Hyperoside regulates iron death-mediated zearalenone poisoning through Nrf2/GPX4 pathway, causing blood- testosterone barrier injury in pigs

Hyperoside regulates iron death-mediated zearalenone poisoning through Nrf2/GPX4 pathway, causing blood- testosterone barrier injury in pigs | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Hyperoside regulates iron death-mediated zearalenone poisoning through Nrf2/GPX4 pathway, causing blood- testosterone barrier injury in pigs shanshan Fei, Yu Yang, Li Yang, Qi Zhang, Mengran Cui, Yiding Liu, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8798293/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Zearalenone (ZEA) is an estrogenic mycotoxin produced by Fusarium, which widely contaminates cereals and threatens animal and human health through the food chain. This study aims to investigate the testicular toxicity of ZEA and the intervention effect of Hyperoside (HYP) in a 30-day-old Luchuan miniature pig model. The results showed that ZEA (3.2 mg/kg diet) exposure significantly decreased serum testosterone level, increased estradiol content, and induced oxidative stress (increased MDA and H 2 O 2 , decreased GSH) and ferroptosis (iron ion accumulation and decreased GPX4/Nrf2 expression) in the testis. It damages the blood-testis barrier (BTB) by destroying tight junction proteins (Occludin, Claudin-11, etc.), leading to reduced numbers of spermatogenic cells and abnormal mitochondrial structure. HYP (2.5 mg/kg body weight) significantly alleviated ZEA-induced oxidative damage, restored GSH level, reduced iron content, and up-regulated Nrf2/GPX4 pathway to inhibit ferroptosis. At the same time, HYP can improve testicular function by repairing the BTB structure and reducing histopathological damage. This study revealed the mechanism by which HYP alleviated ZEA reproductive toxicity by activating antioxidant and ferroptosis pathways, and provided a potential strategy for preventing and treating ZEA pollution. ZEA HYP pig Blood-testis barrier Ferroptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Zearalenone (ZEA), an estrogenic non-steroidal mycotoxin produced by Fusarium fungi, such as Fusarium graminearum, is among the most widely distributed mycotoxins. It is commonly detected in mold-contaminated grains like corn, wheat, barley, oats, and sorghum. When animals consume contaminated feed, it can lead to decreased fecundity and performance, immunosuppression, and other diseases. ZEA can even persist in animal tissues and enter the human body through the food chain, causing poisoning. Mycotoxin contamination in food and feed has become a significant global public health safety issue, posing serious risks to human and animal health. The Food and Agriculture Organization of the United Nations (FAO) estimated that approximately 25% of the world's grain production was contaminated with mycotoxins. The average detection rate of ZEA in grains and other feedstocks ranges from 15% to 75%, but it can be even higher in corn samples(Chen, Yang et al. 2020 ). Mycotoxin contamination in food and feed has become a significant global public health safety issue, posing serious risks to human and animal health. The Food and Agriculture Organization of the United Nations (FAO) estimated that approximately 25% of the world's grain production was contaminated with mycotoxins. The average detection rate of ZEA in grains and other feedstocks ranges from 15% to 75%, but it can be even higher in corn samples(Boeira, Funck et al. 2015 ). Studies have shown that ZEA's chemical structure is similar to that of estrogen and that it possesses estrogenic activity. It competitively binds to estrogen receptors, disrupting the normal function of estrogen signaling pathways. This leads to excessive estrogen secretion, thereby triggering severe reproductive toxicity(Liu, Xu et al. 2023 ). Furthermore, ZEA impairs male reproductive function by reducing sperm quality, increasing spermatogenic cell apoptosis, and hindering spermatogenesis(Li, Zhu et al. 2022 ). Among various livestock, pigs are the most sensitive to ZEA(Yan, Wang et al. 2022 ). The estrogen-like effects of ZEA can induce hyperestrogenemia and reproductive disorders in pigs, such as reduced litter size(Yin, Meng et al. 2015 ). In boars, this may lead to reduced sperm quality, decreased libido, and lowered testosterone levels; in sows, it may impair the immune acquisition capacity of offspring(Bielas, Nizanski et al. 2017). The blood-testis barrier (BTB) is a barrier structure between capillaries and seminiferous tubules, composed of tight junctions (TJs), gap junctions (GJs), anchoring junctions (AJs), and desmosomes. Its integrity is crucial for maintaining the normal microenvironment essential for spermatogenesis. TJs are the largest junctional form within the BTB, formed by tight junction proteins (such as Claudin-11, F11R, occludin, etc.) connecting to the actin cytoskeleton via ZO-1. Claudin-3 and Claudin-11 were highly expressed in the testis. Testosterone regulated Claudin-3 expression, and this protein in turn modulated the transport of small molecules across the Sertoli cell barrier(Liu, Xu et al., 2024). Connexin-43 underwent expression changes during sperm injury, which affected the dynamic properties of the sperm-sperm connection. The cytoplasmic specialized structure (ES) within the anchoring junction was a characteristic ultrastructural feature of this connection, enabling sperm cells to adhere to Sertoli cells, which contained N-cadherin.(Zeng, Yang et al. 2023 ). Exposure to ZEA at specific doses disrupts the process of meiosis, thereby impairing spermatogenesis, reducing sperm motility and concentration, and leading to diminished semen quality. As an estrogen-like compound, ZEA binds to estrogen receptors, causing structural damage to germ cells and the testes(Gao, Zhao et al. 2019 ). Furthermore, spermatogenesis relies on the regular expression of key proteins such as SYCP3 and DDX4. ZEA exposure reduced the expression of SYCP3 and DDX4 proteins in the testis, indicating that ZEA hinders spermatogenesis by disrupting proteins involved in the process, resulting in decreased sperm motility and concentration(Li, Zhu et al. 2022 ). Luteinizing hormone (LH) promotes the synthesis and release of testosterone by Leydig cells. Due to its estrogenic effects, ZEA exposure inhibited pituitary function, thereby attenuating LH's action on Leydig cells and reducing testosterone synthesis. Additionally, studies showed that estradiol binding to follicle-stimulating hormone (FSH) is necessary for the synthesis of N-cadherin, an important component of the BTB. In supporting cells, ZEA disrupts blood-testis barrier function by impairing supporting cell division and cytoskeletal structure through an endoplasmic reticulum stress-autophagy-oxidative pathway(Zheng, Pan et al. 2016 ). Ferroptosis is triggered by increased intracellular iron concentration, which elevates ROS production and impairs their clearance, leading to lethal lipid peroxidation and cell death. Its morphological characteristics include: reduced mitochondrial cristae, increased mitochondrial membrane density, and loss of mitochondrial membrane potential. The Keap1-Nrf2-HO-1 signaling pathway can regulate ferroptosis(Hwang, Liu et al. 2012 ). In the cytoplasm, Nrf2 forms a complex with its negative regulator, Keap1. When cells are stimulated by oxidative stress or other electrophilic agents, modification of the cysteine residues in Keap1 induces a conformational change, thereby reducing the ubiquitination and degradation of Nrf2 (Wu, Wang et al. 2018 ). After translocating to the nucleus, Nrf2 binds to the Antioxidant Response Element (ARE) on target genes, thereby activating their expression. Inhibition of System Xc- and GPx4 can induce ferroptosis; therefore, Xc-system and GPx4 are two of the most critical targets of ferroptosis, and Nrf2 regulates both. Xc-system is a sodium-independent cystine/glutamate antiporter(Figuera-Losada, Thomas et al. 2017 ). As a key negative regulator of lipid peroxidation in vivo, GPx4 converts lipid peroxides into harmless lipoalcohol compounds. This enzyme utilizes reduced glutathione (GSH) as a substrate and protects cells against oxidative stress. Its primary physiological functions include protecting the body from oxidative stress(Puppel, Kapusta et al. 2015 ); facilitating sperm chromosome condensation and maintaining structural stability; protecting mitochondrial ATP from oxidative stress; inhibiting mitochondrial apoptosis(Liu, Li et al. 2022 ). Xc-system, located at the most upstream of the ferroptosis pathway, is responsible for transporting extracellular cystine into cells, where it is rapidly reduced to cystine for GSH synthesis. Through the action of GPx4, GSH can reduce lipid peroxides on the plasma membrane to lipols, thereby protecting cells from ferroptosis. Hyperoside (HYP) is widely found in the fruits and whole plants of natural plants, such as those in the Rosaceae, Hypericaceae, and Ericaceae families. It is a natural flavonoid compound with broad biological effects, including anti-inflammatory, anticancer, antibacterial, antiviral, antidepressant, and organ-protective properties. It can also regulate multiple signaling pathways, metabolic processes, cytokines, and kinases. In tissue distribution experiments, hyperoside was primarily distributed in tissues with high blood flow, with the highest distribution in the kidneys and liver, followed by the testes. Studies found that hyperoside protected hamster fibroblasts from H₂O₂-induced damage by acting as a free radical scavenger or activating antioxidant enzyme activity. Furthermore, hyperoside exerted antioxidant effects in 6-OHDA-induced dopaminergic neurons by activating the Nrf2/HO-1 pathway(Kwon, Lee et al. 2019 ). Materials and methods Main reagents ZEA (C18H22O5, CAS: 17924-92-4, HPLC ≥ 98%) was purchased from Shanghai Stock Solution Biotechnology Co., Ltd. (Shanghai, China). HYP (C21H20O12, CAS:482-26-0, HPLC ≥ 98%) was purchased from Shanghai Stock Solution Biotechnology Co., LTD. (Shanghai, China). Malondialdehyde (MDA) assay kit (A003-1-1), glutathione (GSH) assay kit (A006-1-1), and tissue iron assay kit (A039-2-1) were purchased from Nanjing Jiancheng BioEngineering Co., LTD. Hydrogen peroxide (H 2 O 2 ) detection kit (BC3590) was purchased from Beijing Solaibao Technology Co., LTD. The porcine zearalenone (ZEA) detection kit (EN-Z11963U) was purchased from Shanghai Changdaen Biotechnology Co., LTD. Animal experiments Initially, 24 30-day-old Luchuan miniature pigs were purchased from Qingxi Farm (Haerbin, China). The animals were kept at the Heilongjiang Northeast Agricultural University Animal Hospital Co., Ltd. (License No. SYXK(Hei)2022-021). The minipigs were housed at 28 ± 1℃ and a 12 h light/dark cycle. The experiment was started after 7 days of pre-feeding. Furthermore, this experiment was approved by the Animal Welfare and Ethics Committee of Northeast Agricultural University (No. NEAUEC20220315). After 7 days of pre-feeding, the pigs were randomly and equally divided into four groups: CON, ZEA, HYP, and ZEA/HYP. The ZEA and ZEA/HYP groups were given full-price diets containing 3.2 mg/kg ZEA. The HYP and ZEA/HYP groups were given 2.5 mg/kg B.W. of HYP by gavage every day. The ZEA and HYP were dissolved in dimethyl sulfoxide to form a stock solution, which was then mixed with feed or administered by gavage. The experiment lasted 28 days, and every effort was made to minimize the animals' discomfort and pain; all animals were allowed to drink freely, and none died during the trial. At the end of the experiment, blood was obtained through the anterior vena cava to isolate the serum for subsequent analysis, and then all the test animals were euthanized. The heart, liver, spleen, lungs, kidneys, testis, duodenum, and jejunum were collected and stored at -80℃ for subsequent analysis. Clinical signs and symptoms During the experiment, the pigs' clinical symptoms were observed and photographed. Detection of pig blood routine and serum biochemical indicators On day 28 of the experiment, blood samples were collected from the anterior vena cava of each group, and serum samples were collected after centrifugation. Complete blood count and biochemical parameters were analyzed using fully automated hematology and biochemistry analyzers. Organ coefficient analysis After dissection, the heart, lung, liver, spleen, kidney, and testis were weighed on an electronic analytical balance. The organs were placed on blue glue plates and photographed with a camera from the same height and Angle. Finally, the organ coefficient was calculated using the formula: organ weight (g)/body weight (g) *100%. Detection of zearalenone content in organs We weighed 0.5 g of tissue, added 1 mL of saline and ground it into a homogenate on ice and followed the instructions of the kit. Histopathological changes After necropsy, the heart, liver, spleen, lung, kidney, testis and jejunum were fixed in 10% neutral formalin solution, dehydrated and embedded in alcohol gradient, and then cut into 4 µm sections for hematoxylin-eosin(HE) staining. At the end of staining, images were taken using a light microscope. Testis oxidative stress index detection We weighed 0.1 g of testicular tissue, added 0.9 mL of normal saline, ground it into a homogenate on ice, and determined the contents of MDA, GSH, and H 2 O 2 in the testis according to the instructions of the kit. Transmission electron microscopy The testicular tissue were fixed in glutaraldehyde. Then, they were post-fixed in OsO4, dehydrated and embedded in epoxy resin. Slices of testicular were stained. Images were captured using a transmission electron microscope (HT7650; Hitachi, Japan). Immunohistochemistry The paraffin sections were deparaffinized to water for antigen repair and blocked, incubated for antibodies, dehydrated and sealed after hematoxylin staining, and placed under a microscope for observation. The total iron content in the testis was determined Testicular tissue was weighed 0.1 g, 0.9 mL saline was added, ground into a homogenate and placed on ice, and the total iron content of the testis was determined according to the kit instructions. RNA extraction and quantification The mRNA expression was quantified by reverse transcription-quantitative polymerase chain reaction (RT-PCR). Testicular tissues were lysed with TRIzol to obtain total RNA, which was reverse-transcribed using a reagent kit. