology. Chunguang Zhang: Methodology. Yunyan Luo: Conceptualization. Jianbin Zhang: Writing-review and editing. Falei Li: Writing-review and editing, Funding acquisition. Lei Pu: Writing-original draft, Project administration, Resources, Supervision, Funding acquisition, Formal analysis. Funding This research was funded by Fuyang Normal University scientific research platform open topic(FYKFKT24042), Anhui Natural Science Foundation Project(2208085MC76), the University Synergy Innovation Program of Anhui Province(GXXT-2023-044), Key Projects of Scientific Research Plan of Colleges and Universities of Anhui Province (2023AH050427). Data availability No datasets were generated or analysed during the current study. Ethics approval and consent to participate Our research was approved by the Ethics Committee of Tianjin Agricultural University (2022LLSC032), which conforms to the ethical requirements of animal. Competing interest The authors declare no competing interests. Consent for publication Not applicable. References Ling S, Qiu W, Zhang H, Liang L, Lu D, Chen T, Zhan X, Wang Y, Gu X, Han L. Clinical, biochemical, and genetic analysis of 28 Chinese patients with holocarboxylase synthetase deficiency. Orphanet J Rare Dis. 2023;18(1):48. https://doi.org/10.1186/S13023-023-02656-Y . Onteru SK, Gorbach DM, Young JM, Garrick DJ, Dekkers JCM, Rothschild MF. Whole Genome Association Studies of Residual Feed Intake and Related Traits in the Pig. PLoS ONE. 2013;8(6):e61756. https://doi.org/10.1371/journal.pone.0061756 . Ngoc DD, Tage O, Bjerring SA, Thomas M, Just J, N KH. Genome-wide association and systems genetic analyses of residual feed intake, daily feed consumption, backfat and weight gain in pigs. BMC Genet. 2014;15(1):27. https://doi.org/10.1186/1471-2156-15-27 . Gondáš E, Kráľová Trančíková A, Dibdiaková K, Galanda T, Hatok J, Račay P, Dobrota D, Murín R. Immunodetection of Pyruvate Carboxylase Expression in Human Astrocytomas, Glioblastomas, Oligodendrogliomas, and Meningiomas. Neurochem Res. 2023;48(6):1728–36. https://doi.org/10.1007/S11064-023-03856-5 . Siraprapa S, Witchuda S, Polyak SW, Chareeporn A, Sarawut J. Differential growth inhibition, cell cycle arrest and apoptosis of MCF-7 and MDA-MB-231 cells to holocarboxylase synthetase suppression. Biochem Biophys Res Commun. 2022;593:108–15. https://doi.org/10.1016/J.BBRC.2022.01.049 . Yuan F, Wang N, Chen Y, Huang X, Yang Z, Xu Y, You K, Zhang J, Wang G, Zhuang Y, Pan T, Xiong Y, Yu X, Yang F, Li Y. Calcitriol promotes the maturation of hepatocyte-like cells derived from human pluripotent stem cells. J Steroid Biochem Mol Biol. 2021;211:105881. https://doi.org/10.1016/J.JSBMB.2021.105881 . Mahmood V, Suresh M, Saby M, Murphy LJ. Prohibitin attenuates insulin-stimulated glucose and fatty acid oxidation in adipose tissue by inhibition of pyruvate carboxylase. FEBS J. 2006;273(3):568–76. https://doi.org/10.1111/j.1742-4658.2005.05090.x . Boneh A, Baumgartner M, Hayman M, Peters H. Methylcrotonyl-CoA carboxylase (MCC) deficiency associated with severe muscle pain and physical disability in an adult. J Inherit Metab Dis. 2005;28(6):1139–40. https://doi.org/10.1007/s10545-005-0163-1 . Cai B, Ma M, Zhang J, Kong S, Zhou Z, Li Z, Abdalla BA, Xu H, Zhang X, Lawal RA, Nie Q. Long noncoding RNA ZFP36L2-AS functions as a metabolic modulator to regulate muscle development. Cell Death Dis. 2022;13(4):389. https://doi.org/10.1038/s41419-022-04772-2 . Rubink DS, Winder WW. Effect of phosphorylation by AMP-activated protein kinase on palmitoyl-CoA inhibition of skeletal muscle acetyl-CoA carboxylase. J Appl Physiol (Bethesda Md : 1985). 2005;98(4):1221–7. https://doi.org/10.1152/japplphysiol.00621.2004 . Perry CA, Butterick TA. Biotin. Advances in nutrition (Bethesda, Md.), 2024 15(7), 100251. https://doi.org/10.1016/j.advnut.2024.100251 Kim SW, Lee HJ, Choi N, Kim EK, Ko JM. Dramatic Clinical Improvement With Biotin Mega-Dose Therapy in a Neonate With Holocarboxylase Synthetase Deficiency. Mol Genet Genom Med. 2024;12(8):e70002. https://doi.org/10.1002/mgg3.70002 . Sadri M, Wang H, Kuroishi T, Li Y, Zempleni J. Holocarboxylase synthetase knockout is embryonic lethal in mice. PLoS ONE. 2022;17(4):e0265539. https://doi.org/10.1371/journal.pone.0265539 . Liaubet L, Guilmineau C, Lefort G, Billon Y, Reigner S, Bailly J, Marty-Gasset N, Gress L, Servien R, Bonnet A, Gilbert H, Vialaneix N, Quesnel H. Plasma 1H-NMR metabolic and amino acid profiles of newborn piglets from two lines divergently selected for residual feed intake. Sci Rep. 2023;13(1):7127. https://doi.org/10.1038/S41598-023-34279-5 . Pu L, Luo Y, Wen Z, Dai Y, Zheng C, Zhu X, Qin L, Zhang C, Liang H, Zhang J, Guo L, Wang L. GPX2 Gene Affects Feed Efficiency of Pigs by Inhibiting Fat Deposition and Promoting Muscle Development. Animals. 2022;12(24). https://doi.org/10.3390/ani12243528 . Lee W, Han K-H, Kim HT, Choi H, Ham Y, Ban T-W. Prediction of average daily gain of swine based on machine learning. J Intell Fuzzy Syst. 2019;36(2):923–33. https://doi.org/10.3233/JIFS-169869 . Serão NV, Mauch ED, Onteru SK, Rothschild MF, Dekkers JC. M. Genomewide association study for residual feed intake and component traits of feed efficiency in pigs divergently selected for residual feed intake. J Anim Sci. 2016;94:12–3. https://doi.org/10.2527/msasas2016-026 . Yang Q, Wu P, Wang K, Chen D, Zhou J, Ma J, Li M, Xiao W, Jiang A, Jiang Y, Bai L, Zhu L, Li X, Tang G. SNPs associated with body weight and backfat thickness in two pig breeds identified by a genome-wide association study. Genomics. 2019;111(6):1583–9. https://doi.org/10.1016/j.ygeno.2018.11.002 . Zhuang Z, Li S, Ding R, Yang M, Zheng E, Yang H, Gu T, Xu Z, Cai G, Wu Z, Yang J. Meta-analysis of genome-wide association studies for loin muscle area and loin muscle depth in two Duroc pig populations. PLoS ONE. 2019;14(6):e0218263. https://doi.org/10.1371/journal.pone.0218263 . Gao K, Han S, Li Z, Luo Z, Lv S, Choe HM, Paek HJ, Quan B, Kang J, Yin X. Analysis of metabolome and transcriptome of longissimus thoracis and subcutaneous adipose tissues reveals the regulatory mechanism of meat quality in MSTN mutant castrated male finishing pigs. Meat Sci. 2023;207:109370–109370. https://doi.org/10.1016/j.meatsci.2023.109370 . Zi Z, Zhengqun L, Ning L, Shuqin M, Shiyue L, Zhonghao L, Chunhua Z, Yuanming L, Jun Y, Qianjun L. Effects of fermented bamboo powder on growth performance, apparent digestibility, carcass traits, and meat quality in growing-finishing pigs. Livest Sci. 2023;277. https://doi.org/10.1016/j.livsci.2023.105358 . Toshinobu K. Regulation of immunological and inflammatory functions by biotin. Can J Physiol Pharmacol. 2015;93(12):1091–6. https://doi.org/10.1139/cjpp-2014-0460 . Zihong X, Guoying Z, Xiaoli L, Ning Z, Jing Z. Case report of holocarboxylase synthetase deficiency (late-onset) in 2 Chinese patients. Medicine. 2020;99(18):e19964. https://doi.org/10.1097/MD.0000000000019964 . Yang X, Huang H, Wang Z, Haslam TM, Kunst L, Wang P, Zhao H, Lü S, Ma C. Acetyl-CoA Carboxylase1 Influences ECERIFERUM2 Activity to Mediate the Synthesis of Very-Long-Chain Fatty Acid Past C28. Plant Physiol. 2024;kiae253. https://doi.org/10.1093/plphys/kiae253 . Baker CC, Lorenzo G, Lucineh P, Emily T, Cheuk T, Fuller MT. A cell-type-specific multi-protein complex regulates expression of Cyclin B protein in Drosophila male meiotic prophase. bioRxiv: the preprint server for biology. 2023 https://doi.org/10.1101/2023.02.16.528869 Talapati SR, Nataraj V, Pothuganti M, Gore S, Ramachandra M, Antony T, More SS, Krishnamurthy NR. Structure of cyclin-dependent kinase 2 (CDK2) in complex with the specific and potent inhibitor CVT-313. Acta Crystallogr Sect F: Struct Biology Commun. 2022;76(8):350–6. https://doi.org/10.1107/S2053230X20009243 . Zhang W, Liu Y, Jang H, Nussinov R. CDK2 and CDK4: Cell Cycle Functions Evolve Distinct, Catalysis-Competent Conformations, Offering Drug Targets. JACS Au JACS Au. 2024;4(5):1911–27. 10.1021/jacsau.4c00138 . Zhao S, Wang Q, Zhang X, Ma B, Shi Y, Yin Y, Kong W, Zhang W, Li J, Yang H. MARCH5-mediated downregulation of ACC2 promotes fatty acid oxidation and tumor progression in ovarian cancer. Free Radic Biol Med. 2024;212:464–76. https://doi.org/10.1016/j.freeradbiomed.2024.01.004 . Anqi L, Xiaotong S, Yuan T, Guibing S, Linsen Z, Hongbao W. Effect of Actin Alpha Cardiac Muscle 1 on the Proliferation and Differentiation of Bovine Myoblasts and Preadipocytes. Animals. 2021;11(12):3468–3468. https://doi.org/10.3390/ani11123468 . Albuquerque A, Óvilo C, Núñez Y, Benítez R, López-Garcia A, García F, Félix MDR, Laranjo M, Charneca R, Martins JM. Transcriptomic Profiling of Skeletal Muscle Reveals Candidate Genes Influencing Muscle Growth and Associated Lipid Composition in Portuguese Local Pig Breeds. Animal. 2021;11(5):1423. https://doi.org/10.3390/ANI11051423 . Ganassi M, Badodi S, Wanders K, Zammit PS, Hughes SM. Myogenin is an essential regulator of adult myofibre growth and muscle stem cell homeostasis. eLife. 2020;9:e60445. https://doi.org/10.7554/eLife.60445 . Wang B, Guo J, Zhang M, Liu Z, Zhou R, Guo F, Li K, Mu Y. Front Cell Dev Biology. 2021;9:e685593. https://doi.org/10.3389/FCELL.2021.685593 . Insulin-Degrading Enzyme Regulates the Proliferation and Apoptosis of Porcine Skeletal Muscle Stem Cells via Myostatin/MYOD Pathway [J]. Han S, Park JS, Lee S, Jeong AL, Oh KS, Ka HI, Choi HJ, Son WC, Lee WY, Oh SJ, Lim JS, Lee MS, Yang Y. CTRP1 protects against diet-induced hyperglycemia by enhancing glycolysis and fatty acid oxidation. J Nutr Biochem. 2016;27:43–52. https://doi.org/10.1016/j.jnutbio.2015.08.018 . Ma L, Zhang CM, Gui Y, Zou TL, Xi SH, Guo XY. Fluoride regulates the differentiation and atrophy through FGF21/ERK signaling pathway in C2C12 cells. Ecotoxicol Environ Saf. 2023;252:114626. https://doi.org/10.1016/J.ECOENV.2023.114626 . Pagliara V, Amodio G, Vestuto V, Franceschelli S, Russo NA, Cirillo V, Mottola G, Remondelli P, Moltedo O. Myogenesis in C2C12 Cells Requires Phosphorylation of ATF6α by p38 MAPK. Biomedicines. 2023;11(5):1457. https://doi.org/10.3390/BIOMEDICINES11051457 . Onderci M, Sahin K, Sahin N, Cikim G, Vijaya J, Kucuk O. Effects of dietary combination of chromium and biotin on growth performance, carcass characteristics, and oxidative stress markers in heat-distressed Japanese quail. Biol Trace Elem Res. Biol Trace Elem Res. 2005;106(2):165–76. 10.1385/BTER:106:2 :165. Kato A, Sakakibara I, Fukushima T, Sugiura K, Fukawa T, Nikawa T, Uchida T. Quantitative Proteome Analysis in Response to Glucose Concentration in C2C12 Myotubes. Appl Sci. 2022;12(3):1553. https://doi.org/10.3390/app12031553 . Li X, Yang X, Shan B, Shi J, Xia D, Wegner J, Zhao R. Meat quality is associated with muscle metabolic status but not contractile myofiber type composition in premature pigs. Meat Sci. 2009;81(1):218–23. https://doi.org/10.1016/j.meatsci.2008.07.022 . McCarty MF. In type 1 diabetics, high-dose biotin may compensate for low hepatic insulin exposure, promoting a more normal expression of glycolytic and gluconeogenic enyzymes and thereby aiding glycemic control. Med Hypotheses. 2016;95:45–8. https://doi.org/10.1016/j.mehy.2016.08.002 . Turgut M, Cinar V, Pala R, Tuzcu M, Orhan C, Telceken H, Sahin N, Deeh PBD, Komorowski JR, Sahin K. Biotin and chromium histidinate improve glucose metabolism and proteins expression levels of IRS-1, PPAR-γ, and NF-κB in exercise-trained rats. J Int Soc Sports Nutr. 2018;15(1):45. https://doi.org/10.1186/s12970-018-0249-4 . Vilches-Flores A, Tovar AR, Marin-Hernandez A, Rojas-Ochoa A, Fernandez-Mejia C. Biotin increases glucokinase expression via soluble guanylate cyclase/protein kinase G, adenosine triphosphate production and autocrine action of insulin in pancreatic rat islets. J Nutr Biochem. 2010;21(7):606–12. https://doi.org/10.1016/j.jnutbio.2009.03.009 . Abu Aqel Y, Alnesf A, Aigha II, Islam Z, Kolatkar PR, Teo A, Abdelalim EM. Glucokinase (GCK) in diabetes: from molecular mechanisms to disease pathogenesis. Cell Mol Biol Lett. 2024;29(1):120. https://doi.org/10.1186/s11658-024-00640-3 . Holeček M. Why Are Branched-Chain Amino Acids Increased in Starvation and Diabetes? Nutrients. 