Tbx1 Heterozygosity in the Oligodendrocyte Lineage Shifts Myelinated Axon Composition in the Mouse Fimbria Without Behavioral Impairments

Tbx1 Heterozygosity in the Oligodendrocyte Lineage Shifts Myelinated Axon Composition in the Mouse Fimbria Without Behavioral Impairments | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Tbx1 Heterozygosity in the Oligodendrocyte Lineage Shifts Myelinated Axon Composition in the Mouse Fimbria Without Behavioral Impairments Anne Marie Wells, Takaki Tanifuji, Takeshi Takano, Arumu Endo, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9327970/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Constitutive heterozygosity of Tbx1 , a T-box transcription factor gene in the 22q11.2 deleted region, produces behavioral deficits and alters myelinated axon composition in the mouse fimbria. However, the cellular origins of these effects—and whether axon changes causally drive behavioral impairments—remain unclear. Prior data link Tbx1 heterozygosity to reduced oligodendrocyte precursor cell (OPC) markers in the fimbria in mice, raising the hypothesis that Tbx1 deficiency specifically in the oligodendrocyte lineage contributes to myelin and behavioral phenotypes. To test this hypothesis, we first showed via in vitro siRNA knockdown that Tbx1 regulates both OPCs and mature oligodendrocytes. We then generated conditional Pdgfrα Cre; Tbx1 +/flox mice to initiate Tbx1 heterozygosity in OPCs. These mice exhibited Cre-mediated recombination in Pdgfrα -expressing brain regions and OPC progeny in the fimbria. At 1 month of age, male mutants displayed enhanced spontaneous alternation in the T-maze relative to wild-type littermates—an effect absent at 2 months. No differences appeared in neonatal ultrasonic vocalizations, social interaction, novel object approach, anxiety-like behavior (elevated plus maze), or open-field locomotion and thigmotaxis. Electron microscopic analysis demonstrated a compositional shift in myelinated axons within the fimbria of adult male mutants: increased numbers in the 300–800 nm diameter range and decreased numbers at ~ 1,200 nm and ~ 1,400 nm, with unchanged myelin thickness across diameters. These results demonstrate that Tbx1 heterozygosity in the oligodendrocyte lineage drives a selective shift toward smaller myelinated axons in the fimbria and a transient cognitive enhancement but does not recapitulate the full myelination abnormalities or the broader cognitive/social deficits observed in constitutive Tbx1 heterozygotes. Thus, Tbx1 function in non-oligodendrocyte lineage cells likely exerts non-cell-autonomous effects on myelination that contribute to neurodevelopmental behavioral impairments. Tbx1 Pdgfrα 22q11.2 CNV social behavior cognition fimbria axon myelination Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Cognitive and social impairments serve as predictors of mental illness( 1 , 2 ). Infants later diagnosed with autism spectrum disorder (ASD) exhibit delays and deviations in various aspects of motor, social, and language development( 3 – 11 ). Similarly, children who later develop full-scale symptoms of schizophrenia show delays in the development of social cognition, working memory, attention, and processing speed( 12 – 16 ), and these deficits remain integral to the disorder following its onset( 17 , 18 ). These dimensional deficits in mental illness have genetic underpinnings. Copy number variations (CNVs)--which are deletions or duplications of up to several million base pairs at specific chromosomal loci encompassing numerous protein-coding genes– present high odds ratios and penetrance rates for cognitive and social deficits( 19 , 20 ) as well as mental illnesses( 21 – 23 ). Individuals carrying 1.5Mb to 3.0Mb hemizygous deletions of human chromosome 22q11.2 exhibit cognitive, social, and emotional impairments from childhood ( 24 – 26 ) and are diagnosed at elevated rates with anxiety disorders, attention-deficit hyperactivity disorder, ASD, intellectual disability, and schizophrenia( 27 , 28 ). Duplication of 22q11.2 is associated with epilepsy, ID, ADHD, and ASD at rates higher than those of non-carriers( 29 – 45 ). However, the mechanisms by which how more than 40 protein-coding genes in 22q11.2 contribute to dimensional deficits and clinical diagnoses remain poorly understood in humans. Several rare inherited cases of variants in the human TBX1 gene, a T-box transcription factor gene located within the 22q11.2 CNV, are associated with ASD, schizophrenia, and intellectual disability in the absence of 22q11.2 CNVs( 46 – 51 ). However, due to their rarity, the statistical reliability of the association between TBX1 variants and mental illness is limited. Moreover, these patients often carry variants in other single genes throughout the genome( 49 ), complicating the establishment of causality from these associations. The deletion or overexpression of small murine chromosomal regions or single genes orthologous to human chromosome 22q11.2 offers a complementary approach ( 1 , 52 – 56 ). Constitutive overexpression of several hundred kilobase pair segments of the mouse ortholog of 22q11.2 recapitulates distinct social and cognitive deficits linked to 22q11.2 duplication( 52 , 57 ), suggesting the presence of driver genes within this segment responsible for distinct behavioral phenotypes. Tbx1 is one of the genes within a 200 kb segment of 22q11.2, overexpression and hemizygous deletion of which result in deficits in social behavior, repetitive behavior, and prepulse inhibition ( 50 , 52 ). The heterozygous deletion of Tbx1 alone results in impairments in neonatal social communication( 58 – 60 ), as well as post-pubertal and adult deficits in social interaction( 58 ), social incentive learning( 61 ), acoustic, but not non-acoustic, prepulse inhibition( 50 , 61 ), spatial memory acquisition in the Morris water maze and the speed to complete simple discrimination and reversal phases of attentional set-shifting, in the absence of non-specific deficits of motor speed ( 62 ). The fimbria of post-pubertal Tbx1 heterozygous mice displays a lack of large myelinated axons, enhanced myelination of medium-sized axons, a compositional shift of myelinated axons to smaller sizes, and a gene expression profile suggestive of defective oligodendrocyte precursor cells( 62 ). Furthermore, the volume of the secondary motor cortex and amygdala, regions involved in the vocal network( 63 ), is reduced in post-pubertal Tbx1 heterozygous mice ( 61 ). Additionally, virally induced overexpression of Tbx1 in the hippocampus negatively impacts the developmental maturation of working memory capacity( 64 ). The cellular and developmental origins of the effects of Tbx1 deficiency on oligodendrocyte precursor cells remain unknown. During the embryonic period, oligodendrocyte precursor cells emerge from embryonic neural progenitor cells in the medial ganglionic eminence of the ventricular zones around E12.5, followed by a second wave from the lateral ganglionic eminence at E15.5. Oligodendrocyte precursor cells continue to be generated from neural progenitor cells in the subventricular zone during the neonatal period ( 65 – 69 ). Single-cell transcriptomic analyses have revealed that Tbx1 is expressed in a more diverse array of cell types than previously indicated by in situ hybridization and immunocytochemical studies. In one analysis, involving 1.13 million cells from whole mouse embryos, Tbx1 was detectable in mesodermal and ectodermal cells from E6.5 to E8.5, in ectodermal cells including those of the neural crest and neural tube at E8.25, in radial glial cells and oligodendrocytes at E10.5, and in neurons and oligodendrocytes at E10.5 and E12.5( 70 ). In the mouse brain, Tbx1 is detectable in cell clusters with signatures indicative of endothelial cells and Neurog2-positive radial glia at E18 and radial glial cells in the neonatal mouse brain( 70 ). Similarly, another single-cell combinatorial indexing (sci)-RNA-seq analysis of approximately 2 million cells from mouse embryos at E9.5 to E13.3 identified Tbx1 in endothelial cells, various types of neurons and their progenitors, neural progenitor cells, neural tube, and oligodendrocyte progenitor cells( 71 ). Given that single-cell transcriptomic analyses are capable of detecting rare or transitional cell types with large numbers of cells, these studies suggest that Tbx1 is present in radial glial cells and neural progenitor cells, as well as their progeny Our previous work demonstrated that Tbx1 heterozygosity initiated in neural progenitor cells during the neonatal period recapitulates some behavioral deficits associated with constitutive Tbx1 heterozygosity( 72 ). As neural progenitor cells during the neonatal period give rise to oligodendrocyte precursor cells, oligodendrocytes, neural progenitor cells, and neurons( 65 – 69 ), we sought to determine whether the effects of Tbx1 heterozygosity within the oligodendrocyte lineage induces behavioral and anatomical phenotypes. Our findings indicate that Tbx1 heterozygosity in the oligodendrocyte lineage induces a compositional shift in myelinated axons in the fimbria, while no affecting myelin integrity, large myelinated axons, or behavior. These results suggest a more critical role for Tbx1 in neurogenesis lineage. Methods Mice All protocols for animal handling and use were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Texas Health Science Center at San Antonio (UTHSCSA) in accordance with National Institutes of Health (NIH) guidelines. Mice were housed in a vivarium with a standard light phase from 7 am to 9 pm). C57BL/6J mice : We used 1- and 2-month-old male C57BL6/J mice (Jax #000664, Jackson Laboratory, Bar Harbor, ME) as stimulus mice for social interaction. Pdgfrα Cre ; Tbx1 +/flox m ice : To conditionally induce Tbx1 heterozygosity in oligodendrocyte precursor cells, we chose a Pdgfrα Cre line that initiates Cre synthesis earlier than a Cspg4 Cre line to better induce recombination in the oligodendrocyte lineage( 73 ). The Pdgfrα- promoter drives Cre-based recombination most robustly in oligodendrocyte precursor cells ( 74 ), but also in astrocytes, neurons, fibroblast-like cells, endothelial cells, vascular and leptomeningeal cells, and pericytes in the mouse brain( 74 – 77 ). We crossed hemizygous Pdgfrα Cre mice with Tbx1 +/flox mice to generate PdgfrαCre;Tbx1 +/flox mice. PdgfrαCre breeder mice (C57BL/6-Tg( Pdgfrα -Cre)1Clc/J; Jax #013148, Jackson Laboratory, Bar Harbor, ME) have a mixed C57BL/6J;C57BL/6N background. We backcrossed non-congenic Tbx1 +/flox mice( 78 ) to C57BL/6J for more than 10 generations and confirmed that there was Cre-dependent recombination in a congenic Tbx1 +/flox mice( 72 ). The genetic background of Pdgfrα Cre and Tbx1 +/flox lines were mixed C57BL/6J;C57BL/6N and C57BL/6J, respectively. These two C57BL/6 substrains have many behavioral differences( 79 ). To avoid the confounding effects of their unequal genetic backgrounds( 80 ), we used only an F1 generation derived from crosses of the Pdgfrα Cre and Tbx1 +/flox lines. Pdgfrα Cre ; ROSA-tdTomato mice : We crossed hemizygous Pdgfrα Cre mice (C57BL/6-Tg( Pdgfrα Cre)1Clc/J; Jax #013148, Jackson Laboratory, Bar Harbor, ME) with homozygous congenic ROSA-CAG-tdTomato mice (B6.Cg- Gt(ROSA)26Sor tm14(CAG−tdTomato)Hze /J, Jax # 007914, Jackson Lab, Bar Harbor, ME) to generate Pdgfrα Cre; ROSA-CAG-tdTomato mice. This ROSA line expresses tdTomato in the hippocampus without the action of Cre ( http://connectivity.brain-map.org/transgenic/experiment/81560256 ) We determined the genotypes of the mice using our previously published protocol with primers shown in Table S1 . The sex of the mice was determined by inspection of their external genitalia. In vitro cell culture of oligodendrocytes Lateral ventricle tissues, including the subventricular zone (SVZ), were obtained from postnatal day 1–2 (P1-2) C57BL/6J pups. Cells were isolated in culture, with each culture derived from a single mouse. The cells were cultured in a medium (DMEM/F12, HEPES [11320–032, Gibco, Grand Island, NY, USA]) supplemented with N2 (17502048, Gibco, Grand Island, NY, USA), B27 (17504044, Gibco, Grand Island, NY, USA), epidermal growth factor (EGF) at a concentration of 20 ng/ml (AF100-15, Peprotech, Cranbury, NJ, USA). After two to four passages, the cells were dissociated from the spheres using StemPro Accutase Cell Dissociation Reagent (A1110501, Gibco, Grand Island, NY, USA). The cells were then divided into equal portions and plated on each Poly-L-ornithine (P4957, Sigma, St. Louis, MO, USA) and Bovine Fibronectin (1030-FN, R&D Systems, Minneapolis, MN, USA)-coated 6well plate (Corning, 351146, Corning, NY, USA,). The cells were cultured for 144 hours in medium with 5% fetal bovine serum after withdrawing EGF from the medium to induce and maintain differentiation. At the time of EGF withdrawal, we applied Tbx1 siRNA (10nM, cat#4390771, s74767, Invitrogen; Thermo Fisher Scientific, Waltham, MA, USA) and control siRNA-A (10nM, cat#4390843, Invitrogen; Thermo Fisher Scientific, Waltham, MA, USA) together with siLentFect™ Lipid Reagent for RNAi, 0.5 ml (BIO-RAD, cat# 1703360, Hercules, CA, USA). Quantitative reverse transcription polymerase chain reaction (qRT-PCR) In accordance with our published procedure( 62 ), total RNA was extracted using an RNeasy Plus Mini Kit (Cat#74134, Qiagen, Germantown, USA). Complementary DNA (cDNA) was synthesized from total RNA using SuperScript IV VILO Master Mix (Cat#11766050, Invitrogen, Carlsbad, USA). qRT-PCR reactions were performed in triplicate on a QuantStudio 6 Flex Real-Time PCR System (Cat#4485694, Applied Biosystems, Waltham, USA) using the TaqMan Fast Advanced Master Mix (Cat#4444963, Applied Biosystems, Waltham, USA). We used TaqMan® Gene Expression Assays (cat# 4331182, Thermo Fisher, Waltham, MA, USA). The Taqman probes are listed in the Supplementary Material ( Table S2 ). Data were analyzed using the ΔΔCt method and normalized to the reference gene Pgk1 ; we had an identical pattern of results with another reference gene 18S . Whole brain tissue clearing and index matching We used the SHIELD and SmartBatch+ (LifeCanvas Sciences, Cambridge, MA) standard pipelines for preserving and electrophoretic clearing( 81 ) to visualize tdTomato in the brains of Pdgfra Cre;ROSA-CAG-tdTomato mice. We performed transcardial perfusion of 1-month old mice with ice-cold 0.9% NaCl in dH 2 O, followed by 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS). Brains were preserved using SHIELD as follows: perfused brains were 1) removed from the cranium and fixed in 4% PFA in PBS overnight at 4°C with gentle shaking; 2) incubated in SHIELD OFF solution (dH 2 O + SHIELD Buffer [cat#SH-Bf] + SHIELD Epoxy Buffer [cat#SH-Ex]) solution at 4°C with gentle shaking for 3 days; 3) incubated in pre-warmed SHIELD ON Buffer (cat#SH-ON) at 37°C for 1 day with gentle shaking; 4) incubated in the delipidation buffer (cat#DB) for 3 days at 45°C with gentle shaking. Final clearing by electrophoresis was performed with the SmartBatch+ device, with the delipidation buffer inside the clearing cup containing the samples and conduction buffer (cat#CB) for 30 h. Cleared brains were index-matched using a solution of 50% EasyIndex (RI = 1.52, cat#EI-500-1.52) + 50% dH 2 O with shaking at 37°C for 1 day, then 100% EasyIndex for one additional day until brains were transparent( 81 ). Light sheet microscopy We used a Zeiss Lightsheet 7 Microscope housed in the UTHSCSA Optical Imaging Core to perform volumetric light sheet imaging of cleared Pdgfrα Cre;ROSA-CAG-tdTomato brains using a pair of 5×/0.1 focusing illumination objectives and a Fluar 2.5×/0.12 detection objective at identical settings. Image tiles were stitched together using Zeiss Zen Blue software (ver 3.4). 3D volume analysis was performed with Imaris (Oxford Instruments, ver 10.02). Peak intensity of the tdTomato signal was segmented, and volumetric measurements (mm 3 ) and peak intensities of the total volume (arbitrary units) were calculated for each volume in each mouse. Immunofluorescence Pdgfrα Cre;ROSA- tdTomato mice were sacrificed at 1 month of age. Mice were deeply anesthetized using 4–5% isoflurane and perfused transcardially with 0.9% saline followed by 4% PFA. Brains were extracted and post-fixed in 4% PFA overnight at 4°C, followed by cryoprotection in glycerol overnight at 4°C. Coronal 60-µm thick sections were cut with a freezing microtome. For immunofluorescence labeling, sections were washed in 0.1 M PBS, blocked with 5% normal donkey serum in PBS, and incubated overnight at room temperature, as we described previously( 62 , 72 ). We used a well-validated primary rabbit antibody against myelin basic protein (1:200, MBP, ab40390, Abcam) and Donkey anti-rabbit IgG-Alexa Fluor 488 (1:200, A21206, Invitrogen), together with a nuclear marker (DAPI,1:25,000, D3571, Invitrogen). MBP is a marker of mature oligodendrocytes( 82 , 83 ). We captured images of sections that were mounted and cover-slipped with Vectashield® anti-fade mounting medium (H-1000) using a Keyence microscope (BZ-X800) microscope with BZX Hardware Module and Zeiss LSM 710 confocal microscope at the UT Health Optical Imaging Core. Double staining of tdTomato with markers of oligodendrocytes We captured a series of coronal brain sections from Pdgfrα Cre; ROSA-tdTomato mice using a Keyence BZ-X800 microscope with BZX Hardware Module and a Zeiss LSM 710 confocal microscope at the UT Health Optical Imaging Core. We used the DAPI signal to identify the anatomical boundaries of landmark structures in each image, cross-matched with equivalent levels in the Allen Brain Atlas (Allen Reference Atlas – Mouse Brain [brain atlas]. Available from atlas.brain-map.org ). We then used a color scale to represent the level of tdTomato intensity within the delineated anatomical boundaries. Behavioral Analysis Male neonatal mice were tested for vocalization resulting from maternal separation at P8 and P12, followed by additional behavioral tests at 1 and 2 months of age, corresponding to peripubertal and post-pubertal, adolescent periods( 84 ), respectively; early signs of puberty begin around 1 month of age( 85 ). Because body weight can alter behavior in mice( 86 ) and Pdgfrα regulates progenitor differentiation into adipocytes( 87 , 88 ), we measured body weight at the beginning of behavioral tests. Our behavioral battery included reciprocal social interaction, novel object approach, spontaneous alternation in a T-maze, elevated plus maze, and locomotor activity and thigmotaxis in an inescapable open field( 52 , 57 – 59 , 64 , 89 – 91 ). The order of the behavioral assays was based on the stress level; tasks that in a home cage-like setting were given first (i.e., social interaction and novel object approach). T-maze and elevated plus maze tests permit choices and are thus considered less stressful than an inescapable open field. At least a one-day interval was provided between behavioral tests to reduce the likelihood of carryover effects( 61 , 62 , 92 ), except for the T-maze, in which three different delays were given on three consecutive days. Mice were assigned randomly to experimental groups and tested during the light phase. Experimenters were blinded to genotypes. Social interaction, novel object approach, and behaviors in the elevated plus maze were recorded using a Basler GigE camera, with video images stored in Ethovision v18 software (Noldus Information Technology, Leesburg, VA). Video images of social interaction and novel object approach were manually scored according to our established criteria. Various parameters of the elevated plus maze were automatically analyzed by Ethovision. The time point of each arm entry was recorded for spontaneous alternation, and the data were subsequently tallied manually. Locomotor activity and thigmotaxis in an inescapable open field were analyzed using Med Associates Activity Monitor 7 Software (Fairfax, VT). Ultrasonic vocalization Pups were tested for vocalization induced by maternal separation at postnatal days 8 and 12. A cage containing the mother and a litter was transferred to the test room 30 min before testing. Ultrasonic vocalization was recorded for 5 min by UltraSoundGate (Avisoft, Germany) connected to a computer equipped with Avisoft-RECORDER software (Avisoft, Germany) in a test chamber (18 cm long × 18 cm wide × 30 cm high). The sampling rate and lower cutoff frequency were set at 250 kHz (format, 16-bit) and 10 kHz, respectively. A frequency window from 15–150 kHz was used for analysis. Call detection was provided by an automatic threshold-based algorithm and a hold-time mechanism (hold time = 10 ms). Sonograms were inspected, and mechanical noises were eliminated from the analysis. We used the VocalMat software, which has the lowest false positive and false negative rates( 93 ), to determine call types. This software typically detects only the most salient components of the harmonic call type and classifies this call type differently. As the harmonic call type is often affected in genetic mouse models of neuropsychiatric disorders( 58 , 59 , 86 , 94 ), we manually inspected all call types and re-classified such cases as harmonic calls. Reciprocal Social Interaction Test A test mouse and an age-matched unfamiliar C57BL/6J mouse as a stimulus subject were simultaneously placed in a cage (28.5 cm long × 17.5 cm wide × 12.5 cm high). Mouse behavior was recorded during two 5-min sessions with a 30-min interval between sessions. Video images were scored manually for affiliative and aggressive social interaction by a rater blinded to genotype. The following reciprocal social behaviors were scored by the duration of interaction (minimum of 1 s): aggressive (tail rattle, bite/kicks, sideway offense, boxing/wrestling), affiliative, non-aggressive (mount, pursuit, olfactory investigation, allogrooming, escape/leap), or passive (side-by-side, submissive). We analyzed the sum of time engaged in affiliative, active, and passive social interactions, but passive behavior was rarely seen in our experimental set-up ( 72 , 86 , 91 , 94 ). Novel Object Approach A test mouse was placed in a cage (28.5 cm long × 17.5 cm wide × 12.5 cm high) with an empty, non-secured 50-mL Falcon tube (3 cm diameter × 8.5 cm long) lying on its side. Video images of mouse interactions with the tube were used to manually score approach behavior by two independent analysts blinded to genotype with an inter-rater reliability of > 99%. Approach behavior was scored for olfactory or non-olfactory investigations with a minimum duration of 1 s. Time spent near the tube was also analyzed. Spontaneous Alternation in a T-Maze A test mouse was placed in the start site of the long arm of a black plexiglass T-maze (21.5 cm long × 10.5 cm wide × 20.5 cm high) and allowed to enter the maze and explore either the left or right short arms (31 cm long × 10.25 cm wide × 20.5 cm high) of the cage. We imposed 0 s, 15 s, or 30 s interval delays to maze reentry for ten trials, and the three interval trials were given on three consecutive days. We manually scored the percentages of alternation and latency to reach the alternated and non-alternated arms. Elevated Plus Maze Test Mice were placed in the center stage (5 × 5 cm) of the maze apparatus with four arms (30 × 5 cm) and permitted to explore two closed arms and two open arms extending from the center platform of the maze for 5 min. The maze was positioned 53 cm above the floor. The time spent in visits and the frequency of visits to the two open and two closed arms were analyzed. Open Field Mice were placed in an open-field cage (27.3 cm × 27.3 cm × 20.2 cm; Med Associates, Fairfax, VT) and permitted to explore the cage for 30 min. We measured the distance and velocity of motor activity and duration of time spent in the center (19.05 cm × 19.05 cm central square) versus the margin of an open field, using the activity monitor software (Med Associates, Fairfax, VT). Electron Microscopy (EM) We prepared tissue for EM to characterize myelination in the fimbria of Pdgfrα Cre; Tbx1 +/flox mice as we described previously( 62 ). After behavioral assays were completed at 1 and 2 months of age, 4–5-month-old male Pdgfrα Cre; Tbx1 +/flox (N = 3) and five control mice, including Pdgfrα Cre; Tbx1 +/+ (N = 2), wild-type (WT); Tbx1 +/flox (N = 2), and WT; Tbx1 +/+ (N = 1), were anesthetized with 4.5% isoflurane in a chamber, and anesthesia was maintained by a nose cone with 2.0% isoflurane. The animals were transcardially perfused with 120 mL of 0.9% saline followed by fixation with 120 mL of 0.1 M buffer (pH 7.4; cat#11653 Electron Microscopy Science, Hatfield, PA) with 2.5% sodium glutaraldehyde (cat#16310, Electron Microscopy Sciences, Hatfield, PA) and 2.5% paraformaldehyde (cat#19202, Electron Microscopy Sciences, Hatfield, PA). Brains were extracted and post-fixed in the same solution at 4°C for 7 weeks. The fimbria from the two hemispheres were obtained separately using a vibratome and placed in 0.1 M sodium cacodylate buffer overnight. Tissues were rinsed with 0.1 M sodium cacodylate buffer to remove aldehydes and placed in 2% osmium tetroxide solution (OsO 4 ; cat#19150, Electron Microscopy Sciences, Hatfield, PA) in 0.1 M sodium cacodylate buffer for 1 h. Tissues were dehydrated in a series of ethanol solutions and embedded in molds containing Polybed resin (Poly/Red® 812 Embedding media, cat#08791 − 500 Polysciences, Inc., Warrington, PA). We cut 100-nm sections and collected them on square 150-mesh copper grids (cat#7551C, Polysciences, Inc., Warrington, PA) and stained them with uranyl acetate (7 g in 100 mL deionized water)/Reynold’s lead citrate (1.33 g lead nitrate,1.76 g sodium citrate in 30 mL triple-distilled water, 8 mL 1 N NaOH). Uranyl acetate stains membranous structures and structures containing nucleic acid; lead citrate binds to RNA-containing structures and the hydroxyl groups of carbohydrates. Each fimbria section was viewed in the EM grid squares. Images were screened at 1,000× magnification. For each section, we used all grid images that contained fimbria tissue with round axons without wrinkles, folds, or tears in the sections. One image was captured at the center of each grid field at 20,000× magnification. Images