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using a CFX96 TOUCH fluorescent quantitative polymerase chain reaction (PCR) instrument (Bio-Rad, Hercules, CA, USA). The fold difference was calculated using the 2 − ΔΔCt method. Western blot Protein samples were grouped and separated on SDS-PAGE gels, then transferred to a PTFE membrane. The membrane was placed in an ice bath and transferred at a constant current of 200 mA. The membrane was blocked with skim milk and incubated overnight at 4℃ with the primary antibody. The next day, the primary antibody was washed off, and the membrane was incubated with the secondary antibody for 1 hour. Images were captured using the Tanon 5200 imaging system to detect protein expression. Statistical Analysis The graphs were plotted using the GraphPad Prism software version 10.0 (GraphPad Software, USA), and the data were analyzed using SPSS software version 26.0. Data are mean ± SD of at least three independent experiments. Multiple groups were analyzed using one-way analysis of variance, followed by Tukey’s post-hoc test. Statistical significance was set at P < 0.05. Results Hyperoside can reduce gross injury induced by zearalenone in pigs During the modeling period, the pigs in the blank control group had normal food intake and water intake, regular movement, a good mental state, normal defecation, and no weight loss. Pigs in the ZEA group presented with vomiting, diarrhea, prepuce edema, corneal edema, reduced water and food intake, chills, curled up, and depression(Fig. 1 A). The pigs in the HYP group were mentally active and showed estrus. The diarrhea in the HYP/ZEA group was significantly less than in the ZEA group; the stools were soft but formed, vomiting frequency was reduced, and no corneal edema was observed. The results of blood routine test showed that the number of white blood cells in HYP group was significantly higher than that in the other three groups ( P < 0.01), the mean red blood cell volume was significantly higher than that in CON group ( P < 0.05), and the mean platelet volume was significantly lower than that in CON group and ZEA group ( P < 0.05). The hemoglobin concentration, hematocrit, and thrombocrit in the ZEA group were significantly higher than those in the CON group ( P < 0.05), and the platelet number was significantly lower than that in the CON group ( P < 0.05). The mean corpuscle hemoglobin content in the CON group was significantly lower than that in the ZEA group and the HYP group ( P < 0.05)(Table 2 ). The results of serum biochemical indexes showed that alkaline phosphatase, uric acid and lactate dehydrogenase in ZEA group were significantly lower than those in CON group ( P < 0.05), total cholesterol was significantly higher than that in CON group ( P < 0.05), alkaline phosphatase in HYP group was significantly lower than that in CON group ( P < 0.05), total bilirubin was significantly higher than that in CON group ( P < 0.05). The level of creatinine in ZEA/HYP group was significantly higher than that in CON group ( P < 0.05), the level of urea in ZEA/HYP group was significantly higher than that in CON group ( P < 0.05), and the level of lactate dehydrogenase in ZEA/ HYp group was significantly lower than that in CON group ( P < 0.05)(Table 3 ). Table 1 Primer sequence Genes Forward primer sequence (5’→ 3’) Reverse primer sequence (5’ → 3’) GAPDH GGCTGTGGGCAAGGTCATCC TCTCCAGGCGGCAGGCATG ZO-1 AGGGAGAGAAGTGCCAGTAGGG TGGTGGGTTTGGTGGGTTGAC Claudin-1 GGCTGGGCTGCTGCTTCTC TTTGGATAGGGCCTTGGTGTTGG Occludin GAGTGCTATCCTGGGTGTGATGG CCTGACGCCTGGGCTGTTG Claudin-11 CGGCTGGATCGGCATCATAGTTAC CTTGCGGCAGGTGGGAATAGTG Claudin-3 CCTGTGGATGAACTGCGTGGTG AGGATGGCGACGACGATGAGG CX43 GGGTGTTAAGGATCGTGTGAAGGG AGCGGAGCAGTTGGTGAGGAG SLC7A11 TCCTAAGGGCGTGCTCCAGAAC GACAAGGCTCCAAACAGTGACAGG FTH1 TGGGTGACCACATTACCAACTTGC CCCAGGGTGTGCTTGTCAAAGAG FTL GCCTTCGTCAACCGCCTGATC ACGCCCTCCAGAGCCACATC TfRc GCTGGAGTGCTGGAGATTTTGGAG GGGCTGGCGGAAACCTTGAAG Vimentin TGAATGACCGCTTCGCCAACTAC GCTCTCGCATCTCCTCCTCGTAG N-cadherin CCTGGGGACATCGGGGACTTC AGCGGTAGAGCCACTGCCTTC SLC3A2 CACCAAGAGCTTCAGCGAGGATAGG GAGACGGCACAGAGGAGGTCAGAA Table 2 Changes of blood routine of pigs caused by hypericin poisoning with zalalenone Project CON ZEA HYP ZEA/HYP P WBC, 10 9 /L 15.09 ± 2.49 b 12.13 ± 5.85 b 25.15 ± 6.04 a 12.10 ± 3.86 b P<0.01 RBC, 10 12 /L 8.38 ± 1.15 9.31 ± 1.01 8.26 ± 0.83 8.86 ± 0.77 0.237 HGB, g/L 115.50 ± 29.58 b 147.17 ± 8.50 a 132.33 ± 14.83 ab 135.67 ± 19.95 ab 0.078 HCT, % 33.08 ± 7.57 b 41.07 ± 2.37 a 38.12 ± 3.95 ab 39.35 ± 4.66 ab 0.065 MCV, fL 39.32 ± 5.96 b 44.37 ± 3.27 ab 46.48 ± 3.51 a 44.37 ± 2.42 ab 0.036 MCH, pg 13.68 ± 2.46 a 15.93 ± 1.22 b 16.03 ± 1.09 b 15.25 ± 1.15 ab 0.065 MCHC, g/L 346.83 ± 16.44 358.83 ± 5.38 345.33 ± 12.61 344.00 ± 11.93 0.169 RDW-SD, fL 54.33 ± 13.25 47.03 ± 5.82 50.38 ± 8.30 51.78 ± 5.76 0.556 PLT, 10 9 /L 408.17 ± 171.37 a 212.33 ± 114.98 b 360.17 ± 180.61 ab 265.33 ± 114.76 ab 0.127 MPV, fL 7.55 ± 0.48 a 7.65 ± 0.75 a 6.82 ± 0.28 b 7.30 ± 0.55 ab 0.064 PDW 14.52 ± 0.43 14.58 ± 0.49 14.57 ± 0.33 14.52 ± 0.15 0.984 PCT, % 0.31 ± 0.13 a 0.16 ± 0.08 b 0.23 ± 0.11 ab 0.19 ± 0.08 ab 0.112 Table 3 Changes of serum biochemical indexes of pigs induced by zearalenone induced by hypericin Project CON ZEA HYP ZEA/HYP P GGT, U/L 91.83 ± 20.08 72.33 ± 11.04 95.00 ± 26.47 84.67 ± 6.38 0.159 ALP, U/L 660.17 ± 253.77 a 384.83 ± 24.29 b 411.83 ± 102.18 b 522.67 ± 78.34 ab 0.013 TBIL, µmol/L 0.33 ± 0.31 b 0.60 ± 0.75 ab 3.57 ± 4.69 a 2.90 ± 0.76 ab 0.072 DBIL, µmol/L 2.15 ± 0.96 1.37 ± 0.49 2.38 ± 1.58 2.28 ± 0.34 0.284 IBIL, µmol/L -1.82 ± 0.95 b -0.77 ± 0.53 ab -0.13 ± 2.46 ab 0.62 ± 0.80 a 0.044 Urea, mmol/L 1.17 ± 0.88 b 1.75 ± 0.77 ab 2.00 ± 0.80 ab 2.70 ± 0.64 a 0.022 Cr, µmol/L 25.67 ± 3.16 ab 23.70 ± 2.00 ab 28.53 ± 7.28 a 22.32 ± 4.47 b 0.146 UA, µmol/L 1.48 ± 0.85 a 0.82 ± 0.31 b 1.18 ± 0.40 ab 1.20 ± 0.19 ab 0.187 TC, mmol/L 1.68 ± 0.36 c 2.17 ± 0.27 b 1.85 ± 0.22 bc 2.56 ± 0.28 a P<0.01 TG, mmol/L 0.35 ± 0.14 0.40 ± 0.13 0.32 ± 0.09 0.45 ± 0.07 0.221 CK, U/L 388.50 ± 142.10 319.83 ± 83.87 410.67 ± 319.44 334.33 ± 100.51 0.809 LDH, U/L 856.00 ± 127.52 a 690.17 ± 66.45 b 769.50 ± 72.00 ab 701.50 ± 42.58 b 0.009 The results of sex hormone detection showed that, compared with the CON group, the ZEA group had significantly decreased testosterone ( P < 0.05), progesterone ( P < 0.01), and estradiol ( P < 0.01). Compared with the ZEA group, the content of testosterone in the ZEA/HYP group was significantly increased ( P < 0.05), and the content of estradiol was significantly decreased ( P < 0.05). The results showed that hyperoside had a therapeutic effect on zearalenone-induced sex hormone disorder in pigs(Fig. 1 B-D). The organ coefficient test results showed that, compared with the CON group, the ZEA group had significantly increased liver and kidney volume and weight, and the organ coefficients were significantly different ( P < 0.01). Compared with the ZEA group, the organ coefficients of the liver and kidney in the ZEA/HYP group were significantly decreased ( P < 0.01), indicating that ZEA could alter the shape and weight of the liver and kidney, and that HYP had a specific therapeutic effect. At the same time, compared with the CON group, the testis in the ZEA group became smaller, with decreased weight and organ coefficient. The testicular coefficient increased after HYP treatment, but the difference was not statistically significant (Fig. 1 H-M). Hyperoside can reduce the content of zearalenone in pig tissues The results of zearalenone content in pig tissues showed that compared with the CON group, the ZEA group had a significant increase in the ZEA content in the above organs ( P < 0.01). Compared with ZEA group, ZEA in testis, liver and kidney of ZEA/HYP group was significantly decreased ( P < 0.01), and ZEA in duodenum was significantly decreased ( P < 0.05)(Fig. 2 ). Hyperoside can reduce the histopathological changes of various organs induced by zearalenone in pigs HE staining showed that, compared with the CON group, the hepatocyte structure in the ZEA group was unclear; hepatocytes were obviously swollen, the cytoplasm was lightly stained, and some were balloon-like. The number of lymphoid nodules and lymphocytes in the spleen increased. In the kidney, the glomeruli were enlarged, the number of cells was increased, and the epithelial cells of the renal tubules (proximal convoluted tubules) were swollen and convex to the lumen. The number of spermatogonia in the seminiferous tubules of the testis was rare; a large number of vacuolated structures could be seen, and the lumen cells were exfoliated. The intestinal epithelial tissue of the jejunum was partially defective, and the space between the epithelial tissue and the lamina propria was enlarged. After HYP treatment, the above pathological changes were significantly relieved(Fig. 3 ). Hyperoside can alleviate zearalenone-induced oxidative stress injury in porcine testis tissue Compared with the CON group, the contents of MDA and H 2 O 2 in the testis tissue of the ZEA group were significantly increased, and the GSH content was significantly decreased ( P < 0.01). Compared with ZEA group, the GSH content in the testis of ZEA/HYP group was significantly increased ( P < 0.05), and the MDA and H 2 O 2 contents were decreased, but the difference was not significant(Fig. 1 E-G). Hyperoside can reduce the blood-testis barrier damage induced by zearalenone in pigs Transmission electron microscopy revealed that, compared with the CON group, the tight junctions in the testis tissue of the ZEA group were unclear, incomplete, and showed a midline break. After HYP treatment, the tight junction structure was clear. These results indicate that ZEA can cause blood-testis barrier damage in pigs, which can be alleviated by HYP (Fig. 4 A). Compared with the CON group, the ZEA group had significantly decreased mRNA and protein expressions of CX43, N-cadherin, Vimentin, Occludin, Claudin-11, and Claudin-1 ( P < 0.01). The mRNA expression of Claudin-3 was significantly decreased ( P < 0.05). Compared with the ZEA group, the ZEA group had significantly decreased protein expression levels of Vimentin, N-cadherin, and CX43 ( P < 0.05), and significantly decreased protein expression levels of Occludin, ZO-1, and Claudin-3 ( P < 0.01). The mRNA expression levels of CX43, N-cadherin, Occludin, Claudin-11, and Claudin-1 in the ZEA/HYP group were significantly increased ( P < 0.05), and the mRNA expression level of Vimentin was extremely significantly increased ( P < 0.01). The protein expression levels of Occludin, ZO-1, N-cadherin, Claudin-3, and CX43 in the testis tissue of the ZEA/HYP group were significantly increased ( P < 0.05). These results indicate that hyperoside can alleviate the blood-testis barrier damage caused by zearalenone poisoning in pigs(Fig. 4 B-J). Hyperoside regulates zearalenone-induced ferroptosis in porcine testis through Nrf2/gpx4 pathway The total iron content in testis tissue of ZEA group was significantly higher than that of CON group ( P < 0.01). Compared with ZEA group, the total iron content in the testis tissue of ZEA/HYP group was significantly decreased ( P < 0.05)(Fig. 5 B). The results of transmission electron microscopy showed that, compared with the CON group, a large number of vacuoles were observed in the testis tissue of the ZEA group, the structure between the cells was evacuated, the morphology of mitochondria was significantly changed, the volume became smaller, the number of mitochondrial cristae was reduced, and the structure was blurred. Normal and damaged mitochondria were observed in the Sertoli cells of the ZEA/HYP group under the transmission electron microscope(Fig. 5 A). Compared with the CON group, the mRNA expression levels of FTL, SLC3A2, and SLC7A11 in testis tissue of the ZEA group decreased significantly ( P < 0.05). The mRNA expression level of FTH1 decreased, and that of TfRC increased, but the difference was not significant. The protein expression of TfRC and 4-HNE in the ZEA group increased, while the protein expression of Nrf2 and GPX4 decreased significantly. Compared with the ZEA group, the mRNA expression of FTL in the testis tissue of the ZEA/HYP group increased significantly ( P < 0.05), the mRNA expression of FTH1, SLC3A2, and SLC7A11 increased, and the mRNA expression of TfRC decreased, but the difference was not significant. The protein expressions of TfRC and 4-HNE in ZEA/HYP group showed a downward trend, while the protein expressions of Nrf2 and GPX4 showed an upward trend(Fig. 5 C-J). Discussion ZEA, an estrogen-like mycotoxin produced by Fusarium, is widely present in mildly contaminated grains such as corn, wheat, and barley(Rai, Das et al. 2020 ). In recent years, the mechanisms of ZEA toxicity and its effects on the animal reproductive system have attracted significant attention. In this study, we investigated the toxic effects of ZEA on porcine testicular tissue and the protective effects of HYP against ZEA-induced oxidative stress, BTB damage, and ferroptosis. The estrogen-like activity of ZEA is a primary mechanism underlying its toxicity(Bai, Deng et al. 2023 ). Through its estrogenic effects, ZEA feedback-inhibited pituitary luteinizing hormone (LH) secretion, thereby impairing Leydig cell testosterone synthesis. An altered serum testosterone/estradiol ratio (< 10) has been confirmed as an important indicator of spermatogenic disorder(Schlegel, 2012 ). The significant decline in testosterone levels not only directly led to reduced sperm concentration but also indirectly compromised BTB integrity, as testosterone is a key hormone regulating the expression of tight junction proteins (such as Claudin-3) in the blood-testis barrier(Liu, Xu et al. 2023 ). Additionally, it can induce programmed cell death through the extrinsic Fas-Fas ligand pathway (Cai, Si et al. 2019 ), exacerbating spermatogenic cell loss. According to research, ZEA increased reactive oxygen species (ROS) generation, decreased antioxidant enzyme activity, and induced oxidative damage and autophagy in piglet Sertoli cells, which have been confirmed as important targets of ZEA(Liu, Xi et al. 2023 ). In this study, ZEA