2020;12(10):3087. https://doi.org/10.3390/nu12103087 . Holeček M. The role of skeletal muscle in the pathogenesis of altered concentrations of branched-chain amino acids (valine, leucine, and isoleucine) in liver cirrhosis, diabetes, and other diseases. Physiol Res. 2021;70(3):293–305. https://doi.org/10.33549/physiolres.934648 . Shimomura Y, Fujii H, Suzuki M, Murakami T, Fujitsuka N, Nakai N. Branched-chain alpha-keto acid dehydrogenase complex in rat skeletal muscle: regulation of the activity and gene expression by nutrition and physical exercise. J Nutr. 1995;125(6 Suppl):S1762–5. https://doi.org/10.1093/jn/125.suppl_6.1762S . Additional Declarations No competing interests reported. Supplementary Files supplementaryfile.zip Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6835205","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":489422010,"identity":"92c62ae8-9c1a-46dd-aa13-5749e888f8d0","order_by":0,"name":"Gaoxiao Xu","email":"","orcid":"","institution":"Fuyang Normal University","correspondingAuthor":false,"prefix":"","firstName":"Gaoxiao","middleName":"","lastName":"Xu","suffix":""},{"id":489422011,"identity":"0c47e703-344f-4616-baca-87f7a4a429df","order_by":1,"name":"Han Chu","email":"","orcid":"","institution":"Tianjin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Han","middleName":"","lastName":"Chu","suffix":""},{"id":489422012,"identity":"4e14f2b6-0855-49f8-bee4-64328e328acf","order_by":2,"name":"Lei Qin","email":"","orcid":"","institution":"Tianjin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Lei","middleName":"","lastName":"Qin","suffix":""},{"id":489422013,"identity":"f6ed17d6-c4cc-4332-8194-4cb06c9136e3","order_by":3,"name":"Yuxing Dai","email":"","orcid":"","institution":"Tianjin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yuxing","middleName":"","lastName":"Dai","suffix":""},{"id":489422014,"identity":"53634317-ed6f-446a-9371-9c3a8649abb3","order_by":4,"name":"Chunguang Zhang","email":"","orcid":"","institution":"Tianjin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Chunguang","middleName":"","lastName":"Zhang","suffix":""},{"id":489422015,"identity":"36f0dd64-3bfd-454b-b2e6-36d74d83cf8d","order_by":5,"name":"Yunyan Luo","email":"","orcid":"","institution":"Tianjin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yunyan","middleName":"","lastName":"Luo","suffix":""},{"id":489422017,"identity":"dd74db4a-c3e1-46fb-966e-f7b07210fa4d","order_by":6,"name":"Jianbin Zhang","email":"","orcid":"","institution":"Tianjin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jianbin","middleName":"","lastName":"Zhang","suffix":""},{"id":489422019,"identity":"4bc0f5a1-324b-4b6e-8779-08a845ffc8f4","order_by":7,"name":"Falei Li","email":"","orcid":"","institution":"Fuyang Normal University","correspondingAuthor":false,"prefix":"","firstName":"Falei","middleName":"","lastName":"Li","suffix":""},{"id":489422021,"identity":"3202fed9-26e5-4c52-bcaf-7298c4e18b69","order_by":8,"name":"Lei Pu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA60lEQVRIiWNgGAWjYFAC5gaGBCAlwd7AYAAWOEBQCyNUC89hUrSAgIREMlSAkBZzicTGBw/bbPIlZ74/UPCzjUGO70YC4+cCPFosZyQ2GyS2pVnOlk5mMOxtYzCWvJHALD0DjxaDG4ltEonbDhvIAbUY8LYxJG64kcDGzINfS/sPsBbJwwyGf9sY6onRAjQZqEVagpnBGGhLggEhLZY9D5slEv+lGUj2JBsYy5yTMJx55mGzND4t5uzJBz/+OGNjIHH84DPDN2U28nzHkw9+xuswJDYbkCPBAI8pYrQwP8CrdBSMglEwCkYsAAA+rEq9Zt/50QAAAABJRU5ErkJggg==","orcid":"","institution":"Tianjin Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Lei","middleName":"","lastName":"Pu","suffix":""}],"badges":[],"createdAt":"2025-06-06 08:38:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6835205/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6835205/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":87517073,"identity":"9ecfb4bc-f364-40be-8f5a-9e22c968cb10","added_by":"auto","created_at":"2025-07-24 16:52:03","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":427257,"visible":true,"origin":"","legend":"\u003cp\u003eInterference of \u003cem\u003eHLCS\u003c/em\u003einhibited the proliferation of C2C12 cells. (A) qRT-PCR was performed to detect the expression of \u003cem\u003eHLCS\u003c/em\u003e in proliferating C2C12 cells. (B) The efficiency of \u003cem\u003esiHLCS\u003c/em\u003e mediated interference of target gene expression was determined by qRT-PCR analysis. (C) Protein expression of five carboxylases after interfering with \u003cem\u003eHLCS\u003c/em\u003e in C2C12 cells. (D) The mRNA expressions of five carboxylases after interfering with \u003cem\u003eHLCS\u003c/em\u003e in C2C12 cells. (E) The proliferation of C2C12 cells was examined using the EdU assay. The green color represents the staining of EdU, while the blue color indicates the counter-staining of cell nuclei with DAPI. The quantification was performed to determine the percentage of cells positive for EdU. (F) The expressions levels of \u003cem\u003eCDK\u003c/em\u003e2, \u003cem\u003eCyclin B\u003c/em\u003e, and \u003cem\u003eP\u003c/em\u003e21 were determined by qRT-PCR. (G) Western blotting detected the protein expression of proliferation-related genes. Protein grayscale analysis histogram. (H) The ERK1/2, p38, JNK signaling pathway in C2C12 cell proliferation were detected using Western blotting. GAPDH served as an internal control. The data represent mean ± SD. n=3, *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6835205/v1/c0662e3493558c13e1099140.png"},{"id":87516749,"identity":"e2672eb8-40fc-4359-971e-2cec38ad6de8","added_by":"auto","created_at":"2025-07-24 16:44:03","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":78303,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003esiHLCS \u003c/em\u003eSuppresses C2C12 Cell myogenic differentiation (A) Expression levels of \u003cem\u003eHLCS\u003c/em\u003e were determined in C2C12 cells during myogenic differentiation by qRT-PCR. (B) The differentiation of C2C12 cells was examined using MyHC immunofluorescence staining at 4 d. Green represents MyHC staining, and blue represents cell nuclei counter-stained with DAPI. The myogenic differentiation index was calculated as the ratio of the number of nuclei in the myotube to the total number of nuclei. The fusion index was calculated as the ratio of the number of myotubes with more than 2 nuclei to the total number of nuclei. (C) The interference with \u003cem\u003eHLCS \u003c/em\u003ein myogenic differentiated C2C12 cells affects the mRNA expressions of five carboxylases. (D) Schematic representation of HLCS-mediated biotin attachment to carboxylases. (E) Protein expressions of five carboxylases after interfering with \u003cem\u003eHLCS\u003c/em\u003e in C2C12 cells. (F) mRNA expression levels of \u003cem\u003eMyoD\u003c/em\u003e, \u003cem\u003eMyoG\u003c/em\u003e, and \u003cem\u003eMyh\u003c/em\u003e3 were normalized to the \u003cem\u003eGAPDH\u003c/em\u003e level according to qRT-PCR analysis. (G) Protein levels of HLCS, MyoG and Myh3 after transfection and induction of myogenic differentiation for 6 days. Protein quantitative analysis of HLCS, MyoG and Myh3. (H) Western blotting method was used to detect ERK1/2, p38, JNK signaling pathways in myogenic differentiation of C2C12 cells. GAPDH is an internal reference gene in protein quantification. The data represent mean ± SD. n=3, *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6835205/v1/e571eaac78237622a5514955.png"},{"id":87516750,"identity":"fe63d4f2-12f4-411d-a759-fb66244a5424","added_by":"auto","created_at":"2025-07-24 16:44:03","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":250055,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of addition of biotin combined with \u003cem\u003eHLCS\u003c/em\u003einterfered on myogenic differentiation of C2C12 cells. (A) The mRNA expression levels of\u003cem\u003e HLCS\u003c/em\u003e, \u003cem\u003eMyoG\u003c/em\u003e, and \u003cem\u003eMyh3\u003c/em\u003e were assessed following biotin treatment and induction of myogenic differentiation for 6 days. (B) Protein quantitative analysis of HLCS, MyoG and Myh3. (C) The expression levels of \u003cem\u003eHLCS\u003c/em\u003e, \u003cem\u003eMyoD\u003c/em\u003e, \u003cem\u003eMyoG\u003c/em\u003e and \u003cem\u003eMyh\u003c/em\u003e3 were detected by qRT-PCR after \u003cem\u003eHLCS\u003c/em\u003e interference and biotin co-treatment. (D) The protein levels of HLCS, MyoG, and Myh3 were quantitatively analyzed with GAPDH serving as an internal reference. The data represent mean ± SD. n=3, *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6835205/v1/2bc5fc1317ccf908d52878fa.png"},{"id":87517078,"identity":"b8bb845c-a4d1-44e5-bb2c-1f59ee16f06d","added_by":"auto","created_at":"2025-07-24 16:52:03","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":406160,"visible":true,"origin":"","legend":"\u003cp\u003eImpact of biotin concentration on the expression of various genes and proteins in cells. (A) The mRNA levels of \u003cem\u003eACC1\u003c/em\u003e, \u003cem\u003eACC2\u003c/em\u003e, \u003cem\u003ePCC\u003c/em\u003e, \u003cem\u003ePC\u003c/em\u003e, and \u003cem\u003eMCC\u003c/em\u003e were detected by qRT-PCR. (B) The protein levels of HLCS, ACC2, ACC1, PC, MCC, and PCC were measured by Western blotting. Quantification is shown on the right. (C) The mRNA levels of \u003cem\u003eCEBPα\u003c/em\u003e, \u003cem\u003ePPARγ\u003c/em\u003e, \u003cem\u003eFAS\u003c/em\u003e, \u003cem\u003eHSL\u003c/em\u003e, and \u003cem\u003eLPL\u003c/em\u003e were detected by qRT-PCR. (D) The protein levels of HSL, PPARγ, and CEBPα were determined by Western blotting. (E) The mRNA levels of \u003cem\u003ePKM\u003c/em\u003e, \u003cem\u003ePFKM\u003c/em\u003e, \u003cem\u003ePKAG3\u003c/em\u003e, \u003cem\u003eGSK3β\u003c/em\u003e, and\u003cem\u003eHK2\u003c/em\u003e were detected by qRT-PCR. (F) The protein level of PKM was measured by Western blotting. (G) The protein levels of p-ERK1/2, ERK1/2, p-p38, and p38 were detected by Western blotting. GAPDH was used as an internal control. The data represent mean ± SD. n=3, *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05,**\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6835205/v1/e75d148ca528dd746a9f6722.png"},{"id":87516753,"identity":"080d5cec-3c9f-4e18-9a8f-2e51aaa532e3","added_by":"auto","created_at":"2025-07-24 16:44:03","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":504035,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of different biotin concentrations on gene and protein expression in mouse muscle. (A) Observe the muscle shape and weight of each group, and calculate muscle weight/body weight. (B) mRNA levels of \u003cem\u003eMyh3\u003c/em\u003e, \u003cem\u003eMyog\u003c/em\u003e, \u003cem\u003eMyh3\u003c/em\u003e and \u003cem\u003eMYST\u003c/em\u003e were detected by qRT-PCR. (C) The protein levels of Myh3 and Myog were detected by Western blotting. (D) mRNA levels of \u003cem\u003eHSL\u003c/em\u003e, \u003cem\u003ePPARγ\u003c/em\u003e and \u003cem\u003eCEBPα\u003c/em\u003e were detected by qRT-PCR. (E) Western blotting was used to detect HSL, PPARγ and CEBPα protein levels. (F) mRNA levels of \u003cem\u003eHLCS\u003c/em\u003e, \u003cem\u003eACC2\u003c/em\u003e, \u003cem\u003eACC1\u003c/em\u003e, \u003cem\u003ePC\u003c/em\u003e, \u003cem\u003eMCC\u003c/em\u003e and \u003cem\u003ePCC\u003c/em\u003e were detected by qRT-PCR. (G) Protein levels of hlc, ACC2, ACC1, PC, MCC and PCC were detected by Western blotting. (H) mRNA expression levels of \u003cem\u003eGSK3β\u003c/em\u003e, \u003cem\u003ePKM\u003c/em\u003e and \u003cem\u003ePRKAG3\u003c/em\u003e were detected by qRT-PCR. (I) PKM protein levels were detected by Western blotting. (J) Protein levels of p-ERK1/2, ERK1/2, p-p38 and p38 were detected by Western blotting. Take GAPDH as the internal parameter. Data are mean ±SD. n=3, *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6835205/v1/e178e36cb0ca56914e1fff0f.png"},{"id":87518161,"identity":"c75ed0d9-f198-48f0-95be-ac507ce22753","added_by":"auto","created_at":"2025-07-24 17:00:03","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":319947,"visible":true,"origin":"","legend":"\u003cp\u003eThe crucial role of HLCS in biotin attachment and carboxylase catalysis. HLCS (Holocarboxylase Synthetase) is responsible for attaching biotin to the respective carboxylase, enabling their catalytic activity. In the diagram, yellow circles represent biotin molecules, and the blue oval shapes indicate the five different carboxylases (ACC1, ACC2, PC, PCC, MCC). Once biotin is attached to carboxylase via HLCS, these enzymes catalyze various reactions, producing essential metabolic products such as Acetyl-CoA, Pyruvic Acid, and Succinyl-CoA. Without the function of HLCS (siHLCS), this biotin attachment process is inhibited, resulting in the loss of carboxylase activity. \u003cem\u003eSNPs\u003c/em\u003e of \u003cem\u003eHLCS\u003c/em\u003e were significantly associated with LEA and ADFI in Duroc pigs. Proliferation and myogenic differentiation ability of skeletal muscle cells were decreased when interfering with \u003cem\u003eHLCS\u003c/em\u003e, pig muscle development was affected, and led to the decrease of pig weight. ↑ Indicates expression up-regulation, ↓ Indicates expression down-regulation, -Indicates expression invariant.\u003c/p\u003e","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-6835205/v1/b89591f91df64f2a9c6beeca.png"},{"id":96253446,"identity":"b589dd88-5a02-4d31-8175-ca7c6c40cbef","added_by":"auto","created_at":"2025-11-19 07:42:30","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4563751,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6835205/v1/90e7dddd-a05f-4f55-b2ac-386e8ad6ac51.pdf"},{"id":87516767,"identity":"27ec7a1e-95c0-4a7e-a56f-a3b79e1b8e89","added_by":"auto","created_at":"2025-07-24 16:44:04","extension":"zip","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":27244170,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfile.zip","url":"https://assets-eu.researchsquare.com/files/rs-6835205/v1/9bd58f4fc2c9bf059466eba1.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"Study on the Mechanism of HLCS Gene Deficiency and Biotin Compensation Inhibiting Skeletal Muscle Development","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eHLCS was holocarboxylase synthetase could catalyze biotin incorporation with carboxylases (which were pyruvate carboxylase (PC), 3-methylcrotonyl-CoA carboxylase (MCC), propionyl-CoA carboxylase (PCC), and acetyl-CoA carboxylase (ACC)), carboxyl group on biotin is transferred to the reaction carboxylases substrate (for examples: acetyl-CoA, propionyl-CoA, succinic acid-CoA alphacarbon of propiony-CoA etc) [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. A genome-wide association study (GWAS) suggested that HLCS is an important candidate gene for growth performance of pigs [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Other similar studies have also found that quantitative trait loci (QTL) on pig chromosome 13 was related to the growth performance of pigs, which includes \u003cem\u003eHLCS\u003c/em\u003e [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. This suggests that HLCS gene is closely related to the growth and development of pigs. However, the association of SNPs of the \u003cem\u003eHLCS\u003c/em\u003e gene with growth performance in pigs has not been studied in-depth, the effects of HLCS on skeletal muscle development is not entirely clear.\u003c/p\u003e\u003cp\u003eHLCS was critical in gluconeogenesis, fatty acid synthesis and amino acid metabolism [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The function of HLCS is inseparable from the downstream carboxylase. PC was an important anaplerotic enzyme in skeletal muscle mitochondria, predominantly located in the mitochondrial matrix near the inner membrane, regulating mitochondrial fuel metabolism [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Patients with MCC deficiency have been reported to experience severe muscle pain and physical disability [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. PC and ACC are the essential enzymes for maintaining energy homeostasis [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. ACC primarily carboxylates acetyl-CoA to malonyl-CoA, making it a rate-limiting enzyme for fatty acid synthesis [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The function PC, PCC, ACC and MCC closely related to cell metabolism, but the effect of HLCS gene on muscle development with only a few reports.