were analyzed by MyelTracer( 95 ). Only axons whose myelin was fully within the image were analyzed quantitatively. We obtained multiple images for each animal from a section of the right and left hemispheres. The positions of sections sliced from the fimbria varied between the two hemispheres and did not necessarily match the two sides; in one case, only one hemisphere was available because of the accidental loss of a tissue slice. The number of images varied across tissue slices, resulting in unequal image numbers. Many axons from each grid square and many grid squares from each hemisphere were analyzed for each animal. As the number of images and positions of each image varied between the two hemispheres and did not match between the two sides, the hemisphere could not be used as a replicate. Thus, we pooled data for each animal as a technical replicate; data points within and across images were technical replicates. As there was considerable variability in the data, we could not average the values for each animal. The averages of the total axon diameter per genotype were also not appropriate for this data set, as axon numbers differed between genotypes at specific axon diameters (≥ 300 nm to < 400 nm; ≥1,200 nm to < 1300 nm) (genotype × axon diameter range, F(27,5880) = 6.336, P < 1.0 × 10 − 4 ). Thus, linear mixed models were used, as reported previously( 62 ). Data were assessed for the number of myelinated axons, the thickness of myelination, and the g-ratio along a 100 nm unit axon diameter. Data from different images and hemispheres were embedded in random models. Statistical Analysis We used SPSS (v29.0.2.0 ( 20 ), IBM Corporation) to perform all statistical analyses. Among-group and between-group comparisons of the data were performed using analysis of variance (ANOVA) and Student’s two-tailed t-test (α = 0.05). We determined normality and homogeneity of variance using the Shapiro-Wilk test and Levene’s homogeneity of variance test, respectively If either assumption was violated, we analyzed the data using a linear mixed model, Kruskal Wallis tests, or Mann–Whitney U tests. The Greenhouse–Geisser correction was applied if sphericity was violated and the estimated epsilon was less than 0.75. If multiple tests were applied to a data set, the significance level was adjusted using the Benjamini–Hochberg correction, with a false discovery rate of 5%. We used GraphPad Prism software (v9; GraphPad Software, San Diego, CA) to generate all graphs. All statistical analyses are presented in Table S3. Data Availability All data that support the findings and conclusions are provided within the article. All raw data and additional information are available upon request. List of abbreviations CNVs, Copy number variations ASD, Autism Spectrum disorder scRNA-seq, single cell RNA-seq Pdgfra, Platelet-derived growth factor receptor alpha MAG, Myelin associated glycoprotein MOG, Myelin oligodendrocyte glycoprotein, MBP, myelin basic protein Declarations Ethics approval and consent to participate All protocols for animal handling and use were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Texas Health Science Center at San Antonio (UTHSCSA) in accordance with National Institutes of Health (NIH) guidelines. Consent for publication Not applicable Availability of data and materials All data and materials are available upon request. Competing interests The authors declare no competing interests. Funding T. Takano, GK, ME, TH, and NH were supported by the National Institute of Health (R01MH099660; R01DC015776). T. Tanifuji was supported by SENSHIN Medical Research Foundation and Uehara Memorial Foundation. QS and MAB were supported by the National Institute of Health (R01GM063074). AMW was funded by F30MH134482, UT Health San Antonio CTSA T32 (T32R004545), UT Health San Antonio Neuroscience T32 (T32NS082145), STX-MSTP (NIH T32GM113896/T32GM145432), and SfN NSP Fellowship (R25NS089462). The Zeiss Lightsheet 7 microscope was funded by the NIH S10 grant 1S10OD030383. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. Authors’ contributions Anne Marie Wells: Conducted lightsheet brain analysis, perfused mice and applied MyelTracer to images for electron microscopy, genotyping, social interaction assessments, and manuscript writing. Takaki Tanifuji: Performed qRT-PCR analysis, immunofluorescent staining, confocal imaging and analyses, electron microscopy image capturing, and figure preparation. Takeshi Takano: Conducted statistical analyses and prepared all figures except for immunofluorescent images. Arumu Endo: Performed qRT-PCR analysis and figure preparation. Gina Kang: Conducted all behavioral testing. Marisa Esparza: Managed breeder maintenance, ensured quality control of data input, performed statistical analyses, conducted mouse perfusion, and carried out genotyping. Qian Shi: Responsible for electron microscopy preparation and manuscript writing. Manzoor A. Bhat: Engaged in electron microscopy preparation and manuscript writing. Noboru Hiroi: Designed all experiments, supervised all personnel, prepared electron microscopy samples, captured electron microscopy images, performed immunofluorescent staining, and prepared figures for immunofluorescent staining and wrote the manuscript. Acknowledgments The LifeCanvas device was purchased with generous donations by 10 scientists at UT Health San Antonio. We thank Dr. Bernice Morrow for providing Tbx1 +/flox breeders, Ms. Monica D. Alarcon for technical assistance with EM analysis, and Dr. Lacey B. Sell for her help with MyelTracer software. Results Effects of Tbx1 Knockdown on Markers of Oligodendrocyte Lineage In Vitro We first determined the earliest step along the oligodendrocyte lineage at which Tbx1 deficiency has an effect. To this end, we developed an in vitro screening assay that capitalizes on the capacity of neonatal neural progenitor cells, derived from the subventricular zone of C57BL/6J pups sacrificed on postnatal day 2, to generate neuronal precursor cells and oligodendrocyte precursor cells( 69 ). We evaluated the expression of Cspg4 , a marker of oligodendrocyte precursor cells, as well as Mag, Mbp, Mog , and Plp1 , which are markers indicative of maturing and mature myelinating oligodendrocytes ( 65 ), at 144 hours after EGF withdrawal (i.e., differentiation) and Tbx1 siRNA application. Tbx1 siRNA significantly reduced mRNA levels of Tbx1, Cspg4 , and all markers of mature oligodendrocytes, with Pgk1 as (Fig. 1) and 18S ( Table S3-Figure 1 ) as reference genes. These in vitro findings are consistent with our in vivo data indicating that Cspg4 (also known as Ng2 ) was reduced in the fimbria of Tbx1 heterozygous mice( 62 ). As our culture includes both neuronal ( 58 , 72 ) and oligodendrocyte (see Fig. 1 ) lineages, as well as remaining neural progenitor cells, how Tbx1 knockdown induces changes in the expression of myelin marker genes remains unclear. Tbx1 knockdown in oligodendrocyte precursor cells may reduce myelin markers in a cell-autonomous manner; alternatively, reductions in Tbx1 in neonatal neural progenitor cells or their neuronal progeny may indirectly regulate these markers of oligodendrocytes. Localization of Recombination in Pdgfrα-Cre ; ROSA-tdTomato Mice Given our data suggesting that Tbx1 deficiency begins to affect the stage of oligodendrocyte precursor cells (see Fig. 1 ), we initiated Tbx1 heterozygosity in oligodendrocyte precursor cells using a conditional heterozygous mouse model, where Cre-based initiation of Tbx1 heterozygosity is guided by the promoter of Pdgfrα , a gene expressed in oligodendrocyte precursor cells of both embryonic and post-embryonic origins. We first assessed the extent of PdgfrαCre -mediated recombination throughout the brain, employing a tissue clearing technique (SmartBatch+) and conducting lightsheet microscopy to visualize the 3D volume of tdTomato signals in the brains of PdgfrαCre;ROSA-tdTomato mice (Fig. 2 A ). The highest levels of tdTomato expression were observed in a pair of arch-shaped structures located along the lateral and third ventricles. Additionally, clusters of tdTomato signals were detected on the ventral surface of the posterior brain, while lower levels of signals were seen throughout other regions. To identify brain regions with tdTomato signals in PdgfrαCre;ROSA-tdTomato mice, we analyzed a series of coronal sections from 1-month-old PdgfrαCre;ROSA-tdTomato mice. High levels of tdTomato signals were present in the striatum, superficial layers of the neocortex (Fig. 2 BC ), choroid plexus within the lateral ventricle (Fig. 2 ED ) and the fimbria (Fig. 2 F ). This expression pattern, driven by the Pdgfrα promoter, is consistent with previously reported distributions of Pdgfrα mRNA and protein, as well as recombination activity associated with the Pdgfrα promoter in the mouse brain ( 96 – 98 ). Moreover, the most intense staining of the choroid plexus is consistent with the intensely tdTomato+ structures resembling the shapes of the lateral and third ventricles (see Fig. 2A ). Embryonic Pdgfra-positive cells give rise to distinct pre-oligodendrocyte precursor cells by the perinatal period, but they exhibit similar profiles by postnatal and adult periods( 65 , 99 ). PdgfraCre is expected to induce recombination in oligodendrocyte precursor cells( 74 ). Once tdTomato is expressed through recombination in the PdgfraCre;ROSA-tdTomato mouse line, it remains expressed in their progeny, such as mature oligodendrocytes and myelinated fibers. As myelination of the fimbria is selectively affected in constitutive Tbx1 heterozygous mice( 62 ), we examined whether tdTomato was colocalized with MBP, a marker of mature oligodendrocytes and myelinated fibers, in the fimbria( 100 ). MBP-positive fibers were present throughout the fimbria (Fig. 3 AB ). TdTomato signals were more prominent laterally than medially (Fig. 3 C ) and was colocalized with MBP-positive fibers (Fig. 3 D ) in the fimbria. These data establish that tdTomato triggered by PdgfraCre in PdgfraCre;ROSA-tdTomato mice is present in myelinated fibers in the fimbria. Intense tdTomato signals were present in the choroid plexus located laterally to the lateral surface of the fimbria (Fig. 2 D ). The cell types in the mouse choroid plexus that express Pdgfra include fibroblasts, mural cells, and endothelial cells in the embryo, and fibroblasts, macrophages from the post-embryonic period in the mouse brain; while gene profiles indicative of oligodendrocyte precursor-like cells are detectable during the embryonic period, their genuine location within the choroid plexus remains unclear ( 70 , 101 – 103 ). The robust tdTomato signal observed in the choroid plexus at 1 month of age likely originates from some or all of these cell types. Effects of Tbx1 Heterozygosity in Oligodendrocyte Precursor Cells on Behaviors The rate of growth could affect behavior; PdgfrαCre; Tbx1 +/flox , termed o Tbx1 +/− mice, may exhibit developmental delays, and their phenotypes could reflect a delayed development compared to their wild-type littermates. However, neonatal o Tbx1 +/+ and o Tbx1 +/− mice demonstrated indistinguishable increases in body weights ( Figure S1 ). To determine how Tbx1 heterozygosity in oligodendrocyte precursor cells and their progeny affects behavior, mice were tested for social communication during the neonatal period and a battery of social, cognitive, anxiety-related, and motor behaviors at one and two months of age, as myelination peaks around the fourth to fifth postnatal week in rodents( 104 , 105 ) and mice reach adolescence around 2 months of age( 84 ). Constitutive Tbx1 heterozygous mice exhibit impairments in 1) neonatal social communication as early as P7, 2) social behaviors, 3) working memory/cognitive flexibility in a T-maze and attentional set shifting, and 4) affect-related behaviors in an inescapable open field, though not in an elevated plus maze( 58 – 62 ) around adolescence. We first measured differences among the three control mice: PdgfraCre; Tbx1 +/+, WT; Tbx1 +/flox , and WT; Tbx1 +/+ . There was no significant difference among the controls for any behavioral measure, expect for three time points of total margin time in the open field (see Table S3-Figure 8B ); therefore, we collapsed all the control genotypes into a single control group as oTbx1 +/+ for comparison with oTbx1 +/− ( 70 ). Constitutive Tbx1 +/− mice exhibit various neonatal, peri-adolescent, and postnatal behavioral phenotypes( 58 , 59 ). Therefore, we tested mice for neonatal ultrasonic vocalization on P8 and P12–P13 and performed additional tests with peripubertal (1 month) and adolescent (2 months) mice with 1–2 day intervals between tasks to mitigate potential carryover effects of prior testing( 92 ). We found no differences among o Tbx1 +/− pups in the number, percentage, and duration of various neonatal vocal call types on P8 and P12 (Fig. 4 A–C ). At 1 and 2 months of age, mice were sequentially tested for social interaction, novel object approach, spontaneous alternation in a T-maze, anxiety-related behavior in an elevated plus maze, and locomotor activity and thigmotaxis in an inescapable open field. oTbx1 +/− mice and o Tbx1 +/+ mice were indistinguishable in social interaction (Fig. 5 A ) and novel object approach (Fig. 5 B ). In a T-maze, o Tbx1 +/− mice, at 1 month of age exhibited better spontaneous alternation rates at the longest delay (Fig. 6 A ); otherwise, o Tbx1 +/+ and o Tbx1 +/− mice were indistinguishable in rates of spontaneous alternation at 2 months of age and in latencies to correct choices at 1 and 2 months of age (Fig. 6 B–D ). The two genotypes were indistinguishable in the percentage of time spent in open arms (Fig. 7 A ) and visits to open arms (Fig. 7 B ) of the elevated plus maze. We evaluated motor activity and anxiety-related behavior in the stressful open-field task( 58 , 62 ) where there is no opportunity to escape to closed space. In this task, o Tbx1 +/− and o Tbx1 +/+ mice were indistinguishable in distance traveled at both 1 month and 2 months of age (Fig. 8 A,B ) and time spent in the margin zone (Fig. 8 C,D ). While conditional Tbx1 heterozygosity in the oligodendrocyte cell lineage resulted in improved spontaneous alternation with the longest inter-trial delay at one month of age, this phenotype contrasts with the impaired spontaneous alternation observed in constitutive Tbx1 heterozygous mice ( 58 , 62 ). Moreover, this conditional Tbx1 heterozygosity did not replicate the altered neonatal vocalizations, peri-adolescent or postnatal social interaction deficits, or heightened responses to novel, non-social objects or thigmotaxis seen in constitutive Tbx1 heterozygous mice( 58 ). Effects of Tbx1 Heterozygosity in Oligodendrocyte Precursor Cells on Myelinated Axons in the Fimbria After behavioral testing, we examined myelinated axons in the fimbria using electron microscopy. Constitutive Tbx1 heterozygosity selectively alters the ultrastructure in the fimbria, resulting in a higher proportion of myelinated axons measuring 200–600 nm diameter and a lower proportion of axons ≥ 700 nm and < 1,200 nm diameters. Furthermore, the 700–1,500 nm axons exhibited a thicker myelin sheath, with no larger myelinated axons observed in constitutive Tbx1 heterozygous mice ( 62 ). We evaluated whether the ultrastructural alterations of the fimbria of constitutive Tbx1 +/− mice were recapitulated in o Tbx1 +/− mice. Densely packed axons were observed in the fimbria (Fig. 9 A ). To determine relative myelin thickness, we compared the ratio of the inner axon diameter to the outer fiber diameter (i.e., the g-ratio) (Fig. 9 B ). As was the case with constitutive Tbx1 mice, the g-ratio plateaued at approximately 0.8, the ratio for optimal signal conductance in the brain ( 88 ). However, no differences were observed in g-ratios between o Tbx1 +/− mice and o Tbx1 +/+ mice across the entire range of axon diameters. We separately determined the number and proportion of axons of different diameters. The fimbria of o Tbx1 +/− mice contained more axons of ≥ 300 nm and 1,200 nm and < 1,500 nm diameters compared to o Tbx1 +/+ mice (Fig. 9 C ). Consequently, the curve for the relative proportions of axons (y-axis) versus axon diameter (x-axis) shifted to the left in o Tbx1 +/− mice, compared to o Tbx1 +/+ mice (Fig. 9 D ). Consistent with g-ratios, myelin thickness was indistinguishable between o Tbx1 +/− mice and oTbx1 +/+ mice across all axon diameters ( Figure S2 ). Thus, conditional Tbx1 heterozygosity initiated in oligodendrocyte precursor cells selectively shifted the relative proportion of small to medium myelinated axons in the fimbria but did not affect myelin thickness. In summary, conditional Tbx1 heterozygosity in the oligodendrocyte lineage shifted the proportion of myelinated axons to smaller sizes without affecting the thickness of myelin in the fimbria. Discussion The objective of this study was to delineate the cellular origin(s) of the diverse behavioral and myelin phenotypes observed in constitutive Tbx1 heterozygous mice( 58 – 62 ). As some of these behavioral phenotypes are recapitulated by initiating Tbx1 heterozygosity in neonatal progenitor cells ( 72 ) and neonatal neural progenitor cells in the subventricular zone are responsible for generating neurons and oligodendrocytes during the neonatal period ( 68 , 69 , 106 ), we reasoned that Tbx1 deficiency in neonatal neural progenitor cells, neuronal lineage from neural progenitor cells, or oligodendrocyte lineage from oligodendrocyte precursor cells contributes to the observed myelin and associated behavioral phenotypes. This study aimed to investigate the impact of Tbx1 heterozygosity in the oligodendrocyte lineage on the behavioral and ultrastructural phenotypes. To achieve this objective, we crossed Pdgfrα Cre mice with congenic Tbx1 +/flox mice to generate Pdgfrα Cre; Tbx1 +/flox (o Tbx1 +/−) mice. We evaluated a range of social, cognitive, anxiety-related, and motor behaviors, along with the ultrastructural composition of myelin and axons in the fimbria. The o Tbx1 +/− mice selectively replicated the altered axon sizes in the fimbria observed in constitutive Tbx1 heterozygous mice. In contrast, while o Tbx1 +/− exhibited improved spontaneous alternation following a 30-second delay at one month of age—indicative of enhanced working memory and cognitive flexibility– this was contrary to the impaired spontaneous alternation observed in constitutive Tbx1 heterozygous mice. This observation supports that suggestion that the final phenotype arises from the cumulative effects of various contributory and opposing factors ( 54 , 80 ). Other phenotypes associated with constitutive Tbx1 heterozygosity were absent in o Tbx1 +/− mice, including neonatal social communication, responses to social or non-social stimuli, and anxiety-like behaviors in an elevated plus maze and thigmotaxis. These findings indicate that Tbx1 in the oligodendrocyte lineage does not significantly influence the phenotypes. Combined with the observation that Tbx1 heterozygosity initiated in neonatal (P1–P5) neural progenitor cells at P1-P5, but not P21–P25, recapitulates the social and cognitive deficits observed in constitutive Tbx1 heterozygous mice ( 72 ), the current negative data suggest that Tbx1 in neonatal neural progenitor cells or their neuronal lineage may play a principal role in determining the final phenotype ( 72 ). The fimbria of o Tbx1 +/− mice had more axons of ≥ 300 nm and < 800 nm diameter and fewer axons of ≥ 1,200 nm and < 1,500 nm diameter than o Tbx1 +/+ mice. This was similar to the increase in axons of ≥ 200 nm and < 400 nm and the decrease in axons of ≥ 700 nm and < 1,700 nm axons in constitutive Tbx1 heterozygous mice. The medium-size axons of constitutive Tbx1 heterozygous mice have increased myelin thickness and lack large (≥ 1,700 nm) myelinated axons in the fimbria( 62 ), but these characteristics were absent in o Tbx1 +/− mice. This selective change in the axon phenotype could result from widespread activities of the Pdgfrα promoter in many cell types and regions. Although Pdgfrα Cre induces recombination in oligodendrocyte precursor cells, it also triggers recombination in neurons, astrocytes, pericytes, ependyma, perivascular mesenchymal cells, and other cells( 74 – 77 , 97 , 107 , 108 ). Tbx1 heterozygosity in neurons might underlie the shift in the axonal composition of neurons. The correlation between altered spontaneous alternation and the increased proportion of small-to-medium myelinated axons in the fimbria does not necessarily indicate causality by oligodendrocyte precursor cells. Pdgfra Cre-induced recombination could have affected phenotypes through other cell types and their progenies in other brain regions. In the mouse brain, Tbx1 is not detectable in astrocytes or microglia; however, it is significantly present in endothelial cells and neural progenitor cells. Additionally, Tbx1 can be detected in immature neurons as well as both excitatory and inhibitory neurons at various developmental stages, ranging from embryonic development to adulthood( 70 , 71 , 109 , 110 ). Further research is necessary to elucidate the effects of Tbx1 in different cell types on phenotypic outcomes. Several interpretative limitations warrant attention. The general absence of phenotypes may be attributed to the high mortality rate of o Tbx1 +/- litters, potentially biasing our sample toward mice that were less affected by or recovered more quickly from the mutation’s effects. Among male pups in our breeder colony, only 31% and 24% survived to P7 and 2 months of age, respectively. However, two lines of evidence do not support this possibility. First, more mice were alive during the neonatal period than at 1 and 2 months of age, yet neonatal vocalizations on P8 and P12 were normal. Second, our nestinCreERT; Tbx1 +/flox litters also exhibited a high mortality rate but demonstrated more profound behavioral deficits ( 72 ). We cannot exclude the possibility that the conditional Tbx1 heterozygosity was incomplete. The Pdgfrα promoter induces nearly complete recombination in oligodendrocyte precursor cells, with labels persisting in their mature progeny oligodendrocytes ( 107 , 111 ); however, this promoter may exhibit variability in some cells, leading to incomplete recombination ( 112 ). Furthermore, the lack of behavioral deficits may arise from compensatory processes in oligodendrocyte lineage cells; ablation of specific oligodendrocyte precursor cells did not result in gross behavioral abnormalities ( 66 ). Large-scale human brain imaging studies show alterations in the white matter in CNV carriers( 113 , 114 ), as well as idiopathic cases of ASD and schizophrenia ( 115 , 116 ). Moreover, carriers of hemizygous deletion of 22q11.2 have an altered white matter in the fornix/fimbria( 117 ) and volume alterations of many brain regions( 118 – 120 ). Together with our previous observations that Tbx1 heterozygosity during embryonic neurogenesis ( 61 ) and in neonatal stem cells ( 72 ) likely contribute to volume alterations of specific brain regions and social and cognitive deficits ( 61 ), respectively, the present negative results delineate the extent to which Tbx1 contributes to the behavioral and structural phenotypes of 22q11.2 hemizygosity through different cell types. References Hiroi N, Yamauchi T. Modeling and Predicting Developmental Trajectories of Neuropsychiatric Dimensions Associated With Copy Number Variations. Int J Neuropsychopharmacol. 2019;22(8):488–500. Michelini G, Carlisi CO, Eaton NR, Elison JT, Haltigan JD, Kotov R, et al. Where do neurodevelopmental conditions fit in transdiagnostic psychiatric frameworks? Incorporating a new neurodevelopmental spectrum. World Psychiatry. 2024;23(3):333–57. Ozonoff S, Iosif AM, Baguio F, Cook IC, Hill MM, Hutman T, et al. A prospective study of the emergence of early behavioral signs of autism. J Am Acad Child Adolesc Psychiatry. 2010;49(3):256–66. Ozonoff S, Young GS, Belding A, Hill M, Hill A, Hutman T, et al. The broader autism phenotype in infancy: when does it emerge? J Am Acad Child Adolesc Psychiatry. 2014;53(4):398–407. Esposito G, Hiroi N, Scattoni ML. Cry, baby, cry: Expression of Distress as a Biomarker and Modulator in Autism Spectrum Disorder. Int J Neuropsychopharmacol. 2017;20(6):498–503. Sung S, Fenoglio A, Wolff JJ, Schultz RT, Botteron KN, Dager SR, et al. Examining the factor structure and discriminative utility of the Infant Behavior Questionnaire-Revised in infant siblings of autistic children. Child Dev. 2022;93(5):1398–413. Northrup JB, Leezenbaum NB, Campbell SB. Observed Social Emotional Behavior at 22 Months Predicts a Later ASD Diagnosis in High-Risk Siblings. J Autism Dev Disord. 2021;51(9):3187–98. Miller M, Sun S, Iosif AM, Young GS, Belding A, Tubbs A, et al. Repetitive behavior with objects in infants developing autism predicts diagnosis and later social behavior as early as 9 months. J Abnorm Psychol. 2021;130(6):665–75. Di Giorgio E, Rosa-Salva O, Frasnelli E, Calcagni A, Lunghi M, Scattoni ML, et al. Abnormal visual attention to simple social stimuli in 4-month-old infants at high risk for Autism. Sci Rep. 2021;11(1):15785. Miller M, Iosif AM, Hill M, Young GS, Schwichtenberg AJ, Ozonoff S. Response to Name in Infants Developing Autism Spectrum Disorder: A Prospective Study. J Pediatr. 2017;183:141–6. e1. Caravella KE, Roberts JE. Adaptive Skill Trajectories in Infants with Fragile X Syndrome Contrasted to Typical Controls and Infants at High Risk for Autism. Res Autism Spectr Disord. 2017;40:1–12. Gur RC, Calkins ME, Satterthwaite TD, Ruparel K, Bilker WB, Moore TM, et al. Neurocognitive growth charting in psychosis spectrum youths. JAMA Psychiatry. 2014;71(4):366–74. Seidman LJ, Shapiro DI, Stone WS, Woodberry KA, Ronzio A, Cornblatt BA, et al. Association of Neurocognition With Transition to Psychosis: Baseline Functioning in the Second Phase of the North American Prodrome Longitudinal Study. JAMA Psychiatry. 2016;73(12):1239–48. Meier MH, Caspi A, Reichenberg A, Keefe RS, Fisher HL, Harrington H, et al. Neuropsychological decline in schizophrenia from the premorbid to the postonset period: evidence from a population-representative longitudinal study. Am J Psychiatry. 