exposure significantly reduced serum testosterone levels in pigs while increasing estradiol content, consistent with ZEA's estrogen-like effects. Furthermore, ZEA aggravated testicular tissue damage by inducing oxidative stress and ferroptosis. Oxidative stress is an important mechanism of ZEA toxicity. ZEA exposure significantly increased the content of malondialdehyde (MDA) and hydrogen peroxide (H₂O₂) in testicular tissue and decreased glutathione (GSH) content, indicating that ZEA induced oxidative damage in testicular tissue. The BTB is a crucial structure for maintaining testicular homeostasis, and its integrity is essential for normal sperm development(Zhao, Chen et al. 2023 ). Studies have shown that oxidative stress and endoplasmic reticulum stress caused by ZEA can directly damage the Sertoli cell cytoskeleton, disrupting the barrier network formed by tight junctions (TJs), gap junctions (GJs), and anchoring junctions (AJs)(Zheng, Pan et al. 2016 ). Furthermore, studies on goat testicular Sertoli cells confirm that ZEA exposure induces extensive cytoplasmic vacuolization and highly dilated endoplasmic reticulum within these cells, impairing blood-testis barrier integrity at the ultrastructural level (Liu, Xu et al. 2023 ). Moreover, ZEA reduces the permeability of immunoglobulin transfer from the mother to the offspring via the placenta and milk, suggesting that its impairment of barrier function may have broader physiological implications, leading to compromised defense mechanisms in offspring. This study found that exposure to ZEA significantly impairs the structural integrity of the blood-testis barrier in porcine testicular tissue, leading to reduced expression of tight junction proteins, including Occludin and Claudin-11, thereby compromising normal blood-testis barrier function. Transmission electron microscopy revealed that the tight junction structure in testicular tissue became blurred or even disrupted after ZEA exposure. However, HYP intervention significantly ameliorated these pathological changes and restored the structural integrity of the BTB, indicating that HYP has a protective effect against ZEA-induced BTB damage. Ferroptosis is an iron-dependent form of cell death triggered by increased intracellular iron concentration and insufficient clearance of reactive oxygen species (ROS), leading to lethal lipid peroxidation(Stockwell, Angeli et al. 2017 ). Research indicates that ZEA may downregulate Nrf2 expression and inhibit the function of its downstream proteins SLC7A11 and GPX4, leading to iron accumulation and lipid peroxidation in mouse testes and inducing ferroptosis in testicular Sertoli cells. Its molecular mechanism involves dysregulation of the Keap1-Nrf2 signaling pathway. Under normal conditions, Nrf2 binds to its inhibitory protein Keap1 in the cytoplasm. When cells experience oxidative stress, Keap1 undergoes a conformational change, leading to Nrf2 stabilization and nuclear translocation, activating the expression of downstream target genes, including SLC7A11 and GPX4(Wu, Wang et al. 2018 ). SLC7A11 is a key subunit for the function of System Xc-, which is responsible for cystine uptake for glutathione (GSH) synthesis; GPX4 utilizes GSH to clear lipid peroxides. Inhibition of this pathway triggers lethal lipid peroxidation. Additionally, **upregulated expression of transferrin receptor 1 (TfR1), a specific indicator of ferroptosis, also confirmed intracellular iron metabolism disorder(Tsai, Xia et al. 2020 ). In this study, ZEA exposure significantly increased iron content in porcine testicular tissue and induced upregulation of ferroptosis-related proteins (such as TfRC and 4-HNE), while suppressing the expression of Nrf2 and GPX4. Nrf2 is a key transcription factor in cellular antioxidant stress, and GPX4 is an important negative regulator of ferroptosis. ZEA exacerbated testicular ferroptosis by inhibiting the Nrf2/GPX4 signaling pathway. However, HYP intervention significantly reduced iron content in testicular tissue and upregulated the expression of Nrf2 and GPX4, indicating that HYP inhibited ZEA-induced ferroptosis by activating the Nrf2/GPX4 signaling pathway. HYP, as a natural flavonoid compound, possesses extensive biological activities, including antioxidant, anti-inflammatory, and anti-apoptotic effects, and is widely found in natural flavonoids of plants such as Rosaceae(Jang. 2022). Studies found that hyperoside further enhanced cellular antioxidant defense and upregulated HO-1 expression via the Keap1-Nrf2-ARE signaling pathway(Xing, Liu et al. 2011 ). Hyperoside could alleviate triptolide-induced oxidative damage in testicular tissue and inhibit apoptosis by activating the Nrf2/ARE signaling pathway, triggering the SIRT1-PGC1α axis, and activating mitochondrial function(Wang, Li et al. 2022 ). HYP inhibited H₂O₂-induced sperm damage and, to some extent, prevented lipid peroxidation of the oxidized sperm membrane, resulting in increased sperm motility, reduced DNA fragmentation, and decreased levels of lipid peroxides (LPO)(Moreira, Pereira et al. 2022 ). In this study, HYP significantly reduced ZEA-induced oxidative damage in testicular tissue, restored GSH levels, and decreased MDA and H₂O₂ content. The results indicate that HYP enhances cellular antioxidant capacity by activating the Nrf2 signaling pathway, thereby alleviating ZEA-induced oxidative stress and ferroptosis. This study demonstrated that ZEA caused severe damage to porcine testicular tissue by inducing oxidative stress, disrupting the blood-testis barrier, and initiating ferroptosis. However, HYP, by activating the Nrf2/GPX4 signaling, significantly alleviated ZEA-induced oxidative stress and iron-dependent apoptosis, and restored the structural integrity of the blood–testis barrier. These findings lay the groundwork for HYP as a potential therapeutic agent against ZEA toxicity and offer new insights for addressing the threat that ZEA contamination poses to animal and human health. Declarations Ethics approval This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of Northeast Agricultural University (Date:20220315 /No: NEAUEC20220315). Competing Interests The authors have no relevant financial or non-financial interests to disclose. Funding This work was supported by the National Natural Science Foundation of China (No. 31702282), the Natural Science Foundation of Heilongjiang Province (No. LH2022C039), and the ‘Academic Backbone’ project of Northeast Agricultural University (No. 20XG32). Sichuan Provincial Key Laboratory of Quality and Innovation Research of Chinese Medicinal Materials (No. Z-2023N-6). Joint research and development of preclinical substitution of veterinary Chinese medicine Huanglian (No. FKHT-202308-0004). Author Contribution Shanshan Fei and Yu Yang: searched the literature and wrote the original manuscript. Yiding Liu: performed the experiments.Li Yang and Qi Zhang: performed the experiments. Guangliang Shi: methodology, financial support, and writing the review. Acknowledgements. We thank the members of the Laboratory of Chinese Veterinary Medicine, College of Veterinary Medicine, Northeast Agricultural University. Data Availability The authors have no conflicts of interest to declare that are relevant to the content of this article. References Chen S, Yang S, Wang M, Chen J, Huang S, Wei Z, Cheng Z, Wang H, Long M, Li P (2020) Curcumin inhibits zearalenone-induced apoptosis and oxidative stress in Leydig cells via modulation of the PTEN/Nrf2/Bip signaling pathway. Food Chem Toxicol 141. https://doi.org/10.1016/j.fct.2020.111385 Boeira SP, Funck VR, Filho B, Del'Fabbro C, de Gomes L, Donato MG, Royes F, Oliveira LF, Jesse MS, C. R., Furian AF (2015) Lycopene protects against acute zearalenone-induced oxidative, endocrine, inflammatory and reproductive damages in male mice. Chemico-Biol Interact 230:50–57. https://doi.org/10.1016/j.cbi.2015.02.003 Liu T, Liu G, Xu Y, Huang Y, Zhang Y, Wu Y, Xu Y (2023) Zearalenone Induces Blood-Testis Barrier Damage through Endoplasmic Reticulum Stress-Mediated Paraptosis of Sertoli Cells in Goats. Int J Mol Sci 25(1):553. https://doi.org/10.3390/ijms25010553 Li Y, Zhu Z, Cui H, Ding K, Zhao Y, Ma X, Adetunji AO, Min L (2022) Effect of Zearalenone-Induced Ferroptosis on Mice Spermatogenesis. Animals: open access J MDPI 12(21):3026. https://doi.org/10.3390/ani12213026 Yan R, Wang H, Zhu J, Wang T, Nepovimova E, Long M, Li P, Kuca K, Wu W (2022) Procyanidins inhibit zearalenone-induced apoptosis and oxidative stress of porcine testis cells through activation of Nrf2 signaling pathway. Food Chem toxicology: Int J published Br Industrial Biol Res Association 165:113061. https://doi.org/10.1016/j.fct.2022.113061 Yin S, Meng Q, Zhang B, Shi B, Shan A, Li Z (2015) Alleviation of zearalenone toxicity by modified halloysite nanotubes in the immune response of swine. Food additives & contaminants. Part A, Chemistry, analysis, control, exposure & risk assessment, 32(1): 87–99. https://doi.org/10.1080/19440049.2014.987700 Bielas W, Niżański W, Nicpoń J, Nicpoń JE, Partyka A, Mordak R, Nowak M, Ciaputa R (2017) Effect of zearalenone on circulating testosterone concentration, testicular and epididymal morphology and epididymal sperm characteristics in wild boars. Theriogenology 102:59–66. https://doi.org/10.1016/j.theriogenology.2017.07.015 Zeng Y, Yang Q, Ouyang Y, Lou Y, Cui H, Deng H, Zhu Y, Geng Y, Ouyang P, Chen L, Zuo Z, Fang J, Guo H (2023) Nickel induces blood-testis barrier damage through ROS-mediated p38 MAPK pathways in mice. Redox Biol 67:102886. https://doi.org/10.1016/j.redox.2023.102886 Gao Y, Zhao Y, Zhang H, Zhang P, Liu J, Feng Y, Men Y, Li L, Shen W, Sun Z, Min L (2019) Pubertal exposure to low doses of zearalenone disrupting spermatogenesis through ERα related genetic and epigenetic pathways. Toxicol Lett 315:31–38. https://doi.org/10.1016/j.toxlet.2019.08.007 Zheng W, Pan S, Wang G, Wang YJ, Liu Q, Gu J, Yuan Y, Liu XZ, Liu ZP, Bian JC (2016) Zearalenone impairs the male reproductive system functions via inducing structural and functional alterations of sertoli cells. Environ Toxicol Pharmacol 42:146–155. https://doi.org/10.1016/j.etap.2016.01.013 Hwang JH, Hwang IS, Liu QH, Woo ER, Lee DG (2012) Medioresinol leads to intracellular ROS accumulation and mitochondria-mediated apoptotic cell death in Candida albicans. Biochimie 94(8):1784–1793. https://doi.org/10.1016/j.biochi.2012.04.010 Wu Z, Wang H, Fang S, Xu C (2018) Roles of endoplasmic reticulum stress and autophagy on H 2 O 2 -induced oxidative stress injury in HepG2 cells. Mol Med Rep 18(5):4163–4174. https://doi.org/10.3892/mmr.2018.9443 Figuera-Losada M, Thomas AG, Stathis M, Stockwell BR, Rojas C, Slusher BS (2017) Development of a primary microglia screening assay and its use to characterize inhibition of system x c - by erastin and its analogs. Biochem Biophys Rep 9:266–272. https://doi.org/10.1016/j.bbrep.2016.12.009 Puppel K, Kapusta A, Kuczyńska B (2015) The etiology of oxidative stress in the various species of animals, a review. J Sci Food Agric 95(11):2179–2184. https://doi.org/10.1002/jsfa.7015 Liu Y, Gong S, Li K, Wu G, Zheng X, Zheng J, Lu X, Zhang L, Li J, Su Z, Liu Y, Xie J, Chen J, Li Y (2022) Coptisine protects against hyperuricemic nephropathy through alleviating inflammation, oxidative stress and mitochondrial apoptosis via PI3K/Akt signaling pathway. Biomed pharmacotherapy = Biomedecine pharmacotherapie 156:113941. https://doi.org/10.1016/j.biopha.2022.113941 Kwon SH, Lee SR, Park YJ, Ra M, Lee Y, Pang C, Kim KH (2019) Suppression of 6-Hydroxydopamine-Induced Oxidative Stress by Hyperoside Via Activation of Nrf2/HO-1 Signaling in Dopaminergic Neurons. Int J Mol Sci 20(23):5832. https://doi.org/10.3390/ijms20235832 Rai A, Das M, Tripathi A (2020) Occurrence and toxicity of a fusarium mycotoxin, zearalenone. Crit Rev Food Sci Nutr 60(16):2710–2729. https://doi.org/10.1080/10408398.2019.1655388 Bai J, Deng S, Zhang X, Dai Z, Ji Y, Zeng S, Ren F, Yang Y, Wu Z (2023) Cinnamaldehyde alleviates zearalenone-induced LS174T cell apoptosis, barrier dysfunction and mucin reduction through JNK/NF-κB signaling pathway. Ecotoxicol Environ Saf 263:115276. https://doi.org/10.1016/j.ecoenv.2023.115276 Schlegel PN (2012) Aromatase inhibitors for male infertility. Fertil Steril 98:1359–1362. https://doi.org/10.1016/j.fertnstert.2012.10.023 Cai G, Si M, Li X, Zou H, Gu J, Yuan Y, Liu X, Liu Z, Bian J (2019) Zearalenone induces apoptosis of rat Sertoli cells through Fas-Fas ligand and mitochondrial pathway. Environ Toxicol 34(4):424–433. https://doi.org/10.1002/tox.22696 Liu X, Xi H, Han S, Zhang H, Hu J (2023) Zearalenone induces oxidative stress and autophagy in goat Sertoli cells. Ecotoxicology and environmental safety. 252:114571. https://doi.org/10.1016/j.ecoenv.2023.114571 Zhao Y, Chen MS, Wang JX, Cui JG, Zhang H, Li XN, Li JL (2023) Connexin-43 is a promising target for lycopene preventing phthalate-induced spermatogenic disorders. Journal Adv Res 49:115–126. https://doi.org/10.1016/j.jare.2022.09.001 Stockwell BR, Angeli F, Bayir JP, Bush H, Conrad AI, Dixon M, Fulda SJ, Gascón S, Hatzios S, Kagan SK, Noel VE, Jiang K, Linkermann X, Murphy A, Overholtzer ME, Oyagi M, Pagnussat A, Park GC, Ran J, Rosenfeld Q, Zhang CS, D. D (2017) Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. Cell 171(2):273–285. https://doi.org/10.1016/j.cell.2017.09.021 Tsai Y, Xia C, Sun Z (2020) The Inhibitory Effect of 6-Gingerol on Ubiquitin-Specific Peptidase 14 Enhances Autophagy-Dependent Ferroptosis and Anti-Tumor in vivo and in vitro. Front Pharmacol 11:598555. https://doi.org/10.3389/fphar.2020.598555 Jang E (2022) Hyperoside as a Potential Natural Product Targeting Oxidative Stress in Liver Diseases. Antioxid (Basel Switzerland) 11(8):1437. https://doi.org/10.3390/antiox11081437 Xing HY, Liu Y, Chen JH, Sun FJ, Shi HQ, Xia PY (2011) Hyperoside attenuates hydrogen peroxide-induced L02 cell damage via MAPK-dependent Keap₁-Nrf₂-ARE signaling pathway. Biochem Biophys Res Commun 410(4):759–765. https://doi.org/10.1016/j.bbrc.2011.06.046 Wang Y, Li J, Gu J, He W, Ma B, Fan H (2022) Hyperoside, a natural flavonoid compound, attenuates Triptolide-induced testicular damage by activating the Keap1-Nrf2 and SIRT1-PGC1α signalling pathway. J Pharm Pharmacol 74(7):985–995. https://doi.org/10.1093/jpp/rgac011 Moreira MV, Pereira SC, Guerra-Carvalho B, Carrageta DF, Pinto S, Barros A, Silva BM, Oliveira PF, Alves MG (2022) Hyperoside Supplementation in Preservation Media Surpasses Vitamin C Protection Against Oxidative Stress-Induced Damages in Human Spermatozoa. Cellular physiology and biochemistry: international journal of experimental cellular physiology, biochemistry, and pharmacology. 