\u003c/p\u003e\u003cp\u003eBiotin is a sulfur-containing water soluble B-vitamin. It binds to the carboxylase mentioned above, carboxylates the corresponding substrate, and regulates the metabolism of the animal. Individuals with severe biotin deficiency or HLCS gene dysfunction that lead to clinical symptoms such as hallucinations, depression, anorexia, dermatitis, impaired cellular and humoral immune function, hair loss, seizures, developmental delays, metabolic ketoacidosis, hearing loss, impaired vision, lethargy, muscle weakness, vomiting, and altered fatty acid composition [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Dramatic clinical improvement with biotin mega-dose therapy in people with HLCS deficiency [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In the case of HLCS deficiency, the study on the effect of biotin supplementation on muscle development will also provide a theoretical basis for biotin therapy. Biotin as a nutritional supplement, its effect on muscle development can provide guidance for its application in livestock production.\u003c/p\u003e\u003cp\u003eTherefore, \u003cem\u003eHLCS\u003c/em\u003e gene and biotin were important substances necessary for the process of carboxylation. In this study, the effects of \u003cem\u003eHLCS\u003c/em\u003e gene interference on proliferation and myogenic differentiation of skeletal muscle cells will be investigate. The regulatory mechanism of \u003cem\u003eHLCS\u003c/em\u003e and biotin on the development of muscle tissue and cells will be explore. This work will provides a theoretical basis for the study of mechanism of influence of \u003cem\u003eHLCS\u003c/em\u003e and biotin nutrition supplementation on development of muscle, and promotes efficient pork production.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1. Animals and data collection\u003c/h2\u003e\u003cp\u003e592 Duroc pigs of the same age grew up in the same enclosure. During the trial, daily feed intake (DFI) and body weight (BW) were achieved using electronic feed intake recording equipment (FIRE, Osborne, KS, USA). The experiment lasted from 90 days of age to 180 days of age. When the pig weight reached 100 kg, BF thickness and loin eye area (LEA) were measured between the 10th and 11th ribs using an aloca ultrasonic meter (Corometrics Medical Systems, Inc., Wallingford, CT, USA). The basal diet was formulated to meet or exceed the National Research Council (NRC). ADG was calculated as body weight ratio to the test\u0026rsquo;s time. The prediction of RFI through linear regression model was described as follows [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]:\u003c/p\u003e\u003cp\u003eRFI\u0026thinsp;=\u0026thinsp;DFI \u0026minus; [b1 \u0026times; onBW\u0026thinsp;+\u0026thinsp;b2 \u0026times; offBW\u0026thinsp;+\u0026thinsp;b3 \u0026times; metamidBW\u0026thinsp;+\u0026thinsp;b4 \u0026times; ADGA\u0026thinsp;+\u0026thinsp;b5 \u0026times; offBFA\u0026thinsp;+\u0026thinsp;e]\u003c/p\u003e\u003cp\u003eWhere onBW was the on-test body weight, offBW was the off-test body weight, metamidBW was the metabolic mid-body weight (average weight raised to 0.75 power), ADGA was adjusted ADG to testing from 90 to 180 days old, and offBFA was the off-test BF adjusted to 100 kg of BW, the regression coefficients (b1 to b5) and regression intercept e were computed using a multiple linear regression model. The calculation formula for the age group 30 and 100 kg was described by the Canadian Swine Improvement Program (2010). FCR was calculated as the ratio of mass gain to feed intake.\u003c/p\u003e\u003cp\u003e592 Duroc pigs were genotyped on the Illumina Porcine SNP60 Bead Chip (Illumina, San Diego, CA, USA). Infinium II multicopy technology was used in this experiment. SNP chips were scanned using iScan and Illumina Genome Studio (Illuminia, Inc., 9885 Towne Centre Drive, San Diego, CA, USA), which was used only for analysis.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2. Animals and Treatment\u003c/h2\u003e\u003cp\u003eAll the procedures were carried out under sodium pentobarbital anesthesia, and the pigs were executed while profoundly unconscious. The sedated animals were really put to death by transection of the carotid arteries, after which the longissimus dorsi muscle and subcutaneous adipose tissues were removed.\u003c/p\u003e\u003cp\u003eDuring the pre-experimental feeding period, mice were provided with unrestricted access to standard rodent chow and sterile water. For the formal experiments, the mice were randomly assigned into three groups (n\u0026thinsp;=\u0026thinsp;8 per group): a control group (control), a biotin 20 group (L), and a biotin 50 group (H). Between 10 and 11 a.m., the L group received an oral gavage of 3 mL of biotin solution at a concentration of 20 mol/L, while the H group received an oral gavage of 3 mL of biotin solution at a concentration of 50 mol/L. The control group was administered with an oral gavage of 3 mL saline solution. Biotin administration continued for a duration of four weeks, and body weight was measured every three days during this period.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3. C2C12 cell culture and myogenic differentiation\u003c/h2\u003e\u003cp\u003eThe cells were grown in DMEM supplemented with 10% FBS and 100 units/mL penicillin-streptomycin. Cell cultures were conducted in 5% CO\u003csub\u003e2\u003c/sub\u003e incubator at 37℃. When 60\u0026ndash;70% confluence was reached, trypsin was used to digest and for passage of the cells. After the cells reached confluence, DMEM contained 4% horse serum, and 100 units/mL penicillin-streptomycin was used for myogenic differentiation, and the cells were collected after 6 days of induction.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4. Transfection of cell with siRNA\u003c/h2\u003e\u003cp\u003e\u003cem\u003eHLCS\u003c/em\u003e small interfering RNA (siRNA) and negative control siRNA (NC) oligonucleotides were given in Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e. Cells were transfected using Lipofectamine 3000 transfection reagent following the manufacturer\u0026rsquo;s protocol. 2 h before transfection, the cell medium was replaced with an Opti-MEM medium (Gibco, Grand Island, USA). The siRNA (20 \u0026micro;M) was incubated with 5 \u0026micro;L Lipofectamine 3000 in Opti-MEM medium for 20 min at room temperature before transfection. 6 h later, the medium was replaced with a complete medium.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5. EdU detection\u003c/h2\u003e\u003cp\u003eEdU staining was performed 24 h after cells culture to detect cell proliferation. For this assay, 10 \u0026micro;M EdU was added into the growth medium and incubated for 2 h. Fixation, permeabilization, and EdU staining were required according to the manufacturer\u0026rsquo;s protocol. Cell nuclei were counterstained with Hoechst 33342 at a concentration of 5 \u0026micro;g/mL for 10 min. Then, EdU-positive cells were observed under a fluorescence microscope (Motic, Ximen, China) to estimate the ratio of EdU-positive cells (EdU-stained cells/total cells).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6. RNA extraction and quantitative real-time PCR (qRT-PCR)\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted using the RNA extraction kit (TRIzol reagent; TaKaRa Company) and the extraction steps were performed according to the instructions of the kit. The resulting RNA solution was stored at a temperature of -80\u0026deg;C. Then the RNA was immediately reversed into cDNA by a reverse transcription kit (TaKaRa). The reverse transcription operation was conducted according to the instructions provided by the kit. The synthesized cDNA was stored at -20℃ or directly at -80℃ for later use.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences for qRT-PCR\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer sequence(5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eProduct length/bp\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHLCS\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: AGGAACTCGGCAAAGC\u003c/p\u003e\u003cp\u003eR: CAGACGCAGACCTCACC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e294\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePFKM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: TGTGGTCCGAGTTGGTAT\u003c/p\u003e\u003cp\u003eR: CGTGGCCTCCCTGAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePKM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: GCGTCCGCAGGTTTG\u003c/p\u003e\u003cp\u003eR: GCCTCCCGAGCTATCAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e328\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePRKAG3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: TTCCGAGATTTGGCTGTA\u003c/p\u003e\u003cp\u003eR: CACTCATGTCTAGGTGGTTGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e184\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGSK3β\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: TTTGGAGCCACTGATTACA\u003c/p\u003e\u003cp\u003eR: CGGAAGACCCGCACT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e272\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHK2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: CGACGAGGGACGGAT\u003c/p\u003e\u003cp\u003eR: TTCGGATGTCATTGAGTGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e74\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCDK2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: ACTCTTGGTCTGTTCATCGTGGT\u003c/p\u003e\u003cp\u003eR: GCAAAGTCCTGGGTGTAGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e109\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCyclin B\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: TCTTGCTTGGCTTCATTCATAG\u003c/p\u003e\u003cp\u003eR: TTCTTTTCCAGGTGGCATTAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e124\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP21\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: GGTGGTGGAGACCTGATGAT\u003c/p\u003e\u003cp\u003eR: ATTCTGCTGGCAAAGTGGGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e108\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCEBPα\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: GCAAAGCCAAGAAGTCGGTG\u003c/p\u003e\u003cp\u003eR: TCACTGGTCAACTCCAGCAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e145\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePPARγ\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: GACGCGGAAGAAGAGACCTG\u003c/p\u003e\u003cp\u003eR: TCACCTTGTCGTCACACTCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e84\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFAS\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: GGGTCTATGCCACGATTC\u003c/p\u003e\u003cp\u003eR: GTGTCCCATGTTGGATTTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e272\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHSL\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: ACTCACCGCTGACTTCC\u003c/p\u003e\u003cp\u003eR: GTCTCGTTGCGTTTGTAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e159\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLPL\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: TGGCGTAGCAGGAAGTCTGA\u003c/p\u003e\u003cp\u003eR: TGCAATCACACGGATGGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e163\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMyoD\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: CGGCTCTCTCTGCTCCTTTG\u003c/p\u003e\u003cp\u003eR: GTCGAAACACGGGTCATCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e182\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMyoG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: GACCCTACAGACGCCCACAA\u003c/p\u003e\u003cp\u003eR: CCGTGATGCTGTCCACGAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e94\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMyh3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: CCACCTGAACGAGCCC\u003c/p\u003e\u003cp\u003eR: TGGTAGGCGTTGTCGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e207\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eACC1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: ATTGTGGCTCAAACTGCAGGT\u003c/p\u003e\u003cp\u003eR: GCCAATCCACTCGAAGACCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e70\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eACC2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: TTCATGGACAGTGGCTTCTC\u003c/p\u003e\u003cp\u003eR: GCACGCCTTACTGAAGAGAAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e150\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: CGCAAGATGGGAGACAAG\u003c/p\u003e\u003cp\u003eR: AATAGGGAAGCCGTAGGTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e135\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: ACCCACTCAGGCACAA\u003c/p\u003e\u003cp\u003eR: TCCTCTTCAGGGCTTCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e258\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: ATGGACTCAAGGCACAAT\u003c/p\u003e\u003cp\u003eR: CCAGTTTCAATCCTCGTAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e264\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGapdh\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: AGGAGAGTGTTTCCTCGTCC\u003c/p\u003e\u003cp\u003eR: TGCCGTGAGTGGAGTCATAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003ePrimers were designed by primer software, and the primer sequences were shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. qRT-RCR was used to detect gene expression. In the qRT-PCR eight-row tube, the following components were added in sequence: 2 \u0026times; All-in-One qPCR Mix 7.5 \u0026micro;L, cDNA 1 \u0026micro;L, upstream primer 0.75 \u0026micro;L, downstream primer 0.75 \u0026micro;L, ddH\u003csub\u003e2\u003c/sub\u003eO 5 \u0026micro;L, prepared into qRT-PCR reaction solution, centrifuged and mixed qRT-PCR reaction solution. Perform PCR reaction: pre-denaturation: 95\u0026deg;C for 10 min, denaturation: 95\u0026deg;C for 30 s, annealing: 58\u0026deg;C for 30 s, extension: 72\u0026deg;C for 30 s, 45 cycles of denaturation, annealing, and extension were completed for melting curve analysis. Melting curve analysis: 95\u0026deg;C for 2 min, 72\u0026deg;C for 1 min, 95\u0026deg;C for 30 s.