2014;171(1):91–101. Bora E, Lin A, Wood SJ, Yung AR, McGorry PD, Pantelis C. Cognitive deficits in youth with familial and clinical high risk to psychosis: a systematic review and meta-analysis. Acta Psychiatr Scand. 2014;130(1):1–15. Sheffield JM, Karcher NR, Barch DM. Cognitive Deficits in Psychotic Disorders: A Lifespan Perspective. Neuropsychol Rev. 2018;28(4):509–33. Tschentscher N, Woll CFJ, Tafelmaier JC, Kriesche D, Bucher JC, Engel RR et al. Neurocognitive Deficits in First-Episode and Chronic Psychotic Disorders: A Systematic Review from 2009 to 2022. Brain Sci. 2023;13(2). Johansson M, Hjarthag F, Helldin L. Cognitive markers related to long-term remission status in Schizophrenia Spectrum Disorders. Psychiatry Res. 2020;289:113035. Stefansson H, Meyer-Lindenberg A, Steinberg S, Magnusdottir B, Morgen K, Arnarsdottir S, et al. CNVs conferring risk of autism or schizophrenia affect cognition in controls. Nature. 2014;505(7483):361–6. Kendall KM, Rees E, Escott-Price V, Einon M, Thomas R, Hewitt J, et al. Cognitive Performance Among Carriers of Pathogenic Copy Number Variants: Analysis of 152,000 UK Biobank Subjects. Biol Psychiatry. 2017;82(2):103–10. Malhotra D, Sebat J. CNVs: harbingers of a rare variant revolution in psychiatric genetics. Cell. 2012;148(6):1223–41. Marshall CR, Howrigan DP, Merico D, Thiruvahindrapuram B, Wu W, Greer DS, et al. Contribution of copy number variants to schizophrenia from a genome-wide study of 41,321 subjects. Nat Genet. 2017;49(1):27–35. Goh S, Thiyagarajan L, Dudding-Byth T, Mark P, Kirk EP. A systematic review and pooled analysis of penetrance estimates of copy number variants associated with neurodevelopment. Genet Med. 2024:101227. Gur RE, Yi JJ, Donald-McGinn DM, Tang SX, Calkins ME, Whinna D, et al. Neurocognitive development in 22q11.2 deletion syndrome: comparison with youth having developmental delay and medical comorbidities. Mol Psychiatry. 2014;19(11):1205–11. Morrison S, Chawner S, van Amelsvoort T, Swillen A, Vingerhoets C, Vergaelen E, et al. Cognitive deficits in childhood, adolescence and adulthood in 22q11.2 deletion syndrome and association with psychopathology. Transl Psychiatry. 2020;10(1):53. Chawner S, Owen MJ, Holmans P, Raymond FL, Skuse D, Hall J, et al. Genotype-phenotype associations in children with copy number variants associated with high neuropsychiatric risk in the UK (IMAGINE-ID): a case-control cohort study. Lancet Psychiatry. 2019;6(6):493–505. Zinkstok J, Boot E, Bassett AS, Hiroi N, Butcher NJ, Vingerhoets C, et al. The 22q11.2 deletion syndrome from a neurobiological perspective. Lancet Psychiatry. 2019;6(11):951–60. Schneider M, Debbane M, Bassett AS, Chow EW, Fung WL, van den Bree M, et al. Psychiatric disorders from childhood to adulthood in 22q11.2 deletion syndrome: results from the International Consortium on Brain and Behavior in 22q11.2 Deletion Syndrome. Am J Psychiatry. 2014;171(6):627–39. Ensenauer RE, Adeyinka A, Flynn HC, Michels VV, Lindor NM, Dawson DB, et al. Microduplication 22q11.2, an emerging syndrome: clinical, cytogenetic, and molecular analysis of thirteen patients. Am J Hum Genet. 2003;73(5):1027–40. Hassed SJ, Hopcus-Niccum D, Zhang L, Li S, Mulvihill JJ. A new genomic duplication syndrome complementary to the velocardiofacial (22q11 deletion) syndrome. Clin Genet. 2004;65(5):400–4. Portnoi MF, Lebas F, Gruchy N, Ardalan A, Biran-Mucignat V, Malan V, et al. 22q11.2 duplication syndrome: two new familial cases with some overlapping features with DiGeorge/velocardiofacial syndromes. Am J Med Genet A. 2005;137(1):47–51. Yobb TM, Somerville MJ, Willatt L, Firth HV, Harrison K, MacKenzie J, et al. Microduplication and triplication of 22q11.2: a highly variable syndrome. Am J Hum Genet. 2005;76(5):865–76. de La Rochebrochard C, Joly-Helas G, Goldenberg A, Durand I, Laquerriere A, Ickowicz V, et al. The intrafamilial variability of the 22q11.2 microduplication encompasses a spectrum from minor cognitive deficits to severe congenital anomalies. Am J Med Genet A. 2006;140(14):1608–13. Alberti A, Romano C, Falco M, Cali F, Schinocca P, Galesi O, et al. 1.5 Mb de novo 22q11.21 microduplication in a patient with cognitive deficits and dysmorphic facial features. Clin Genet. 2007;71(2):177–82. Engels H, Brockschmidt A, Hoischen A, Landwehr C, Bosse K, Walldorf C, et al. DNA microarray analysis identifies candidate regions and genes in unexplained mental retardation. Neurology. 2007;68(10):743–50. Mukaddes NM, Herguner S. Autistic disorder and 22q11.2 duplication. World J Biol Psychiatry. 2007;8(2):127–30. Torres-Juan L, Rosell J, Morla M, Vidal-Pou C, Garcia-Algas F, de la Fuente MA, et al. Mutations in TBX1 genocopy the 22q11.2 deletion and duplication syndromes: a new susceptibility factor for mental retardation. Eur J Hum Genet. 2007;15(6):658–63. Descartes M, Franklin J, de Stahl TD, Piotrowski A, Bruder CE, Dumanski JP, et al. Distal 22q11.2 microduplication encompassing the BCR gene. Am J Med Genet A. 2008;146A(23):3075–81. Ramelli GP, Silacci C, Ferrarini A, Cattaneo C, Visconti P, Pescia G. Microduplication 22q11.2 in a child with autism spectrum disorder: clinical and genetic study. Dev Med Child Neurol. 2008;50(12):953–5. Wentzel C, Fernstrom M, Ohrner Y, Anneren G, Thuresson AC. Clinical variability of the 22q11.2 duplication syndrome. Eur J Med Genet. 2008;51(6):501–10. Yu S, Cox K, Friend K, Smith S, Buchheim R, Bain S, et al. Familial 22q11.2 duplication: a three-generation family with a 3-Mb duplication and a familial 1.5-Mb duplication. Clin Genet. 2008;73(2):160–4. Lo-Castro A, Galasso C, Cerminara C, El-Malhany N, Benedetti S, Nardone AM, et al. Association of syndromic mental retardation and autism with 22q11.2 duplication. Neuropediatrics. 2009;40(3):137–40. Portnoi MF. Microduplication 22q11.2: a new chromosomal syndrome. Eur J Med Genet. 2009;52(2–3):88–93. Soysal Y, Vermeesch J, Davani NA, Sensoy N, Hekimler K, Imirzalioglu N. Molecular characterization of microduplication 22q11.2 in a girl with hypernasal speech. Genet Mol Res. 2011;10(3):2148–54. Wenger TL, Miller JS, DePolo LM, de Marchena AB, Clements CC, Emanuel BS, et al. 22q11.2 duplication syndrome: elevated rate of autism spectrum disorder and need for medical screening. Mol Autism. 2016;7:27. Singh T, Poterba T, Curtis D, Akil H, Al Eissa M, Barchas JD, et al. Rare coding variants in ten genes confer substantial risk for schizophrenia. Nature. 2022;604(7906):509–16. Alhazmi S, Alzahrani M, Farsi R, Alharbi M, Algothmi K, Alburae N, et al. Multiple Recurrent Copy Number Variations (CNVs) in Chromosome 22 Including 22q11.2 Associated with Autism Spectrum Disorder. Pharmgenomics Pers Med. 2022;15:705–20. Alghamdi M, Al Khalifah R, Al Homyani DK, Alkhamis WH, Arold ST, Ekhzaimy A, et al. A Novel TBX1 Variant Causing Hypoparathyroidism and Deafness. J Endocr Soc. 2020;4(2):bvz028. Ogata T, Niihori T, Tanaka N, Kawai M, Nagashima T, Funayama R, et al. TBX1 mutation identified by exome sequencing in a Japanese family with 22q11.2 deletion syndrome-like craniofacial features and hypocalcemia. PLoS ONE. 2014;9(3):e91598. Paylor R, Glaser B, Mupo A, Ataliotis P, Spencer C, Sobotka A, et al. Tbx1 haploinsufficiency is linked to behavioral disorders in mice and humans: implications for 22q11 deletion syndrome. Proc Natl Acad Sci U S A. 2006;103(20):7729–34. Gong W, Gottlieb S, Collins J, Blescia A, Dietz H, Goldmuntz E, et al. Mutation analysis of TBX1 in non-deleted patients with features of DGS/VCFS or isolated cardiovascular defects. J Med Genet. 2001;38(12):E45. Hiroi N, Zhu H, Lee M, Funke B, Arai M, Itokawa M, et al. A 200-kb region of human chromosome 22q11.2 confers antipsychotic-responsive behavioral abnormalities in mice. Proc Natl Acad Sci USA. 2005;102(52):19132–7. Hiroi N, Hiramoto T, Harper KM, Suzuki G, Boku S. Mouse models of 22q11.2-associated autism spectrum disorder. Autism. 2012;S1(001):1–9. Hiroi N, Takahashi T, Hishimoto A, Izumi T, Boku S, Hiramoto T. Copy Number Variation at 22q11.2: from rare variants to common mechanisms of developmental neuropsychiatric disorders. Mol Psychiatry. 2013;18:1153–65. Hiroi N, Nishi A. Dimensional deconstruction and reconstruction of CNV-associated neuropsychiatric disorders. In: Pletnikov MV, Waddington JL, editors. Modeling the Psychopathological Dimensions of Schizophrenia: From Molecules to Behavior. Handbook of Behavioral Neuroscience. 23. London, UK2015. pp. 285–302. Nishi A, Hiroi N. Genetic Mechanisms Emerging from Mouse Models of CNV-Associated Neuropsychiatric Disorders. In: Abel T, Nickl-Jockschat T, editors. The Neurobiology of Schizophrenia. New York: Academic Press/Elsevier; 2016. pp. 397–417. Suzuki G, Harper KM, Hiramoto T, Funke B, Lee M, Kang G, et al. Over-expression of a human chromosome 22q11.2 segment including TXNRD2, COMT and ARVCF developmentally affects incentive learning and working memory in mice. Hum Mol Genet. 2009;18(20):3914–25. Hiramoto T, Kang G, Suzuki G, Satoh Y, Kucherlapati R, Watanabe Y, et al. Tbx1: identification of a 22q11.2 gene as a risk factor for autism spectrum disorder in a mouse model. Hum Mol Genet. 2011;20(24):4775–85. Takahashi T, Okabe S, Broin PO, Nishi A, Ye K, Beckert MV, et al. Structure and function of neonatal social communication in a genetic mouse model of autism. Mol Psychiatry. 2016;21(9):1208–14. Kato R, Machida A, Nomoto K, Kang G, Hiramoto T, Tanigaki K, et al. Maternal approach behaviors toward neonatal calls are impaired by mother's experiences of raising pups with a risk gene variant for autism. Dev Psychobiol. 2021;63(1):108–13. Hiramoto T, Sumiyoshi A, Kato R, Yamauchi T, Takano T, Kang G, et al. Highly demarcated structural alterations in the brain and impaired social incentive learning in Tbx1 heterozygous mice. Mol Psychiatry. 2025;30(5):1876–86. Hiramoto T, Sumiyoshi A, Yamauchi T, Tanigaki K, Shi Q, Kang G, et al. Tbx1, a gene encoded in 22q11.2 copy number variant, is a link between alterations in fimbria myelination and cognitive speed in mice. Mol Psychiatry. 2022;27(2):929–38. Nieder A, Mooney R. The neurobiology of innate, volitional and learned vocalizations in mammals and birds. Philos Trans R Soc Lond B Biol Sci. 2020;375(1789):20190054. Boku S, Izumi T, Abe S, Takahashi T, Nishi A, Nomaru H, et al. Copy number elevation of 22q11.2 genes arrests the developmental maturation of working memory capacity and adult neurogenesis. Mol Psychiatry. 2018;23(4):985–92. Marques S, van Bruggen D, Vanichkina DP, Floriddia EM, Munguba H, Varemo L, et al. Transcriptional Convergence of Oligodendrocyte Lineage Progenitors during Development. Dev Cell. 2018;46(4):504–17. e7. Kessaris N, Fogarty M, Iannarelli P, Grist M, Wegner M, Richardson WD. Competing waves of oligodendrocytes in the forebrain and postnatal elimination of an embryonic lineage. Nat Neurosci. 2006;9(2):173–9. Menn B, Garcia-Verdugo JM, Yaschine C, Gonzalez-Perez O, Rowitch D, Alvarez-Buylla A. Origin of oligodendrocytes in the subventricular zone of the adult brain. J Neurosci. 2006;26(30):7907–18. Rushing G, Ihrie RA. Neural stem cell heterogeneity through time and space in the ventricular-subventricular zone. Front Biol (Beijing). 2016;11(4):261–84. Fuentealba LC, Rompani SB, Parraguez JI, Obernier K, Romero R, Cepko CL, et al. Embryonic Origin of Postnatal Neural Stem Cells. Cell. 2015;161(7):1644–55. Wang R, Zhang P, Wang J, Ma L, Suo EW. Construction of a cross-species cell landscape at single-cell level. Nucleic Acids Res. 2023;51(2):501–16. Cao J, Spielmann M, Qiu X, Huang X, Ibrahim DM, Hill AJ, et al. The single-cell transcriptional landscape of mammalian organogenesis. Nature. 2019;566(7745):496–502. Hiramoto T, Boku S, Kang G, Abe S, Nagashima M, Barbachan e Silva M, et al. Transcriptional regulation of neonatal neural stem cells is a determinant of social behavior. BioRxiv. 2023;11(12):468452. Nishiyama A, Lin XH, Giese N, Heldin CH, Stallcup WB. Co-localization of NG2 proteoglycan and PDGF alpha-receptor on O2A progenitor cells in the developing rat brain. J Neurosci Res. 1996;43(3):299–314. Rivers LE, Young KM, Rizzi M, Jamen F, Psachoulia K, Wade A, et al. PDGFRA/NG2 glia generate myelinating oligodendrocytes and piriform projection neurons in adult mice. Nat Neurosci. 2008;11(12):1392–401. Sil S, Periyasamy P, Thangaraj A, Chivero ET, Buch S. PDGF/PDGFR axis in the neural systems. Mol Aspects Med. 2018;62:63–74. Brandebura AN, Morehead M, Heller DT, Holcomb P, Kolson DR, Jones G, et al. Glial Cell Expansion Coincides with Neural Circuit Formation in the Developing Auditory Brainstem. Dev Neurobiol. 2018;78(11):1097–116. Beiter RM, Rivet-Noor C, Merchak AR, Bai R, Johanson DM, Slogar E, et al. Evidence for oligodendrocyte progenitor cell heterogeneity in the adult mouse brain. Sci Rep. 2022;12(1):12921. Arnold JS, Werling U, Braunstein EM, Liao J, Nowotschin S, Edelmann W, et al. Inactivation of Tbx1 in the pharyngeal endoderm results in 22q11DS malformations. Development. 2006;133(5):977–87. Matsuo N, Takao K, Nakanishi K, Yamasaki N, Tanda K, Miyakawa T. Behavioral profiles of three C57BL/6 substrains. Front Behav Neurosci. 2010;4:29. Hiroi N. Critical Reappraisal of Mechanistic Links of Copy Number Variants to Dimensional Constructs of Neuropsychiatric Disorders in Mouse Models. J Neuropsychiatry Clin Neurosci. 2018;72(5):301–21. Yang D, Wang Y, Qi T, Zhang X, Shen L, Ma J, et al. Phosphorylation of pyruvate dehydrogenase inversely associates with neuronal activity. Neuron. 2024;112(6):959–71. e8. Readhead C, Popko B, Takahashi N, Shine HD, Saavedra RA, Sidman RL, et al. Expression of a myelin basic protein gene in transgenic shiverer mice: correction of the dysmyelinating phenotype. Cell. 1987;48(4):703–12. Meschkat M, Steyer AM, Weil MT, Kusch K, Jahn O, Piepkorn L, et al. White matter integrity in mice requires continuous myelin synthesis at the inner tongue. Nat Commun. 2022;13(1):1163. Arellano JI, Duque A, Rakic P. A coming-of-age story: adult neurogenesis or adolescent neurogenesis in rodents? Front Neurosci. 2024;18:1383728. Bronson FH, Dagg CP, Snell GD. Reproduction. In: Green EL, editor. Biology of the Laboratory Mouse. Second Edition ed. New York: Dover Publications, Inc.; 2007. p. Oneline publication. Nakamura M, Ye K, MB ES, Yamauchi T, Hoeppner DJ, Fayyazuddin A, et al. Computational identification of variables in neonatal vocalizations predictive for postpubertal social behaviors in a mouse model of 16p11.2 deletion. Mol Psychiatry. 2021;26(11):6578–88. Gao Z, Daquinag AC, Su F, Snyder B, Kolonin MG. PDGFRalpha/PDGFRbeta signaling balance modulates progenitor cell differentiation into white and beige adipocytes. Development. 2018;145(1). Marcelin G, Ferreira A, Liu Y, Atlan M, Aron-Wisnewsky J, Pelloux V, et al. A PDGFRalpha-Mediated Switch toward CD9(high) Adipocyte Progenitors Controls Obesity-Induced Adipose Tissue Fibrosis. Cell Metab. 2017;25(3):673–85. Harper KM, Hiramoto T, Tanigaki K, Kang G, Suzuki G, Trimble W, et al. Alterations of social interaction through genetic and environmental manipulation of the 22q11.2 gene Sept5 in the mouse brain. Hum Mol Genet. 2012;21(15):3489–99. Suzuki G, Harper KM, Hiramoto T, Sawamura T, Lee M, Kang G, et al. Sept5 deficiency exerts pleiotropic influence on affective behaviors and cognitive functions in mice. Hum Mol Genet. 2009;18(9):1652–60. Yamauchi T, Kang G, Hiroi N. Heterozygosity of murine Crkl does not recapitulate behavioral dimensions of human 22q11.2 hemizygosity. Genes Brain Behav. 2020;20(5):e12719. Paylor R, Spencer CM, Yuva-Paylor LA, Pieke-Dahl S. The use of behavioral test batteries, II: effect of test interval. Physiol Behav. 2006;87(1):95–102. Fonseca AH, Santana GM, Bosque Ortiz GM, Bampi S, Dietrich MO. Analysis of ultrasonic vocalizations from mice using computer vision and machine learning. Elife. 2021;10. Sakamoto Y, Takano T, Shimoyama S, Hiramoto T, Hiroi N, Nakamura K. Prepartum bumetanide treatment reverses altered neonatal social communication but non-specifically reduces post-pubertal social behavior in a mouse model of fragile X syndrome. Genomic Psychiatry. 2025;1(1):61–72. Kaiser T, Allen HM, Kwon O, Barak B, Wang J, He Z et al. MyelTracer: A Semi-Automated Software for Myelin g-Ratio Quantification. eNeuro. 2021;8(4). Allen Brain Atlas. Mouse Brain. http://wwwbrain-maporg . 2017. Nait Oumesmar B, Vignais L, Baron-Van Evercooren A. Developmental expression of platelet-derived growth factor alpha-receptor in neurons and glial cells of the mouse CNS. J Neurosci. 1997;17(1):125–39. Zhu X, Bergles DE, Nishiyama A. NG2 cells generate both oligodendrocytes and gray matter astrocytes. Development. 2008;135(1):145–57. Marques S, Zeisel A, Codeluppi S, van Bruggen D, Mendanha Falcao A, Xiao L, et al. Oligodendrocyte heterogeneity in the mouse juvenile and adult central nervous system. Science. 2016;352(6291):1326–9. Ozarkar SS, Patel RKR, Vulli T, Friar CA, Burette AC, Philpot BD. Regional analysis of myelin basic protein across postnatal brain development of C57BL/6J mice. Front Neuroanat. 2025;19:1535745. Bastedo WE, Scott RW, Arostegui M, Underhill TM. Single-cell analysis of mesenchymal cells in permeable neural vasculature reveals novel diverse subpopulations of fibroblasts. Fluids Barriers CNS. 2024;21(1):31. Takeuchi A, Takahashi Y, Iida K, Hosokawa M, Irie K, Ito M, et al. Identification of Qk as a Glial Precursor Cell Marker that Governs the Fate Specification of Neural Stem Cells to a Glial Cell Lineage. Stem Cell Rep. 2020;15(4):883–97. Dani N, Herbst RH, McCabe C, Green GS, Kaiser K, Head JP, et al. A cellular and spatial map of the choroid plexus across brain ventricles and ages. Cell. 2021;184(11):3056–e7421. Downes N, Mullins P. The development of myelin in the brain of the juvenile rat. Toxicol Pathol. 2014;42(5):913–22. Thompson CL, Ng L, Menon V, Martinez S, Lee CK, Glattfelder K, et al. A high-resolution spatiotemporal atlas of gene expression of the developing mouse brain. Neuron. 2014;83(2):309–23. Redmond SA, Figueres-Onate M, Obernier K, Nascimento MA, Parraguez JI, Lopez-Mascaraque L, et al. Development of Ependymal and Postnatal Neural Stem Cells and Their Origin from a Common Embryonic Progenitor. Cell Rep. 2019;27(2):429–41. e3. Kang SH, Fukaya M, Yang JK, Rothstein JD, Bergles DE. NG2 + CNS glial progenitors remain committed to the oligodendrocyte lineage in postnatal life and following neurodegeneration. Neuron. 2010;68(4):668–81. Komitova M, Zhu X, Serwanski DR, Nishiyama A. NG2 cells are distinct from neurogenic cells in the postnatal mouse subventricular zone. J Comp Neurol. 2009;512(5):702–16. Rosenberg AB, Roco CM, Muscat RA, Kuchina A, Sample P, Yao Z, et al. Single-cell profiling of the developing mouse brain and spinal cord with split-pool barcoding. Science. 2018;360(6385):176–82. Yao Z, Liu H, Xie F, Fischer S, Adkins RS, Aldridge AI, et al. A transcriptomic and epigenomic cell atlas of the mouse primary motor cortex. Nature. 2021;598(7879):103–10. O'Rourke M, Cullen CL, Auderset L, Pitman KA, Achatz D, Gasperini R, et al. Evaluating Tissue-Specific Recombination in a Pdgfralpha-CreERT2 Transgenic Mouse Line. PLoS ONE. 2016;11(9):e0162858. Tripathi RB, Rivers LE, Young KM, Jamen F, Richardson WD. NG2 glia generate new oligodendrocytes but few astrocytes in a murine experimental autoimmune encephalomyelitis model of demyelinating disease. J Neurosci. 2010;30(48):16383–90. Thompson PM, Jahanshad N, Ching CRK, Salminen LE, Thomopoulos SI, Bright J, et al. ENIGMA and global neuroscience: A decade of large-scale studies of the brain in health and disease across more than 40 countries. Transl Psychiatry. 2020;10(1):100. Kochunov P, Hong LE, Dennis EL, Morey RA, Tate DF, Wilde EA, et al. ENIGMA-DTI: Translating reproducible white matter deficits into personalized vulnerability metrics in cross-diagnostic psychiatric research. Hum Brain Mapp. 2020;43(1):194–206. Koshiyama D, Fukunaga M, Okada N, Morita K, Nemoto K, Usui K, et al. White matter microstructural alterations across four major psychiatric disorders: mega-analysis study in 2937 individuals. Mol Psychiatry. 2020;25(4):883–95. Kelly S, Jahanshad N, Zalesky A, Kochunov P, Agartz I, Alloza C, et al. Widespread white matter microstructural differences in schizophrenia across 4322 individuals: results from the ENIGMA Schizophrenia DTI Working Group. Mol Psychiatry. 2018;23(5):1261–9. Villalon-Reina JE, Martinez K, Qu X, Ching CRK, Nir TM, Kothapalli D, et al. Altered white matter microstructure in 22q11.2 deletion syndrome: a multisite diffusion tensor imaging study. Mol Psychiatry. 2020;25(11):2818–31. Ching CRK, Gutman BA, Sun D, Villalon Reina J, Ragothaman A, Isaev D, et al. Mapping Subcortical Brain Alterations in 22q11.2 Deletion Syndrome: Effects of Deletion Size and Convergence With Idiopathic Neuropsychiatric Illness. Am J Psychiatry. 2020;177(7):589–600. Sun D, Ching CRK, Lin A, Forsyth JK, Kushan L, Vajdi A, et al. Large-scale mapping of cortical alterations in 22q11.2 deletion syndrome: Convergence with idiopathic psychosis and effects of deletion size. Mol Psychiatry. 2020;25(8):1822–34. Sonderby IE, Ching CRK, Thomopoulos SI, van der Meer D, Sun D, Villalon-Reina JE et al. Effects of copy number variations on brain structure and risk for psychiatric illness: Large-scale studies from the ENIGMA working groups on CNVs. Hum Brain Mapp. 2021. Supplementary Tables Table S1 Primers used for genotyping . Mouse line Forward (5’ à 3’) Reverse (5’ à 3’) Purpose Pdgfrα-Cre olMR1084 (GCGGTCTGGCAGTAAAAACTATC) olMR1085 (GTGAAACAGCATTGCTGTCACTT) Generic cre - transgene Pdgfrα - Cre olMR7338 (CTAGGCCACAGAATTGAAAGATCT) olMR7339 (GTAGGTGGAAATTCTAGCATCATCC) Generic cre – internal positive control ROSA-CAG-tdTomato olMR9020 (AAGGGAGCTGCAGTGGAGTA) olMR9021 (CCGAAAATCTGTGGGAAGTC) tdTomato wild-type control ROSA-CAG-tdTomato olMR9103 (GGCATTAAAGCAGCGTATCC) olMR9105 (CTGTTCCTGTACGGCATGG) tdTomato mutant Tbx1 +/flox 2g 1F (TCTTCTTGGGGCTGTAGACT) Tbx1 1R (TGACTGTGCTGAAGTGCATC) LoxP site Tbx1 +/− KO1F (TTGGTGACGATCATCTCGGT) KO1R (ATGATCTCCGCCGTGTCTAG) Mut2R (AGGTCCCTCGAAGAGGTTCA) Tbx1 +/+ Tbx1 +/− Table S2 Primers for qRT-PCR Gene Assay ID Tbx1 Mm00448949_m1 Cspg4 Mm00507257_m1 Mag Mm00487538_m1 Mbp Mm01266402_m1 Mog Mm01279062_m1 Plp1 Mm01297210_m1 Additional Declarations No competing interests reported. Supplementary Files SupplementaryInformation.docx TableS3.pdf Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 20 Apr, 2026 Reviews received at journal 19 Apr, 2026 Reviewers agreed at journal 14 Apr, 2026 Reviews received at journal 11 Apr, 2026 Reviewers agreed at journal 09 Apr, 2026 Reviewers invited by journal 08 Apr, 2026 Editor assigned by journal 08 Apr, 2026 Submission checks completed at journal 08 Apr, 2026 First submitted to journal 05 Apr, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9327970","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":622830014,"identity":"03f76477-53c1-440d-a90c-2636309a8f6d","order_by":0,"name":"Anne Marie Wells","email":"","orcid":"","institution":"University of Texas Health Science Center","correspondingAuthor":false,"prefix":"","firstName":"Anne","middleName":"Marie","lastName":"Wells","suffix":""},{"id":622830015,"identity":"f67514da-f82f-48ab-a99c-57e432ea98a5","order_by":1,"name":"Takaki Tanifuji","email":"","orcid":"","institution":"University of Texas Health Science Center","correspondingAuthor":false,"prefix":"","firstName":"Takaki","middleName":"","lastName":"Tanifuji","suffix":""},{"id":622830016,"identity":"35bf0cd7-1fae-4948-8ceb-2bf706f25b3c","order_by":2,"name":"Takeshi Takano","email":"","orcid":"","institution":"University of Texas Health Science Center","correspondingAuthor":false,"prefix":"","firstName":"Takeshi","middleName":"","lastName":"Takano","suffix":""},{"id":622830017,"identity":"7c0e882c-3a38-4bbc-8b4a-91de46eebc19","order_by":3,"name":"Arumu Endo","email":"","orcid":"","institution":"University of Texas Health Science Center","correspondingAuthor":false,"prefix":"","firstName":"Arumu","middleName":"","lastName":"Endo","suffix":""},{"id":622830018,"identity":"1fda2007-a0e4-41a5-88d0-ad3db57dc12b","order_by":4,"name":"Gina Kang","email":"","orcid":"","institution":"University of Texas Health Science Center","correspondingAuthor":false,"prefix":"","firstName":"Gina","middleName":"","lastName":"Kang","suffix":""},{"id":622830022,"identity":"079f4cb8-fd55-4ef7-97bc-c903293855e8","order_by":5,"name":"Marisa Esparza","email":"","orcid":"","institution":"University of Texas Health Science Center","correspondingAuthor":false,"prefix":"","firstName":"Marisa","middleName":"","lastName":"Esparza","suffix":""},{"id":622830023,"identity":"35646ed4-dcce-4e87-b838-70468730628f","order_by":6,"name":"Qian Shi","email":"","orcid":"","institution":"University of Texas Health Science Center","correspondingAuthor":false,"prefix":"","firstName":"Qian","middleName":"","lastName":"Shi","suffix":""},{"id":622830026,"identity":"eccc6eee-c721-4ffc-9903-79e1527ff3ad","order_by":7,"name":"Manzoor A. Bhat","email":"","orcid":"","institution":"University of Texas Health Science Center","correspondingAuthor":false,"prefix":"","firstName":"Manzoor","middleName":"A.","lastName":"Bhat","suffix":""},{"id":622830027,"identity":"a86e52cb-0fd0-42e1-ad02-cdf321606a61","order_by":8,"name":"Noboru Hiroi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAt0lEQVRIiWNgGAWjYBACA2YgkVABZEAFGBuI03KGQYIELWBlbaRoMWfnffjg4bzDdeb8hx9/+MFgI7vhAAEtls3sxgaJ2w5LWM5IM5PsYUgzJqjF4DAbmwRIi8ENHjYGHobDiURqmQPUcv4M88c/DP+J1dIA1HIgh0Gah+EAUVqYDRKOpUtuuJFmJi1jkGw8k6CW88cYH/6oseY3OH/48cc3FXayfYS0oJtAmvJRMApGwSgYBTgAAC7ZQKnAPOQjAAAAAElFTkSuQmCC","orcid":"","institution":"University of Texas Health Science Center","correspondingAuthor":true,"prefix":"","firstName":"Noboru","middleName":"","lastName":"Hiroi","suffix":""}],"badges":[],"createdAt":"2026-04-05 18:23:02","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9327970/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9327970/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":107247112,"identity":"dff187f6-7894-42f4-bfd1-4e46afa9283b","added_by":"auto","created_at":"2026-04-19 08:11:59","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":17871,"visible":true,"origin":"","legend":"\u003cp\u003eThe relative quantification (RQ) (mean ± SEM) of expression levels at each stage of oligodendrogenesis, as determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR) using \u003cem\u003ePgk1\u003c/em\u003e as a reference gene. Three cell clones were derived from three different C57BL/6J pups at postnatal days 2 or 3, with data obtained from three culture wells for each clone, except for one \u003cem\u003eTbx1\u003c/em\u003esiRNA-treated clone where \u003cem\u003eTbx1 \u003c/em\u003emRNA was undetectable and thus excluded from the analysis. A linear mixed model showed that Tbx1 siRNA reduced expression of all genes tested equally (Treatment, F(1,89)=14.665, p=0.0002386; Gene, F(5,89)=0.8440, p=0.5222; Treatment x Gene, F(5,89)=0.8440, p=0.5222). Mann-Whitney tests confirmed that \u003cem\u003eTbx1\u003c/em\u003e siRNA reduced expression of each gene. Statistically significant differences between control siRNA and \u003cem\u003eTbx1\u003c/em\u003e siRNA groups are indicated by *, **, and *** for p \u0026lt;0.05, p\u0026lt;0.01, and p\u0026lt;0.005, respectively; they remained significant following Benjamini-Hochberg correction at a 5% false discovery rate (FDR).