56(S1):1–23. https://doi.org/10.33594/000000487 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8798293","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":600055531,"identity":"bbd1415c-5ef4-4870-9472-a839e02888ce","order_by":0,"name":"shanshan Fei","email":"","orcid":"","institution":"Northeast Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"shanshan","middleName":"","lastName":"Fei","suffix":""},{"id":600055532,"identity":"c0cff492-35ca-4126-8efe-c251934e11b1","order_by":1,"name":"Yu Yang","email":"","orcid":"","institution":"Northeast Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Yang","suffix":""},{"id":600055533,"identity":"93630d08-ba79-4b44-bd23-e0bf5aedbf33","order_by":2,"name":"Li Yang","email":"","orcid":"","institution":"Cultivation Base of State Key Laboratory for Ecological Restoration and Ecosystem Management","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Yang","suffix":""},{"id":600055534,"identity":"43eff68f-de77-4a56-87fb-9613f6b34d4b","order_by":3,"name":"Qi Zhang","email":"","orcid":"","institution":"Northeast Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Qi","middleName":"","lastName":"Zhang","suffix":""},{"id":600055535,"identity":"3e2afd42-3e8c-4caa-bff4-976f6a40a0cb","order_by":4,"name":"Mengran Cui","email":"","orcid":"","institution":"Northeast Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Mengran","middleName":"","lastName":"Cui","suffix":""},{"id":600055536,"identity":"6fdba14a-dc4c-49d4-9ecc-de862f627ddd","order_by":5,"name":"Yiding Liu","email":"","orcid":"","institution":"Northeast Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yiding","middleName":"","lastName":"Liu","suffix":""},{"id":600055537,"identity":"51d02e5d-ee6a-4f26-9ecd-1f3f576f58f0","order_by":6,"name":"Guangliang Shi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABG0lEQVRIiWNgGAWjYDACCcYGMM3HDCIroKI8xGhhA2s5Q5QWKM0GIhjbiNAiP7u5+TVPzR27NnbmZw+/zrsjxz8jgfHB2zYGeXMcWgzuHGyz5jn2LLmNmc3cWHbbM2OJGwnMhnPbGAx3NuDQIpHYZszDdjgZ6BczaclthxMbbiSwSfO2MSQYHMDhsBkgLf9AWti/SUvOOVw//0YC+298WhhuJDY/5m07bMfGzGMm+bHhcIIB0BZmfFoMbiS2Mc7tOwxUxlMmzXDssOHGMw+bJeeckzDcgNNh6Y8/vPl22J6f//g2yR81h+Xljicf/PCmzEYep8OAMQKKmsQGIMEMiQ5w5ErgVA9S+AFI2IPV/sCnbhSMglEwCkYsAAB/O1rkt1VoFAAAAABJRU5ErkJggg==","orcid":"","institution":"Northeast Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Guangliang","middleName":"","lastName":"Shi","suffix":""}],"badges":[],"createdAt":"2026-02-05 14:38:38","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8798293/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8798293/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":104064113,"identity":"0d4ec283-73a3-4529-b24d-0de40dd2a4df","added_by":"auto","created_at":"2026-03-06 10:16:40","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":462862,"visible":true,"origin":"","legend":"\u003cp\u003eHyperoside alleviates Zearalenone-induced organ damage and sex hormone changes in pigs. (A): Clinical signs after ZEA poisoning in pigs; (B): Serum testosterone content of pigs; (C): Serum estradiol content of pigs; (D): Progesterone content in pig serum; (E): MDA content in porcine testicular tissue; (F): H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e content in porcine testicular tissue; (G): GSH content in porcine testicular\u003c/p\u003e\n\u003cp\u003etissue; (H): Heart index; (I): Liver index; (J): Spleen index; (K): Lung index; (L): Kidney index; (M): Testis index. Compared with the CON group,* means 0.01 \u0026lt;\u003cem\u003e P\u003c/em\u003e \u0026lt; 0.05 compared with CON group, ** means P \u0026lt; 0.01, # means 0.01 \u0026lt; \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 compared with ZEN group, and ## means \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8798293/v1/0c0c0dd2d0745c243f1d1778.png"},{"id":104064116,"identity":"0ceae744-7d09-4197-8992-2db805be3efb","added_by":"auto","created_at":"2026-03-06 10:16:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":240574,"visible":true,"origin":"","legend":"\u003cp\u003eZEA content in each organ of pigs. (A): Standard curve; (B): ZEA content in pig testis; (C): ZEA content in pig jejunum; (D): ZEA content in pig liver; (E): ZEA content in pig spleen; (F): ZEA content in pig kidney; (G): ZEA content in pig duodenum. Compared with the CON group,* means 0.01 \u0026lt;\u003cem\u003e P\u003c/em\u003e \u0026lt; 0.05 compared with CON group, ** means P \u0026lt; 0.01, # means 0.01 \u0026lt; \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 compared with ZEN group, and ## means \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8798293/v1/62bac8c1aa925b4419acbb6e.png"},{"id":104402912,"identity":"b7f52d30-bc15-48be-994e-2ee89e7bfce6","added_by":"auto","created_at":"2026-03-11 12:16:53","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2503138,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8798293/v1/7863dca2a18442bf375af1a7.png"},{"id":104064118,"identity":"179c32fc-4c53-4899-8e2b-7404b01d82a6","added_by":"auto","created_at":"2026-03-06 10:16:40","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":369401,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8798293/v1/98c1cdb42f190d32d1b0bdd3.png"},{"id":104064115,"identity":"11213ed5-dca4-4d8c-ad1b-f373bc9555cb","added_by":"auto","created_at":"2026-03-06 10:16:40","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1202004,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8798293/v1/8e256e0b86e6a262a1295800.png"},{"id":104402800,"identity":"bc9505b5-bdb2-4e84-8364-1da36ae11e8e","added_by":"auto","created_at":"2026-03-11 12:16:30","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":272891,"visible":true,"origin":"","legend":"\u003cp\u003eHypericin regulates iron death-mediated zearalenone poisoning through Nrf2/GPX4 pathway, causing blood-testosterone barrier injury in pigs\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8798293/v1/69c8d687fb833eee6a4cf0b4.png"},{"id":106725249,"identity":"211ac0c6-e4a4-426e-8986-f0949864c526","added_by":"auto","created_at":"2026-04-12 18:32:03","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6158957,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8798293/v1/0e4784bf-3ae8-46d5-9a2d-634e87a95ee2.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Hyperoside regulates iron death-mediated zearalenone poisoning through Nrf2/GPX4 pathway, causing blood- testosterone barrier injury in pigs","fulltext":[{"header":"Introduction","content":"\u003cp\u003eZearalenone (ZEA), an estrogenic non-steroidal mycotoxin produced by Fusarium fungi, such as Fusarium graminearum, is among the most widely distributed mycotoxins. It is commonly detected in mold-contaminated grains like corn, wheat, barley, oats, and sorghum. When animals consume contaminated feed, it can lead to decreased fecundity and performance, immunosuppression, and other diseases. ZEA can even persist in animal tissues and enter the human body through the food chain, causing poisoning. Mycotoxin contamination in food and feed has become a significant global public health safety issue, posing serious risks to human and animal health. The Food and Agriculture Organization of the United Nations (FAO) estimated that approximately 25% of the world's grain production was contaminated with mycotoxins. The average detection rate of ZEA in grains and other feedstocks ranges from 15% to 75%, but it can be even higher in corn samples(Chen, Yang et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Mycotoxin contamination in food and feed has become a significant global public health safety issue, posing serious risks to human and animal health. The Food and Agriculture Organization of the United Nations (FAO) estimated that approximately 25% of the world's grain production was contaminated with mycotoxins. The average detection rate of ZEA in grains and other feedstocks ranges from 15% to 75%, but it can be even higher in corn samples(Boeira, Funck et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eStudies have shown that ZEA's chemical structure is similar to that of estrogen and that it possesses estrogenic activity. It competitively binds to estrogen receptors, disrupting the normal function of estrogen signaling pathways. This leads to excessive estrogen secretion, thereby triggering severe reproductive toxicity(Liu, Xu et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Furthermore, ZEA impairs male reproductive function by reducing sperm quality, increasing spermatogenic cell apoptosis, and hindering spermatogenesis(Li, Zhu et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Among various livestock, pigs are the most sensitive to ZEA(Yan, Wang et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The estrogen-like effects of ZEA can induce hyperestrogenemia and reproductive disorders in pigs, such as reduced litter size(Yin, Meng et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In boars, this may lead to reduced sperm quality, decreased libido, and lowered testosterone levels; in sows, it may impair the immune acquisition capacity of offspring(Bielas, Nizanski et al. 2017).\u003c/p\u003e \u003cp\u003eThe blood-testis barrier (BTB) is a barrier structure between capillaries and seminiferous tubules, composed of tight junctions (TJs), gap junctions (GJs), anchoring junctions (AJs), and desmosomes. Its integrity is crucial for maintaining the normal microenvironment essential for spermatogenesis. TJs are the largest junctional form within the BTB, formed by tight junction proteins (such as Claudin-11, F11R, occludin, etc.) connecting to the actin cytoskeleton via ZO-1. Claudin-3 and Claudin-11 were highly expressed in the testis. Testosterone regulated Claudin-3 expression, and this protein in turn modulated the transport of small molecules across the Sertoli cell barrier(Liu, Xu et al., 2024). Connexin-43 underwent expression changes during sperm injury, which affected the dynamic properties of the sperm-sperm connection. The cytoplasmic specialized structure (ES) within the anchoring junction was a characteristic ultrastructural feature of this connection, enabling sperm cells to adhere to Sertoli cells, which contained N-cadherin.(Zeng, Yang et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eExposure to ZEA at specific doses disrupts the process of meiosis, thereby impairing spermatogenesis, reducing sperm motility and concentration, and leading to diminished semen quality. As an estrogen-like compound, ZEA binds to estrogen receptors, causing structural damage to germ cells and the testes(Gao, Zhao et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Furthermore, spermatogenesis relies on the regular expression of key proteins such as SYCP3 and DDX4. ZEA exposure reduced the expression of SYCP3 and DDX4 proteins in the testis, indicating that ZEA hinders spermatogenesis by disrupting proteins involved in the process, resulting in decreased sperm motility and concentration(Li, Zhu et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Luteinizing hormone (LH) promotes the synthesis and release of testosterone by Leydig cells. Due to its estrogenic effects, ZEA exposure inhibited pituitary function, thereby attenuating LH's action on Leydig cells and reducing testosterone synthesis. Additionally, studies showed that estradiol binding to follicle-stimulating hormone (FSH) is necessary for the synthesis of N-cadherin, an important component of the BTB. In supporting cells, ZEA disrupts blood-testis barrier function by impairing supporting cell division and cytoskeletal structure through an endoplasmic reticulum stress-autophagy-oxidative pathway(Zheng, Pan et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFerroptosis is triggered by increased intracellular iron concentration, which elevates ROS production and impairs their clearance, leading to lethal lipid peroxidation and cell death. Its morphological characteristics include: reduced mitochondrial cristae, increased mitochondrial membrane density, and loss of mitochondrial membrane potential. The Keap1-Nrf2-HO-1 signaling pathway can regulate ferroptosis(Hwang, Liu et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). In the cytoplasm, Nrf2 forms a complex with its negative regulator, Keap1. When cells are stimulated by oxidative stress or other electrophilic agents, modification of the cysteine residues in Keap1 induces a conformational change, thereby reducing the ubiquitination and degradation of Nrf2 (Wu, Wang et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). After translocating to the nucleus, Nrf2 binds to the Antioxidant Response Element (ARE) on target genes, thereby activating their expression. Inhibition of System Xc- and GPx4 can induce ferroptosis; therefore, Xc-system and GPx4 are two of the most critical targets of ferroptosis, and Nrf2 regulates both. Xc-system is a sodium-independent cystine/glutamate antiporter(Figuera-Losada, Thomas et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). As a key negative regulator of lipid peroxidation in vivo, GPx4 converts lipid peroxides into harmless lipoalcohol compounds. This enzyme utilizes reduced glutathione (GSH) as a substrate and protects cells against oxidative stress. Its primary physiological functions include protecting the body from oxidative stress(Puppel, Kapusta et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2015\u003c/span\u003e); facilitating sperm chromosome condensation and maintaining structural stability; protecting mitochondrial ATP from oxidative stress; inhibiting mitochondrial apoptosis(Liu, Li et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Xc-system, located at the most upstream of the ferroptosis pathway, is responsible for transporting extracellular cystine into cells, where it is rapidly reduced to cystine for GSH synthesis. Through the action of GPx4, GSH can reduce lipid peroxides on the plasma membrane to lipols, thereby protecting cells from ferroptosis.