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7. Immunofluorescence assay\u003c/h2\u003e\u003cp\u003eCells were fixed with 4% paraformaldehyde for 15 min at room temperature and permeabilized with 0.1% Triton X-100 for 10 min. After blocking with bovine serum albumin for 30 min, the cells were incubated with primary antibody (MyHC) in blocking solution overnight at 4\u0026deg;C. 1. After undergoing three rounds of washing the following day, the cells were incubated with a secondary antibody (anti-rabbit FITC-conjugated) for 2 h at 4\u0026deg;C in a dark chamber. Afterward, the cell nuclei were stained with 1 mg/mL DAPI for 5 min at room temperature. Subsequently, fluorescence were detected using Motic fluorescence microscope (Motic, Ximen, China).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8. Western blotting analysis\u003c/h2\u003e\u003cp\u003eCells were harvested and lysed in RIPA buffer, which supplemented with protease inhibitor (Roche Complete mini tablet) and phosphatase inhibitor (Pierce Halt phosphatase inhibitor cocktail) to prepare whole-cell extracts. The lysates were centrifuged at 12000 rpm for 10 min, and the supernatant was boiled in sodium dodecyl sulfate (SDS) loading buffer (Beyotime, Shanghai, China). Proteins were separated by using 12.5% SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to immobilon (polyvinylidene difluoride) transfer membrane (PVDF) (Solarbio, Beijing, China). The membrane was blocked with 5% defatted milk and incubated at 4\u0026deg;C overnight with primary antibodies, followed by horseradish peroxidase-conjugated secondary antibody. Blots were visualized by a commercial enhanced chemiluminescence (ECL) detection kit (Solarbio, Beijing, China), with GAPDH as an internal control for normalization.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9. Data analysis\u003c/h2\u003e\u003cp\u003eThe genetic haplotype definition was defined as several genes or SNPs statistically associated with each other and formed a gene locus or common patterns of genetic variation. Haploview 4.2 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.broadinstitute.org/mpg/haploview\u003c/span\u003e\u003cspan address=\"http://www.broadinstitute.org/mpg/haploview\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used to detect the haplotype block in all the SNPs of \u003cem\u003eHLCS\u003c/em\u003e gene [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The generalized Linear Model (GLM) program in SAS9.2 was used to conduct most minor square variance analysis with the following models to compare the significance of SNP and growth performance.\u003c/p\u003e\u003cp\u003e\u003cem\u003eY\u0026thinsp;=\u0026thinsp;\u0026micro;\u0026thinsp;+\u0026thinsp;G\u0026thinsp;+\u0026thinsp;S\u0026thinsp;+\u0026thinsp;W\u0026thinsp;+\u0026thinsp;e\u003c/em\u003e\u003c/p\u003e\u003cp\u003eWhere \u003cem\u003eY\u003c/em\u003e is the observation of the traits, \u003cem\u003e\u0026micro;\u003c/em\u003e is the population mean, \u003cem\u003eG\u003c/em\u003e is the genotype effect, \u003cem\u003eS\u003c/em\u003e is the gender fixation effect, \u003cem\u003eW\u003c/em\u003e is the initial weight, \u003cem\u003ee\u003c/em\u003e is the random error.\u003c/p\u003e\u003cp\u003eThe MTDFREML program was used to obtain EBV. Depending on the trait, the mixed model for a single trait is:\u003c/p\u003e\u003cp\u003e\u003cem\u003ey\u003c/em\u003e\u003csub\u003e\u003cem\u003eijk\u003c/em\u003e\u003c/sub\u003e\u0026thinsp;\u003cem\u003e=\u0026thinsp;\u0026micro;\u0026thinsp;+\u0026thinsp;S\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e+P\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e+b\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e+O\u003c/em\u003e\u003csub\u003e\u003cem\u003ej\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e+S\u003c/em\u003e\u003csub\u003e\u003cem\u003ej\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e+e\u003c/em\u003e\u003csub\u003e\u003cem\u003eijk\u003c/em\u003e\u003c/sub\u003e\u003c/p\u003e\u003cp\u003eWhere \u003cem\u003ey\u003c/em\u003e is observations of the traits, \u003cem\u003e\u0026micro;\u003c/em\u003e is the population mean, \u003cem\u003eS\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e is the gender fixation effect, \u003cem\u003eP\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e is the parity fixation effect, \u003cem\u003eb\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e is the batch fixation effect, \u003cem\u003eO\u003c/em\u003e\u003csub\u003e\u003cem\u003ej\u003c/em\u003e\u003c/sub\u003e is the individual animal random effects, \u003cem\u003eS\u003c/em\u003e\u003csub\u003e\u003cem\u003ej\u003c/em\u003e\u003c/sub\u003e is the second animal effect (father number), \u003cem\u003ee\u003c/em\u003e\u003csub\u003e\u003cem\u003eijk\u003c/em\u003e\u003c/sub\u003e is the random error.\u003c/p\u003e\u003cp\u003eThree biological replicates were set up in each experiment. To analyze the qRT-PCR and the Western blotting results for cellular experiments, the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method was used. Data analysis was performed using an independent sample \u003cem\u003et\u003c/em\u003e-test and one-way analysis of variance using SPSS 25 software, and differences were performed. In the significance test, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 means highly significant difference, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 means significant difference, means no significant difference. The data in tables were presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error, while the data in figures were expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error. Proteins were analyzed in a grayscale using Image J software to obtain quantitative data.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e3.1. SNPs of HLCS association with feed efficiency traits\u003c/h2\u003e\u003cp\u003eOur research team found that the intron region of \u003cem\u003eHLCS\u003c/em\u003e gene DNA contains five SNPs. The five SNPs were located in the two haplotype block, indicating that the SNPs were highly linked. The results of the information from five SNPs of \u003cem\u003eHLCS\u003c/em\u003e were presented in other articles of the team. In Duroc population, the five SNPs were linkage genotypes, and haplotype analysis results showed that five SNPs of \u003cem\u003eHLCS\u003c/em\u003e were distributed in two block haplotype. ASGA0089950 and ASGA0097399 were contained in block one, ALGA0073814, ASGA0059961 and ALGA0073818 were contained in block two (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e,Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThis experiment involved a joint analysis of phenotype values and estimated breeding values (EBV) to study the correlation between SNPs of haplotype linked phenotype the \u003cem\u003eHLCS\u003c/em\u003e gene and growth performance in 592 Duroc pigs. The results of correlation analysis were demonstrated in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e and Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e.The statistical results has shown that individuals with genotype G6 and G7 had larger LEA and higher ADFI. (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eGenotype frequencies of five SNPs in 592 Duroc pigs in block one\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHaplotype block 1\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eASGA0089950-ASGA0097399\u003c/p\u003e\u003cp\u003e(Genotype Sequence)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNum\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFrequency(%)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eG1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTT-GG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e26\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e4.4%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eG2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTC-CG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e182\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e30.7%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eG3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCC-CC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e382\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e64.5%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eG4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCC-CG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0.3%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eGenotype frequencies of five SNPs in 592 Duroc pigs in block two\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHaplotype block 2\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eALGA0073814-ASGA0059961-ALGA0073818\u003c/p\u003e\u003cp\u003e(Genotype Sequence)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNum\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFrequency(%)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eG5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTT-GG-GG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e4.2%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eG6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTG-AG-TG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e221\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e37.3%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eG7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGG-AA-TT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e345\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e58.3%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eG8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGG-NN-NN\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0.2%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eAssociation of genotype of \u003cem\u003eHLCS\u003c/em\u003e with different feed efficiency related traits in block one\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"7\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTrait\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGenotype\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNum.(592)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePhenotypic value \u003csup\u003e1)\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eGenotype\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNum.(592)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eEBV \u003csup\u003e1)\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eLEA (cm\u003csup\u003e2\u003c/sup\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e26\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e37.93\u0026thinsp;\u0026plusmn;\u0026thinsp;1.11\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e26\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e\u003cp\u003e-0.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.40\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e182\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e37.42\u0026thinsp;\u0026plusmn;\u0026thinsp;0.37\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e182\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e\u003cp\u003e-0.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e382\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e37.88\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e382\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e\u003cp\u003e-0.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eADG (kg/d)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e26\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e0.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e26\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e\u003cp\u003e0.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e182\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e0.64\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e182\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e\u003cp\u003e0.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e382\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e0.64\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e382\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e\u003cp\u003e0.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eADFI (kg/d)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e26\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e1.64\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e26\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e\u003cp\u003e0.03\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e182\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e1.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e182\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e\u003cp\u003e0.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e382\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e1.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e382\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e\u003cp\u003e0.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eRFI (g/d)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e26\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e-17.93\u0026thinsp;\u0026plusmn;\u0026thinsp;30.03\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e26\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e\u003cp\u003e0.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e182\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e25.72\u0026thinsp;\u0026plusmn;\u0026thinsp;12.8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e182\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e\u003cp\u003e0.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e382\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e32.71\u0026thinsp;\u0026plusmn;\u0026thinsp;8.57\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e382\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e\u003cp\u003e-0.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eFCR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e26\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e2.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e26\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e\u003cp\u003e0.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e182\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e2.70\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e182\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e\u003cp\u003e0.