\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-9327970/v1/9c2e4aa81b418349f833dc76.png"},{"id":107247105,"identity":"7200003a-429a-443c-acf7-6221fefa67c4","added_by":"auto","created_at":"2026-04-19 08:11:58","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1358668,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e. A representative lightsheet image of the brain from a 1-month-old male PdgfrαCre;ROSA-tdTomato mouse. Following SmartBatch+ tissue delipification, tdTomato signals were visualized using a Zeiss LSM 7 Lightsheet microscope with a 2.5x objective (N = 3). \u003cstrong\u003eB-D\u003c/strong\u003e. tdTomato expression in 1-month-old PdgfrαCre;ROSA-tdTomato mice is depicted together with blue DAPI signals at the levels of the anterior striatum (\u003cstrong\u003eB\u003c/strong\u003e), middle striatum (\u003cstrong\u003eC\u003c/strong\u003e), posterior striatum/fimbria (\u003cstrong\u003eD\u003c/strong\u003e), anterior lateral ventricle (\u003cstrong\u003eE\u003c/strong\u003e), middle lateral ventricle (\u003cstrong\u003eF\u003c/strong\u003e), and fimbria (\u003cstrong\u003eH\u003c/strong\u003e). Abbreviations: ChPx, choroid plexus; LV, lateral ventricle; Str, striatum; Sept, septum; CC, corpus callosum; CTX, cortex; HGCL, hippocampal granule cell layer; fmb, fimbria; SVZ, subventricular zone. N = 3.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-9327970/v1/ba3a79f23819ff4fc6f6cb5c.png"},{"id":107247106,"identity":"59dfbcb6-dadf-4fda-884e-e0330bf85c2d","added_by":"auto","created_at":"2026-04-19 08:11:58","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":631024,"visible":true,"origin":"","legend":"\u003cp\u003eA Representative Case of Confocal Images of the Fimbria of a 1-Month-Old Male PdgfrαCre;ROSA-tdTomato Mouse. Sections were stained for DAPI (\u003cstrong\u003eA\u003c/strong\u003e, blue) and MBP (\u003cstrong\u003eB\u003c/strong\u003e, green). \u003cstrong\u003eC\u003c/strong\u003e. Red tdTomato signals originated from the PdgfrαCre;ROSA-tdTomato genotype. \u003cstrong\u003eD\u003c/strong\u003e. A composite image of the three colors is presented; white arrows indicate an area where fibers are positive for both MBP and tdTomato. N = 4. ChPx, choroid plexus; fmb, fimbria.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-9327970/v1/708e062087f683bafbad35ae.png"},{"id":107484506,"identity":"af57d197-606c-4038-a0f6-3c9f5650890c","added_by":"auto","created_at":"2026-04-22 02:32:09","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":971653,"visible":true,"origin":"","legend":"\u003cp\u003eThe number (\u003cstrong\u003eA\u003c/strong\u003e), proportion (\u003cstrong\u003eB\u003c/strong\u003e), and duration (\u003cstrong\u003eC\u003c/strong\u003e) (mean ± standard error of the mean [SEM]) of 12 call types emitted on postnatal days (P) P8 and P12. The two genotypes exhibited differences in certain interaction effects: \u003cstrong\u003eA\u003c/strong\u003e. Number: Genotype, F(1,912)=0.1966, p = 0.6576; Genotype x Postnatal day, F(1, 912)=4.835, p = 0.0281; Genotype x Call type, F(11, 9123)=0.7077, p = 0.7319; Genotype x Postnatal day x Call types, F(11, 912)=0.3686, p = 0.9679. \u003cstrong\u003eB\u003c/strong\u003e. Proportion: Genotype, F(1,912)=0.0107, p = 0.9176; Genotype x Postnatal day, F(1, 912)=0.0107, p = 0.9176; Genotype x Call type, F(11, 912)=1.3657, p = 0.1837; Genotype x Postnatal day x Call types, F(11, 912)=0.7966, p = 0.6437.\u003cstrong\u003e C\u003c/strong\u003e. Duration: Genotype, F(1,560)=0.0435, p = 0.8349; Genotype x Postnatal day, F(1, 560)=0.10519, p = 0.7458; Genotype x Call type, F(11, 560)=3.361, p = 0.00016; Genotype x Postnatal day x Call types, F(11, 560)=1.0389, p = 0.4101. However, Mann-Whitney U tests did not reveal any significant genotype effects at any postnatal day for any call type after applying Benjamini-Hochberg corrections at 5% false discovery rate (FDR). \u003cstrong\u003eInset\u003c/strong\u003e in \u003cstrong\u003eA\u003c/strong\u003e: The total number of ultrasonic vocalizations (mean ± SEM) emitted at P8 and P12. The two genotypes did not differ on the two postnatal days (Genotype, F(1,76)=0.1559, p = 0.694; Genotype x Postnatal day, F(1, 76)=1.103, p = 0.2969). \u003cstrong\u003eInset\u003c/strong\u003e in \u003cstrong\u003eC\u003c/strong\u003e: \u0026nbsp;Duration: Genotype, F(1,32)=0.0002, p = 0.9878; Genotype x Postnatal day, F(1, 32)=0.3617, p = 0.5518). Ha, harmonic; Sd, step-down; Sh, short; Df, down frequency modulation; Uf, up frequency modulation; Ts, two steps; Fl, flat; Ch, chevron; Co, complex; Su, step-up; Ms, multiple steps; Rc, reverse chevron. \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice, N = 27; \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e mice, N = 11 at P8; \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e mice, N = 30; \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e mice, N = 12 at P12.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-9327970/v1/08f2fcfc66d2e700a15db4a1.png"},{"id":107247113,"identity":"c915853d-e637-4fbd-a1e0-7f418dda7302","added_by":"auto","created_at":"2026-04-19 08:11:59","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":302295,"visible":true,"origin":"","legend":"\u003cp\u003eInteraction with Social and Non-Social Stimuli. \u003cstrong\u003eA\u003c/strong\u003e) Social Interaction. The \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/− \u003c/sup\u003e(PdgfrαCre;Tbx1\u003csup\u003e+/flox\u003c/sup\u003e) mice and \u003cem\u003eoTbx1\u003c/em\u003e+/+ mice did not differ in the amount of time (mean ± SEM) spent in affiliative social interaction (1 month: genotype, F(1, 72) = 0.1118, p = 0.739; genotype × session, F(1, 72) = 0.262, p = 0.6102; 2 months: genotype, F(1, 58) = 0.00547, p = 0.9413; genotype x session, F(1, 58) = 1.2175, p = 0.2744). The three genotypes of \u003cem\u003eoTbx1\u003c/em\u003e+/+ (1 month, N = 8, PdgfrαCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N = 10, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N = 9, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e; 2 months, N = 8, PdgfrαCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N = 6, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N = 7, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e) did not show significant differences (1 month: genotype, F(2, 48) = 1.686, p = 0.1960; genotype × session, F(2, 48) = 0.843, p = 0.4366; 2 months: genotype, F(2, 36) = 0.0392, p = 0.9616; genotype x session, F(2, 36) = 0.2382, p = 0.7893), and were thus combined as \u003cem\u003eoTbx1\u003c/em\u003e+/+. \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice , N = 27; \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e mice, N = 11 at 1 month; \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice, N = 21; \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e mice, N = 10 at 2 months. \u003cstrong\u003eB\u003c/strong\u003e) Approach to a novel, non-social object. The two genotypes did not differ in the amount of time spent in affiliative social interaction (1 month: genotype, F(1, 70) = 2.2507E-05, p = 0.9962; genotype × session, F(1, 70) = 1.0305, p = 0.31354; 2 months: genotype, F(1, 58) = 0.11634, p = 0.7342; genotype × session, F(1, 58) = 0.0821, p = 0.77545). The three genotypes of \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e (1 month: N = 8, PdgfrαCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N = 9, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N = 9, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e; 2 months: N = 8, PdgfrαCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N = 6, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N = 7, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e) did not differ (1 month: genotype, F(2, 46) = 0.1772, p = 0.8382; genotype × session, F(2, 46) = 0.9318, p = 0.4012; 2 months: genotype, F(2, 36) = 0.0580, p = 0.9437; genotype × session, F(2, 36) = 0.6581, p = 0.5239) and were therefore combined as \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e. \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice, N = 26; \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e mice, N = 11 at 1 month; \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice, N = 21; \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e mice, N = 10 at 2 months.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-9327970/v1/ac016891451cb6f2f6a82bbc.png"},{"id":107247109,"identity":"835bf807-43c2-4fdd-bfe9-1e6cb18db216","added_by":"auto","created_at":"2026-04-19 08:11:58","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":78536,"visible":true,"origin":"","legend":"\u003cp\u003eSpontaneous alternation in a T-maze. Compared to male \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e (N = 20) mice, male \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e (N = 10) mice performed better in the percentage of correct spontaneous alternations (mean ± SEM) at the longest delay (30 s) in a T-maze at 1 month of age, but not at 2 months. Specifically, at 1 month: % alternation, genotype, F(1, 96) = 4.66, p = 0.0333; genotype × delays, F(2,96) = 3.1509, p = 0.0473; at 2 months: genotype, F(1, 81) = 2.047, p = 0.1564; genotype × delays, F(2, 81) = 0.2439, p = 0.7841. The three genotypes of \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e (1 month: N = 8, PdgfrαCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N = 7, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N = 9, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e; 2 months: N = 8, PdgfrαCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N = 6, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N = 6, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e) did not differ (1 month: genotype, F(2, 63) = 0.1046, p = 0.9008; genotype × delays, F(4, 63) = 0.2648, p = 0.8995; 2 months: genotype, F(2, 51) = 0.1197, p = 0.8874; genotype × delays, F(4, 51) = 0.6401, p = 0.6363) and consequently were combined as \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e. \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e mice exhibited higher levels of alternations at the 30-second delay compared to \u003cem\u003eoTbx1\u003c/em\u003e+/+ mice, as determined by the Mann-Whitney test (p = 0.0081). \u003cstrong\u003eB\u003c/strong\u003e) The two groups did not exhibit significant differences in the latency to correct choices in the T-maze at 1 month (genotype, F(1, 96) = 2.181, p = 0.1430; genotype × delays, F(2, 96) = 2.058, p = 0.1332) or at 2 months (genotype, F(1, 81) = 1.1135, p = 0.2944; genotype × delays, F(2, 81) = 2.5825, p = 0.0817). The three genotypes of \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e (1 month, N=8), PdgfrαCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e (N=7), Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e (N=9), and Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e (2 months, N=8), PdgfrαCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e (N=6), Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e (N=6), and Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e, demonstrated a significant interaction effect at 1 month of age (genotype, F(2, 63) = 1.5787, p = 0.2143; genotype × session, F(4, 63) = 4.5625, p = 0.00267), but no significant interaction at 2 months of age (genotype, F(2, 51) = 0.1631, p = 0.8500; genotype × session, F(4, 51) = 1.0611, p = 0.3853). However, Mann-Whitney U tests revealed that none of the three genotypes significantly differed from one another at 1 month of age after applying the Benjamini-Hochberg correction (p\u0026gt;0.05 for all pairs). The three genotypes were combined as o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e. The sample sizes were as follows: \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice, N = 24; \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e mice, N = 10 at 1 month; \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice, N = 20; \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e mice, N = 9 at 2 months.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-9327970/v1/cb7130d0568d87a1d2b75cc0.png"},{"id":107484516,"identity":"8aa762f0-8576-4dcd-8bb5-d7739ac1450c","added_by":"auto","created_at":"2026-04-22 02:32:12","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":47156,"visible":true,"origin":"","legend":"\u003cp\u003eAnxiety-related behavior in an elevated T-maze.The \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e and \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice did not differ significantly in the relative amount of time spent (mean +SEM) in the open arms of an elevated plus maze (\u003cstrong\u003eA\u003c/strong\u003e,1 month,U = 100, p = 0.3440; 2 months, U = 98, p = 0.9483) or the frequency of visits to the open arms of the elevated plus maze (\u003cstrong\u003eB\u003c/strong\u003e, 1 month,t(32) = 1.7412, p = 0.0912; 2 months, t(28) = 0.5925, p = 0.5583). The three genotypes of \u003cem\u003eoTbx1\u003c/em\u003e+/+ (1 month, N=7, PdgfrαCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N=7, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N=6, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e+/flox; 2 months, N=8, PdgfrαCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N=6, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N=6, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e) did not differ in the percentage of time spent in open arms (1 month,genotype, F(2, 20) = 0.0745, p = 0.9285; 2 months,genotype, F(2, 17) = 2.126, p = 0.1499) or the percentage of visits to open arms (1 month,genotype, F(2, 20) = 0.1837, p = 0.8336; 2 months,genotype, F(2, 17) = 1.4821, p = 0.2551), and thus were combined as \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e. The sample sizes were: \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice, N = 23; \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e mice, N = 11 at 1 month; \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice, N = 20; \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e mice, N = 10 at 2 months.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-9327970/v1/1515e4ac1d9144feddfe5686.png"},{"id":107485481,"identity":"86431653-28d1-4b81-9c3e-1fd890157a1f","added_by":"auto","created_at":"2026-04-22 02:35:03","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":573792,"visible":true,"origin":"","legend":"\u003cp\u003eMotor Activity and Thigmotaxis. \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e and \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e mice exhibited indistinguishable distances traveled at both 1 month and 2 months of age (\u003cstrong\u003eA\u003c/strong\u003e, 1 month, genotype, F(1, 198) = 0.6314, p = 0.4278; genotype × time, F(5, 198) = 0.9551, p = 0.4466; \u003cstrong\u003eB\u003c/strong\u003e, 2 months, genotype, F(1, 28) = 0.0242, p = 0.87739; genotype × time, F(3.66, 102.485) = 0.5389, p = 0.69188). The Greenhouse–Geisser correction was applied due to a violation of sphericity, with the estimated epsilon being less than 0.75.The three genotypes of \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e (1 month, N=8, PdgfrαCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N=7, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N=9, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e; 2 months, N=8, PdgfrαCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N=6, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, N=6, Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e) demonstrated differences at both ages (genotype, F(2, 21) = 5.475, p = 0.01220; genotype × time, F(7.10, 74.58) = 1.118, p = 0.3611; at 2 months,genotype, F(2, 17) = 9.533, p = 0.00167; genotype × time, F(10, 85) = 0.3955, p = 0.9453). Comparisons of all pairs using Student's t-tests indicated that no pair reached significance after the Benjamini-Hochberg correction (p\u0026gt;0.05 for all pairs), resulting in their combination as \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e and \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e mice spent equal amounts of time in the margin zone (i.e., thigmotaxis) of the inescapable open field at both 1 and 2 months of age (\u003cstrong\u003eC,\u003c/strong\u003e 1 month, genotype, F(1, 198) = 0.2009, p = 0.6545; genotype × time, F(5,198) = 2.1516, p = 0.0609; \u003cstrong\u003eD\u003c/strong\u003e, 2 months, genotype, F(1, 168) = 0.08912, p = 0.7657; genotype × time, F(5, 168) = 0.9880, p = 0.4267). The three genotypes of \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e did not differ at 1 month of age (genotype, F(2, 21) = 0.3687, p = 0.6961; genotype × time, F(5.485, 57.58) = 0.9884, p = 0.4375), but differences were observed at 2 months of age (genotype, F(2, 17) = 4.880, p = 0.0211; genotype × time, F(5.049, 42.917) = 0.7179, p = 0.6147). Comparisons of all pairs using Student's t-tests revealed that 2-month-old Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e and Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e differed at the first four time points, even after the Benjamini-Hochberg correction (p\u0026lt;0.05). However, these groups had relatively small sample sizes (N=6 for both), and PdgfrαCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003eand Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e or PdgfrαCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+ \u003c/sup\u003eand Wild-type;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e did not differ at any time point (p \u0026gt;0.05), thus they were combined as \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e. Sample sizes included \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice, N = 24; \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e mice, N = 11 at 1 month; \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice, N = 20; \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e mice, N = 10 at 2 months.\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-9327970/v1/60dbe4546bcc46e24b1cf315.png"},{"id":107247110,"identity":"57011447-08f4-4db8-b8b9-92678bb8f413","added_by":"auto","created_at":"2026-04-19 08:11:58","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":486266,"visible":true,"origin":"","legend":"\u003cp\u003eElectron Microscopy Analysis of Myelinated Axons. \u003cstrong\u003eA\u003c/strong\u003e. Representative electron microscopy images of axons in the fimbria at 20,000× magnification. Genotypes: +/+, \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e; +/-, \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e. Scale bar = 1,600 nm. \u003cstrong\u003eB\u003c/strong\u003e. G-ratios plotted against axon diameters for 4,423 and 2,317 axons from 5 \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice and 3 \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e mice, respectively. All axons with closed myelin sheaths were analyzed using MyelTracer. The reciprocal function best fits the data distributions. G-ratios increased as a function of axon diameter (\u003cem\u003eoTbx1\u003c/em\u003e+/+, R = 0.6268, p \u0026lt; 0.001; \u003cem\u003eoTbx1\u003c/em\u003e+/−, R = 0.6491, p \u0026lt; 0.001). There was no significant difference in the axon diameter range for G-ratios between oTbx1+/+ and oTbx1+/− mice (genotype, p = 0.8131; genotype × axon diameter, p = 0.221). \u003cstrong\u003eC\u003c/strong\u003e. Average number (± SEM) of axons per image field versus axon diameter. Significant differences were observed between \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e and \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/− \u003c/sup\u003emice (c² (27) = 109.7085, p = 6.22 × 10⁻¹²), primarily due to a higher number of axons with diameters ≥300 nm and \u0026lt;800 nm and a lower number of axons with diameters ≥1,200 nm and \u0026lt;1,500 nm in \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e compared to \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice, as determined by Mann-Whitney U tests applied to this diameter range (*, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001; ****, p \u0026lt; 0.0001). The shift in axon sizes toward smaller to medium diameters in \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e compared to \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice resulted in a smaller average axon size for \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/− \u003c/sup\u003emice (Mann-Whitney non-parametric tests, p = 7.48 × 10⁻¹⁹). \u003cstrong\u003eD\u003c/strong\u003e. Differences in the percentage of myelinated axons for \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/−\u003c/sup\u003e versus oTbx1+/+ mice across axon diameters (Kolmogorov-Smirnov, p = 3.59 × 10⁻¹⁶).\u003c/p\u003e","description":"","filename":"floatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-9327970/v1/a51ac25fe6117bcdd6fad934.png"},{"id":107704915,"identity":"cef7c4a4-0a72-4c9d-a05a-0a8ec89056c4","added_by":"auto","created_at":"2026-04-24 09:03:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5109444,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9327970/v1/7061ec73-aadc-4074-aef7-a038ae47e816.pdf"},{"id":107247104,"identity":"66814b01-69b8-4b51-b28d-e4669eb28e80","added_by":"auto","created_at":"2026-04-19 08:11:58","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":163523,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-9327970/v1/82ef2cb1f34bdeb4b5252c3f.docx"},{"id":107484395,"identity":"f3a01a6a-15bb-4c41-97fa-7ae1e5ede685","added_by":"auto","created_at":"2026-04-22 02:31:51","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":3050549,"visible":true,"origin":"","legend":"","description":"","filename":"TableS3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9327970/v1/b9a44424808da2c08632495b.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003e\u003cem\u003eTbx1\u003c/em\u003e Heterozygosity in the Oligodendrocyte Lineage Shifts Myelinated Axon Composition in the Mouse Fimbria Without Behavioral Impairments\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCognitive and social impairments serve as predictors of mental illness(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Infants later diagnosed with autism spectrum disorder (ASD) exhibit delays and deviations in various aspects of motor, social, and language development(\u003cspan additionalcitationids=\"CR4 CR5 CR6 CR7 CR8 CR9 CR10\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). Similarly, children who later develop full-scale symptoms of schizophrenia show delays in the development of social cognition, working memory, attention, and processing speed(\u003cspan additionalcitationids=\"CR13 CR14 CR15\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e), and these deficits remain integral to the disorder following its onset(\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThese dimensional deficits in mental illness have genetic underpinnings. Copy number variations (CNVs)--which are deletions or duplications of up to several million base pairs at specific chromosomal loci encompassing numerous protein-coding genes\u0026ndash; present high odds ratios and penetrance rates for cognitive and social deficits(\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e) as well as mental illnesses(\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIndividuals carrying 1.5Mb to 3.0Mb hemizygous deletions of human chromosome 22q11.2 exhibit cognitive, social, and emotional impairments from childhood (\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e) and are diagnosed at elevated rates with anxiety disorders, attention-deficit hyperactivity disorder, ASD, intellectual disability, and schizophrenia(\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). Duplication of 22q11.2 is associated with epilepsy, ID, ADHD, and ASD at rates higher than those of non-carriers(\u003cspan additionalcitationids=\"CR30 CR31 CR32 CR33 CR34 CR35 CR36 CR37 CR38 CR39 CR40 CR41 CR42 CR43 CR44\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e). However, the mechanisms by which how more than 40 protein-coding genes in 22q11.2 contribute to dimensional deficits and clinical diagnoses remain poorly understood in humans.\u003c/p\u003e \u003cp\u003eSeveral rare inherited cases of variants in the human \u003cem\u003eTBX1\u003c/em\u003e gene, a T-box transcription factor gene located within the 22q11.2 CNV, are associated with ASD, schizophrenia, and intellectual disability in the absence of 22q11.2 CNVs(\u003cspan additionalcitationids=\"CR47 CR48 CR49 CR50\" citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e). However, due to their rarity, the statistical reliability of the association between \u003cem\u003eTBX1\u003c/em\u003e variants and mental illness is limited. Moreover, these patients often carry variants in other single genes throughout the genome(\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e), complicating the establishment of causality from these associations.