\u003c/p\u003e \u003cp\u003eHyperoside (HYP) is widely found in the fruits and whole plants of natural plants, such as those in the Rosaceae, Hypericaceae, and Ericaceae families. It is a natural flavonoid compound with broad biological effects, including anti-inflammatory, anticancer, antibacterial, antiviral, antidepressant, and organ-protective properties. It can also regulate multiple signaling pathways, metabolic processes, cytokines, and kinases. In tissue distribution experiments, hyperoside was primarily distributed in tissues with high blood flow, with the highest distribution in the kidneys and liver, followed by the testes. Studies found that hyperoside protected hamster fibroblasts from H₂O₂-induced damage by acting as a free radical scavenger or activating antioxidant enzyme activity. Furthermore, hyperoside exerted antioxidant effects in 6-OHDA-induced dopaminergic neurons by activating the Nrf2/HO-1 pathway(Kwon, Lee et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMain reagents\u003c/h2\u003e \u003cp\u003eZEA (C18H22O5, CAS: 17924-92-4, HPLC\u0026thinsp;\u0026ge;\u0026thinsp;98%) was purchased from Shanghai Stock Solution Biotechnology Co., Ltd. (Shanghai, China). HYP (C21H20O12, CAS:482-26-0, HPLC\u0026thinsp;\u0026ge;\u0026thinsp;98%) was purchased from Shanghai Stock Solution Biotechnology Co., LTD. (Shanghai, China). Malondialdehyde (MDA) assay kit (A003-1-1), glutathione (GSH) assay kit (A006-1-1), and tissue iron assay kit (A039-2-1) were purchased from Nanjing Jiancheng BioEngineering Co., LTD. Hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) detection kit (BC3590) was purchased from Beijing Solaibao Technology Co., LTD. The porcine zearalenone (ZEA) detection kit (EN-Z11963U) was purchased from Shanghai Changdaen Biotechnology Co., LTD.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eAnimal experiments\u003c/h3\u003e\n\u003cp\u003eInitially, 24 30-day-old Luchuan miniature pigs were purchased from Qingxi Farm (Haerbin, China). The animals were kept at the Heilongjiang Northeast Agricultural University Animal Hospital Co., Ltd. (License No. SYXK(Hei)2022-021). The minipigs were housed at 28\u0026thinsp;\u0026plusmn;\u0026thinsp;1℃ and a 12 h light/dark cycle. The experiment was started after 7 days of pre-feeding. Furthermore, this experiment was approved by the Animal Welfare and Ethics Committee of Northeast Agricultural University (No. NEAUEC20220315). After 7 days of pre-feeding, the pigs were randomly and equally divided into four groups: CON, ZEA, HYP, and ZEA/HYP. The ZEA and ZEA/HYP groups were given full-price diets containing 3.2 mg/kg ZEA. The HYP and ZEA/HYP groups were given 2.5 mg/kg B.W. of HYP by gavage every day. The ZEA and HYP were dissolved in dimethyl sulfoxide to form a stock solution, which was then mixed with feed or administered by gavage. The experiment lasted 28 days, and every effort was made to minimize the animals' discomfort and pain; all animals were allowed to drink freely, and none died during the trial. At the end of the experiment, blood was obtained through the anterior vena cava to isolate the serum for subsequent analysis, and then all the test animals were euthanized. The heart, liver, spleen, lungs, kidneys, testis, duodenum, and jejunum were collected and stored at -80℃ for subsequent analysis.\u003c/p\u003e\n\u003ch3\u003eClinical signs and symptoms\u003c/h3\u003e\n\u003cp\u003eDuring the experiment, the pigs' clinical symptoms were observed and photographed.\u003c/p\u003e\n\u003ch3\u003eDetection of pig blood routine and serum biochemical indicators\u003c/h3\u003e\n\u003cp\u003eOn day 28 of the experiment, blood samples were collected from the anterior vena cava of each group, and serum samples were collected after centrifugation. Complete blood count and biochemical parameters were analyzed using fully automated hematology and biochemistry analyzers.\u003c/p\u003e\n\u003ch3\u003eOrgan coefficient analysis\u003c/h3\u003e\n\u003cp\u003eAfter dissection, the heart, lung, liver, spleen, kidney, and testis were weighed on an electronic analytical balance. The organs were placed on blue glue plates and photographed with a camera from the same height and Angle. Finally, the organ coefficient was calculated using the formula: organ weight (g)/body weight (g) *100%.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDetection of zearalenone content in organs\u003c/h2\u003e \u003cp\u003eWe weighed 0.5 g of tissue, added 1 mL of saline and ground it into a homogenate on ice and followed the instructions of the kit.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eHistopathological changes\u003c/h3\u003e\n\u003cp\u003eAfter necropsy, the heart, liver, spleen, lung, kidney, testis and jejunum were fixed in 10% neutral formalin solution, dehydrated and embedded in alcohol gradient, and then cut into 4 \u0026micro;m sections for hematoxylin-eosin(HE) staining. At the end of staining, images were taken using a light microscope.\u003c/p\u003e\n\u003ch3\u003eTestis oxidative stress index detection\u003c/h3\u003e\n\u003cp\u003eWe weighed 0.1 g of testicular tissue, added 0.9 mL of normal saline, ground it into a homogenate on ice, and determined the contents of MDA, GSH, and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in the testis according to the instructions of the kit.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eTransmission electron microscopy\u003c/h2\u003e \u003cp\u003eThe testicular tissue were fixed in glutaraldehyde. Then, they were post-fixed in OsO4, dehydrated and embedded in epoxy resin. Slices of testicular were stained. Images were captured using a transmission electron microscope (HT7650; Hitachi, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry\u003c/h2\u003e \u003cp\u003eThe paraffin sections were deparaffinized to water for antigen repair and blocked, incubated for antibodies, dehydrated and sealed after hematoxylin staining, and placed under a microscope for observation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eThe total iron content in the testis was determined\u003c/h2\u003e \u003cp\u003eTesticular tissue was weighed 0.1 g, 0.9 mL saline was added, ground into a homogenate and placed on ice, and the total iron content of the testis was determined according to the kit instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction and quantification\u003c/h2\u003e \u003cp\u003eThe mRNA expression was quantified by reverse transcription-quantitative polymerase chain reaction (RT-PCR). Testicular tissues were lysed with TRIzol to obtain total RNA, which was reverse-transcribed using a reagent kit. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using a CFX96 TOUCH fluorescent quantitative polymerase chain reaction (PCR) instrument (Bio-Rad, Hercules, CA, USA). The fold difference was calculated using the 2\u0026thinsp;\u0026minus;\u0026thinsp;ΔΔCt method.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot\u003c/h2\u003e \u003cp\u003eProtein samples were grouped and separated on SDS-PAGE gels, then transferred to a PTFE membrane. The membrane was placed in an ice bath and transferred at a constant current of 200 mA. The membrane was blocked with skim milk and incubated overnight at 4℃ with the primary antibody. The next day, the primary antibody was washed off, and the membrane was incubated with the secondary antibody for 1 hour. Images were captured using the Tanon 5200 imaging system to detect protein expression.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eThe graphs were plotted using the GraphPad Prism software version 10.0 (GraphPad Software, USA), and the data were analyzed using SPSS software version 26.0. Data are mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD of at least three independent experiments. Multiple groups were analyzed using one-way analysis of variance, followed by Tukey\u0026rsquo;s post-hoc test. Statistical significance was set at \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eHyperoside can reduce gross injury induced by zearalenone in pigs\u003c/h2\u003e \u003cp\u003eDuring the modeling period, the pigs in the blank control group had normal food intake and water intake, regular movement, a good mental state, normal defecation, and no weight loss. Pigs in the ZEA group presented with vomiting, diarrhea, prepuce edema, corneal edema, reduced water and food intake, chills, curled up, and depression(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). The pigs in the HYP group were mentally active and showed estrus. The diarrhea in the HYP/ZEA group was significantly less than in the ZEA group; the stools were soft but formed, vomiting frequency was reduced, and no corneal edema was observed.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe results of blood routine test showed that the number of white blood cells in HYP group was significantly higher than that in the other three groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), the mean red blood cell volume was significantly higher than that in CON group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the mean platelet volume was significantly lower than that in CON group and ZEA group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The hemoglobin concentration, hematocrit, and thrombocrit in the ZEA group were significantly higher than those in the CON group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the platelet number was significantly lower than that in the CON group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The mean corpuscle hemoglobin content in the CON group was significantly lower than that in the ZEA group and the HYP group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05)(Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The results of serum biochemical indexes showed that alkaline phosphatase, uric acid and lactate dehydrogenase in ZEA group were significantly lower than those in CON group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), total cholesterol was significantly higher than that in CON group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), alkaline phosphatase in HYP group was significantly lower than that in CON group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), total bilirubin was significantly higher than that in CON group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The level of creatinine in ZEA/HYP group was significantly higher than that in CON group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), the level of urea in ZEA/HYP group was significantly higher than that in CON group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the level of lactate dehydrogenase in ZEA/ HYp group was significantly lower than that in CON group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05)(Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequence\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer sequence (5\u0026rsquo;\u0026rarr; 3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer sequence (5\u0026rsquo; \u0026rarr; 3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCTGTGGGCAAGGTCATCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTCCAGGCGGCAGGCATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZO-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGGAGAGAAGTGCCAGTAGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGTGGGTTTGGTGGGTTGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eClaudin-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCTGGGCTGCTGCTTCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTGGATAGGGCCTTGGTGTTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOccludin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGTGCTATCCTGGGTGTGATGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTGACGCCTGGGCTGTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eClaudin-11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGCTGGATCGGCATCATAGTTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTGCGGCAGGTGGGAATAGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eClaudin-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTGTGGATGAACTGCGTGGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGATGGCGACGACGATGAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCX43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGTGTTAAGGATCGTGTGAAGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGCGGAGCAGTTGGTGAGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLC7A11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCTAAGGGCGTGCTCCAGAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACAAGGCTCCAAACAGTGACAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFTH1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGGTGACCACATTACCAACTTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCAGGGTGTGCTTGTCAAAGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFTL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCTTCGTCAACCGCCTGATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACGCCCTCCAGAGCCACATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTfRc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTGGAGTGCTGGAGATTTTGGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGCTGGCGGAAACCTTGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVimentin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGAATGACCGCTTCGCCAACTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTCTCGCATCTCCTCCTCGTAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN-cadherin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTGGGGACATCGGGGACTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGCGGTAGAGCCACTGCCTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLC3A2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACCAAGAGCTTCAGCGAGGATAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGACGGCACAGAGGAGGTCAGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eChanges of blood routine of pigs caused by hypericin poisoning with zalalenone\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProject\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCON\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eZEA\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHYP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eZEA/HYP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWBC, 10\u003csup\u003e9\u003c/sup\u003e/L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15.09\u0026thinsp;\u0026plusmn;\u0026thinsp;2.49\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12.13\u0026thinsp;\u0026plusmn;\u0026thinsp;5.85\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e25.15\u0026thinsp;\u0026plusmn;\u0026thinsp;6.04\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e12.10\u0026thinsp;\u0026plusmn;\u0026thinsp;3.86\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eP\u0026lt;0.