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e382\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e2.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e382\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e\u003cp\u003e0.03\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eAssociation of genotype of \u003cem\u003eHLCS\u003c/em\u003e with different feed efficiency related traits in block two\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"7\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTrait\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGenotype\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNum.(592)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePhenotypic value \u003csup\u003e1)\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eGenotype\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNum.(592)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eEBV \u003csup\u003e1)\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eLEA (cm\u003csup\u003e2\u003c/sup\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e34.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.82\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-1.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.34\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e221\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e37.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e221\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-0.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e345\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e38.03\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e345\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-0.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eADG (kg/d)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-0.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e221\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.65\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e221\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e345\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.64\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e345\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eADFI (kg/d)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-0.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e221\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e221\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e345\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1.66\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e345\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eRFI (g/d)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e11.20\u0026thinsp;\u0026plusmn;\u0026thinsp;37.42\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e221\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e43.69\u0026thinsp;\u0026plusmn;\u0026thinsp;10.63\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e221\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-0.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e345\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e21.43\u0026thinsp;\u0026plusmn;\u0026thinsp;9.37\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e345\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-0.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eFCR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e221\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e221\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-0.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e345\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eG7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e345\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-0.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003csup\u003e1)\u003c/sup\u003e The value of each trait was expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error. (a, b) mean \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\u003cp\u003eTherefore, this study suggested that \u003cem\u003eHLCS\u003c/em\u003e gene mutation was closely related to pig growth performance. The effect of \u003cem\u003eHLCS\u003c/em\u003e on skeletal muscle cells development was elucidated by interfering with \u003cem\u003eHLCS\u003c/em\u003e on C2C12 cells.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e\u003cem\u003e3.2. siHLCS\u003c/em\u003e inhibited the proliferation of C2C12 cells\u003c/h2\u003e\u003cp\u003eTo investigate the potential role of \u003cem\u003eHLCS\u003c/em\u003e in skeletal muscle cells proliferation, we employed qRT-PCR to detect \u003cem\u003eHLCS\u003c/em\u003e mRNA expression in a proliferation of C2C12 cells at 0, 12, 24, 36, 48, and 60 h, \u003cem\u003eHLCS\u003c/em\u003e was expressed at all stages but the highest level of expression at the 24 h proliferation stages, and there was a trend of increasing first and then decreasing (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). To screen the interference fragment of \u003cem\u003eHLCS\u003c/em\u003e, we designed two siRNA oligonucleotides to specifically interfered the \u003cem\u003eHLCS\u003c/em\u003e gene. The \u003cem\u003esiRNA-2\u003c/em\u003e fragments had the highest interference efficiency (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). As a protein-coding gene, \u003cem\u003eHLCS\u003c/em\u003e encoded an enzyme that can catalyze the binding of biotin to ACC2, ACC1, PC, MCC and PCC carboxylases. The expressions levels of \u003cem\u003eACC1\u003c/em\u003e, \u003cem\u003eACC2\u003c/em\u003e, and \u003cem\u003ePC\u003c/em\u003e significantly increased when \u003cem\u003eHLCS\u003c/em\u003e was interfered with in C2C12 cells. (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC-D).\u003c/p\u003e\u003cp\u003eThe effects of \u003cem\u003esiHLCS\u003c/em\u003e on skeletal muscle cell proliferation were analyzed using EdU staining. The result revealed that transfection with \u003cem\u003esiHLCS\u003c/em\u003e significantly inhibited the proliferation of skeletal muscle cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). Furthermore, cell cycle-related genes (\u003cem\u003eCyclin B\u003c/em\u003e and \u003cem\u003eCDK2\u003c/em\u003e) were down-regulated and cell cycle repressor gene (\u003cem\u003eP21\u003c/em\u003e) was up-regulated in the \u003cem\u003esiHLCS\u003c/em\u003e group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). Western blotting result indicated that the expression level of \u003cem\u003eCDK2\u003c/em\u003e decreased significantly (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). Taken together, these data demonstrated that proliferation of C2C12 cells can be inhibited by transfection with \u003cem\u003esiHLCS\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eIn order to understand the effect of \u003cem\u003esiHLCS\u003c/em\u003e on MAPK signaling pathway in C2C12 cells, the protein levels of p-JNK\u003csup\u003eThr183/Tyr185\u003c/sup\u003e, JNK, p-p38\u003csup\u003eThr180/Tyr182\u003c/sup\u003e, p38, p-ERK1/2\u003csup\u003eThr202/Tyr204\u003c/sup\u003e and ERK were analyzed by Western blotting analysis. The results showed that the protein expression levels of ERK, p38, JNK, and their phosphorylated forms were down-regulated in the \u003cem\u003esiHLCS\u003c/em\u003e group, while the ratios of p-ERK1/2\u003csup\u003eThr202/Tyr204\u003c/sup\u003e/ERK and p-JNK\u003csup\u003eThr183/Tyr185\u003c/sup\u003e/JNK were up-regulated in the \u003cem\u003esiHLCS\u003c/em\u003e group. (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e\u003cem\u003e3.3. siHLCS inhibited myogenic differentiation of C2C12 cell\u003c/em\u003e\u003c/h2\u003e\u003cp\u003eTo research the roles of the \u003cem\u003eHLCS\u003c/em\u003e gene in skeletal muscle cells myogenic differentiation, the current study examined the mRNA expression of \u003cem\u003eHLCS\u003c/em\u003e throughout the myogenic differentiation process of C2C12 cells, and found that the \u003cem\u003eHLCS\u003c/em\u003e expression tended to rise first and then fall with C2C12 cell myogenic differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). The myogenic differentiation of muscle cell was evaluated by employing immunofluorescence staining targeting MyHC, a widely recognized marker indicative of cellular myogenic differentiation. Immunofluorescence assay result has shown that interfering with \u003cem\u003eHLCS\u003c/em\u003e in C2C12 cells reduced the percentage of cells expressing MyHC, which resulted in the decrease of myogenic differentiation index and fusion index (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). The expressions levels of \u003cem\u003eACC1\u003c/em\u003e, \u003cem\u003ePC\u003c/em\u003e, \u003cem\u003eMCC\u003c/em\u003e, and \u003cem\u003ePCC\u003c/em\u003e were significantly down-regulated when \u003cem\u003eHLCS\u003c/em\u003e was interfered in C2C12 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). The interference of \u003cem\u003eHLCS\u003c/em\u003e resulted in a reduction in the mRNA expression levels of the myogenic genes \u003cem\u003eMyoD\u003c/em\u003e, \u003cem\u003eMyoG\u003c/em\u003e, and \u003cem\u003eMyh3\u003c/em\u003e, as demonstrated by qRT-PCR analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). Protein expressions levels of MyoG, Myh3 were also significantly down-regulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). Collectively, our results indicated that the myogenic differentiation of C2C12 cells were inhibited after interfering with \u003cem\u003eHLCS\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eTo explore the involvement of the MAPK signaling pathway when interfered with \u003cem\u003eHLCS\u003c/em\u003e in C2C12 cells. The protein levels of p-JNK\u003csup\u003eThr183/Tyr185\u003c/sup\u003e, JNK, p-p38\u003csup\u003eThr180/Tyr182\u003c/sup\u003e, p38, p-ERK1/2\u003csup\u003eThr202/Tyr204\u003c/sup\u003e and ERK1/2 were analyzed by Western blotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). The \u003cem\u003esiHLCS\u003c/em\u003e group exhibited a distinct down-regulation of p-ERK1/2\u003csup\u003eThr202/Tyr204\u003c/sup\u003e and ERK levels, and the ratios of p-ERK1/2\u003csup\u003eThr202/Tyr204\u003c/sup\u003e/ERK and p-p38/p38 were also down-regulated in the \u003cem\u003esiHLCS\u003c/em\u003e group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH)..\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e3.4. Effect of biotin supplementation on C2C12 myogenic differentiation\u003c/h2\u003e\u003cp\u003eTo investigate the role of biotin in myogenic differentiation, C2C12 cells were induced to differentiate and supplemented with different concentrations of biotin (0, 0.1, 1.0, 10 \u0026micro;M/L) in the myogenic differentiation medium. The q-PCR results showed that the mRNA expression levels of \u003cem\u003eHLCS\u003c/em\u003e, \u003cem\u003eMyoD\u003c/em\u003e and \u003cem\u003eMyoG\u003c/em\u003e were significantly decreased and the expression levels of \u003cem\u003eMyh3\u003c/em\u003e were significantly increased when C2C12 myoblasts were incubated with 0.1 \u0026micro;M/L biotin concentration. The mRNA expression levels of \u003cem\u003eHLCS\u003c/em\u003e, \u003cem\u003eMyoD\u003c/em\u003e, \u003cem\u003eMyoG\u003c/em\u003e and \u003cem\u003eMyh3\u003c/em\u003e were decreased when C2C12 myoblasts were incubated with a biotin concentration of 1.0 \u0026micro;M/L. The Western blotting analysis revealed a significant reduction in the protein levels of MyoG and Myh3 when C2C12 myoblasts were incubated with biotin at concentrations of 0.1, 1, and 10 \u0026micro;M/L (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B). Considering the above experimental result, this paper chose to add 1 \u0026micro;M/L concentration of biotin to carry out the follow-up mechanism study.\u003c/p\u003e\u003cp\u003eThe effectiveness of biotin as the main treatment for HLCS deficiency has been proven in multiple studies. Supplementation with high doses of biotin can partially or completely compensate for the disruption in biotin circulation caused by HLCS deficiency. To further elucidate the specific mechanism underlying biotin's impact on myogenic differentiation, we introduced \u003cem\u003esiHLCS\u003c/em\u003e. Considering the potential influence of \u003cem\u003esiHLCS\u003c/em\u003e on biotin metabolism, we designed a controlled experiment incorporating both conditions with and without additional biotin supplementation. The mRNA expression levels of \u003cem\u003eMyoD\u003c/em\u003e and \u003cem\u003eMyoG\u003c/em\u003e were significantly reduced after biotin treatment, as shown by qRT-PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC) and the proteins expression levels of \u003cem\u003eMyh3\u003c/em\u003e and \u003cem\u003eMyoG\u003c/em\u003e were significantly reduced after biotin treatment, as shown by Western blotting analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Compared with \u003cem\u003esiHLCS\u003c/em\u003e group, the mRNA expression levels of \u003cem\u003eMyoD\u003c/em\u003e, \u003cem\u003eMyoG\u003c/em\u003e in \u003cem\u003esiHLCS\u003c/em\u003e\u0026thinsp;+\u0026thinsp;biotin group has shown a downward trend (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC), and the proteins expression levels of \u003cem\u003eMyh3\u003c/em\u003e was significantly increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e3.5. Effect of Biotin Supplementation at Varying Concentrations on C2C12 Cell Differentiation\u003c/h2\u003e\u003cp\u003eThe specific role of biotin in myogenic differentiation was investigated by supplementing C2C12 cells with varying concentrations of biotin during differentiation, followed by quantification of mRNA and protein expression levels. At a concentration of 0.1 \u0026micro;M/L, mRNA expression levels of \u003cem\u003eACC1\u003c/em\u003e, \u003cem\u003eMCC\u003c/em\u003e, and \u003cem\u003ePCC\u003c/em\u003e were significantly increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Western blot analysis revealed that at 0.1 \u0026micro;M/L, protein levels of ACC1, ACC2, and PC were significantly elevated. However, at concentrations of 1 \u0026micro;M/L and 10 \u0026micro;M/L, protein expression of ACC1 decreased significantly, while that of PC increased significantly (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). The expression of adipogenesis-related genes was also assessed. It was found that, with the exception of \u003cem\u003eLPL\u003c/em\u003e and \u003cem\u003eFAS\u003c/em\u003e, whose mRNA levels were significantly elevated at 0.1 \u0026micro;M/L biotin, \u003cem\u003eHSL\u003c/em\u003e, \u003cem\u003eCEBPα\u003c/em\u003e, and \u003cem\u003ePPARγ\u003c/em\u003e exhibited varying degrees of downregulation at different biotin concentrations (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Western blot analysis showed that HSL and CEBPα were significantly reduced at 1 \u0026micro;M/L, while PPARγ was significantly upregulated at 0.1 \u0026micro;M/L and significantly downregulated at both 1 \u0026micro;M/L and 10 \u0026micro;M/L (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003eAdditionally, the expression levels of glycolysis-related genes in C2C12 cells were explored. After treatment with 0.1 \u0026micro;M/L biotin, GSK3β expression was significantly upregulated, while PFKM expression was significantly downregulated. At 1 \u0026micro;M/L and 10 \u0026micro;M/L, the expression of PKM, PFKM, PRKAG3, and GSK3β was further altered (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE).The protein expression level of PKM decreased progressively with increasing biotin concentration (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). This result suggests that lower concentrations of biotin promote the expression of glycolysis-related genes, while higher concentrations of biotin exert an inhibitory effect.