\u003c/p\u003e \u003cp\u003eThe deletion or overexpression of small murine chromosomal regions or single genes orthologous to human chromosome 22q11.2 offers a complementary approach (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan additionalcitationids=\"CR53 CR54 CR55\" citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e). Constitutive overexpression of several hundred kilobase pair segments of the mouse ortholog of 22q11.2 recapitulates distinct social and cognitive deficits linked to 22q11.2 duplication(\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e), suggesting the presence of driver genes within this segment responsible for distinct behavioral phenotypes. \u003cem\u003eTbx1\u003c/em\u003e is one of the genes within a 200 kb segment of 22q11.2, overexpression and hemizygous deletion of which result in deficits in social behavior, repetitive behavior, and prepulse inhibition (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe heterozygous deletion of \u003cem\u003eTbx1\u003c/em\u003e alone results in impairments in neonatal social communication(\u003cspan additionalcitationids=\"CR59\" citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e), as well as post-pubertal and adult deficits in social interaction(\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e), social incentive learning(\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e), acoustic, but not non-acoustic, prepulse inhibition(\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e), spatial memory acquisition in the Morris water maze and the speed to complete simple discrimination and reversal phases of attentional set-shifting, in the absence of non-specific deficits of motor speed (\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e). The fimbria of post-pubertal \u003cem\u003eTbx1\u003c/em\u003e heterozygous mice displays a lack of large myelinated axons, enhanced myelination of medium-sized axons, a compositional shift of myelinated axons to smaller sizes, and a gene expression profile suggestive of defective oligodendrocyte precursor cells(\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e). Furthermore, the volume of the secondary motor cortex and amygdala, regions involved in the vocal network(\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e), is reduced in post-pubertal \u003cem\u003eTbx1\u003c/em\u003e heterozygous mice (\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e). Additionally, virally induced overexpression of \u003cem\u003eTbx1\u003c/em\u003e in the hippocampus negatively impacts the developmental maturation of working memory capacity(\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe cellular and developmental origins of the effects of \u003cem\u003eTbx1\u003c/em\u003e deficiency on oligodendrocyte precursor cells remain unknown. During the embryonic period, oligodendrocyte precursor cells emerge from embryonic neural progenitor cells in the medial ganglionic eminence of the ventricular zones around E12.5, followed by a second wave from the lateral ganglionic eminence at E15.5. Oligodendrocyte precursor cells continue to be generated from neural progenitor cells in the subventricular zone during the neonatal period (\u003cspan additionalcitationids=\"CR66 CR67 CR68\" citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSingle-cell transcriptomic analyses have revealed that \u003cem\u003eTbx1\u003c/em\u003e is expressed in a more diverse array of cell types than previously indicated by \u003cem\u003ein situ\u003c/em\u003e hybridization and immunocytochemical studies. In one analysis, involving 1.13\u0026nbsp;million cells from whole mouse embryos, \u003cem\u003eTbx1\u003c/em\u003e was detectable in mesodermal and ectodermal cells from E6.5 to E8.5, in ectodermal cells including those of the neural crest and neural tube at E8.25, in radial glial cells and oligodendrocytes at E10.5, and in neurons and oligodendrocytes at E10.5 and E12.5(\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e). In the mouse brain, \u003cem\u003eTbx1\u003c/em\u003e is detectable in cell clusters with signatures indicative of endothelial cells and Neurog2-positive radial glia at E18 and radial glial cells in the neonatal mouse brain(\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e). Similarly, another single-cell combinatorial indexing (sci)-RNA-seq analysis of approximately 2\u0026nbsp;million cells from mouse embryos at E9.5 to E13.3 identified \u003cem\u003eTbx1\u003c/em\u003e in endothelial cells, various types of neurons and their progenitors, neural progenitor cells, neural tube, and oligodendrocyte progenitor cells(\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e). Given that single-cell transcriptomic analyses are capable of detecting rare or transitional cell types with large numbers of cells, these studies suggest that \u003cem\u003eTbx1\u003c/em\u003e is present in radial glial cells and neural progenitor cells, as well as their progeny\u003c/p\u003e \u003cp\u003eOur previous work demonstrated that \u003cem\u003eTbx1\u003c/em\u003e heterozygosity initiated in neural progenitor cells during the neonatal period recapitulates some behavioral deficits associated with constitutive \u003cem\u003eTbx1\u003c/em\u003e heterozygosity(\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e). As neural progenitor cells during the neonatal period give rise to oligodendrocyte precursor cells, oligodendrocytes, neural progenitor cells, and neurons(\u003cspan additionalcitationids=\"CR66 CR67 CR68\" citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e), we sought to determine whether the effects of \u003cem\u003eTbx1\u003c/em\u003e heterozygosity within the oligodendrocyte lineage induces behavioral and anatomical phenotypes. Our findings indicate that \u003cem\u003eTbx1\u003c/em\u003e heterozygosity in the oligodendrocyte lineage induces a compositional shift in myelinated axons in the fimbria, while no affecting myelin integrity, large myelinated axons, or behavior. These results suggest a more critical role for \u003cem\u003eTbx1\u003c/em\u003e in neurogenesis lineage.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eMice\u003c/h2\u003e\n \u003cp\u003eAll protocols for animal handling and use were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Texas Health Science Center at San Antonio (UTHSCSA) in accordance with National Institutes of Health (NIH) guidelines. Mice were housed in a vivarium with a standard light phase from 7 am to 9 pm).\u003c/p\u003e\n \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eC57BL/6J mice\u003c/span\u003e: We used 1- and 2-month-old male C57BL6/J mice (Jax #000664, Jackson Laboratory, Bar Harbor, ME) as stimulus mice for social interaction.\u003c/p\u003e\n \u003cp\u003e\u003cspan type=\"ItalicUnderline\" class=\"ItalicUnderline\" name=\"Emphasis\"\u003ePdgfr\u0026alpha;\u003c/span\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eCre\u003c/span\u003e;\u003cspan type=\"ItalicUnderline\" class=\"ItalicUnderline\" name=\"Emphasis\"\u003eTbx1\u003c/span\u003e\u003csup\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e+/flox\u003c/span\u003e\u003c/sup\u003e \u003cspan type=\"ItalicUnderline\" class=\"ItalicUnderline\" name=\"Emphasis\"\u003em\u003c/span\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eice\u003c/span\u003e: To conditionally induce \u003cem\u003eTbx1\u003c/em\u003e heterozygosity in oligodendrocyte precursor cells, we chose a \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003eCre line that initiates Cre synthesis earlier than a \u003cem\u003eCspg4\u003c/em\u003eCre line to better induce recombination in the oligodendrocyte lineage(\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e). The \u003cem\u003ePdgfr\u0026alpha;-\u003c/em\u003e promoter drives Cre-based recombination most robustly in oligodendrocyte precursor cells (\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e), but also in astrocytes, neurons, fibroblast-like cells, endothelial cells, vascular and leptomeningeal cells, and pericytes in the mouse brain(\u003cspan additionalcitationids=\"CR75 CR76\" citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eWe crossed hemizygous \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003eCre mice with \u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e mice to generate \u003cem\u003ePdgfr\u0026alpha;Cre;Tbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e mice. \u003cem\u003ePdgfr\u0026alpha;Cre\u003c/em\u003e breeder mice (C57BL/6-Tg(\u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003e-Cre)1Clc/J; Jax #013148, Jackson Laboratory, Bar Harbor, ME) have a mixed C57BL/6J;C57BL/6N background. We backcrossed non-congenic \u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e mice(\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e) to C57BL/6J for more than 10 generations and confirmed that there was Cre-dependent recombination in a congenic \u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e mice(\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e). The genetic background of \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003eCre and \u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e lines were mixed C57BL/6J;C57BL/6N and C57BL/6J, respectively. These two C57BL/6 substrains have many behavioral differences(\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e). To avoid the confounding effects of their unequal genetic backgrounds(\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e), we used only an F1 generation derived from crosses of the \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003eCre and \u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e lines.\u003c/p\u003e\n \u003cp\u003e\u003cspan type=\"ItalicUnderline\" class=\"ItalicUnderline\" name=\"Emphasis\"\u003ePdgfr\u0026alpha;\u003c/span\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eCre\u003c/span\u003e;\u003cspan type=\"ItalicUnderline\" class=\"ItalicUnderline\" name=\"Emphasis\"\u003eROSA-tdTomato\u003c/span\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003emice\u003c/span\u003e: We crossed hemizygous \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003eCre mice (C57BL/6-Tg(\u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003eCre)1Clc/J; Jax #013148, Jackson Laboratory, Bar Harbor, ME) with homozygous congenic \u003cem\u003eROSA-CAG-tdTomato\u003c/em\u003e mice (B6.Cg-\u003cem\u003eGt(ROSA)26Sor\u003c/em\u003e\u003csup\u003e\u003cem\u003etm14(CAG\u0026minus;tdTomato)Hze\u003c/em\u003e\u003c/sup\u003e/J, Jax # 007914, Jackson Lab, Bar Harbor, ME) to generate \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003eCre;\u003cem\u003eROSA-CAG-tdTomato\u003c/em\u003e mice. This ROSA line expresses tdTomato in the hippocampus without the action of Cre ( \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://connectivity.brain-map.org/transgenic/experiment/81560256\u003c/span\u003e\u003c/span\u003e)\u003c/p\u003e\n \u003cp\u003eWe determined the genotypes of the mice using our previously published protocol with primers shown in \u003cstrong\u003eTable \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/strong\u003e. The sex of the mice was determined by inspection of their external genitalia.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eIn vitro\u003c/strong\u003e \u003cstrong\u003ecell culture of oligodendrocytes\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eLateral ventricle tissues, including the subventricular zone (SVZ), were obtained from postnatal day 1\u0026ndash;2 (P1-2) C57BL/6J pups. Cells were isolated in culture, with each culture derived from a single mouse. The cells were cultured in a medium (DMEM/F12, HEPES [11320\u0026ndash;032, Gibco, Grand Island, NY, USA]) supplemented with N2 (17502048, Gibco, Grand Island, NY, USA), B27 (17504044, Gibco, Grand Island, NY, USA), epidermal growth factor (EGF) at a concentration of 20 ng/ml (AF100-15, Peprotech, Cranbury, NJ, USA). After two to four passages, the cells were dissociated from the spheres using StemPro Accutase Cell Dissociation Reagent (A1110501, Gibco, Grand Island, NY, USA). The cells were then divided into equal portions and plated on each Poly-L-ornithine (P4957, Sigma, St. Louis, MO, USA) and Bovine Fibronectin (1030-FN, R\u0026amp;D Systems, Minneapolis, MN, USA)-coated 6well plate (Corning, 351146, Corning, NY, USA,). The cells were cultured for 144 hours in medium with 5% fetal bovine serum after withdrawing EGF from the medium to induce and maintain differentiation. At the time of EGF withdrawal, we applied \u003cem\u003eTbx1\u003c/em\u003e siRNA (10nM, cat#4390771, s74767, Invitrogen; Thermo Fisher Scientific, Waltham, MA, USA) and control siRNA-A (10nM, cat#4390843, Invitrogen; Thermo Fisher Scientific, Waltham, MA, USA) together with siLentFect\u0026trade; Lipid Reagent for RNAi, 0.5 ml (BIO-RAD, cat# 1703360, Hercules, CA, USA).\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eQuantitative reverse transcription polymerase chain reaction (qRT-PCR)\u003c/h3\u003e\n\u003cp\u003eIn accordance with our published procedure(\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e), total RNA was extracted using an RNeasy Plus Mini Kit (Cat#74134, Qiagen, Germantown, USA). Complementary DNA (cDNA) was synthesized from total RNA using SuperScript IV VILO Master Mix (Cat#11766050, Invitrogen, Carlsbad, USA). qRT-PCR reactions were performed in triplicate on a QuantStudio 6 Flex Real-Time PCR System (Cat#4485694, Applied Biosystems, Waltham, USA) using the TaqMan Fast Advanced Master Mix (Cat#4444963, Applied Biosystems, Waltham, USA). We used TaqMan\u0026reg; Gene Expression Assays (cat# 4331182, Thermo Fisher, Waltham, MA, USA). The Taqman probes are listed in the Supplementary Material (\u003cstrong\u003eTable S2\u003c/strong\u003e). Data were analyzed using the \u0026Delta;\u0026Delta;Ct method and normalized to the reference gene \u003cem\u003ePgk1\u003c/em\u003e; we had an identical pattern of results with another reference gene \u003cem\u003e18S\u003c/em\u003e.\u003c/p\u003e\n\u003ch3\u003eWhole brain tissue clearing and index matching\u003c/h3\u003e\n\u003cp\u003eWe used the SHIELD and SmartBatch+ (LifeCanvas Sciences, Cambridge, MA) standard pipelines for preserving and electrophoretic clearing(\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e) to visualize tdTomato in the brains of \u003cem\u003ePdgfra\u003c/em\u003eCre;ROSA-CAG-tdTomato mice. We performed transcardial perfusion of 1-month old mice with ice-cold 0.9% NaCl in dH\u003csub\u003e2\u003c/sub\u003eO, followed by 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS). Brains were preserved using SHIELD as follows: perfused brains were 1) removed from the cranium and fixed in 4% PFA in PBS overnight at 4\u0026deg;C with gentle shaking; 2) incubated in SHIELD OFF solution (dH\u003csub\u003e2\u003c/sub\u003eO\u0026thinsp;+\u0026thinsp;SHIELD Buffer [cat#SH-Bf] + SHIELD Epoxy Buffer [cat#SH-Ex]) solution at 4\u0026deg;C with gentle shaking for 3 days; 3) incubated in pre-warmed SHIELD ON Buffer (cat#SH-ON) at 37\u0026deg;C for 1 day with gentle shaking; 4) incubated in the delipidation buffer (cat#DB) for 3 days at 45\u0026deg;C with gentle shaking. Final clearing by electrophoresis was performed with the SmartBatch+ device, with the delipidation buffer inside the clearing cup containing the samples and conduction buffer (cat#CB) for 30 h. Cleared brains were index-matched using a solution of 50% EasyIndex (RI\u0026thinsp;=\u0026thinsp;1.52, cat#EI-500-1.52)\u0026thinsp;+\u0026thinsp;50% dH\u003csub\u003e2\u003c/sub\u003eO with shaking at 37\u0026deg;C for 1 day, then 100% EasyIndex for one additional day until brains were transparent(\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eLight sheet microscopy\u003c/h3\u003e\n\u003cp\u003eWe used a Zeiss Lightsheet 7 Microscope housed in the UTHSCSA Optical Imaging Core to perform volumetric light sheet imaging of cleared \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003eCre;ROSA-CAG-tdTomato brains using a pair of 5\u0026times;/0.1 focusing illumination objectives and a Fluar 2.5\u0026times;/0.12 detection objective at identical settings. Image tiles were stitched together using Zeiss Zen Blue software (ver 3.4). 3D volume analysis was performed with Imaris (Oxford Instruments, ver 10.02). Peak intensity of the tdTomato signal was segmented, and volumetric measurements (mm\u003csup\u003e3\u003c/sup\u003e) and peak intensities of the total volume (arbitrary units) were calculated for each volume in each mouse.\u003c/p\u003e\n\u003ch3\u003eImmunofluorescence\u003c/h3\u003e\n\u003cp\u003e\u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003eCre;ROSA-\u003cem\u003etdTomato\u003c/em\u003e mice were sacrificed at 1 month of age. Mice were deeply anesthetized using 4\u0026ndash;5% isoflurane and perfused transcardially with 0.9% saline followed by 4% PFA. Brains were extracted and post-fixed in 4% PFA overnight at 4\u0026deg;C, followed by cryoprotection in glycerol overnight at 4\u0026deg;C. Coronal 60-\u0026micro;m thick sections were cut with a freezing microtome. For immunofluorescence labeling, sections were washed in 0.1 M PBS, blocked with 5% normal donkey serum in PBS, and incubated overnight at room temperature, as we described previously(\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e, \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e). We used a well-validated primary rabbit antibody against myelin basic protein (1:200, MBP, ab40390, Abcam) and Donkey anti-rabbit IgG-Alexa Fluor 488 (1:200, A21206, Invitrogen), together with a nuclear marker (DAPI,1:25,000, D3571, Invitrogen). MBP is a marker of mature oligodendrocytes(\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e, \u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e). We captured images of sections that were mounted and cover-slipped with Vectashield\u0026reg; anti-fade mounting medium (H-1000) using a Keyence microscope (BZ-X800) microscope with BZX Hardware Module and Zeiss LSM 710 confocal microscope at the UT Health Optical Imaging Core.\u003c/p\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003eDouble staining of tdTomato with markers of oligodendrocytes\u003c/h2\u003e\n \u003cp\u003eWe captured a series of coronal brain sections from \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003eCre;\u003cem\u003eROSA-tdTomato\u003c/em\u003e mice using a Keyence BZ-X800 microscope with BZX Hardware Module and a Zeiss LSM 710 confocal microscope at the UT Health Optical Imaging Core. We used the DAPI signal to identify the anatomical boundaries of landmark structures in each image, cross-matched with equivalent levels in the Allen Brain Atlas (Allen Reference Atlas \u0026ndash; Mouse Brain [brain atlas]. Available from \u003cem\u003eatlas.brain-map.org\u003c/em\u003e). We then used a color scale to represent the level of tdTomato intensity within the delineated anatomical boundaries.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eBehavioral Analysis\u003c/h3\u003e\n\u003cp\u003eMale neonatal mice were tested for vocalization resulting from maternal separation at P8 and P12, followed by additional behavioral tests at 1 and 2 months of age, corresponding to peripubertal and post-pubertal, adolescent periods(\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e), respectively; early signs of puberty begin around 1 month of age(\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e). Because body weight can alter behavior in mice(\u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e) and \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003e regulates progenitor differentiation into adipocytes(\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e87\u003c/span\u003e, \u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e88\u003c/span\u003e), we measured body weight at the beginning of behavioral tests. Our behavioral battery included reciprocal social interaction, novel object approach, spontaneous alternation in a T-maze, elevated plus maze, and locomotor activity and thigmotaxis in an inescapable open field(\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan additionalcitationids=\"CR58\" citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e, \u003cspan additionalcitationids=\"CR90\" citationid=\"CR89\" class=\"CitationRef\"\u003e89\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e91\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eThe order of the behavioral assays was based on the stress level; tasks that in a home cage-like setting were given first (i.e., social interaction and novel object approach). T-maze and elevated plus maze tests permit choices and are thus considered less stressful than an inescapable open field. At least a one-day interval was provided between behavioral tests to reduce the likelihood of carryover effects(\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e, \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e, \u003cspan citationid=\"CR92\" class=\"CitationRef\"\u003e92\u003c/span\u003e), except for the T-maze, in which three different delays were given on three consecutive days.\u003c/p\u003e\n\u003cp\u003eMice were assigned randomly to experimental groups and tested during the light phase. Experimenters were blinded to genotypes. Social interaction, novel object approach, and behaviors in the elevated plus maze were recorded using a Basler GigE camera, with video images stored in Ethovision v18 software (Noldus Information Technology, Leesburg, VA). Video images of social interaction and novel object approach were manually scored according to our established criteria. Various parameters of the elevated plus maze were automatically analyzed by Ethovision. The time point of each arm entry was recorded for spontaneous alternation, and the data were subsequently tallied manually. Locomotor activity and thigmotaxis in an inescapable open field were analyzed using Med Associates Activity Monitor 7 Software (Fairfax, VT).\u003c/p\u003e\n\u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eUltrasonic vocalization\u003c/span\u003e Pups were tested for vocalization induced by maternal separation at postnatal days 8 and 12. A cage containing the mother and a litter was transferred to the test room 30 min before testing. Ultrasonic vocalization was recorded for 5 min by UltraSoundGate (Avisoft, Germany) connected to a computer equipped with Avisoft-RECORDER software (Avisoft, Germany) in a test chamber (18 cm long \u0026times; 18 cm wide \u0026times; 30 cm high). The sampling rate and lower cutoff frequency were set at 250 kHz (format, 16-bit) and 10 kHz, respectively. A frequency window from 15\u0026ndash;150 kHz was used for analysis. Call detection was provided by an automatic threshold-based algorithm and a hold-time mechanism (hold time\u0026thinsp;=\u0026thinsp;10 ms). Sonograms were inspected, and mechanical noises were eliminated from the analysis. We used the VocalMat software, which has the lowest false positive and false negative rates(\u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e93\u003c/span\u003e), to determine call types. This software typically detects only the most salient components of the harmonic call type and classifies this call type differently. As the harmonic call type is often affected in genetic mouse models of neuropsychiatric disorders(\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e, \u003cspan citationid=\"CR94\" class=\"CitationRef\"\u003e94\u003c/span\u003e), we manually inspected all call types and re-classified such cases as harmonic calls.\u003c/p\u003e\n\u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eReciprocal Social Interaction Test\u003c/span\u003e A test mouse and an age-matched unfamiliar C57BL/6J mouse as a stimulus subject were simultaneously placed in a cage (28.5 cm long \u0026times; 17.5 cm wide \u0026times; 12.5 cm high). Mouse behavior was recorded during two 5-min sessions with a 30-min interval between sessions. Video images were scored manually for affiliative and aggressive social interaction by a rater blinded to genotype. The following reciprocal social behaviors were scored by the duration of interaction (minimum of 1 s): aggressive (tail rattle, bite/kicks, sideway offense, boxing/wrestling), affiliative, non-aggressive (mount, pursuit, olfactory investigation, allogrooming, escape/leap), or passive (side-by-side, submissive). We analyzed the sum of time engaged in affiliative, active, and passive social interactions, but passive behavior was rarely seen in our experimental set-up (\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e, \u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e, \u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e91\u003c/span\u003e, \u003cspan citationid=\"CR94\" class=\"CitationRef\"\u003e94\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eNovel Object Approach\u003c/span\u003e A test mouse was placed in a cage (28.5 cm long \u0026times; 17.5 cm wide \u0026times; 12.5 cm high) with an empty, non-secured 50-mL Falcon tube (3 cm diameter \u0026times; 8.5 cm long) lying on its side. Video images of mouse interactions with the tube were used to manually score approach behavior by two independent analysts blinded to genotype with an inter-rater reliability of \u0026gt;\u0026thinsp;99%. Approach behavior was scored for olfactory or non-olfactory investigations with a minimum duration of 1 s. Time spent near the tube was also analyzed.\u003c/p\u003e\n\u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eSpontaneous Alternation in a T-Maze\u003c/span\u003e A test mouse was placed in the start site of the long arm of a black plexiglass T-maze (21.5 cm long \u0026times; 10.5 cm wide \u0026times; 20.5 cm high) and allowed to enter the maze and explore either the left or right short arms (31 cm long \u0026times; 10.25 cm wide \u0026times; 20.5 cm high) of the cage. We imposed 0 s, 15 s, or 30 s interval delays to maze reentry for ten trials, and the three interval trials were given on three consecutive days. We manually scored the percentages of alternation and latency to reach the alternated and non-alternated arms.\u003c/p\u003e\n\u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eElevated Plus Maze Test\u003c/span\u003e Mice were placed in the center stage (5 \u0026times; 5 cm) of the maze apparatus with four arms (30 \u0026times; 5 cm) and permitted to explore two closed arms and two open arms extending from the center platform of the maze for 5 min. The maze was positioned 53 cm above the floor. The time spent in visits and the frequency of visits to the two open and two closed arms were analyzed.