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRBC, 10\u003csup\u003e12\u003c/sup\u003e/L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8.38\u0026thinsp;\u0026plusmn;\u0026thinsp;1.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9.31\u0026thinsp;\u0026plusmn;\u0026thinsp;1.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.26\u0026thinsp;\u0026plusmn;\u0026thinsp;0.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8.86\u0026thinsp;\u0026plusmn;\u0026thinsp;0.77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.237\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHGB, g/L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e115.50\u0026thinsp;\u0026plusmn;\u0026thinsp;29.58\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e147.17\u0026thinsp;\u0026plusmn;\u0026thinsp;8.50\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e132.33\u0026thinsp;\u0026plusmn;\u0026thinsp;14.83\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e135.67\u0026thinsp;\u0026plusmn;\u0026thinsp;19.95\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.078\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHCT, %\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e33.08\u0026thinsp;\u0026plusmn;\u0026thinsp;7.57\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e41.07\u0026thinsp;\u0026plusmn;\u0026thinsp;2.37\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e38.12\u0026thinsp;\u0026plusmn;\u0026thinsp;3.95\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e39.35\u0026thinsp;\u0026plusmn;\u0026thinsp;4.66\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.065\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMCV, fL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e39.32\u0026thinsp;\u0026plusmn;\u0026thinsp;5.96\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e44.37\u0026thinsp;\u0026plusmn;\u0026thinsp;3.27\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e46.48\u0026thinsp;\u0026plusmn;\u0026thinsp;3.51\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e44.37\u0026thinsp;\u0026plusmn;\u0026thinsp;2.42\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.036\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMCH, pg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e13.68\u0026thinsp;\u0026plusmn;\u0026thinsp;2.46\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15.93\u0026thinsp;\u0026plusmn;\u0026thinsp;1.22\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e16.03\u0026thinsp;\u0026plusmn;\u0026thinsp;1.09\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15.25\u0026thinsp;\u0026plusmn;\u0026thinsp;1.15\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.065\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMCHC, g/L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e346.83\u0026thinsp;\u0026plusmn;\u0026thinsp;16.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e358.83\u0026thinsp;\u0026plusmn;\u0026thinsp;5.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e345.33\u0026thinsp;\u0026plusmn;\u0026thinsp;12.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e344.00\u0026thinsp;\u0026plusmn;\u0026thinsp;11.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.169\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRDW-SD, fL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e54.33\u0026thinsp;\u0026plusmn;\u0026thinsp;13.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e47.03\u0026thinsp;\u0026plusmn;\u0026thinsp;5.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e50.38\u0026thinsp;\u0026plusmn;\u0026thinsp;8.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e51.78\u0026thinsp;\u0026plusmn;\u0026thinsp;5.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.556\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePLT, 10\u003csup\u003e9\u003c/sup\u003e/L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e408.17\u0026thinsp;\u0026plusmn;\u0026thinsp;171.37\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e212.33\u0026thinsp;\u0026plusmn;\u0026thinsp;114.98\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e360.17\u0026thinsp;\u0026plusmn;\u0026thinsp;180.61\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e265.33\u0026thinsp;\u0026plusmn;\u0026thinsp;114.76\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.127\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMPV, fL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.55\u0026thinsp;\u0026plusmn;\u0026thinsp;0.48\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7.65\u0026thinsp;\u0026plusmn;\u0026thinsp;0.75\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.82\u0026thinsp;\u0026plusmn;\u0026thinsp;0.28\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.55\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.064\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePDW\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e14.52\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e14.52\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.984\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCT, %\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.112\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eChanges of serum biochemical indexes of pigs induced by zearalenone induced by hypericin\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProject\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCON\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eZEA\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHYP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eZEA/HYP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGGT, U/L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e91.83\u0026thinsp;\u0026plusmn;\u0026thinsp;20.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e72.33\u0026thinsp;\u0026plusmn;\u0026thinsp;11.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e95.00\u0026thinsp;\u0026plusmn;\u0026thinsp;26.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e84.67\u0026thinsp;\u0026plusmn;\u0026thinsp;6.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.159\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eALP, U/L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e660.17\u0026thinsp;\u0026plusmn;\u0026thinsp;253.77\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e384.83\u0026thinsp;\u0026plusmn;\u0026thinsp;24.29\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e411.83\u0026thinsp;\u0026plusmn;\u0026thinsp;102.18\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e522.67\u0026thinsp;\u0026plusmn;\u0026thinsp;78.34\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.013\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTBIL, \u0026micro;mol/L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.75\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.57\u0026thinsp;\u0026plusmn;\u0026thinsp;4.69\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.76\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.072\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDBIL, \u0026micro;mol/L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.38\u0026thinsp;\u0026plusmn;\u0026thinsp;1.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.284\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIBIL, \u0026micro;mol/L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-1.82\u0026thinsp;\u0026plusmn;\u0026thinsp;0.95\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-0.77\u0026thinsp;\u0026plusmn;\u0026thinsp;0.53\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-0.13\u0026thinsp;\u0026plusmn;\u0026thinsp;2.46\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.80\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.044\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUrea, mmol/L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.88\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.77\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.80\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.70\u0026thinsp;\u0026plusmn;\u0026thinsp;0.64\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.022\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCr, \u0026micro;mol/L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e25.67\u0026thinsp;\u0026plusmn;\u0026thinsp;3.16\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e23.70\u0026thinsp;\u0026plusmn;\u0026thinsp;2.00\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e28.53\u0026thinsp;\u0026plusmn;\u0026thinsp;7.28\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e22.32\u0026thinsp;\u0026plusmn;\u0026thinsp;4.47\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.146\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUA, \u0026micro;mol/L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.85\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.82\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.40\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.187\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTC, mmol/L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.85\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.28\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eP\u0026lt;0.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTG, mmol/L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.221\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCK, U/L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e388.50\u0026thinsp;\u0026plusmn;\u0026thinsp;142.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e319.83\u0026thinsp;\u0026plusmn;\u0026thinsp;83.87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e410.67\u0026thinsp;\u0026plusmn;\u0026thinsp;319.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e334.33\u0026thinsp;\u0026plusmn;\u0026thinsp;100.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.809\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLDH, U/L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e856.00\u0026thinsp;\u0026plusmn;\u0026thinsp;127.52\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e690.17\u0026thinsp;\u0026plusmn;\u0026thinsp;66.45\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e769.50\u0026thinsp;\u0026plusmn;\u0026thinsp;72.00\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e701.50\u0026thinsp;\u0026plusmn;\u0026thinsp;42.58\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.009\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe results of sex hormone detection showed that, compared with the CON group, the ZEA group had significantly decreased testosterone (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), progesterone (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and estradiol (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Compared with the ZEA group, the content of testosterone in the ZEA/HYP group was significantly increased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the content of estradiol was significantly decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The results showed that hyperoside had a therapeutic effect on zearalenone-induced sex hormone disorder in pigs(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-D).\u003c/p\u003e \u003cp\u003eThe organ coefficient test results showed that, compared with the CON group, the ZEA group had significantly increased liver and kidney volume and weight, and the organ coefficients were significantly different (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Compared with the ZEA group, the organ coefficients of the liver and kidney in the ZEA/HYP group were significantly decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), indicating that ZEA could alter the shape and weight of the liver and kidney, and that HYP had a specific therapeutic effect. At the same time, compared with the CON group, the testis in the ZEA group became smaller, with decreased weight and organ coefficient. The testicular coefficient increased after HYP treatment, but the difference was not statistically significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH-M).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eHyperoside can reduce the content of zearalenone in pig tissues\u003c/h2\u003e \u003cp\u003eThe results of zearalenone content in pig tissues showed that compared with the CON group, the ZEA group had a significant increase in the ZEA content in the above organs (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Compared with ZEA group, ZEA in testis, liver and kidney of ZEA/HYP group was significantly decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and ZEA in duodenum was significantly decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05)(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eHyperoside can reduce the histopathological changes of various organs induced by zearalenone in pigs\u003c/h2\u003e \u003cp\u003eHE staining showed that, compared with the CON group, the hepatocyte structure in the ZEA group was unclear; hepatocytes were obviously swollen, the cytoplasm was lightly stained, and some were balloon-like. The number of lymphoid nodules and lymphocytes in the spleen increased. In the kidney, the glomeruli were enlarged, the number of cells was increased, and the epithelial cells of the renal tubules (proximal convoluted tubules) were swollen and convex to the lumen. The number of spermatogonia in the seminiferous tubules of the testis was rare; a large number of vacuolated structures could be seen, and the lumen cells were exfoliated. The intestinal epithelial tissue of the jejunum was partially defective, and the space between the epithelial tissue and the lamina propria was enlarged. After HYP treatment, the above pathological changes were significantly relieved(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eHyperoside can alleviate zearalenone-induced oxidative stress injury in porcine testis tissue\u003c/h2\u003e \u003cp\u003eCompared with the CON group, the contents of MDA and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in the testis tissue of the ZEA group were significantly increased, and the GSH content was significantly decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Compared with ZEA group, the GSH content in the testis of ZEA/HYP group was significantly increased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the MDA and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e contents were decreased, but the difference was not significant(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE-G).