\u003c/p\u003e\u003cp\u003eTo further explore the involvement of the MAPK signaling pathway, we analyzed the impact of different biotin concentrations on MAPK activation in C2C12 cells. Protein levels of p-JNK\u003csup\u003eThr183/Tyr185\u003c/sup\u003e, JNK, p-p38\u003csup\u003eThr180/Tyr182\u003c/sup\u003e, p38, p-ERK1/2\u003csup\u003eThr202/Tyr204\u003c/sup\u003e, and ERK1/2 were assessed through Western blotting. The results indicated that as the biotin concentration increased, the levels of p-ERK1/2\u003csup\u003eThr202/Tyr204\u003c/sup\u003e, p-p38\u003csup\u003eThr180/Tyr182\u003c/sup\u003e and p38 were significantly upregulated. The p-ERK1/2\u003csup\u003eThr202/Tyr204\u003c/sup\u003e/ERK ratio increased significantly with the increase of biotin concentration, and the p-p38/p38 ratio decreased significantly after biotin concentration increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). This suggests that biotin may regulate the metabolic activity and differentiation of C2C12 cells by activating the ERK1/2 and p38 signaling pathways.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e3.6. Impact of Different Doses of Biotin on Muscle Generation in Mice\u003c/h2\u003e\u003cp\u003eTo further validate the inhibitory effects of biotin on muscle development, we conducted an experiment using mice divided into three groups: the control group received 0.3 mL of physiological saline daily via gavage, the low-dose biotin group received 20 mg/kg body weight/day (Biotin low), and the high-dose biotin group received 50 mg/kg body weight/day (Biotin high). The results showed that the relative weight and cross-sectional area of longissimus dorsi muscle of mice were significantly reduced when low-dose biotin was added (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). The qRT-PCR analysis revealed a significant downregulation in the expression levels of myogenesis-related genes, specifically \u003cem\u003eMyoD\u003c/em\u003e, \u003cem\u003eMyoG\u003c/em\u003e, and \u003cem\u003eMyh3\u003c/em\u003e, indicating suppression of muscle development (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Western blotting analysis showed that the protein expression level of Myh3 in the Biotin high group was significantly increased, while the protein expression level of MyoG was down-regulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003eThe expression of genes associated with fat formation was also evaluated. The results showed that HSL and FAS mRNA levels were significantly increased in the Biotin low group, and HSL mRNA levels were still increased in the Biotin high group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). The changes of HSL protein expression levels in Western blotting analysis results were consistent with the qRT-PCR results (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). Furthermore, qRT-PCR result has shown that \u003cem\u003eACC1\u003c/em\u003e and \u003cem\u003ePCC\u003c/em\u003e expression were significantly elevated in the low-dose group but returned to control levels in the high-dose group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF), which was consistent with the trend of Western blotting results (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG).\u003c/p\u003e\u003cp\u003eRegarding glycolysis-related genes, the mRNA expression levels of \u003cem\u003ePKM\u003c/em\u003e, \u003cem\u003ePRKAG3\u003c/em\u003e, and \u003cem\u003eGSK3β\u003c/em\u003e were significantly elevated in the low-dose biotin group but showed no significant changes in the high-dose group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH). The protein expression level of PKM was decreased in high-dose biotin group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eI).\u003c/p\u003e\u003cp\u003eTo further explore the involvement of MAPK signaling pathways, Western blotting analysis was used to detect the protein levels of p-JNK\u003csup\u003eThr183/Tyr185\u003c/sup\u003e, JNK, p-p38\u003csup\u003eThr180/Tyr182\u003c/sup\u003e, p38, p-ERK1/2\u003csup\u003eThr202/Tyr204\u003c/sup\u003e, and ERK1/2 in the muscle of mice. The results showed that the protein levels of p-ERK1/2\u003csup\u003eThr202/Tyr204\u003c/sup\u003e, ERK1/2 and p38 were significantly up-regulated in the high-dose group, while the protein levels of p38 were significantly down-regulated in the low-dose biotin group. p-ERK1/2\u003csup\u003eThr202/Tyr204\u003c/sup\u003e/ERK1/2 and p-p38/p38 ratios were significantly up-regulated in the low-dose biotin group and significantly down-regulated in the high-dose group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eJ).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussions","content":"\u003cp\u003ePork is an important source of meat for human beings. The growth performance of pig determines the economic benefits of pig farms. Growth performance of pig includes the LEA, ADG, FCR and RFI traits, which were the critical points of genetic breeding improvement [\u003cspan additionalcitationids=\"CR17 CR18\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. This study found that five SNPs were identified within \u003cem\u003eHLCS\u003c/em\u003e, which were located on chromosome 13. five \u003cem\u003eSNPs\u003c/em\u003e of \u003cem\u003eHLCS\u003c/em\u003e had a high linkage and were found to be correlated with LEA and RFI. Pigs with low RFI have been found to have larger LEA. LEA is the cross-sectional area of the longissimus dorsi muscle, which represents the muscles development [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The expression of \u003cem\u003eHLCS\u003c/em\u003e gene was significantly different in longissimus dorsi muscle of individuals with different \u003cem\u003eHLCS\u003c/em\u003e genotypes. It is confident that the \u003cem\u003eHLCS\u003c/em\u003e gene may play a key role in influencing the growth performance of pigs, particularly in muscle development. Cellular level experiments were conducted to further investigate the impact of the \u003cem\u003eHLCS\u003c/em\u003e gene on skeletal muscle cell development.\u003c/p\u003e\u003cp\u003eACC1, ACC2, PC, PCC and MCC are the carboxylases downstream of HLCS. There are many studies on the functions of HLCS-related carboxylase in fatty acid metabolism and glucose metabolism, but few studies on the role of \u003cem\u003eHLCS\u003c/em\u003e gene in skeletal muscle cell development [\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In this study, proliferation in skeletal skeletal muscle cells was inhibited after interfering with \u003cem\u003eHLCS\u003c/em\u003e. The ability of skeletal muscle cell proliferation is related to the cell cycle, which includes the inter-division phase (G1, S, G2) and the division phase (M), Cyclin B was an important regulator of cellular proliferation that assistted to initiate the transition from the G2 to the M phase of the cell cycle [\u003cspan additionalcitationids=\"CR26\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In this study, the expression of \u003cem\u003eCyclin B\u003c/em\u003e was suppressed upon interfering with \u003cem\u003eHLCS\u003c/em\u003e. Consistent with C2C12 cells, knockdown of \u003cem\u003eHLCS\u003c/em\u003e in MCF-7 cell lines resulted in a 40\u0026ndash;50% reduction in proliferation, accompanied by G1 cell cycle arrest-induced apoptosis [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].after interfering with \u003cem\u003eHLCS\u003c/em\u003e, and further research found that the expressions of \u003cem\u003eACC1\u003c/em\u003e, \u003cem\u003eACC2\u003c/em\u003e and \u003cem\u003ePC\u003c/em\u003e gene increased during proliferation of C2C12 cells. Zhao et al., 2024 found that down-regulating ACC2 promoted the proliferation and migration of ovarian cancer cells in vivo and in vitro [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In accordance with the aforementioned studies, results from our study demonstrated that the expression of \u003cem\u003ePC\u003c/em\u003e was inhibited when \u003cem\u003eHLCS\u003c/em\u003e interfered, G2/M cell cycle arrest was induced and leading to apoptosis, thereby the proliferative ability of C2C12 cells was decreased. ACC1 and ACC2 are key regulators of fatty acid metabolism, controlling the rate-limiting step in the synthesis of malonyl-CoA, which is pivotal for fatty acid biosynthesis and cellular energy homeostasis. Dysregulation of ACC1 and ACC2 activity can lead to altered lipid metabolism, affecting membrane synthesis and energy production, thereby impacting cell proliferation. These enzymes collectively ensure the proper supply of metabolic intermediates required for cell cycle progression. These changes in carboxylase activity can upset the balance of metabolic flux, resulting in cell cycle stagnation or reduced proliferation.\u003c/p\u003e\u003cp\u003eMyoG, MyoD and Myh3 were hallmark of myotube formation [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. It has been reported that down-regulation of \u003cem\u003eMyoG\u003c/em\u003e, \u003cem\u003eMyoD\u003c/em\u003e, and \u003cem\u003eMyh3\u003c/em\u003e decreased myotube formation in C2C12 cells [\u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Our results found that the expressions of \u003cem\u003eMyoG\u003c/em\u003e, \u003cem\u003eMyoD\u003c/em\u003e and \u003cem\u003eMyh3\u003c/em\u003e were decreased, myogenic differentiation and fusion were attenuated after interfering with \u003cem\u003eHLCS\u003c/em\u003e. The present studies have demonstrated that interference with \u003cem\u003eHLCS\u003c/em\u003e resulted in a reduction in the expressions of \u003cem\u003eACC1\u003c/em\u003e, \u003cem\u003ePC\u003c/em\u003e, \u003cem\u003ePCC\u003c/em\u003e, and \u003cem\u003eMCC\u003c/em\u003e. Furthermore, decreased \u003cem\u003eACC\u003c/em\u003e expression led to delayed cell fusion and myosin formation [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. This result is consistent with the results of this study.\u003c/p\u003e\u003cp\u003eBy exploring the connection between \u003cem\u003eHLCS\u003c/em\u003e and MAPK signaling pathway, it was observed that the p-p38 and p-ERK1/2 decreased significantly during the proliferation and myogenic differentiation of C2C12 cells. Previous studies have shown that downregulation of p-ERK1/2 and p-p38 MAPK can diminish the proliferation and differentiation of C2C12 cells, which aligns with our results [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. It indicated that interference with \u003cem\u003eHLCS\u003c/em\u003e inhibited the proliferation and myogenic differentiation of C2C12 cells through regulation of p38 MAPK and ERK signaling pathway. Therefore, we considered that proliferation and myogenic differentiation ability of skeletal muscle cells were decreased when \u003cem\u003eHLCS\u003c/em\u003e was inferenced, pig muscle development was affected, and lead to the decrease of pig weight.\u003c/p\u003e\u003cp\u003eLarge doses of biotin were often used to treat HLCS deficiency [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Therefore, we speculated that biotin addition would affect the expression of HLCS gene. Interestingly, we found that biotin supplementation did not increase the expression of \u003cem\u003eHLCS\u003c/em\u003e gene. It is worth noting that biotin addition inhibited the expression of \u003cem\u003eHLCS\u003c/em\u003e gene, which may have some negative feedback mechanism. Our results indicated that myogenic differentiation was inhibited further by the addition of biotin and \u003cem\u003esiHLCS\u003c/em\u003e at same. In order to further confirm the effect of biotin on muscle development, this study added biotin to the basal diet of mice, the muscle development of the mice was inhibited, the weight of the longissimus dorsi muscle was reduced, the cross-sectional area of longissimus dorsi muscle was reduced. Addition of biotin in the diet can alleviate the oxidative stress of Japanese quail and promote the growth of muscles [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. The expressions of myogenic genes were decreased in muscle tissue. This study can provide theoretical basis for the study of biotin overdose contraindications.