\u003c/p\u003e\n\u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eOpen Field\u003c/span\u003e Mice were placed in an open-field cage (27.3 cm \u0026times; 27.3 cm \u0026times; 20.2 cm; Med Associates, Fairfax, VT) and permitted to explore the cage for 30 min. We measured the distance and velocity of motor activity and duration of time spent in the center (19.05 cm \u0026times; 19.05 cm central square) versus the margin of an open field, using the activity monitor software (Med Associates, Fairfax, VT).\u003c/p\u003e\n\u003ch3\u003eElectron Microscopy (EM)\u003c/h3\u003e\n\u003cp\u003eWe prepared tissue for EM to characterize myelination in the fimbria of \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003eCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e mice as we described previously(\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e). After behavioral assays were completed at 1 and 2 months of age, 4\u0026ndash;5-month-old male \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003eCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e (N\u0026thinsp;=\u0026thinsp;3) and five control mice, including \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003eCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e (N\u0026thinsp;=\u0026thinsp;2), wild-type (WT);\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e (N\u0026thinsp;=\u0026thinsp;2), and WT;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e (N\u0026thinsp;=\u0026thinsp;1), were anesthetized with 4.5% isoflurane in a chamber, and anesthesia was maintained by a nose cone with 2.0% isoflurane. The animals were transcardially perfused with 120 mL of 0.9% saline followed by fixation with 120 mL of 0.1 M buffer (pH 7.4; cat#11653 Electron Microscopy Science, Hatfield, PA) with 2.5% sodium glutaraldehyde (cat#16310, Electron Microscopy Sciences, Hatfield, PA) and 2.5% paraformaldehyde (cat#19202, Electron Microscopy Sciences, Hatfield, PA). Brains were extracted and post-fixed in the same solution at 4\u0026deg;C for 7 weeks. The fimbria from the two hemispheres were obtained separately using a vibratome and placed in 0.1 M sodium cacodylate buffer overnight. Tissues were rinsed with 0.1 M sodium cacodylate buffer to remove aldehydes and placed in 2% osmium tetroxide solution (OsO\u003csub\u003e4\u003c/sub\u003e; cat#19150, Electron Microscopy Sciences, Hatfield, PA) in 0.1 M sodium cacodylate buffer for 1 h. Tissues were dehydrated in a series of ethanol solutions and embedded in molds containing Polybed resin (Poly/Red\u0026reg; 812 Embedding media, cat#08791\u0026thinsp;\u0026minus;\u0026thinsp;500 Polysciences, Inc., Warrington, PA). We cut 100-nm sections and collected them on square 150-mesh copper grids (cat#7551C, Polysciences, Inc., Warrington, PA) and stained them with uranyl acetate (7 g in 100 mL deionized water)/Reynold\u0026rsquo;s lead citrate (1.33 g lead nitrate,1.76 g sodium citrate in 30 mL triple-distilled water, 8 mL 1 N NaOH). Uranyl acetate stains membranous structures and structures containing nucleic acid; lead citrate binds to RNA-containing structures and the hydroxyl groups of carbohydrates.\u003c/p\u003e\n\u003cp\u003eEach fimbria section was viewed in the EM grid squares. Images were screened at 1,000\u0026times; magnification. For each section, we used all grid images that contained fimbria tissue with round axons without wrinkles, folds, or tears in the sections. One image was captured at the center of each grid field at 20,000\u0026times; magnification. Images were analyzed by MyelTracer(\u003cspan citationid=\"CR95\" class=\"CitationRef\"\u003e95\u003c/span\u003e). Only axons whose myelin was fully within the image were analyzed quantitatively.\u003c/p\u003e\n\u003cp\u003eWe obtained multiple images for each animal from a section of the right and left hemispheres. The positions of sections sliced from the fimbria varied between the two hemispheres and did not necessarily match the two sides; in one case, only one hemisphere was available because of the accidental loss of a tissue slice. The number of images varied across tissue slices, resulting in unequal image numbers. Many axons from each grid square and many grid squares from each hemisphere were analyzed for each animal. As the number of images and positions of each image varied between the two hemispheres and did not match between the two sides, the hemisphere could not be used as a replicate. Thus, we pooled data for each animal as a technical replicate; data points within and across images were technical replicates. As there was considerable variability in the data, we could not average the values for each animal. The averages of the total axon diameter per genotype were also not appropriate for this data set, as axon numbers differed between genotypes at specific axon diameters (\u0026ge;\u0026thinsp;300 nm to \u0026lt;\u0026thinsp;400 nm; \u0026ge;1,200 nm to \u0026lt;\u0026thinsp;1300 nm) (genotype \u0026times; axon diameter range, F(27,5880)\u0026thinsp;=\u0026thinsp;6.336, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;1.0 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e). Thus, linear mixed models were used, as reported previously(\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e). Data were assessed for the number of myelinated axons, the thickness of myelination, and the g-ratio along a 100 nm unit axon diameter. Data from different images and hemispheres were embedded in random models.\u003c/p\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003eStatistical Analysis\u003c/h2\u003e\n \u003cp\u003eWe used SPSS (v29.0.2.0 (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e), IBM Corporation) to perform all statistical analyses. Among-group and between-group comparisons of the data were performed using analysis of variance (ANOVA) and Student\u0026rsquo;s two-tailed t-test (\u0026alpha;\u0026thinsp;=\u0026thinsp;0.05). We determined normality and homogeneity of variance using the Shapiro-Wilk test and Levene\u0026rsquo;s homogeneity of variance test, respectively If either assumption was violated, we analyzed the data using a linear mixed model, Kruskal Wallis tests, or Mann\u0026ndash;Whitney U tests. The Greenhouse\u0026ndash;Geisser correction was applied if sphericity was violated and the estimated epsilon was less than 0.75. If multiple tests were applied to a data set, the significance level was adjusted using the Benjamini\u0026ndash;Hochberg correction, with a false discovery rate of 5%. We used GraphPad Prism software (v9; GraphPad Software, San Diego, CA) to generate all graphs. All statistical analyses are presented in Table S3.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eData Availability\u003c/h2\u003e\n \u003cp\u003eAll data that support the findings and conclusions are provided within the article. All raw data and additional information are available upon request.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"List of abbreviations","content":"\u003cp\u003eCNVs, Copy number variations\u003c/p\u003e\n\u003cp\u003eASD, Autism Spectrum disorder\u003c/p\u003e\n\u003cp\u003escRNA-seq, single cell RNA-seq\u003c/p\u003e\n\u003cp\u003ePdgfra, Platelet-derived growth factor receptor alpha\u003c/p\u003e\n\u003cp\u003eMAG, Myelin associated glycoprotein\u003c/p\u003e\n\u003cp\u003eMOG, Myelin oligodendrocyte glycoprotein,\u003c/p\u003e\n\u003cp\u003eMBP, myelin basic protein\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll protocols for animal handling and use were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Texas Health Science Center at San Antonio (UTHSCSA) in accordance with National Institutes of Health (NIH) guidelines.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data and materials are available upon request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eT. Takano, GK, ME, TH, and NH were supported by the National Institute of Health (R01MH099660; R01DC015776). T. Tanifuji was supported by SENSHIN Medical Research Foundation and Uehara Memorial Foundation. QS and MAB were supported by the National Institute of Health (R01GM063074). AMW was funded by F30MH134482, UT Health San Antonio CTSA T32 (T32R004545), UT Health San Antonio Neuroscience T32 (T32NS082145), STX-MSTP (NIH T32GM113896/T32GM145432), and SfN NSP Fellowship (R25NS089462). The Zeiss Lightsheet 7 microscope was funded by the NIH S10 grant 1S10OD030383. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAnne Marie Wells: Conducted lightsheet brain analysis, perfused mice and applied MyelTracer to images for electron microscopy, genotyping, social interaction assessments, and manuscript writing.\u003c/p\u003e\n\u003cp\u003eTakaki Tanifuji: Performed qRT-PCR analysis, immunofluorescent staining, confocal imaging and analyses, electron microscopy image capturing, and figure preparation.\u003c/p\u003e\n\u003cp\u003eTakeshi Takano: Conducted statistical analyses and prepared all figures except for immunofluorescent images.\u003c/p\u003e\n\u003cp\u003eArumu Endo: Performed qRT-PCR analysis and figure preparation.\u003c/p\u003e\n\u003cp\u003eGina Kang: Conducted all behavioral testing.\u003c/p\u003e\n\u003cp\u003eMarisa Esparza: Managed breeder maintenance, ensured quality control of data input, performed statistical analyses, conducted mouse perfusion, and carried out genotyping.\u003c/p\u003e\n\u003cp\u003eQian Shi: Responsible for electron microscopy preparation and manuscript writing.\u003c/p\u003e\n\u003cp\u003eManzoor A. Bhat: Engaged in electron microscopy preparation and manuscript writing.\u003c/p\u003e\n\u003cp\u003eNoboru Hiroi: Designed all experiments, supervised all personnel, prepared electron microscopy samples, captured electron microscopy images, performed immunofluorescent staining, and prepared figures for immunofluorescent staining and wrote the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe LifeCanvas device was purchased with generous donations by 10 scientists at UT Health San Antonio. We thank Dr. Bernice Morrow for providing \u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e breeders, Ms. Monica D. Alarcon for technical assistance with EM analysis, and Dr. Lacey B. Sell for her help with MyelTracer software.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eEffects of\u003c/span\u003e \u003cspan type=\"ItalicUnderline\" class=\"ItalicUnderline\" name=\"Emphasis\"\u003eTbx1\u003c/span\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eKnockdown on Markers of Oligodendrocyte Lineage\u003c/span\u003e \u003cspan type=\"ItalicUnderline\" class=\"ItalicUnderline\" name=\"Emphasis\"\u003eIn Vitro\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003eWe first determined the earliest step along the oligodendrocyte lineage at which \u003cem\u003eTbx1\u003c/em\u003e deficiency has an effect. To this end, we developed an \u003cem\u003ein vitro\u003c/em\u003e screening assay that capitalizes on the capacity of neonatal neural progenitor cells, derived from the subventricular zone of C57BL/6J pups sacrificed on postnatal day 2, to generate neuronal precursor cells and oligodendrocyte precursor cells(\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e). We evaluated the expression of \u003cem\u003eCspg4\u003c/em\u003e, a marker of oligodendrocyte precursor cells, as well as \u003cem\u003eMag, Mbp, Mog\u003c/em\u003e, and \u003cem\u003ePlp1\u003c/em\u003e, which are markers indicative of maturing and mature myelinating oligodendrocytes (\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e), at 144 hours after EGF withdrawal (i.e., differentiation) and \u003cem\u003eTbx1\u003c/em\u003e siRNA application.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eTbx1\u003c/em\u003e siRNA significantly reduced mRNA levels of \u003cem\u003eTbx1, Cspg4\u003c/em\u003e, and all markers of mature oligodendrocytes, with \u003cem\u003ePgk1\u003c/em\u003e as (Fig.\u0026nbsp;1) and \u003cem\u003e18S\u003c/em\u003e (\u003cstrong\u003eTable S3-Figure 1\u003c/strong\u003e) as reference genes. These \u003cem\u003ein vitro\u003c/em\u003e findings are consistent with our \u003cem\u003ein vivo\u003c/em\u003e data indicating that \u003cem\u003eCspg4\u003c/em\u003e (also known as \u003cem\u003eNg2\u003c/em\u003e) was reduced in the fimbria of \u003cem\u003eTbx1\u003c/em\u003e heterozygous mice(\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eAs our culture includes both neuronal (\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e) and oligodendrocyte (see \u003cstrong\u003eFig.\u0026nbsp;1\u003c/strong\u003e) lineages, as well as remaining neural progenitor cells, how \u003cem\u003eTbx1\u003c/em\u003e knockdown induces changes in the expression of myelin marker genes remains unclear. \u003cem\u003eTbx1\u003c/em\u003e knockdown in oligodendrocyte precursor cells may reduce myelin markers in a cell-autonomous manner; alternatively, reductions in \u003cem\u003eTbx1\u003c/em\u003e in neonatal neural progenitor cells or their neuronal progeny may indirectly regulate these markers of oligodendrocytes.\u003c/p\u003e\n\u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eLocalization of Recombination in\u003c/span\u003e \u003cspan type=\"ItalicUnderline\" class=\"ItalicUnderline\" name=\"Emphasis\"\u003ePdgfr\u0026alpha;-Cre\u003c/span\u003e;\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eROSA-tdTomato Mice\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003eGiven our data suggesting that \u003cem\u003eTbx1\u003c/em\u003e deficiency begins to affect the stage of oligodendrocyte precursor cells (see \u003cstrong\u003eFig.\u0026nbsp;1\u003c/strong\u003e), we initiated \u003cem\u003eTbx1\u003c/em\u003e heterozygosity in oligodendrocyte precursor cells using a conditional heterozygous mouse model, where Cre-based initiation of \u003cem\u003eTbx1\u003c/em\u003e heterozygosity is guided by the promoter of \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003e, a gene expressed in oligodendrocyte precursor cells of both embryonic and post-embryonic origins. We first assessed the extent of \u003cem\u003ePdgfr\u0026alpha;Cre\u003c/em\u003e-mediated recombination throughout the brain, employing a tissue clearing technique (SmartBatch+) and conducting lightsheet microscopy to visualize the 3D volume of tdTomato signals in the brains of Pdgfr\u0026alpha;Cre;ROSA-tdTomato mice (Fig.\u0026nbsp;2\u003cstrong\u003eA\u003c/strong\u003e). The highest levels of tdTomato expression were observed in a pair of arch-shaped structures located along the lateral and third ventricles. Additionally, clusters of tdTomato signals were detected on the ventral surface of the posterior brain, while lower levels of signals were seen throughout other regions.\u003c/p\u003e\n\u003cp\u003eTo identify brain regions with tdTomato signals in Pdgfr\u0026alpha;Cre;ROSA-tdTomato mice, we analyzed a series of coronal sections from 1-month-old Pdgfr\u0026alpha;Cre;ROSA-tdTomato mice. High levels of tdTomato signals were present in the striatum, superficial layers of the neocortex (Fig.\u0026nbsp;2\u003cstrong\u003eBC\u003c/strong\u003e), choroid plexus within the lateral ventricle (Fig.\u0026nbsp;2\u003cstrong\u003eED\u003c/strong\u003e) and the fimbria (Fig.\u0026nbsp;2\u003cstrong\u003eF\u003c/strong\u003e). This expression pattern, driven by the \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003e promoter, is consistent with previously reported distributions of \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003e mRNA and protein, as well as recombination activity associated with the \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003e promoter in the mouse brain (\u003cspan additionalcitationids=\"CR97\" citationid=\"CR96\" class=\"CitationRef\"\u003e96\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR98\" class=\"CitationRef\"\u003e98\u003c/span\u003e). Moreover, the most intense staining of the choroid plexus is consistent with the intensely tdTomato+ structures resembling the shapes of the lateral and third ventricles (see \u003cstrong\u003eFig.\u0026nbsp;2A\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eEmbryonic Pdgfra-positive cells give rise to distinct pre-oligodendrocyte precursor cells by the perinatal period, but they exhibit similar profiles by postnatal and adult periods(\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e, \u003cspan citationid=\"CR99\" class=\"CitationRef\"\u003e99\u003c/span\u003e). PdgfraCre is expected to induce recombination in oligodendrocyte precursor cells(\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e). Once tdTomato is expressed through recombination in the PdgfraCre;ROSA-tdTomato mouse line, it remains expressed in their progeny, such as mature oligodendrocytes and myelinated fibers. As myelination of the fimbria is selectively affected in constitutive \u003cem\u003eTbx1\u003c/em\u003e heterozygous mice(\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e), we examined whether tdTomato was colocalized with MBP, a marker of mature oligodendrocytes and myelinated fibers, in the fimbria(\u003cspan citationid=\"CR100\" class=\"CitationRef\"\u003e100\u003c/span\u003e). MBP-positive fibers were present throughout the fimbria (Fig.\u0026nbsp;3\u003cstrong\u003eAB\u003c/strong\u003e). TdTomato signals were more prominent laterally than medially (Fig.\u0026nbsp;3\u003cstrong\u003eC\u003c/strong\u003e) and was colocalized with MBP-positive fibers (Fig.\u0026nbsp;3\u003cstrong\u003eD\u003c/strong\u003e) in the fimbria. These data establish that tdTomato triggered by PdgfraCre in PdgfraCre;ROSA-tdTomato mice is present in myelinated fibers in the fimbria.\u003c/p\u003e\n\u003cp\u003eIntense tdTomato signals were present in the choroid plexus located laterally to the lateral surface of the fimbria (Fig.\u0026nbsp;2\u003cstrong\u003eD\u003c/strong\u003e). The cell types in the mouse choroid plexus that express \u003cem\u003ePdgfra\u003c/em\u003e include fibroblasts, mural cells, and endothelial cells in the embryo, and fibroblasts, macrophages from the post-embryonic period in the mouse brain; while gene profiles indicative of oligodendrocyte precursor-like cells are detectable during the embryonic period, their genuine location within the choroid plexus remains unclear (\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e, \u003cspan additionalcitationids=\"CR102\" citationid=\"CR101\" class=\"CitationRef\"\u003e101\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR103\" class=\"CitationRef\"\u003e103\u003c/span\u003e). The robust tdTomato signal observed in the choroid plexus at 1 month of age likely originates from some or all of these cell types.\u003c/p\u003e\n\u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eEffects of\u003c/span\u003e \u003cspan type=\"ItalicUnderline\" class=\"ItalicUnderline\" name=\"Emphasis\"\u003eTbx1\u003c/span\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eHeterozygosity in Oligodendrocyte Precursor Cells on Behaviors\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003eThe rate of growth could affect behavior; Pdgfr\u0026alpha;Cre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e, termed o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e mice, may exhibit developmental delays, and their phenotypes could reflect a delayed development compared to their wild-type littermates. However, neonatal o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e and o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e mice demonstrated indistinguishable increases in body weights (\u003cstrong\u003eFigure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eTo determine how \u003cem\u003eTbx1\u003c/em\u003e heterozygosity in oligodendrocyte precursor cells and their progeny affects behavior, mice were tested for social communication during the neonatal period and a battery of social, cognitive, anxiety-related, and motor behaviors at one and two months of age, as myelination peaks around the fourth to fifth postnatal week in rodents(\u003cspan citationid=\"CR104\" class=\"CitationRef\"\u003e104\u003c/span\u003e, \u003cspan citationid=\"CR105\" class=\"CitationRef\"\u003e105\u003c/span\u003e) and mice reach adolescence around 2 months of age(\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e). Constitutive \u003cem\u003eTbx1\u003c/em\u003e heterozygous mice exhibit impairments in 1) neonatal social communication as early as P7, 2) social behaviors, 3) working memory/cognitive flexibility in a T-maze and attentional set shifting, and 4) affect-related behaviors in an inescapable open field, though not in an elevated plus maze(\u003cspan additionalcitationids=\"CR59 CR60 CR61\" citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e) around adolescence.\u003c/p\u003e\n\u003cp\u003eWe first measured differences among the three control mice: PdgfraCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+,\u003c/sup\u003e WT;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e, and WT;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e. There was no significant difference among the controls for any behavioral measure, expect for three time points of total margin time in the open field (see \u003cstrong\u003eTable S3-Figure 8B\u003c/strong\u003e); therefore, we collapsed all the control genotypes into a single control group as \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e for comparison with \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e (\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eConstitutive \u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e mice exhibit various neonatal, peri-adolescent, and postnatal behavioral phenotypes(\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e). Therefore, we tested mice for neonatal ultrasonic vocalization on P8 and P12\u0026ndash;P13 and performed additional tests with peripubertal (1 month) and adolescent (2 months) mice with 1\u0026ndash;2 day intervals between tasks to mitigate potential carryover effects of prior testing(\u003cspan citationid=\"CR92\" class=\"CitationRef\"\u003e92\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eWe found no differences among o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e pups in the number, percentage, and duration of various neonatal vocal call types on P8 and P12 (Fig.\u0026nbsp;4\u003cstrong\u003eA\u0026ndash;C\u003c/strong\u003e). At 1 and 2 months of age, mice were sequentially tested for social interaction, novel object approach, spontaneous alternation in a T-maze, anxiety-related behavior in an elevated plus maze, and locomotor activity and thigmotaxis in an inescapable open field. \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e mice and o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice were indistinguishable in social interaction (Fig.\u0026nbsp;5\u003cstrong\u003eA\u003c/strong\u003e) and novel object approach (Fig.\u0026nbsp;5\u003cstrong\u003eB\u003c/strong\u003e). In a T-maze, o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e mice, at 1 month of age exhibited better spontaneous alternation rates at the longest delay (Fig.\u0026nbsp;6\u003cstrong\u003eA\u003c/strong\u003e); otherwise, o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e and o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e mice were indistinguishable in rates of spontaneous alternation at 2 months of age and in latencies to correct choices at 1 and 2 months of age (Fig.\u0026nbsp;6\u003cstrong\u003eB\u0026ndash;D\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eThe two genotypes were indistinguishable in the percentage of time spent in open arms (Fig.\u0026nbsp;7\u003cstrong\u003eA\u003c/strong\u003e) and visits to open arms (Fig.\u0026nbsp;7\u003cstrong\u003eB\u003c/strong\u003e) of the elevated plus maze.\u003c/p\u003e\n\u003cp\u003eWe evaluated motor activity and anxiety-related behavior in the stressful open-field task(\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e) where there is no opportunity to escape to closed space. In this task, o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e and o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice were indistinguishable in distance traveled at both 1 month and 2 months of age (Fig.\u0026nbsp;8\u003cstrong\u003eA,B\u003c/strong\u003e) and time spent in the margin zone (Fig.\u0026nbsp;8\u003cstrong\u003eC,D\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eWhile conditional \u003cem\u003eTbx1\u003c/em\u003e heterozygosity in the oligodendrocyte cell lineage resulted in improved spontaneous alternation with the longest inter-trial delay at one month of age, this phenotype contrasts with the impaired spontaneous alternation observed in constitutive \u003cem\u003eTbx1\u003c/em\u003e heterozygous mice (\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e). Moreover, this conditional \u003cem\u003eTbx1\u003c/em\u003e heterozygosity did not replicate the altered neonatal vocalizations, peri-adolescent or postnatal social interaction deficits, or heightened responses to novel, non-social objects or thigmotaxis seen in constitutive \u003cem\u003eTbx1\u003c/em\u003e heterozygous mice(\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eEffects of\u003c/span\u003e \u003cspan type=\"ItalicUnderline\" class=\"ItalicUnderline\" name=\"Emphasis\"\u003eTbx1\u003c/span\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eHeterozygosity in Oligodendrocyte Precursor Cells on Myelinated Axons in the Fimbria\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003eAfter behavioral testing, we examined myelinated axons in the fimbria using electron microscopy. Constitutive \u003cem\u003eTbx1\u003c/em\u003e heterozygosity selectively alters the ultrastructure in the fimbria, resulting in a higher proportion of myelinated axons measuring 200\u0026ndash;600 nm diameter and a lower proportion of axons\u0026thinsp;\u0026ge;\u0026thinsp;700 nm and \u0026lt;\u0026thinsp;1,200 nm diameters. Furthermore, the 700\u0026ndash;1,500 nm axons exhibited a thicker myelin sheath, with no larger myelinated axons observed in constitutive \u003cem\u003eTbx1\u003c/em\u003e heterozygous mice (\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e). We evaluated whether the ultrastructural alterations of the fimbria of constitutive \u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e mice were recapitulated in o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e mice.