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eHyperoside can reduce the blood-testis barrier damage induced by zearalenone in pigs\u003c/h2\u003e \u003cp\u003eTransmission electron microscopy revealed that, compared with the CON group, the tight junctions in the testis tissue of the ZEA group were unclear, incomplete, and showed a midline break. After HYP treatment, the tight junction structure was clear. These results indicate that ZEA can cause blood-testis barrier damage in pigs, which can be alleviated by HYP (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eCompared with the CON group, the ZEA group had significantly decreased mRNA and protein expressions of CX43, N-cadherin, Vimentin, Occludin, Claudin-11, and Claudin-1 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). The mRNA expression of Claudin-3 was significantly decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Compared with the ZEA group, the ZEA group had significantly decreased protein expression levels of Vimentin, N-cadherin, and CX43 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and significantly decreased protein expression levels of Occludin, ZO-1, and Claudin-3 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). The mRNA expression levels of CX43, N-cadherin, Occludin, Claudin-11, and Claudin-1 in the ZEA/HYP group were significantly increased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the mRNA expression level of Vimentin was extremely significantly increased (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.01). The protein expression levels of Occludin, ZO-1, N-cadherin, Claudin-3, and CX43 in the testis tissue of the ZEA/HYP group were significantly increased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These results indicate that hyperoside can alleviate the blood-testis barrier damage caused by zearalenone poisoning in pigs(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB-J).\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eHyperoside regulates zearalenone-induced ferroptosis in porcine testis through Nrf2/gpx4 pathway\u003c/h2\u003e \u003cp\u003eThe total iron content in testis tissue of ZEA group was significantly higher than that of CON group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Compared with ZEA group, the total iron content in the testis tissue of ZEA/HYP group was significantly decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05)(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe results of transmission electron microscopy showed that, compared with the CON group, a large number of vacuoles were observed in the testis tissue of the ZEA group, the structure between the cells was evacuated, the morphology of mitochondria was significantly changed, the volume became smaller, the number of mitochondrial cristae was reduced, and the structure was blurred. Normal and damaged mitochondria were observed in the Sertoli cells of the ZEA/HYP group under the transmission electron microscope(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eCompared with the CON group, the mRNA expression levels of FTL, SLC3A2, and SLC7A11 in testis tissue of the ZEA group decreased significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The mRNA expression level of FTH1 decreased, and that of TfRC increased, but the difference was not significant. The protein expression of TfRC and 4-HNE in the ZEA group increased, while the protein expression of Nrf2 and GPX4 decreased significantly. Compared with the ZEA group, the mRNA expression of FTL in the testis tissue of the ZEA/HYP group increased significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), the mRNA expression of FTH1, SLC3A2, and SLC7A11 increased, and the mRNA expression of TfRC decreased, but the difference was not significant. The protein expressions of TfRC and 4-HNE in ZEA/HYP group showed a downward trend, while the protein expressions of Nrf2 and GPX4 showed an upward trend(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-J).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eZEA, an estrogen-like mycotoxin produced by Fusarium, is widely present in mildly contaminated grains such as corn, wheat, and barley(Rai, Das et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In recent years, the mechanisms of ZEA toxicity and its effects on the animal reproductive system have attracted significant attention. In this study, we investigated the toxic effects of ZEA on porcine testicular tissue and the protective effects of HYP against ZEA-induced oxidative stress, BTB damage, and ferroptosis.\u003c/p\u003e \u003cp\u003eThe estrogen-like activity of ZEA is a primary mechanism underlying its toxicity(Bai, Deng et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Through its estrogenic effects, ZEA feedback-inhibited pituitary luteinizing hormone (LH) secretion, thereby impairing Leydig cell testosterone synthesis. An altered serum testosterone/estradiol ratio (\u0026lt;\u0026thinsp;10) has been confirmed as an important indicator of spermatogenic disorder(Schlegel, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). The significant decline in testosterone levels not only directly led to reduced sperm concentration but also indirectly compromised BTB integrity, as testosterone is a key hormone regulating the expression of tight junction proteins (such as Claudin-3) in the blood-testis barrier(Liu, Xu et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Additionally, it can induce programmed cell death through the extrinsic Fas-Fas ligand pathway (Cai, Si et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), exacerbating spermatogenic cell loss. According to research, ZEA increased reactive oxygen species (ROS) generation, decreased antioxidant enzyme activity, and induced oxidative damage and autophagy in piglet Sertoli cells, which have been confirmed as important targets of ZEA(Liu, Xi et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In this study, ZEA exposure significantly reduced serum testosterone levels in pigs while increasing estradiol content, consistent with ZEA's estrogen-like effects. Furthermore, ZEA aggravated testicular tissue damage by inducing oxidative stress and ferroptosis. Oxidative stress is an important mechanism of ZEA toxicity. ZEA exposure significantly increased the content of malondialdehyde (MDA) and hydrogen peroxide (H₂O₂) in testicular tissue and decreased glutathione (GSH) content, indicating that ZEA induced oxidative damage in testicular tissue.\u003c/p\u003e \u003cp\u003eThe BTB is a crucial structure for maintaining testicular homeostasis, and its integrity is essential for normal sperm development(Zhao, Chen et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Studies have shown that oxidative stress and endoplasmic reticulum stress caused by ZEA can directly damage the Sertoli cell cytoskeleton, disrupting the barrier network formed by tight junctions (TJs), gap junctions (GJs), and anchoring junctions (AJs)(Zheng, Pan et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Furthermore, studies on goat testicular Sertoli cells confirm that ZEA exposure induces extensive cytoplasmic vacuolization and highly dilated endoplasmic reticulum within these cells, impairing blood-testis barrier integrity at the ultrastructural level (Liu, Xu et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Moreover, ZEA reduces the permeability of immunoglobulin transfer from the mother to the offspring via the placenta and milk, suggesting that its impairment of barrier function may have broader physiological implications, leading to compromised defense mechanisms in offspring. This study found that exposure to ZEA significantly impairs the structural integrity of the blood-testis barrier in porcine testicular tissue, leading to reduced expression of tight junction proteins, including Occludin and Claudin-11, thereby compromising normal blood-testis barrier function. Transmission electron microscopy revealed that the tight junction structure in testicular tissue became blurred or even disrupted after ZEA exposure. However, HYP intervention significantly ameliorated these pathological changes and restored the structural integrity of the BTB, indicating that HYP has a protective effect against ZEA-induced BTB damage.\u003c/p\u003e \u003cp\u003eFerroptosis is an iron-dependent form of cell death triggered by increased intracellular iron concentration and insufficient clearance of reactive oxygen species (ROS), leading to lethal lipid peroxidation(Stockwell, Angeli et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Research indicates that ZEA may downregulate Nrf2 expression and inhibit the function of its downstream proteins SLC7A11 and GPX4, leading to iron accumulation and lipid peroxidation in mouse testes and inducing ferroptosis in testicular Sertoli cells. Its molecular mechanism involves dysregulation of the Keap1-Nrf2 signaling pathway. Under normal conditions, Nrf2 binds to its inhibitory protein Keap1 in the cytoplasm. When cells experience oxidative stress, Keap1 undergoes a conformational change, leading to Nrf2 stabilization and nuclear translocation, activating the expression of downstream target genes, including SLC7A11 and GPX4(Wu, Wang et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). SLC7A11 is a key subunit for the function of System Xc-, which is responsible for cystine uptake for glutathione (GSH) synthesis; GPX4 utilizes GSH to clear lipid peroxides. Inhibition of this pathway triggers lethal lipid peroxidation. Additionally, **upregulated expression of transferrin receptor 1 (TfR1), a specific indicator of ferroptosis, also confirmed intracellular iron metabolism disorder(Tsai, Xia et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In this study, ZEA exposure significantly increased iron content in porcine testicular tissue and induced upregulation of ferroptosis-related proteins (such as TfRC and 4-HNE), while suppressing the expression of Nrf2 and GPX4. Nrf2 is a key transcription factor in cellular antioxidant stress, and GPX4 is an important negative regulator of ferroptosis. ZEA exacerbated testicular ferroptosis by inhibiting the Nrf2/GPX4 signaling pathway. However, HYP intervention significantly reduced iron content in testicular tissue and upregulated the expression of Nrf2 and GPX4, indicating that HYP inhibited ZEA-induced ferroptosis by activating the Nrf2/GPX4 signaling pathway.\u003c/p\u003e \u003cp\u003eHYP, as a natural flavonoid compound, possesses extensive biological activities, including antioxidant, anti-inflammatory, and anti-apoptotic effects, and is widely found in natural flavonoids of plants such as Rosaceae(Jang. 2022). Studies found that hyperoside further enhanced cellular antioxidant defense and upregulated HO-1 expression via the Keap1-Nrf2-ARE signaling pathway(Xing, Liu et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Hyperoside could alleviate triptolide-induced oxidative damage in testicular tissue and inhibit apoptosis by activating the Nrf2/ARE signaling pathway, triggering the SIRT1-PGC1α axis, and activating mitochondrial function(Wang, Li et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). HYP inhibited H₂O₂-induced sperm damage and, to some extent, prevented lipid peroxidation of the oxidized sperm membrane, resulting in increased sperm motility, reduced DNA fragmentation, and decreased levels of lipid peroxides (LPO)(Moreira, Pereira et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this study, HYP significantly reduced ZEA-induced oxidative damage in testicular tissue, restored GSH levels, and decreased MDA and H₂O₂ content. The results indicate that HYP enhances cellular antioxidant capacity by activating the Nrf2 signaling pathway, thereby alleviating ZEA-induced oxidative stress and ferroptosis.\u003c/p\u003e \u003cp\u003eThis study demonstrated that ZEA caused severe damage to porcine testicular tissue by inducing oxidative stress, disrupting the blood-testis barrier, and initiating ferroptosis. However, HYP, by activating the Nrf2/GPX4 signaling, significantly alleviated ZEA-induced oxidative stress and iron-dependent apoptosis, and restored the structural integrity of the blood\u0026ndash;testis barrier. These findings lay the groundwork for HYP as a potential therapeutic agent against ZEA toxicity and offer new insights for addressing the threat that ZEA contamination poses to animal and human health.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003cstrong\u003eEthics approval\u003c/strong\u003e \u003cp\u003eThis study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of Northeast Agricultural University (Date:20220315 /No: NEAUEC20220315).\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eCompeting Interests\u003c/strong\u003e \u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by the National Natural Science Foundation of China (No. 31702282), the Natural Science Foundation of Heilongjiang Province (No. LH2022C039), and the \u0026lsquo;Academic Backbone\u0026rsquo; project of Northeast Agricultural University (No. 20XG32). Sichuan Provincial Key Laboratory of Quality and Innovation Research of Chinese Medicinal Materials (No. Z-2023N-6). Joint research and development of preclinical substitution of veterinary Chinese medicine Huanglian (No. FKHT-202308-0004).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eShanshan Fei and Yu Yang: searched the literature and wrote the original manuscript. Yiding Liu: performed the experiments.Li Yang and Qi Zhang: performed the experiments. Guangliang Shi: methodology, financial support, and writing the review.\u003c/p\u003e\u003ch2\u003eAcknowledgements.\u003c/h2\u003e \u003cp\u003eWe thank the members of the Laboratory of Chinese Veterinary Medicine, College of Veterinary Medicine, Northeast Agricultural University.