\u003c/p\u003e\u003cp\u003eIn order to further clarify the reason why biotin inhibits muscle development, we further studied glucose metabolism, lipid metabolism and related signaling pathways in cells and muscle tissue in this study. This study found that the addition of biotin promoted the increase the expressions of \u003cem\u003eACC\u003c/em\u003e and \u003cem\u003ePC\u003c/em\u003e, and the decrease of \u003cem\u003eMCC\u003c/em\u003e. The expression of genes associated with adipogenesis in muscle tissue exhibited a decrease, while the expression of genes involved in lipolysis showed abnormal elevation. Additionally, there was an increase observed in the expression of genes related to glycolysis. The result of this experiment is similar with previous research which found that biotin can accelerate the glycolysis process by promoting glucose absorption [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Supra-physiological levels of biotin could induce the increased expression of glucokinase, and suppressed the key gluconeogenic enzyme phosphoenolpyruvate carboxykinase [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eBiotin and chromium histidinate improve glucose metabolism and proteins expression levels of \u003cem\u003eIRS-1\u003c/em\u003e, \u003cem\u003ePPARγ\u003c/em\u003e, and \u003cem\u003eNF-kappaB\u003c/em\u003e in exercise-trained rats [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Biotin increases pancreatic glucokinase expression, glucokinase plays an important role in the initiation of glucose sensing and glucose metabolism in cells [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. The present study investigates how biotin affects the expressions of \u003cem\u003ePKM\u003c/em\u003e, \u003cem\u003ePRKAG3\u003c/em\u003e, and \u003cem\u003eGSK3β\u003c/em\u003e genes involved in glycolysis, which provides another example for biotin to promote glucose metabolism. Abnormal glucose metabolism will affect the metabolism of amino acids, and the content of branched-chain amino acids (BCAA) in diabetic patients were increased [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. BCAA catabolism does begin in muscle, aminotransferase activity is high in muscle [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. BCAA increasing was contributes to greater skeletal muscle cross sectional area [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Abnormal glycolysis causes C2C12 muscle atrophy [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. We speculated that biotin inhibited muscle development by accelerating the glycolysis and lead to lipid metabolism disorders. More tricarboxylic acid cycle products are degraded and consumed, inhibiting amino acid synthesis. Perhaps this process also promotes the degradation of branched-chain amino acids, which ultimately inhibits the development of muscle tissue and cells. Through further study of possible signaling pathways, it was found that the addition of biotin had certain effects on MAPK signaling pathway and TGFβ signaling pathway of skeletal muscle cells and muscle tissue. The above studies give us an important reminder that excessive dietary addition of biotin may reduce the muscle content. For exercisers who want to build muscle, additional biotin intake may not be a good option [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn summary, our findings demonstrated that five SNPs of the \u003cem\u003eHLCS\u003c/em\u003e gene were significantly linked to LEA, and RFI in Duroc pigs. After interfering with \u003cem\u003eHLCS\u003c/em\u003e, C2C12 cell proliferation was reduced, and p-ERK and p-p38 levels were decrease. Myogenic differentiation was inhibited, and p-ERK1/2 and p-p38 levels were decrease after interfering with \u003cem\u003eHLCS\u003c/em\u003e in C2C12 cells. Exogenous biotin can further inhibit the expression of \u003cem\u003eHLCS\u003c/em\u003e gene and the development of skeletal muscle cells and muscle tissues. These findings provided insight into the relationship between the \u003cem\u003eHLCS\u003c/em\u003e gene and pig growth performance, and the effects of \u003cem\u003eHLCS\u003c/em\u003e and biotin compensation on muscle tissue and skeletal muscle cell development were clarified (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn summary, our findings demonstrated that five SNPs of the \u003cem\u003eHLCS\u003c/em\u003e gene were significantly linked to LEA, 100 kg BF, and RFI in Duroc pigs. Further validated at the cellular level and in vivo in mice, \u003cem\u003eHLCS\u003c/em\u003e gene is a necessary gene for muscle development. In the case of \u003cem\u003esiHLCS\u003c/em\u003e, proliferation and myogenic differentiation of skeletal muscle cells were suppressed. Biotin supplementation relieved the effects of \u003cem\u003eHLCS\u003c/em\u003e deficiency. However, when the \u003cem\u003eHLCS\u003c/em\u003e gene is not deficient, the addition of biotin could repressed muscle development both at the cellular level and in vivo level of mice. These findings provided insight into the relationship between the \u003cem\u003eHLCS\u003c/em\u003e gene and pig growth performance, as well as highlighting the regulatory effects of \u003cem\u003eHLCS\u003c/em\u003e deficiency and biotin compensation on skeletal muscle cells at the cellular level (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). This study can provide theoretical basis for the functional study of \u003cem\u003eHLCS\u003c/em\u003e and biotin and provide reference for the efficient production of pork.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank the Fuyang Normal University, Tianjin Key Laboratory of Green Ecological Feed teachers and students gave me a lot of guidance and help.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthorship contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGaoxiao Xu:\u0026nbsp;\u003c/strong\u003eWriting-original draft, Methodology, Software,Visualization, Funding acquisition. \u003cstrong\u003eHan Chu:\u0026nbsp;\u003c/strong\u003eWriting-original draft, Methodology, Data curation, Formal analysis,Validation.\u003cstrong\u003e\u0026nbsp;Lei Qin:\u003c/strong\u003e Writing\u0026ndash;original draft, Data curation, Methodology. \u003cstrong\u003eYuxing Dai:\u0026nbsp;\u003c/strong\u003eWriting-original draft, Investigation, Methodology. \u003cstrong\u003eChunguang Zhang:\u003c/strong\u003e Methodology. \u003cstrong\u003eYunyan Luo:\u003c/strong\u003e Conceptualization. \u003cstrong\u003eJianbin Zhang:\u003c/strong\u003e Writing-review and editing. \u003cstrong\u003eFalei Li:\u003c/strong\u003e Writing-review and editing, Funding acquisition.\u003cstrong\u003e\u0026nbsp;Lei Pu:\u0026nbsp;\u003c/strong\u003eWriting-original draft, Project administration, Resources, Supervision, Funding acquisition, Formal analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by Fuyang Normal University scientific research platform open topic(FYKFKT24042), Anhui Natural Science Foundation Project(2208085MC76), the University Synergy Innovation Program of Anhui Province(GXXT-2023-044), Key Projects of Scientific Research Plan of Colleges and Universities of Anhui Province (2023AH050427).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo datasets were generated or analysed during the current study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur research was approved by the Ethics Committee of Tianjin Agricultural University (2022LLSC032), which conforms to the ethical requirements of animal.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLing S, Qiu W, Zhang H, Liang L, Lu D, Chen T, Zhan X, Wang Y, Gu X, Han L. Clinical, biochemical, and genetic analysis of 28 Chinese patients with holocarboxylase synthetase deficiency. Orphanet J Rare Dis. 2023;18(1):48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/S13023-023-02656-Y\u003c/span\u003e\u003cspan address=\"10.1186/S13023-023-02656-Y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOnteru SK, Gorbach DM, Young JM, Garrick DJ, Dekkers JCM, Rothschild MF. Whole Genome Association Studies of Residual Feed Intake and Related Traits in the Pig. PLoS ONE. 2013;8(6):e61756. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0061756\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0061756\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNgoc DD, Tage O, Bjerring SA, Thomas M, Just J, N KH. Genome-wide association and systems genetic analyses of residual feed intake, daily feed consumption, backfat and weight gain in pigs. BMC Genet. 2014;15(1):27. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1471-2156-15-27\u003c/span\u003e\u003cspan address=\"10.1186/1471-2156-15-27\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGond\u0026aacute;š E, Kr\u0026aacute;ľov\u0026aacute; Tranč\u0026iacute;kov\u0026aacute; A, Dibdiakov\u0026aacute; K, Galanda T, Hatok J, Račay P, Dobrota D, Mur\u0026iacute;n R. Immunodetection of Pyruvate Carboxylase Expression in Human Astrocytomas, Glioblastomas, Oligodendrogliomas, and Meningiomas. Neurochem Res. 2023;48(6):1728\u0026ndash;36. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/S11064-023-03856-5\u003c/span\u003e\u003cspan address=\"10.1007/S11064-023-03856-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSiraprapa S, Witchuda S, Polyak SW, Chareeporn A, Sarawut J. Differential growth inhibition, cell cycle arrest and apoptosis of MCF-7 and MDA-MB-231 cells to holocarboxylase synthetase suppression. Biochem Biophys Res Commun. 2022;593:108\u0026ndash;15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/J.BBRC.2022.01.049\u003c/span\u003e\u003cspan address=\"10.1016/J.BBRC.2022.01.049\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYuan F, Wang N, Chen Y, Huang X, Yang Z, Xu Y, You K, Zhang J, Wang G, Zhuang Y, Pan T, Xiong Y, Yu X, Yang F, Li Y. Calcitriol promotes the maturation of hepatocyte-like cells derived from human pluripotent stem cells. J Steroid Biochem Mol Biol. 2021;211:105881. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/J.JSBMB.2021.105881\u003c/span\u003e\u003cspan address=\"10.1016/J.JSBMB.2021.105881\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMahmood V, Suresh M, Saby M, Murphy LJ. Prohibitin attenuates insulin-stimulated glucose and fatty acid oxidation in adipose tissue by inhibition of pyruvate carboxylase. FEBS J. 2006;273(3):568\u0026ndash;76. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1742-4658.2005.05090.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1742-4658.2005.05090.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBoneh A, Baumgartner M, Hayman M, Peters H. Methylcrotonyl-CoA carboxylase (MCC) deficiency associated with severe muscle pain and physical disability in an adult. J Inherit Metab Dis. 2005;28(6):1139\u0026ndash;40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10545-005-0163-1\u003c/span\u003e\u003cspan address=\"10.1007/s10545-005-0163-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCai B, Ma M, Zhang J, Kong S, Zhou Z, Li Z, Abdalla BA, Xu H, Zhang X, Lawal RA, Nie Q. Long noncoding RNA ZFP36L2-AS functions as a metabolic modulator to regulate muscle development. Cell Death Dis. 2022;13(4):389. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41419-022-04772-2\u003c/span\u003e\u003cspan address=\"10.1038/s41419-022-04772-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRubink DS, Winder WW. Effect of phosphorylation by AMP-activated protein kinase on palmitoyl-CoA inhibition of skeletal muscle acetyl-CoA carboxylase. J Appl Physiol (Bethesda Md : 1985). 2005;98(4):1221\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/japplphysiol.00621.2004\u003c/span\u003e\u003cspan address=\"10.1152/japplphysiol.00621.2004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePerry CA, Butterick TA. Biotin. Advances in nutrition (Bethesda, Md.), 2024 15(7), 100251. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.advnut.2024.100251\u003c/span\u003e\u003cspan address=\"10.1016/j.advnut.2024.100251\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKim SW, Lee HJ, Choi N, Kim EK, Ko JM. Dramatic Clinical Improvement With Biotin Mega-Dose Therapy in a Neonate With Holocarboxylase Synthetase Deficiency. Mol Genet Genom Med. 2024;12(8):e70002. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/mgg3.70002\u003c/span\u003e\u003cspan address=\"10.1002/mgg3.70002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSadri M, Wang H, Kuroishi T, Li Y, Zempleni J. Holocarboxylase synthetase knockout is embryonic lethal in mice. PLoS ONE. 2022;17(4):e0265539. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0265539\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0265539\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiaubet L, Guilmineau C, Lefort G, Billon Y, Reigner S, Bailly J, Marty-Gasset N, Gress L, Servien R, Bonnet A, Gilbert H, Vialaneix N, Quesnel H. Plasma 1H-NMR metabolic and amino acid profiles of newborn piglets from two lines divergently selected for residual feed intake. Sci Rep. 2023;13(1):7127. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/S41598-023-34279-5\u003c/span\u003e\u003cspan address=\"10.1038/S41598-023-34279-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePu L, Luo Y, Wen Z, Dai Y, Zheng C, Zhu X, Qin L, Zhang C, Liang H, Zhang J, Guo L, Wang L. GPX2 Gene Affects Feed Efficiency of Pigs by Inhibiting Fat Deposition and Promoting Muscle Development. Animals. 2022;12(24). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ani12243528\u003c/span\u003e\u003cspan address=\"10.3390/ani12243528\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLee W, Han K-H, Kim HT, Choi H, Ham Y, Ban T-W. Prediction of average daily gain of swine based on machine learning. J Intell Fuzzy Syst. 2019;36(2):923\u0026ndash;33. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3233/JIFS-169869\u003c/span\u003e\u003cspan address=\"10.3233/JIFS-169869\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSer\u0026atilde;o NV, Mauch ED, Onteru SK, Rothschild MF, Dekkers JC. M. Genomewide association study for residual feed intake and component traits of feed efficiency in pigs divergently selected for residual feed intake. J Anim Sci. 2016;94:12\u0026ndash;3. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2527/msasas2016-026\u003c/span\u003e\u003cspan address=\"10.2527/msasas2016-026\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang Q, Wu P, Wang K, Chen D, Zhou J, Ma J, Li M, Xiao W, Jiang A, Jiang Y, Bai L, Zhu L, Li X, Tang G. SNPs associated with body weight and backfat thickness in two pig breeds identified by a genome-wide association study. Genomics. 2019;111(6):1583\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ygeno.2018.11.002\u003c/span\u003e\u003cspan address=\"10.1016/j.ygeno.2018.11.