\u003c/p\u003e\n\u003cp\u003eDensely packed axons were observed in the fimbria (Fig.\u0026nbsp;9\u003cstrong\u003eA\u003c/strong\u003e). To determine relative myelin thickness, we compared the ratio of the inner axon diameter to the outer fiber diameter (i.e., the g-ratio) (Fig.\u0026nbsp;9\u003cstrong\u003eB\u003c/strong\u003e). As was the case with constitutive \u003cem\u003eTbx1\u003c/em\u003e mice, the g-ratio plateaued at approximately 0.8, the ratio for optimal signal conductance in the brain (\u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e88\u003c/span\u003e). However, no differences were observed in g-ratios between o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e mice and o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice across the entire range of axon diameters.\u003c/p\u003e\n\u003cp\u003eWe separately determined the number and proportion of axons of different diameters. The fimbria of o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e mice contained more axons of \u0026ge;\u0026thinsp;300 nm and \u0026lt;\u0026thinsp;800 nm diameters but fewer axons of \u0026gt;\u0026thinsp;1,200 nm and \u0026lt;\u0026thinsp;1,500 nm diameters compared to o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice (Fig.\u0026nbsp;9\u003cstrong\u003eC\u003c/strong\u003e). Consequently, the curve for the relative proportions of axons (y-axis) versus axon diameter (x-axis) shifted to the left in o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e mice, compared to o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice (Fig.\u0026nbsp;9\u003cstrong\u003eD\u003c/strong\u003e). Consistent with g-ratios, myelin thickness was indistinguishable between o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e mice and \u003cem\u003eoTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice across all axon diameters (\u003cstrong\u003eFigure S2\u003c/strong\u003e). Thus, conditional \u003cem\u003eTbx1\u003c/em\u003e heterozygosity initiated in oligodendrocyte precursor cells selectively shifted the relative proportion of small to medium myelinated axons in the fimbria but did not affect myelin thickness.\u003c/p\u003e\n\u003cp\u003eIn summary, conditional \u003cem\u003eTbx1\u003c/em\u003e heterozygosity in the oligodendrocyte lineage shifted the proportion of myelinated axons to smaller sizes without affecting the thickness of myelin in the fimbria.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe objective of this study was to delineate the cellular origin(s) of the diverse behavioral and myelin phenotypes observed in constitutive \u003cem\u003eTbx1\u003c/em\u003e heterozygous mice(\u003cspan additionalcitationids=\"CR59 CR60 CR61\" citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e). As some of these behavioral phenotypes are recapitulated by initiating \u003cem\u003eTbx1\u003c/em\u003e heterozygosity in neonatal progenitor cells (\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e) and neonatal neural progenitor cells in the subventricular zone are responsible for generating neurons and oligodendrocytes during the neonatal period (\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e, \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e, \u003cspan citationid=\"CR106\" class=\"CitationRef\"\u003e106\u003c/span\u003e), we reasoned that \u003cem\u003eTbx1\u003c/em\u003e deficiency in neonatal neural progenitor cells, neuronal lineage from neural progenitor cells, or oligodendrocyte lineage from oligodendrocyte precursor cells contributes to the observed myelin and associated behavioral phenotypes. This study aimed to investigate the impact of \u003cem\u003eTbx1\u003c/em\u003e heterozygosity in the oligodendrocyte lineage on the behavioral and ultrastructural phenotypes.\u003c/p\u003e\n\u003cp\u003eTo achieve this objective, we crossed \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003eCre mice with congenic \u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e mice to generate \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003eCre;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e (o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;)\u003c/sup\u003e mice. We evaluated a range of social, cognitive, anxiety-related, and motor behaviors, along with the ultrastructural composition of myelin and axons in the fimbria. The o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e mice selectively replicated the altered axon sizes in the fimbria observed in constitutive \u003cem\u003eTbx1\u003c/em\u003e heterozygous mice. In contrast, while o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e exhibited improved spontaneous alternation following a 30-second delay at one month of age\u0026mdash;indicative of enhanced working memory and cognitive flexibility\u0026ndash; this was contrary to the impaired spontaneous alternation observed in constitutive \u003cem\u003eTbx1\u003c/em\u003e heterozygous mice. This observation supports that suggestion that the final phenotype arises from the cumulative effects of various contributory and opposing factors (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eOther phenotypes associated with constitutive \u003cem\u003eTbx1\u003c/em\u003e heterozygosity were absent in o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e mice, including neonatal social communication, responses to social or non-social stimuli, and anxiety-like behaviors in an elevated plus maze and thigmotaxis. These findings indicate that \u003cem\u003eTbx1\u003c/em\u003e in the oligodendrocyte lineage does not significantly influence the phenotypes. Combined with the observation that \u003cem\u003eTbx1\u003c/em\u003e heterozygosity initiated in neonatal (P1\u0026ndash;P5) neural progenitor cells at P1-P5, but not P21\u0026ndash;P25, recapitulates the social and cognitive deficits observed in constitutive \u003cem\u003eTbx1\u003c/em\u003e heterozygous mice (\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e), the current negative data suggest that \u003cem\u003eTbx1\u003c/em\u003e in neonatal neural progenitor cells or their neuronal lineage may play a principal role in determining the final phenotype (\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eThe fimbria of o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e mice had more axons of \u0026ge;\u0026thinsp;300 nm and \u0026lt;\u0026thinsp;800 nm diameter and fewer axons of \u0026ge;\u0026thinsp;1,200 nm and \u0026lt;\u0026thinsp;1,500 nm diameter than o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice. This was similar to the increase in axons of \u0026ge;\u0026thinsp;200 nm and \u0026lt;\u0026thinsp;400 nm and the decrease in axons of \u0026ge;\u0026thinsp;700 nm and \u0026lt;\u0026thinsp;1,700 nm axons in constitutive \u003cem\u003eTbx1\u003c/em\u003e heterozygous mice. The medium-size axons of constitutive \u003cem\u003eTbx1\u003c/em\u003e heterozygous mice have increased myelin thickness and lack large (\u0026ge;\u0026thinsp;1,700 nm) myelinated axons in the fimbria(\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e), but these characteristics were absent in o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e mice. This selective change in the axon phenotype could result from widespread activities of the \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003e promoter in many cell types and regions. Although \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003eCre induces recombination in oligodendrocyte precursor cells, it also triggers recombination in neurons, astrocytes, pericytes, ependyma, perivascular mesenchymal cells, and other cells(\u003cspan additionalcitationids=\"CR75 CR76\" citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e, \u003cspan citationid=\"CR97\" class=\"CitationRef\"\u003e97\u003c/span\u003e, \u003cspan citationid=\"CR107\" class=\"CitationRef\"\u003e107\u003c/span\u003e, \u003cspan citationid=\"CR108\" class=\"CitationRef\"\u003e108\u003c/span\u003e). \u003cem\u003eTbx1\u003c/em\u003e heterozygosity in neurons might underlie the shift in the axonal composition of neurons. The correlation between altered spontaneous alternation and the increased proportion of small-to-medium myelinated axons in the fimbria does not necessarily indicate causality by oligodendrocyte precursor cells. \u003cem\u003ePdgfra\u003c/em\u003eCre-induced recombination could have affected phenotypes through other cell types and their progenies in other brain regions. In the mouse brain, \u003cem\u003eTbx1\u003c/em\u003e is not detectable in astrocytes or microglia; however, it is significantly present in endothelial cells and neural progenitor cells. Additionally, \u003cem\u003eTbx1\u003c/em\u003e can be detected in immature neurons as well as both excitatory and inhibitory neurons at various developmental stages, ranging from embryonic development to adulthood(\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e, \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e, \u003cspan citationid=\"CR109\" class=\"CitationRef\"\u003e109\u003c/span\u003e, \u003cspan citationid=\"CR110\" class=\"CitationRef\"\u003e110\u003c/span\u003e). Further research is necessary to elucidate the effects of Tbx1 in different cell types on phenotypic outcomes.\u003c/p\u003e\n\u003cp\u003eSeveral interpretative limitations warrant attention. The general absence of phenotypes may be attributed to the high mortality rate of o\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/-\u003c/sup\u003e litters, potentially biasing our sample toward mice that were less affected by or recovered more quickly from the mutation\u0026rsquo;s effects. Among male pups in our breeder colony, only 31% and 24% survived to P7 and 2 months of age, respectively. However, two lines of evidence do not support this possibility. First, more mice were alive during the neonatal period than at 1 and 2 months of age, yet neonatal vocalizations on P8 and P12 were normal. Second, our nestinCreERT;\u003cem\u003eTbx1\u003c/em\u003e\u003csup\u003e+/flox\u003c/sup\u003e litters also exhibited a high mortality rate but demonstrated more profound behavioral deficits (\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eWe cannot exclude the possibility that the conditional \u003cem\u003eTbx1\u003c/em\u003e heterozygosity was incomplete. The \u003cem\u003ePdgfr\u0026alpha;\u003c/em\u003e promoter induces nearly complete recombination in oligodendrocyte precursor cells, with labels persisting in their mature progeny oligodendrocytes (\u003cspan citationid=\"CR107\" class=\"CitationRef\"\u003e107\u003c/span\u003e, \u003cspan citationid=\"CR111\" class=\"CitationRef\"\u003e111\u003c/span\u003e); however, this promoter may exhibit variability in some cells, leading to incomplete recombination (\u003cspan citationid=\"CR112\" class=\"CitationRef\"\u003e112\u003c/span\u003e). Furthermore, the lack of behavioral deficits may arise from compensatory processes in oligodendrocyte lineage cells; ablation of specific oligodendrocyte precursor cells did not result in gross behavioral abnormalities (\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eLarge-scale human brain imaging studies show alterations in the white matter in CNV carriers(\u003cspan citationid=\"CR113\" class=\"CitationRef\"\u003e113\u003c/span\u003e, \u003cspan citationid=\"CR114\" class=\"CitationRef\"\u003e114\u003c/span\u003e), as well as idiopathic cases of ASD and schizophrenia (\u003cspan citationid=\"CR115\" class=\"CitationRef\"\u003e115\u003c/span\u003e, \u003cspan citationid=\"CR116\" class=\"CitationRef\"\u003e116\u003c/span\u003e). Moreover, carriers of hemizygous deletion of 22q11.2 have an altered white matter in the fornix/fimbria(\u003cspan citationid=\"CR117\" class=\"CitationRef\"\u003e117\u003c/span\u003e) and volume alterations of many brain regions(\u003cspan additionalcitationids=\"CR119\" citationid=\"CR118\" class=\"CitationRef\"\u003e118\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR120\" class=\"CitationRef\"\u003e120\u003c/span\u003e). Together with our previous observations that \u003cem\u003eTbx1\u003c/em\u003e heterozygosity during embryonic neurogenesis (\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e) and in neonatal stem cells (\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e) likely contribute to volume alterations of specific brain regions and social and cognitive deficits (\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e), respectively, the present negative results delineate the extent to which \u003cem\u003eTbx1\u003c/em\u003e contributes to the behavioral and structural phenotypes of 22q11.2 hemizygosity through different cell types.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eHiroi N, Yamauchi T. Modeling and Predicting Developmental Trajectories of Neuropsychiatric Dimensions Associated With Copy Number Variations. Int J Neuropsychopharmacol. 2019;22(8):488\u0026ndash;500.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMichelini G, Carlisi CO, Eaton NR, Elison JT, Haltigan JD, Kotov R, et al. Where do neurodevelopmental conditions fit in transdiagnostic psychiatric frameworks? Incorporating a new neurodevelopmental spectrum. World Psychiatry. 2024;23(3):333\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOzonoff S, Iosif AM, Baguio F, Cook IC, Hill MM, Hutman T, et al. A prospective study of the emergence of early behavioral signs of autism. J Am Acad Child Adolesc Psychiatry. 2010;49(3):256\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOzonoff S, Young GS, Belding A, Hill M, Hill A, Hutman T, et al. The broader autism phenotype in infancy: when does it emerge? J Am Acad Child Adolesc Psychiatry. 2014;53(4):398\u0026ndash;407.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEsposito G, Hiroi N, Scattoni ML. Cry, baby, cry: Expression of Distress as a Biomarker and Modulator in Autism Spectrum Disorder. Int J Neuropsychopharmacol. 2017;20(6):498\u0026ndash;503.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSung S, Fenoglio A, Wolff JJ, Schultz RT, Botteron KN, Dager SR, et al. Examining the factor structure and discriminative utility of the Infant Behavior Questionnaire-Revised in infant siblings of autistic children. Child Dev. 2022;93(5):1398\u0026ndash;413.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNorthrup JB, Leezenbaum NB, Campbell SB. Observed Social Emotional Behavior at 22 Months Predicts a Later ASD Diagnosis in High-Risk Siblings. J Autism Dev Disord. 2021;51(9):3187\u0026ndash;98.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiller M, Sun S, Iosif AM, Young GS, Belding A, Tubbs A, et al. Repetitive behavior with objects in infants developing autism predicts diagnosis and later social behavior as early as 9 months. J Abnorm Psychol. 2021;130(6):665\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDi Giorgio E, Rosa-Salva O, Frasnelli E, Calcagni A, Lunghi M, Scattoni ML, et al. Abnormal visual attention to simple social stimuli in 4-month-old infants at high risk for Autism. Sci Rep. 2021;11(1):15785.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiller M, Iosif AM, Hill M, Young GS, Schwichtenberg AJ, Ozonoff S. Response to Name in Infants Developing Autism Spectrum Disorder: A Prospective Study. J Pediatr. 2017;183:141\u0026ndash;6. e1.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCaravella KE, Roberts JE. Adaptive Skill Trajectories in Infants with Fragile X Syndrome Contrasted to Typical Controls and Infants at High Risk for Autism. Res Autism Spectr Disord. 2017;40:1\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGur RC, Calkins ME, Satterthwaite TD, Ruparel K, Bilker WB, Moore TM, et al. Neurocognitive growth charting in psychosis spectrum youths. JAMA Psychiatry. 2014;71(4):366\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeidman LJ, Shapiro DI, Stone WS, Woodberry KA, Ronzio A, Cornblatt BA, et al. Association of Neurocognition With Transition to Psychosis: Baseline Functioning in the Second Phase of the North American Prodrome Longitudinal Study. JAMA Psychiatry. 2016;73(12):1239\u0026ndash;48.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeier MH, Caspi A, Reichenberg A, Keefe RS, Fisher HL, Harrington H, et al. Neuropsychological decline in schizophrenia from the premorbid to the postonset period: evidence from a population-representative longitudinal study. Am J Psychiatry. 2014;171(1):91\u0026ndash;101.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBora E, Lin A, Wood SJ, Yung AR, McGorry PD, Pantelis C. Cognitive deficits in youth with familial and clinical high risk to psychosis: a systematic review and meta-analysis. Acta Psychiatr Scand. 2014;130(1):1\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSheffield JM, Karcher NR, Barch DM. Cognitive Deficits in Psychotic Disorders: A Lifespan Perspective. Neuropsychol Rev. 2018;28(4):509\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTschentscher N, Woll CFJ, Tafelmaier JC, Kriesche D, Bucher JC, Engel RR et al. Neurocognitive Deficits in First-Episode and Chronic Psychotic Disorders: A Systematic Review from 2009 to 2022. Brain Sci. 2023;13(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohansson M, Hjarthag F, Helldin L. Cognitive markers related to long-term remission status in Schizophrenia Spectrum Disorders. Psychiatry Res. 2020;289:113035.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStefansson H, Meyer-Lindenberg A, Steinberg S, Magnusdottir B, Morgen K, Arnarsdottir S, et al. CNVs conferring risk of autism or schizophrenia affect cognition in controls. Nature. 2014;505(7483):361\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKendall KM, Rees E, Escott-Price V, Einon M, Thomas R, Hewitt J, et al. Cognitive Performance Among Carriers of Pathogenic Copy Number Variants: Analysis of 152,000 UK Biobank Subjects. Biol Psychiatry. 2017;82(2):103\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMalhotra D, Sebat J. CNVs: harbingers of a rare variant revolution in psychiatric genetics. Cell. 2012;148(6):1223\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarshall CR, Howrigan DP, Merico D, Thiruvahindrapuram B, Wu W, Greer DS, et al. Contribution of copy number variants to schizophrenia from a genome-wide study of 41,321 subjects. Nat Genet. 2017;49(1):27\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoh S, Thiyagarajan L, Dudding-Byth T, Mark P, Kirk EP. A systematic review and pooled analysis of penetrance estimates of copy number variants associated with neurodevelopment. Genet Med. 2024:101227.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGur RE, Yi JJ, Donald-McGinn DM, Tang SX, Calkins ME, Whinna D, et al. Neurocognitive development in 22q11.2 deletion syndrome: comparison with youth having developmental delay and medical comorbidities. Mol Psychiatry. 2014;19(11):1205\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorrison S, Chawner S, van Amelsvoort T, Swillen A, Vingerhoets C, Vergaelen E, et al. Cognitive deficits in childhood, adolescence and adulthood in 22q11.2 deletion syndrome and association with psychopathology. Transl Psychiatry. 2020;10(1):53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChawner S, Owen MJ, Holmans P, Raymond FL, Skuse D, Hall J, et al. Genotype-phenotype associations in children with copy number variants associated with high neuropsychiatric risk in the UK (IMAGINE-ID): a case-control cohort study. Lancet Psychiatry. 2019;6(6):493\u0026ndash;505.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZinkstok J, Boot E, Bassett AS, Hiroi N, Butcher NJ, Vingerhoets C, et al. The 22q11.2 deletion syndrome from a neurobiological perspective. Lancet Psychiatry. 2019;6(11):951\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchneider M, Debbane M, Bassett AS, Chow EW, Fung WL, van den Bree M, et al. Psychiatric disorders from childhood to adulthood in 22q11.2 deletion syndrome: results from the International Consortium on Brain and Behavior in 22q11.2 Deletion Syndrome. Am J Psychiatry. 2014;171(6):627\u0026ndash;39.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEnsenauer RE, Adeyinka A, Flynn HC, Michels VV, Lindor NM, Dawson DB, et al. Microduplication 22q11.2, an emerging syndrome: clinical, cytogenetic, and molecular analysis of thirteen patients. Am J Hum Genet. 2003;73(5):1027\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHassed SJ, Hopcus-Niccum D, Zhang L, Li S, Mulvihill JJ. A new genomic duplication syndrome complementary to the velocardiofacial (22q11 deletion) syndrome. Clin Genet. 2004;65(5):400\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePortnoi MF, Lebas F, Gruchy N, Ardalan A, Biran-Mucignat V, Malan V, et al. 22q11.2 duplication syndrome: two new familial cases with some overlapping features with DiGeorge/velocardiofacial syndromes. Am J Med Genet A. 2005;137(1):47\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYobb TM, Somerville MJ, Willatt L, Firth HV, Harrison K, MacKenzie J, et al. Microduplication and triplication of 22q11.2: a highly variable syndrome. Am J Hum Genet. 2005;76(5):865\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede La Rochebrochard C, Joly-Helas G, Goldenberg A, Durand I, Laquerriere A, Ickowicz V, et al. The intrafamilial variability of the 22q11.2 microduplication encompasses a spectrum from minor cognitive deficits to severe congenital anomalies. Am J Med Genet A. 2006;140(14):1608\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlberti A, Romano C, Falco M, Cali F, Schinocca P, Galesi O, et al. 1.5 Mb de novo 22q11.21 microduplication in a patient with cognitive deficits and dysmorphic facial features. Clin Genet. 2007;71(2):177\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEngels H, Brockschmidt A, Hoischen A, Landwehr C, Bosse K, Walldorf C, et al. DNA microarray analysis identifies candidate regions and genes in unexplained mental retardation. Neurology. 2007;68(10):743\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMukaddes NM, Herguner S. Autistic disorder and 22q11.2 duplication. World J Biol Psychiatry. 2007;8(2):127\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTorres-Juan L, Rosell J, Morla M, Vidal-Pou C, Garcia-Algas F, de la Fuente MA, et al. Mutations in TBX1 genocopy the 22q11.2 deletion and duplication syndromes: a new susceptibility factor for mental retardation. Eur J Hum Genet. 2007;15(6):658\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDescartes M, Franklin J, de Stahl TD, Piotrowski A, Bruder CE, Dumanski JP, et al. Distal 22q11.2 microduplication encompassing the BCR gene. Am J Med Genet A. 2008;146A(23):3075\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamelli GP, Silacci C, Ferrarini A, Cattaneo C, Visconti P, Pescia G. Microduplication 22q11.2 in a child with autism spectrum disorder: clinical and genetic study. Dev Med Child Neurol. 2008;50(12):953\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWentzel C, Fernstrom M, Ohrner Y, Anneren G, Thuresson AC. Clinical variability of the 22q11.2 duplication syndrome. Eur J Med Genet. 2008;51(6):501\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu S, Cox K, Friend K, Smith S, Buchheim R, Bain S, et al. Familial 22q11.2 duplication: a three-generation family with a 3-Mb duplication and a familial 1.5-Mb duplication. Clin Genet. 2008;73(2):160\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLo-Castro A, Galasso C, Cerminara C, El-Malhany N, Benedetti S, Nardone AM, et al. Association of syndromic mental retardation and autism with 22q11.2 duplication. Neuropediatrics. 2009;40(3):137\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePortnoi MF. Microduplication 22q11.2: a new chromosomal syndrome. Eur J Med Genet. 2009;52(2\u0026ndash;3):88\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoysal Y, Vermeesch J, Davani NA, Sensoy N, Hekimler K, Imirzalioglu N. Molecular characterization of microduplication 22q11.2 in a girl with hypernasal speech. Genet Mol Res. 2011;10(3):2148\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWenger TL, Miller JS, DePolo LM, de Marchena AB, Clements CC, Emanuel BS, et al. 22q11.2 duplication syndrome: elevated rate of autism spectrum disorder and need for medical screening. Mol Autism. 2016;7:27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh T, Poterba T, Curtis D, Akil H, Al Eissa M, Barchas JD, et al. Rare coding variants in ten genes confer substantial risk for schizophrenia. Nature. 2022;604(7906):509\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlhazmi S, Alzahrani M, Farsi R, Alharbi M, Algothmi K, Alburae N, et al. Multiple Recurrent Copy Number Variations (CNVs) in Chromosome 22 Including 22q11.2 Associated with Autism Spectrum Disorder. Pharmgenomics Pers Med. 2022;15:705\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlghamdi M, Al Khalifah R, Al Homyani DK, Alkhamis WH, Arold ST, Ekhzaimy A, et al. A Novel TBX1 Variant Causing Hypoparathyroidism and Deafness. J Endocr Soc. 2020;4(2):bvz028.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOgata T, Niihori T, Tanaka N, Kawai M, Nagashima T, Funayama R, et al. TBX1 mutation identified by exome sequencing in a Japanese family with 22q11.2 deletion syndrome-like craniofacial features and hypocalcemia. PLoS ONE. 2014;9(3):e91598.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaylor R, Glaser B, Mupo A, Ataliotis P, Spencer C, Sobotka A, et al. Tbx1 haploinsufficiency is linked to behavioral disorders in mice and humans: implications for 22q11 deletion syndrome. Proc Natl Acad Sci U S A. 2006;103(20):7729\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGong W, Gottlieb S, Collins J, Blescia A, Dietz H, Goldmuntz E, et al. Mutation analysis of TBX1 in non-deleted patients with features of DGS/VCFS or isolated cardiovascular defects. J Med Genet. 2001;38(12):E45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHiroi N, Zhu H, Lee M, Funke B, Arai M, Itokawa M, et al. A 200-kb region of human chromosome 22q11.2 confers antipsychotic-responsive behavioral abnormalities in mice. Proc Natl Acad Sci USA. 2005;102(52):19132\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHiroi N, Hiramoto T, Harper KM, Suzuki G, Boku S. Mouse models of 22q11.2-associated autism spectrum disorder. Autism. 