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e \u003cp\u003eThe authors have no conflicts of interest to declare that are relevant to the content of this article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eChen S, Yang S, Wang M, Chen J, Huang S, Wei Z, Cheng Z, Wang H, Long M, Li P (2020) Curcumin inhibits zearalenone-induced apoptosis and oxidative stress in Leydig cells via modulation of the PTEN/Nrf2/Bip signaling pathway. Food Chem Toxicol 141. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fct.2020.111385\u003c/span\u003e\u003cspan address=\"10.1016/j.fct.2020.111385\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoeira SP, Funck VR, Filho B, Del'Fabbro C, de Gomes L, Donato MG, Royes F, Oliveira LF, Jesse MS, C. R., Furian AF (2015) Lycopene protects against acute zearalenone-induced oxidative, endocrine, inflammatory and reproductive damages in male mice. Chemico-Biol Interact 230:50\u0026ndash;57. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cbi.2015.02.003\u003c/span\u003e\u003cspan address=\"10.1016/j.cbi.2015.02.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu T, Liu G, Xu Y, Huang Y, Zhang Y, Wu Y, Xu Y (2023) Zearalenone Induces Blood-Testis Barrier Damage through Endoplasmic Reticulum Stress-Mediated Paraptosis of Sertoli Cells in Goats. Int J Mol Sci 25(1):553. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms25010553\u003c/span\u003e\u003cspan address=\"10.3390/ijms25010553\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Zhu Z, Cui H, Ding K, Zhao Y, Ma X, Adetunji AO, Min L (2022) Effect of Zearalenone-Induced Ferroptosis on Mice Spermatogenesis. Animals: open access J MDPI 12(21):3026. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ani12213026\u003c/span\u003e\u003cspan address=\"10.3390/ani12213026\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan R, Wang H, Zhu J, Wang T, Nepovimova E, Long M, Li P, Kuca K, Wu W (2022) Procyanidins inhibit zearalenone-induced apoptosis and oxidative stress of porcine testis cells through activation of Nrf2 signaling pathway. Food Chem toxicology: Int J published Br Industrial Biol Res Association 165:113061. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fct.2022.113061\u003c/span\u003e\u003cspan address=\"10.1016/j.fct.2022.113061\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin S, Meng Q, Zhang B, Shi B, Shan A, Li Z (2015) Alleviation of zearalenone toxicity by modified halloysite nanotubes in the immune response of swine. Food additives \u0026amp; contaminants. Part A, Chemistry, analysis, control, exposure \u0026amp; risk assessment, 32(1): 87\u0026ndash;99. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/19440049.2014.987700\u003c/span\u003e\u003cspan address=\"10.1080/19440049.2014.987700\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBielas W, Niżański W, Nicpoń J, Nicpoń JE, Partyka A, Mordak R, Nowak M, Ciaputa R (2017) Effect of zearalenone on circulating testosterone concentration, testicular and epididymal morphology and epididymal sperm characteristics in wild boars. Theriogenology 102:59\u0026ndash;66. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.theriogenology.2017.07.015\u003c/span\u003e\u003cspan address=\"10.1016/j.theriogenology.2017.07.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng Y, Yang Q, Ouyang Y, Lou Y, Cui H, Deng H, Zhu Y, Geng Y, Ouyang P, Chen L, Zuo Z, Fang J, Guo H (2023) Nickel induces blood-testis barrier damage through ROS-mediated p38 MAPK pathways in mice. Redox Biol 67:102886. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.redox.2023.102886\u003c/span\u003e\u003cspan address=\"10.1016/j.redox.2023.102886\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao Y, Zhao Y, Zhang H, Zhang P, Liu J, Feng Y, Men Y, Li L, Shen W, Sun Z, Min L (2019) Pubertal exposure to low doses of zearalenone disrupting spermatogenesis through ERα related genetic and epigenetic pathways. Toxicol Lett 315:31\u0026ndash;38. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.toxlet.2019.08.007\u003c/span\u003e\u003cspan address=\"10.1016/j.toxlet.2019.08.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng W, Pan S, Wang G, Wang YJ, Liu Q, Gu J, Yuan Y, Liu XZ, Liu ZP, Bian JC (2016) Zearalenone impairs the male reproductive system functions via inducing structural and functional alterations of sertoli cells. Environ Toxicol Pharmacol 42:146\u0026ndash;155. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.etap.2016.01.013\u003c/span\u003e\u003cspan address=\"10.1016/j.etap.2016.01.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHwang JH, Hwang IS, Liu QH, Woo ER, Lee DG (2012) Medioresinol leads to intracellular ROS accumulation and mitochondria-mediated apoptotic cell death in Candida albicans. Biochimie 94(8):1784\u0026ndash;1793. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biochi.2012.04.010\u003c/span\u003e\u003cspan address=\"10.1016/j.biochi.2012.04.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu Z, Wang H, Fang S, Xu C (2018) Roles of endoplasmic reticulum stress and autophagy on H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e-induced oxidative stress injury in HepG2 cells. Mol Med Rep 18(5):4163\u0026ndash;4174. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3892/mmr.2018.9443\u003c/span\u003e\u003cspan address=\"10.3892/mmr.2018.9443\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFiguera-Losada M, Thomas AG, Stathis M, Stockwell BR, Rojas C, Slusher BS (2017) Development of a primary microglia screening assay and its use to characterize inhibition of system x\u003csub\u003ec\u003c/sub\u003e\u003csup\u003e-\u003c/sup\u003e by erastin and its analogs. Biochem Biophys Rep 9:266\u0026ndash;272. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbrep.2016.12.009\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrep.2016.12.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePuppel K, Kapusta A, Kuczyńska B (2015) The etiology of oxidative stress in the various species of animals, a review. J Sci Food Agric 95(11):2179\u0026ndash;2184. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jsfa.7015\u003c/span\u003e\u003cspan address=\"10.1002/jsfa.7015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Gong S, Li K, Wu G, Zheng X, Zheng J, Lu X, Zhang L, Li J, Su Z, Liu Y, Xie J, Chen J, Li Y (2022) Coptisine protects against hyperuricemic nephropathy through alleviating inflammation, oxidative stress and mitochondrial apoptosis via PI3K/Akt signaling pathway. Biomed pharmacotherapy = Biomedecine pharmacotherapie 156:113941. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biopha.2022.113941\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2022.113941\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKwon SH, Lee SR, Park YJ, Ra M, Lee Y, Pang C, Kim KH (2019) Suppression of 6-Hydroxydopamine-Induced Oxidative Stress by Hyperoside Via Activation of Nrf2/HO-1 Signaling in Dopaminergic Neurons. Int J Mol Sci 20(23):5832. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms20235832\u003c/span\u003e\u003cspan address=\"10.3390/ijms20235832\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRai A, Das M, Tripathi A (2020) Occurrence and toxicity of a fusarium mycotoxin, zearalenone. Crit Rev Food Sci Nutr 60(16):2710\u0026ndash;2729. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/10408398.2019.1655388\u003c/span\u003e\u003cspan address=\"10.1080/10408398.2019.1655388\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBai J, Deng S, Zhang X, Dai Z, Ji Y, Zeng S, Ren F, Yang Y, Wu Z (2023) Cinnamaldehyde alleviates zearalenone-induced LS174T cell apoptosis, barrier dysfunction and mucin reduction through JNK/NF-κB signaling pathway. Ecotoxicol Environ Saf 263:115276. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ecoenv.2023.115276\u003c/span\u003e\u003cspan address=\"10.1016/j.ecoenv.2023.115276\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchlegel PN (2012) Aromatase inhibitors for male infertility. Fertil Steril 98:1359\u0026ndash;1362. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fertnstert.2012.10.023\u003c/span\u003e\u003cspan address=\"10.1016/j.fertnstert.2012.10.023\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai G, Si M, Li X, Zou H, Gu J, Yuan Y, Liu X, Liu Z, Bian J (2019) Zearalenone induces apoptosis of rat Sertoli cells through Fas-Fas ligand and mitochondrial pathway. Environ Toxicol 34(4):424\u0026ndash;433. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/tox.22696\u003c/span\u003e\u003cspan address=\"10.1002/tox.22696\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu X, Xi H, Han S, Zhang H, Hu J (2023) Zearalenone induces oxidative stress and autophagy in goat Sertoli cells. Ecotoxicology and environmental safety. 252:114571. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ecoenv.2023.114571\u003c/span\u003e\u003cspan address=\"10.1016/j.ecoenv.2023.114571\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao Y, Chen MS, Wang JX, Cui JG, Zhang H, Li XN, Li JL (2023) Connexin-43 is a promising target for lycopene preventing phthalate-induced spermatogenic disorders. Journal Adv Res 49:115\u0026ndash;126. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jare.2022.09.001\u003c/span\u003e\u003cspan address=\"10.1016/j.jare.2022.09.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStockwell BR, Angeli F, Bayir JP, Bush H, Conrad AI, Dixon M, Fulda SJ, Gasc\u0026oacute;n S, Hatzios S, Kagan SK, Noel VE, Jiang K, Linkermann X, Murphy A, Overholtzer ME, Oyagi M, Pagnussat A, Park GC, Ran J, Rosenfeld Q, Zhang CS, D. D (2017) Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. Cell 171(2):273\u0026ndash;285. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cell.2017.09.021\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2017.09.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsai Y, Xia C, Sun Z (2020) The Inhibitory Effect of 6-Gingerol on Ubiquitin-Specific Peptidase 14 Enhances Autophagy-Dependent Ferroptosis and Anti-Tumor in vivo and in vitro. Front Pharmacol 11:598555. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphar.2020.598555\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2020.598555\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJang E (2022) Hyperoside as a Potential Natural Product Targeting Oxidative Stress in Liver Diseases. Antioxid (Basel Switzerland) 11(8):1437. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/antiox11081437\u003c/span\u003e\u003cspan address=\"10.3390/antiox11081437\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXing HY, Liu Y, Chen JH, Sun FJ, Shi HQ, Xia PY (2011) Hyperoside attenuates hydrogen peroxide-induced L02 cell damage via MAPK-dependent Keap₁-Nrf₂-ARE signaling pathway. Biochem Biophys Res Commun 410(4):759\u0026ndash;765. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbrc.2011.06.046\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2011.06.046\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Li J, Gu J, He W, Ma B, Fan H (2022) Hyperoside, a natural flavonoid compound, attenuates Triptolide-induced testicular damage by activating the Keap1-Nrf2 and SIRT1-PGC1α signalling pathway. J Pharm Pharmacol 74(7):985\u0026ndash;995. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jpp/rgac011\u003c/span\u003e\u003cspan address=\"10.1093/jpp/rgac011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoreira MV, Pereira SC, Guerra-Carvalho B, Carrageta DF, Pinto S, Barros A, Silva BM, Oliveira PF, Alves MG (2022) Hyperoside Supplementation in Preservation Media Surpasses Vitamin C Protection Against Oxidative Stress-Induced Damages in Human Spermatozoa. Cellular physiology and biochemistry: international journal of experimental cellular physiology, biochemistry, and pharmacology. 56(S1):1\u0026ndash;23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.33594/000000487\u003c/span\u003e\u003cspan address=\"10.33594/000000487\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"ZEA, HYP, pig, Blood-testis barrier, Ferroptosis","lastPublishedDoi":"10.21203/rs.3.rs-8798293/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8798293/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eZearalenone (ZEA) is an estrogenic mycotoxin produced by Fusarium, which widely contaminates cereals and threatens animal and human health through the food chain. This study aims to investigate the testicular toxicity of ZEA and the intervention effect of Hyperoside (HYP) in a 30-day-old Luchuan miniature pig model. The results showed that ZEA (3.2 mg/kg diet) exposure significantly decreased serum testosterone level, increased estradiol content, and induced oxidative stress (increased MDA and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, decreased GSH) and ferroptosis (iron ion accumulation and decreased GPX4/Nrf2 expression) in the testis. It damages the blood-testis barrier (BTB) by destroying tight junction proteins (Occludin, Claudin-11, etc.), leading to reduced numbers of spermatogenic cells and abnormal mitochondrial structure. HYP (2.5 mg/kg body weight) significantly alleviated ZEA-induced oxidative damage, restored GSH level, reduced iron content, and up-regulated Nrf2/GPX4 pathway to inhibit ferroptosis. At the same time, HYP can improve testicular function by repairing the BTB structure and reducing histopathological damage. This study revealed the mechanism by which HYP alleviated ZEA reproductive toxicity by activating antioxidant and ferroptosis pathways, and provided a potential strategy for preventing and treating ZEA pollution.\u003c/p\u003e","manuscriptTitle":"Hyperoside regulates iron death-mediated zearalenone poisoning through Nrf2/GPX4 pathway, causing blood- testosterone barrier injury in pigs","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-06 10:16:35","doi":"10.21203/rs.3.rs-8798293/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4426b3e6-f169-482c-bf26-aef0d5fa1233","owner":[],"postedDate":"March 6th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-04-08T21:09:12+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-06 10:16:35","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8798293","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8798293","identity":"rs-8798293","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}