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhuang Z, Li S, Ding R, Yang M, Zheng E, Yang H, Gu T, Xu Z, Cai G, Wu Z, Yang J. Meta-analysis of genome-wide association studies for loin muscle area and loin muscle depth in two Duroc pig populations. PLoS ONE. 2019;14(6):e0218263. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0218263\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0218263\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGao K, Han S, Li Z, Luo Z, Lv S, Choe HM, Paek HJ, Quan B, Kang J, Yin X. Analysis of metabolome and transcriptome of longissimus thoracis and subcutaneous adipose tissues reveals the regulatory mechanism of meat quality in MSTN mutant castrated male finishing pigs. Meat Sci. 2023;207:109370\u0026ndash;109370. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.meatsci.2023.109370\u003c/span\u003e\u003cspan address=\"10.1016/j.meatsci.2023.109370\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZi Z, Zhengqun L, Ning L, Shuqin M, Shiyue L, Zhonghao L, Chunhua Z, Yuanming L, Jun Y, Qianjun L. Effects of fermented bamboo powder on growth performance, apparent digestibility, carcass traits, and meat quality in growing-finishing pigs. Livest Sci. 2023;277. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.livsci.2023.105358\u003c/span\u003e\u003cspan address=\"10.1016/j.livsci.2023.105358\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eToshinobu K. Regulation of immunological and inflammatory functions by biotin. Can J Physiol Pharmacol. 2015;93(12):1091\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1139/cjpp-2014-0460\u003c/span\u003e\u003cspan address=\"10.1139/cjpp-2014-0460\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZihong X, Guoying Z, Xiaoli L, Ning Z, Jing Z. Case report of holocarboxylase synthetase deficiency (late-onset) in 2 Chinese patients. Medicine. 2020;99(18):e19964. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/MD.0000000000019964\u003c/span\u003e\u003cspan address=\"10.1097/MD.0000000000019964\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang X, Huang H, Wang Z, Haslam TM, Kunst L, Wang P, Zhao H, L\u0026uuml; S, Ma C. Acetyl-CoA Carboxylase1 Influences ECERIFERUM2 Activity to Mediate the Synthesis of Very-Long-Chain Fatty Acid Past C28. Plant Physiol. 2024;kiae253. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/plphys/kiae253\u003c/span\u003e\u003cspan address=\"10.1093/plphys/kiae253\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBaker CC, Lorenzo G, Lucineh P, Emily T, Cheuk T, Fuller MT. A cell-type-specific multi-protein complex regulates expression of Cyclin B protein in Drosophila male meiotic prophase. bioRxiv: the preprint server for biology. 2023 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/2023.02.16.528869\u003c/span\u003e\u003cspan address=\"10.1101/2023.02.16.528869\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTalapati SR, Nataraj V, Pothuganti M, Gore S, Ramachandra M, Antony T, More SS, Krishnamurthy NR. Structure of cyclin-dependent kinase 2 (CDK2) in complex with the specific and potent inhibitor CVT-313. Acta Crystallogr Sect F: Struct Biology Commun. 2022;76(8):350\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1107/S2053230X20009243\u003c/span\u003e\u003cspan address=\"10.1107/S2053230X20009243\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang W, Liu Y, Jang H, Nussinov R. CDK2 and CDK4: Cell Cycle Functions Evolve Distinct, Catalysis-Competent Conformations, Offering Drug Targets. JACS Au JACS Au. 2024;4(5):1911\u0026ndash;27. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/jacsau.4c00138\u003c/span\u003e\u003cspan address=\"10.1021/jacsau.4c00138\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao S, Wang Q, Zhang X, Ma B, Shi Y, Yin Y, Kong W, Zhang W, Li J, Yang H. MARCH5-mediated downregulation of ACC2 promotes fatty acid oxidation and tumor progression in ovarian cancer. Free Radic Biol Med. 2024;212:464\u0026ndash;76. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.freeradbiomed.2024.01.004\u003c/span\u003e\u003cspan address=\"10.1016/j.freeradbiomed.2024.01.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAnqi L, Xiaotong S, Yuan T, Guibing S, Linsen Z, Hongbao W. Effect of Actin Alpha Cardiac Muscle 1 on the Proliferation and Differentiation of Bovine Myoblasts and Preadipocytes. Animals. 2021;11(12):3468\u0026ndash;3468. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ani11123468\u003c/span\u003e\u003cspan address=\"10.3390/ani11123468\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlbuquerque A, \u0026Oacute;vilo C, N\u0026uacute;\u0026ntilde;ez Y, Ben\u0026iacute;tez R, L\u0026oacute;pez-Garcia A, Garc\u0026iacute;a F, F\u0026eacute;lix MDR, Laranjo M, Charneca R, Martins JM. Transcriptomic Profiling of Skeletal Muscle Reveals Candidate Genes Influencing Muscle Growth and Associated Lipid Composition in Portuguese Local Pig Breeds. Animal. 2021;11(5):1423. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ANI11051423\u003c/span\u003e\u003cspan address=\"10.3390/ANI11051423\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGanassi M, Badodi S, Wanders K, Zammit PS, Hughes SM. Myogenin is an essential regulator of adult myofibre growth and muscle stem cell homeostasis. eLife. 2020;9:e60445. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7554/eLife.60445\u003c/span\u003e\u003cspan address=\"10.7554/eLife.60445\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang B, Guo J, Zhang M, Liu Z, Zhou R, Guo F, Li K, Mu Y. Front Cell Dev Biology. 2021;9:e685593. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/FCELL.2021.685593\u003c/span\u003e\u003cspan address=\"10.3389/FCELL.2021.685593\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Insulin-Degrading Enzyme Regulates the Proliferation and Apoptosis of Porcine Skeletal Muscle Stem Cells via Myostatin/MYOD Pathway [J].\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHan S, Park JS, Lee S, Jeong AL, Oh KS, Ka HI, Choi HJ, Son WC, Lee WY, Oh SJ, Lim JS, Lee MS, Yang Y. CTRP1 protects against diet-induced hyperglycemia by enhancing glycolysis and fatty acid oxidation. J Nutr Biochem. 2016;27:43\u0026ndash;52. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jnutbio.2015.08.018\u003c/span\u003e\u003cspan address=\"10.1016/j.jnutbio.2015.08.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMa L, Zhang CM, Gui Y, Zou TL, Xi SH, Guo XY. Fluoride regulates the differentiation and atrophy through FGF21/ERK signaling pathway in C2C12 cells. Ecotoxicol Environ Saf. 2023;252:114626. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/J.ECOENV.2023.114626\u003c/span\u003e\u003cspan address=\"10.1016/J.ECOENV.2023.114626\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePagliara V, Amodio G, Vestuto V, Franceschelli S, Russo NA, Cirillo V, Mottola G, Remondelli P, Moltedo O. Myogenesis in C2C12 Cells Requires Phosphorylation of ATF6α by p38 MAPK. Biomedicines. 2023;11(5):1457. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/BIOMEDICINES11051457\u003c/span\u003e\u003cspan address=\"10.3390/BIOMEDICINES11051457\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOnderci M, Sahin K, Sahin N, Cikim G, Vijaya J, Kucuk O. Effects of dietary combination of chromium and biotin on growth performance, carcass characteristics, and oxidative stress markers in heat-distressed Japanese quail. Biol Trace Elem Res.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBiol Trace Elem Res. 2005;106(2):165\u0026ndash;76. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1385/BTER:106:2\u003c/span\u003e\u003cspan address=\"10.1385/BTER:106:2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e:165.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKato A, Sakakibara I, Fukushima T, Sugiura K, Fukawa T, Nikawa T, Uchida T. Quantitative Proteome Analysis in Response to Glucose Concentration in C2C12 Myotubes. Appl Sci. 2022;12(3):1553. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/app12031553\u003c/span\u003e\u003cspan address=\"10.3390/app12031553\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi X, Yang X, Shan B, Shi J, Xia D, Wegner J, Zhao R. Meat quality is associated with muscle metabolic status but not contractile myofiber type composition in premature pigs. Meat Sci. 2009;81(1):218\u0026ndash;23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.meatsci.2008.07.022\u003c/span\u003e\u003cspan address=\"10.1016/j.meatsci.2008.07.022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMcCarty MF. In type 1 diabetics, high-dose biotin may compensate for low hepatic insulin exposure, promoting a more normal expression of glycolytic and gluconeogenic enyzymes and thereby aiding glycemic control. Med Hypotheses. 2016;95:45\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.mehy.2016.08.002\u003c/span\u003e\u003cspan address=\"10.1016/j.mehy.2016.08.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTurgut M, Cinar V, Pala R, Tuzcu M, Orhan C, Telceken H, Sahin N, Deeh PBD, Komorowski JR, Sahin K. Biotin and chromium histidinate improve glucose metabolism and proteins expression levels of IRS-1, PPAR-γ, and NF-κB in exercise-trained rats. J Int Soc Sports Nutr. 2018;15(1):45. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12970-018-0249-4\u003c/span\u003e\u003cspan address=\"10.1186/s12970-018-0249-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVilches-Flores A, Tovar AR, Marin-Hernandez A, Rojas-Ochoa A, Fernandez-Mejia C. Biotin increases glucokinase expression via soluble guanylate cyclase/protein kinase G, adenosine triphosphate production and autocrine action of insulin in pancreatic rat islets. J Nutr Biochem. 2010;21(7):606\u0026ndash;12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jnutbio.2009.03.009\u003c/span\u003e\u003cspan address=\"10.1016/j.jnutbio.2009.03.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbu Aqel Y, Alnesf A, Aigha II, Islam Z, Kolatkar PR, Teo A, Abdelalim EM. Glucokinase (GCK) in diabetes: from molecular mechanisms to disease pathogenesis. Cell Mol Biol Lett. 2024;29(1):120. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s11658-024-00640-3\u003c/span\u003e\u003cspan address=\"10.1186/s11658-024-00640-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHoleček M. Why Are Branched-Chain Amino Acids Increased in Starvation and Diabetes? Nutrients. 2020;12(10):3087. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/nu12103087\u003c/span\u003e\u003cspan address=\"10.3390/nu12103087\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHoleček M. The role of skeletal muscle in the pathogenesis of altered concentrations of branched-chain amino acids (valine, leucine, and isoleucine) in liver cirrhosis, diabetes, and other diseases. Physiol Res. 2021;70(3):293\u0026ndash;305. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.33549/physiolres.934648\u003c/span\u003e\u003cspan address=\"10.33549/physiolres.934648\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShimomura Y, Fujii H, Suzuki M, Murakami T, Fujitsuka N, Nakai N. Branched-chain alpha-keto acid dehydrogenase complex in rat skeletal muscle: regulation of the activity and gene expression by nutrition and physical exercise. J Nutr. 1995;125(6 Suppl):S1762\u0026ndash;5. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jn/125.suppl_6.1762S\u003c/span\u003e\u003cspan address=\"10.1093/jn/125.suppl_6.1762S\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"HLCS, biotin, muscle development, fat deposition, MAPK signaling pathway","lastPublishedDoi":"10.21203/rs.3.rs-6835205/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6835205/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eHolocarboxylase synthetase (HLCS) facilitates the binding of biotin to biotin-dependent carboxylase enzymes (ACC, MCC, PC, and PCC) for carboxylation reactions. This research demonstrates a significant association between single nucleotide polymorphisms (SNPs) in the HLCS gene and the lean meat percentage (LEA) and growth characteristics of Duroc pigs. To deepen our understanding of HLCS functionality, we conducted validation experiments using skeletal muscle cell models.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eInterference with HLCS at the cellular level led to a significant increase in the expressions of ACC and PC, resulting in inhibited proliferation and myogenic differentiation of skeletal muscle cells. Biotin, a coenzyme of carboxylase commonly used to address HLCS deficiency, unexpectedly resulted in a notable decrease in HLCS gene expression and a significant inhibition of myogenic muscle differentiation in our experiment. To further investigate the impact of biotin on muscle development, varying concentrations of biotin were added to the mice's base diet. It was observed that the expression of the HLCS gene in muscle tissue decreased, consequently hindering muscle tissue development. Subsequent research revealed that following biotin supplementation, glycolysis and lipid catabolism in skeletal muscle cells and tissues were disrupted. Examination of the relevant signaling pathways indicated abnormal protein expression and phosphorylation in the MAPK and TGFβ signaling pathways upon the addition of biotin.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e\u003cp\u003eThe HLCS gene plays a crucial role in skeletal muscle development in pigs, and biotin has been found to mitigate the hindrance resulting from HLCS deficiency. Conversely, under normal functioning of the HLCS gene, supplementation of biotin can impede muscle development.\u003c/p\u003e","manuscriptTitle":"Study on the Mechanism of HLCS Gene Deficiency and Biotin Compensation Inhibiting Skeletal Muscle Development","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-24 16:43:58","doi":"10.21203/rs.3.rs-6835205/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f53b80e7-9e8d-4d23-81d1-d434f11245c6","owner":[],"postedDate":"July 24th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-12-26T12:53:42+00:00","versionOfRecord":[],"versionCreatedAt":"2025-07-24 16:43:58","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6835205","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6835205","identity":"rs-6835205","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00