2012;S1(001):1\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHiroi N, Takahashi T, Hishimoto A, Izumi T, Boku S, Hiramoto T. Copy Number Variation at 22q11.2: from rare variants to common mechanisms of developmental neuropsychiatric disorders. Mol Psychiatry. 2013;18:1153\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHiroi N, Nishi A. Dimensional deconstruction and reconstruction of CNV-associated neuropsychiatric disorders. In: Pletnikov MV, Waddington JL, editors. Modeling the Psychopathological Dimensions of Schizophrenia: From Molecules to Behavior. Handbook of Behavioral Neuroscience. 23. London, UK2015. pp. 285\u0026ndash;302.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNishi A, Hiroi N. Genetic Mechanisms Emerging from Mouse Models of CNV-Associated Neuropsychiatric Disorders. In: Abel T, Nickl-Jockschat T, editors. The Neurobiology of Schizophrenia. New York: Academic Press/Elsevier; 2016. pp. 397\u0026ndash;417.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuzuki G, Harper KM, Hiramoto T, Funke B, Lee M, Kang G, et al. Over-expression of a human chromosome 22q11.2 segment including TXNRD2, COMT and ARVCF developmentally affects incentive learning and working memory in mice. Hum Mol Genet. 2009;18(20):3914\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHiramoto T, Kang G, Suzuki G, Satoh Y, Kucherlapati R, Watanabe Y, et al. Tbx1: identification of a 22q11.2 gene as a risk factor for autism spectrum disorder in a mouse model. Hum Mol Genet. 2011;20(24):4775\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakahashi T, Okabe S, Broin PO, Nishi A, Ye K, Beckert MV, et al. Structure and function of neonatal social communication in a genetic mouse model of autism. Mol Psychiatry. 2016;21(9):1208\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKato R, Machida A, Nomoto K, Kang G, Hiramoto T, Tanigaki K, et al. Maternal approach behaviors toward neonatal calls are impaired by mother's experiences of raising pups with a risk gene variant for autism. Dev Psychobiol. 2021;63(1):108\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHiramoto T, Sumiyoshi A, Kato R, Yamauchi T, Takano T, Kang G, et al. Highly demarcated structural alterations in the brain and impaired social incentive learning in Tbx1 heterozygous mice. Mol Psychiatry. 2025;30(5):1876\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHiramoto T, Sumiyoshi A, Yamauchi T, Tanigaki K, Shi Q, Kang G, et al. Tbx1, a gene encoded in 22q11.2 copy number variant, is a link between alterations in fimbria myelination and cognitive speed in mice. Mol Psychiatry. 2022;27(2):929\u0026ndash;38.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNieder A, Mooney R. The neurobiology of innate, volitional and learned vocalizations in mammals and birds. Philos Trans R Soc Lond B Biol Sci. 2020;375(1789):20190054.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoku S, Izumi T, Abe S, Takahashi T, Nishi A, Nomaru H, et al. Copy number elevation of 22q11.2 genes arrests the developmental maturation of working memory capacity and adult neurogenesis. Mol Psychiatry. 2018;23(4):985\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarques S, van Bruggen D, Vanichkina DP, Floriddia EM, Munguba H, Varemo L, et al. Transcriptional Convergence of Oligodendrocyte Lineage Progenitors during Development. Dev Cell. 2018;46(4):504\u0026ndash;17. e7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKessaris N, Fogarty M, Iannarelli P, Grist M, Wegner M, Richardson WD. Competing waves of oligodendrocytes in the forebrain and postnatal elimination of an embryonic lineage. Nat Neurosci. 2006;9(2):173\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMenn B, Garcia-Verdugo JM, Yaschine C, Gonzalez-Perez O, Rowitch D, Alvarez-Buylla A. Origin of oligodendrocytes in the subventricular zone of the adult brain. J Neurosci. 2006;26(30):7907\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRushing G, Ihrie RA. Neural stem cell heterogeneity through time and space in the ventricular-subventricular zone. Front Biol (Beijing). 2016;11(4):261\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFuentealba LC, Rompani SB, Parraguez JI, Obernier K, Romero R, Cepko CL, et al. Embryonic Origin of Postnatal Neural Stem Cells. Cell. 2015;161(7):1644\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang R, Zhang P, Wang J, Ma L, Suo EW. Construction of a cross-species cell landscape at single-cell level. Nucleic Acids Res. 2023;51(2):501\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao J, Spielmann M, Qiu X, Huang X, Ibrahim DM, Hill AJ, et al. The single-cell transcriptional landscape of mammalian organogenesis. Nature. 2019;566(7745):496\u0026ndash;502.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHiramoto T, Boku S, Kang G, Abe S, Nagashima M, Barbachan e Silva M, et al. Transcriptional regulation of neonatal neural stem cells is a determinant of social behavior. BioRxiv. 2023;11(12):468452.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNishiyama A, Lin XH, Giese N, Heldin CH, Stallcup WB. Co-localization of NG2 proteoglycan and PDGF alpha-receptor on O2A progenitor cells in the developing rat brain. J Neurosci Res. 1996;43(3):299\u0026ndash;314.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRivers LE, Young KM, Rizzi M, Jamen F, Psachoulia K, Wade A, et al. PDGFRA/NG2 glia generate myelinating oligodendrocytes and piriform projection neurons in adult mice. Nat Neurosci. 2008;11(12):1392\u0026ndash;401.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSil S, Periyasamy P, Thangaraj A, Chivero ET, Buch S. PDGF/PDGFR axis in the neural systems. Mol Aspects Med. 2018;62:63\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrandebura AN, Morehead M, Heller DT, Holcomb P, Kolson DR, Jones G, et al. Glial Cell Expansion Coincides with Neural Circuit Formation in the Developing Auditory Brainstem. Dev Neurobiol. 2018;78(11):1097\u0026ndash;116.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeiter RM, Rivet-Noor C, Merchak AR, Bai R, Johanson DM, Slogar E, et al. Evidence for oligodendrocyte progenitor cell heterogeneity in the adult mouse brain. Sci Rep. 2022;12(1):12921.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArnold JS, Werling U, Braunstein EM, Liao J, Nowotschin S, Edelmann W, et al. Inactivation of Tbx1 in the pharyngeal endoderm results in 22q11DS malformations. Development. 2006;133(5):977\u0026ndash;87.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatsuo N, Takao K, Nakanishi K, Yamasaki N, Tanda K, Miyakawa T. Behavioral profiles of three C57BL/6 substrains. Front Behav Neurosci. 2010;4:29.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHiroi N. Critical Reappraisal of Mechanistic Links of Copy Number Variants to Dimensional Constructs of Neuropsychiatric Disorders in Mouse Models. J Neuropsychiatry Clin Neurosci. 2018;72(5):301\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang D, Wang Y, Qi T, Zhang X, Shen L, Ma J, et al. Phosphorylation of pyruvate dehydrogenase inversely associates with neuronal activity. Neuron. 2024;112(6):959\u0026ndash;71. e8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReadhead C, Popko B, Takahashi N, Shine HD, Saavedra RA, Sidman RL, et al. Expression of a myelin basic protein gene in transgenic shiverer mice: correction of the dysmyelinating phenotype. Cell. 1987;48(4):703\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeschkat M, Steyer AM, Weil MT, Kusch K, Jahn O, Piepkorn L, et al. White matter integrity in mice requires continuous myelin synthesis at the inner tongue. Nat Commun. 2022;13(1):1163.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArellano JI, Duque A, Rakic P. A coming-of-age story: adult neurogenesis or adolescent neurogenesis in rodents? Front Neurosci. 2024;18:1383728.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBronson FH, Dagg CP, Snell GD. Reproduction. In: Green EL, editor. Biology of the Laboratory Mouse. Second Edition ed. New York: Dover Publications, Inc.; 2007. p. Oneline publication.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakamura M, Ye K, MB ES, Yamauchi T, Hoeppner DJ, Fayyazuddin A, et al. Computational identification of variables in neonatal vocalizations predictive for postpubertal social behaviors in a mouse model of 16p11.2 deletion. Mol Psychiatry. 2021;26(11):6578\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao Z, Daquinag AC, Su F, Snyder B, Kolonin MG. PDGFRalpha/PDGFRbeta signaling balance modulates progenitor cell differentiation into white and beige adipocytes. Development. 2018;145(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarcelin G, Ferreira A, Liu Y, Atlan M, Aron-Wisnewsky J, Pelloux V, et al. A PDGFRalpha-Mediated Switch toward CD9(high) Adipocyte Progenitors Controls Obesity-Induced Adipose Tissue Fibrosis. Cell Metab. 2017;25(3):673\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarper KM, Hiramoto T, Tanigaki K, Kang G, Suzuki G, Trimble W, et al. Alterations of social interaction through genetic and environmental manipulation of the 22q11.2 gene Sept5 in the mouse brain. Hum Mol Genet. 2012;21(15):3489\u0026ndash;99.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuzuki G, Harper KM, Hiramoto T, Sawamura T, Lee M, Kang G, et al. Sept5 deficiency exerts pleiotropic influence on affective behaviors and cognitive functions in mice. Hum Mol Genet. 2009;18(9):1652\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamauchi T, Kang G, Hiroi N. Heterozygosity of murine Crkl does not recapitulate behavioral dimensions of human 22q11.2 hemizygosity. Genes Brain Behav. 2020;20(5):e12719.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaylor R, Spencer CM, Yuva-Paylor LA, Pieke-Dahl S. The use of behavioral test batteries, II: effect of test interval. Physiol Behav. 2006;87(1):95\u0026ndash;102.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFonseca AH, Santana GM, Bosque Ortiz GM, Bampi S, Dietrich MO. Analysis of ultrasonic vocalizations from mice using computer vision and machine learning. Elife. 2021;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSakamoto Y, Takano T, Shimoyama S, Hiramoto T, Hiroi N, Nakamura K. Prepartum bumetanide treatment reverses altered neonatal social communication but non-specifically reduces post-pubertal social behavior in a mouse model of fragile X syndrome. Genomic Psychiatry. 2025;1(1):61\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaiser T, Allen HM, Kwon O, Barak B, Wang J, He Z et al. MyelTracer: A Semi-Automated Software for Myelin g-Ratio Quantification. eNeuro. 2021;8(4).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAllen Brain Atlas. Mouse Brain. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://wwwbrain-maporg\u003c/span\u003e\u003cspan address=\"http://wwwbrain-maporg\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. 2017.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNait Oumesmar B, Vignais L, Baron-Van Evercooren A. Developmental expression of platelet-derived growth factor alpha-receptor in neurons and glial cells of the mouse CNS. J Neurosci. 1997;17(1):125\u0026ndash;39.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu X, Bergles DE, Nishiyama A. NG2 cells generate both oligodendrocytes and gray matter astrocytes. Development. 2008;135(1):145\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarques S, Zeisel A, Codeluppi S, van Bruggen D, Mendanha Falcao A, Xiao L, et al. Oligodendrocyte heterogeneity in the mouse juvenile and adult central nervous system. Science. 2016;352(6291):1326\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOzarkar SS, Patel RKR, Vulli T, Friar CA, Burette AC, Philpot BD. Regional analysis of myelin basic protein across postnatal brain development of C57BL/6J mice. Front Neuroanat. 2025;19:1535745.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBastedo WE, Scott RW, Arostegui M, Underhill TM. Single-cell analysis of mesenchymal cells in permeable neural vasculature reveals novel diverse subpopulations of fibroblasts. Fluids Barriers CNS. 2024;21(1):31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakeuchi A, Takahashi Y, Iida K, Hosokawa M, Irie K, Ito M, et al. Identification of Qk as a Glial Precursor Cell Marker that Governs the Fate Specification of Neural Stem Cells to a Glial Cell Lineage. Stem Cell Rep. 2020;15(4):883\u0026ndash;97.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDani N, Herbst RH, McCabe C, Green GS, Kaiser K, Head JP, et al. A cellular and spatial map of the choroid plexus across brain ventricles and ages. Cell. 2021;184(11):3056\u0026ndash;e7421.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDownes N, Mullins P. The development of myelin in the brain of the juvenile rat. Toxicol Pathol. 2014;42(5):913\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThompson CL, Ng L, Menon V, Martinez S, Lee CK, Glattfelder K, et al. A high-resolution spatiotemporal atlas of gene expression of the developing mouse brain. Neuron. 2014;83(2):309\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRedmond SA, Figueres-Onate M, Obernier K, Nascimento MA, Parraguez JI, Lopez-Mascaraque L, et al. Development of Ependymal and Postnatal Neural Stem Cells and Their Origin from a Common Embryonic Progenitor. Cell Rep. 2019;27(2):429\u0026ndash;41. e3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang SH, Fukaya M, Yang JK, Rothstein JD, Bergles DE. NG2\u0026thinsp;+\u0026thinsp;CNS glial progenitors remain committed to the oligodendrocyte lineage in postnatal life and following neurodegeneration. Neuron. 2010;68(4):668\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKomitova M, Zhu X, Serwanski DR, Nishiyama A. NG2 cells are distinct from neurogenic cells in the postnatal mouse subventricular zone. J Comp Neurol. 2009;512(5):702\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRosenberg AB, Roco CM, Muscat RA, Kuchina A, Sample P, Yao Z, et al. Single-cell profiling of the developing mouse brain and spinal cord with split-pool barcoding. Science. 2018;360(6385):176\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYao Z, Liu H, Xie F, Fischer S, Adkins RS, Aldridge AI, et al. A transcriptomic and epigenomic cell atlas of the mouse primary motor cortex. Nature. 2021;598(7879):103\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eO'Rourke M, Cullen CL, Auderset L, Pitman KA, Achatz D, Gasperini R, et al. Evaluating Tissue-Specific Recombination in a Pdgfralpha-CreERT2 Transgenic Mouse Line. PLoS ONE. 2016;11(9):e0162858.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTripathi RB, Rivers LE, Young KM, Jamen F, Richardson WD. NG2 glia generate new oligodendrocytes but few astrocytes in a murine experimental autoimmune encephalomyelitis model of demyelinating disease. J Neurosci. 2010;30(48):16383\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThompson PM, Jahanshad N, Ching CRK, Salminen LE, Thomopoulos SI, Bright J, et al. ENIGMA and global neuroscience: A decade of large-scale studies of the brain in health and disease across more than 40 countries. Transl Psychiatry. 2020;10(1):100.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKochunov P, Hong LE, Dennis EL, Morey RA, Tate DF, Wilde EA, et al. ENIGMA-DTI: Translating reproducible white matter deficits into personalized vulnerability metrics in cross-diagnostic psychiatric research. Hum Brain Mapp. 2020;43(1):194\u0026ndash;206.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoshiyama D, Fukunaga M, Okada N, Morita K, Nemoto K, Usui K, et al. White matter microstructural alterations across four major psychiatric disorders: mega-analysis study in 2937 individuals. Mol Psychiatry. 2020;25(4):883\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKelly S, Jahanshad N, Zalesky A, Kochunov P, Agartz I, Alloza C, et al. Widespread white matter microstructural differences in schizophrenia across 4322 individuals: results from the ENIGMA Schizophrenia DTI Working Group. Mol Psychiatry. 2018;23(5):1261\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVillalon-Reina JE, Martinez K, Qu X, Ching CRK, Nir TM, Kothapalli D, et al. Altered white matter microstructure in 22q11.2 deletion syndrome: a multisite diffusion tensor imaging study. Mol Psychiatry. 2020;25(11):2818\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChing CRK, Gutman BA, Sun D, Villalon Reina J, Ragothaman A, Isaev D, et al. Mapping Subcortical Brain Alterations in 22q11.2 Deletion Syndrome: Effects of Deletion Size and Convergence With Idiopathic Neuropsychiatric Illness. Am J Psychiatry. 2020;177(7):589\u0026ndash;600.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun D, Ching CRK, Lin A, Forsyth JK, Kushan L, Vajdi A, et al. Large-scale mapping of cortical alterations in 22q11.2 deletion syndrome: Convergence with idiopathic psychosis and effects of deletion size. Mol Psychiatry. 2020;25(8):1822\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSonderby IE, Ching CRK, Thomopoulos SI, van der Meer D, Sun D, Villalon-Reina JE et al. Effects of copy number variations on brain structure and risk for psychiatric illness: Large-scale studies from the ENIGMA working groups on CNVs. Hum Brain Mapp. 2021.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Supplementary Tables","content":" \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable S1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Bold\" class=\"Bold\" name=\"Emphasis\"\u003ePrimers used for genotyping\u003c/span\u003e.\u003c/div\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eMouse line\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eForward (5\u0026rsquo; \u0026agrave; 3\u0026rsquo;)\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eReverse (5\u0026rsquo; \u0026agrave; 3\u0026rsquo;)\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003ePurpose\u003c/div\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePdgfrα-Cre\u003c/span\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eolMR1084 (GCGGTCTGGCAGTAAAAACTATC)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eolMR1085 (GTGAAACAGCATTGCTGTCACTT)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eGeneric cre - transgene\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePdgfrα\u003c/span\u003e-\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eCre\u003c/span\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eolMR7338 (CTAGGCCACAGAATTGAAAGATCT)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eolMR7339 (GTAGGTGGAAATTCTAGCATCATCC)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eGeneric cre \u0026ndash; internal positive control\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eROSA-CAG-tdTomato\u003c/span\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eolMR9020 (AAGGGAGCTGCAGTGGAGTA)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eolMR9021 (CCGAAAATCTGTGGGAAGTC)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003etdTomato wild-type control\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eROSA-CAG-tdTomato\u003c/span\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eolMR9103 (GGCATTAAAGCAGCGTATCC)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eolMR9105 (CTGTTCCTGTACGGCATGG)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003etdTomato mutant\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eTbx1\u003c/span\u003e\u003csup\u003e+/flox\u003c/sup\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003e2g 1F (TCTTCTTGGGGCTGTAGACT)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eTbx1 1R (TGACTGTGCTGAAGTGCATC)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eLoxP site\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eTbx1\u003c/span\u003e\u003csup\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003e+/\u0026minus;\u003c/span\u003e\u003c/sup\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eKO1F (TTGGTGACGATCATCTCGGT)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eKO1R (ATGATCTCCGCCGTGTCTAG)\u003c/div\u003e \u003cdiv class=\"SimplePara\"\u003eMut2R (AGGTCCCTCGAAGAGGTTCA)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eTbx1\u003c/span\u003e\u003csup\u003e+/+\u003c/sup\u003e\u003c/div\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eTbx1\u003c/span\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003cbr/\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable S2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cdiv class=\"SimplePara\"\u003ePrimers for qRT-PCR\u003c/div\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eGene\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eAssay ID\u003c/div\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eTbx1\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eMm00448949_m1\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eCspg4\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eMm00507257_m1\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eMag\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eMm00487538_m1\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eMbp\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eMm01266402_m1\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eMog\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eMm01279062_m1\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003ePlp1\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eMm01297210_m1\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003cbr/\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-brain","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mbrj","sideBox":"Learn more about [Molecular Brain](http://molecularbrain.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mbrj/default.aspx","title":"Molecular Brain","twitterHandle":"@molecularbrain","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Tbx1, Pdgfrα, 22q11.2 CNV, social behavior, cognition, fimbria, axon, myelination","lastPublishedDoi":"10.21203/rs.3.rs-9327970/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9327970/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eConstitutive heterozygosity of \u003cem\u003eTbx1\u003c/em\u003e, a T-box transcription factor gene in the 22q11.2 deleted region, produces behavioral deficits and alters myelinated axon composition in the mouse fimbria. However, the cellular origins of these effects\u0026mdash;and whether axon changes causally drive behavioral impairments\u0026mdash;remain unclear. Prior data link \u003cem\u003eTbx1\u003c/em\u003e heterozygosity to reduced oligodendrocyte precursor cell (OPC) markers in the fimbria in mice, raising the hypothesis that \u003cem\u003eTbx1\u003c/em\u003e deficiency specifically in the oligodendrocyte lineage contributes to myelin and behavioral phenotypes. To test this hypothesis, we first showed via \u003cem\u003ein vitro\u003c/em\u003e siRNA knockdown that \u003cem\u003eTbx1\u003c/em\u003e regulates both OPCs and mature oligodendrocytes. We then generated conditional \u003cem\u003ePdgfrα\u003c/em\u003eCre;\u003cem\u003eTbx1\u003c/em\u003e+/flox mice to initiate \u003cem\u003eTbx1\u003c/em\u003e heterozygosity in OPCs. These mice exhibited Cre-mediated recombination in \u003cem\u003ePdgfrα\u003c/em\u003e-expressing brain regions and OPC progeny in the fimbria. At 1 month of age, male mutants displayed enhanced spontaneous alternation in the T-maze relative to wild-type littermates\u0026mdash;an effect absent at 2 months. No differences appeared in neonatal ultrasonic vocalizations, social interaction, novel object approach, anxiety-like behavior (elevated plus maze), or open-field locomotion and thigmotaxis. Electron microscopic analysis demonstrated a compositional shift in myelinated axons within the fimbria of adult male mutants: increased numbers in the 300\u0026ndash;800 nm diameter range and decreased numbers at ~\u0026thinsp;1,200 nm and ~\u0026thinsp;1,400 nm, with unchanged myelin thickness across diameters. These results demonstrate that \u003cem\u003eTbx1\u003c/em\u003e heterozygosity in the oligodendrocyte lineage drives a selective shift toward smaller myelinated axons in the fimbria and a transient cognitive enhancement but does not recapitulate the full myelination abnormalities or the broader cognitive/social deficits observed in constitutive \u003cem\u003eTbx1\u003c/em\u003e heterozygotes. Thus, \u003cem\u003eTbx1\u003c/em\u003e function in non-oligodendrocyte lineage cells likely exerts non-cell-autonomous effects on myelination that contribute to neurodevelopmental behavioral impairments.\u003c/p\u003e","manuscriptTitle":"Tbx1 Heterozygosity in the Oligodendrocyte Lineage Shifts Myelinated Axon Composition in the Mouse Fimbria Without Behavioral Impairments","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-19 08:11:53","doi":"10.21203/rs.3.rs-9327970/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-04-20T06:03:49+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-20T01:00:32+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"330785509332486857965004966216152008917","date":"2026-04-14T08:47:26+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-11T08:13:42+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"313247501406783901167134123588847408224","date":"2026-04-09T04:31:06+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-04-09T03:35:29+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-04-09T03:25:04+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-04-08T05:05:20+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Brain","date":"2026-04-05T18:05:36+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-brain","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mbrj","sideBox":"Learn more about [Molecular Brain](http://molecularbrain.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mbrj/default.aspx","title":"Molecular Brain","twitterHandle":"@molecularbrain","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"2b7529a5-30e8-4e68-96ae-828e130bf156","owner":[],"postedDate":"April 19th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-07T16:09:41+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-19 08:11:53","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9327970","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9327970","identity":"rs-9327970","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}