Conditioned Media and Extracellular Vesicles Derived from Human Wharton's Jelly Mesenchymal Stem Cells Improve the in vitro Maturation of Immature Oocytes in Normal and PCOS Mouse Model | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Conditioned Media and Extracellular Vesicles Derived from Human Wharton's Jelly Mesenchymal Stem Cells Improve the in vitro Maturation of Immature Oocytes in Normal and PCOS Mouse Model Arezoo Solati, Sanaz Alaee, Fatemeh Zal, Zahra Khodabandeh, Mahintaj Dara, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7410176/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 27 Dec, 2025 Read the published version in BioMedical Engineering OnLine → Version 1 posted 12 You are reading this latest preprint version Abstract Background The effects of conditioned medium (CM) and extracellular Vesicles (EVs) derived from human Wharton’s jelly mesenchymal stem cells (hWJMSCs) on in vitro maturation (IVM) of immature oocytes in both normal and polycystic ovary syndrome (PCOS)-induced mice were investigated. PCOS was induced in adult female NMRI mice by administering letrozole (90 µg/kg/day) via gavage for one week. Germinal vesicle (GV) oocytes were collected from both PCOS-induced and normal mice, while mature oocytes (MII) were obtained from superovulated normal mice to serve as controls. The experimental groups included 7 groups: Control (MII oocytes), 3 IVM groups (In vitro maturation of GV oocytes): IVM (with simple IVM media), IVM + CM and IVM + EVs (IVM media supplemented with CM and EVs, respectively), and three PCOS groups (In vitro maturation of GV oocytes from PCOS-induced mice): PCOS IVM (with simple IVM media), PCOS IVM + CM and PCOS IVM + EVs (IVM media supplemented with CM and EVs, respectively). After IVM was conducted in all groups, mature oocytes were harvested and assessed for maturation rate, morphology, viability, and gene expression profiles of key regulators (CDK1, CCNB1, MAP2K). Developmentally competent oocytes were selected using Brilliant Cresyl Blue staining and then subjected to in vitro maturation with or without CM or EVs supplementation. Nuclear maturation was evaluated via orcein staining, while viability was assessed using Trypan Blue. Morphometric parameters were measured using ImageJ software. Real-time PCR was utilized for the evaluation of gene expression of targeted genes. Results Results demonstrated that in BCB + oocytes, CM and EVs significantly improved mature oocytes compared to IVM (P < 0.05). Oocytes from PCOS-induced mice exhibited reduced maturation and increased degeneration, which were rescued by CM and EV treatment. Gene expression analysis revealed downregulation of MAP2K, CCNB1, and CDK1 in IVM and PCOS IVM groups compared to the control group, while CM supplementation restored their expression. Oocyte diameter and viability were significantly enhanced in IVM + CM compared to IVM (P < 0.05). Conclusions These findings suggest that hWJMSC-derived secretomes, particularly CM, enhance oocyte maturation and quality, offering potential therapeutic benefits for IVM in both normal and PCOS conditions. Extracellular Vesicles PCOS IVM Conditioned media Oocyte Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Polycystic ovary syndrome is a common hormone disorder that affects women during their childbearing years. The number of women diagnosed with PCOS varies depending on the set of diagnostic rules used ( 1 ). During fertility treatments, women with PCOS typically produce more eggs when given ovary-stimulating hormones compared to women without PCOS ( 2 ). However, because of alterations in the follicular fluid, hormonal imbalance, and oocyte microenvironment, a significant proportion of these oocytes remain immature, compromising their developmental potential ( 3 , 4 ). Currently, in vitro maturation (IVM) serves as an effective approach to rescue oocytes that fail to mature in vivo following ovarian stimulation, enabling their progression to mature oocytes at the stage of metaphase II (MII) ( 5 ). Consequently, IVM has been proposed as a tailored approach for PCOS patients undergoing Assisted Reproductive Techniques ( 6 ). However, despite its potential, the clinical application of IVM remains limited due to low maturation and fertilization rates, ultimately resulting in lower pregnancy success even in non-PCOS patients ( 7 , 8 ). A key challenge in IVM lies in replicating the physiological follicular environment in vitro, as current culture conditions fail to support oocyte maturation fully ( 9 ). The process of oocyte maturation involves coordinated signaling pathways and cell cycle regulators, including CDC2 (also known as CDK1), CCNB1 (cyclin B1), and MAP2K (MEK1/2)( 10 ). CDC2/CDK1, in complex with cyclin B1, forms the maturation-promoting factor (MPF), which is crucial for the germinal vesicle breakdown, spindle formation, chromosome condensation, and consequently, oocyte progression of the maturation oocyte ( 11 ). The levels and activity of CCNB1 are tightly regulated, ensuring the timely activation and inactivation of MPF during maturation. Additionally, MAP2K (MEK1/2), part of the MAPK/ERK signaling pathway, modulates cytoplasmic and nuclear maturation processes by regulating the activity of cyclin-dependent kinases and other downstream effectors ( 10 ). Activation of the MAPK pathway is essential for spindle assembly, oocyte cytoplasmic maturation, and successful completion of meiosis II ( 12 ). Together, CDC2, CCNB1, and MAP2K orchestrate the intricate signaling networks that underpin oocyte maturation, ensuring the oocyte reaches developmental competence for fertilization ( 12 ). Recent advances in IVM research have focused on optimizing culture conditions to enhance meiotic resumption and cytoplasmic maturation- two critical determinants of oocyte quality ( 13 , 14 ). In this context, novel culture medium additives have emerged as potential tools to improve oocyte maturation efficiency and developmental outcomes ( 15 , 16 ). Nowadays, mesenchymal stem cells (MSCs) are recognized as potential therapeutic agents for treating a wide range of diseases largely attributed to their capacity to secrete bioactive molecules ( 17 ). Conditioned medium (CM) derived from MSCs has shown significant clinical relevance, as it contains a complex mixture of bioactive factors capable of exerting therapeutic effects ( 18 ). MSC-derived CM are rich in growth factors, cytokines, and tissue regeneration mediators that can modulate in vitro maturation ( 13 ). Extracellular Vesicles (EVs) are membrane-enclosed particles present in various biological fluids, including plasma, urine, follicular fluid, and culture supernatants of MSCs ( 19 ). The cells secrete these lipid bilayer vesicles into the extracellular environment, where they coordinate communication between cells by transporting diverse cargoes such as cytokines, proteins, microRNAs, and lipids ( 19 ). Many of the regenerative effects associated with MSC therapy are mediated through EVs ( 20 ). In the process of reproduction, EVs influence key reproductive processes, including oocyte maturation, sperm capacitation, fertilization, and the development and implantation of the embryo ( 21 ). Therefore, the IVM medium was supplemented with CM or EVs of human Wharton’s jelly mesenchymal stem cells (hWJMSCs) in a mouse model of PCOS. After conducting the IVM, the maturation rates (GV, MI, MII stages), oocyte quality parameters such as zona pellucida thickness, perivitelline space size, and oocyte diameter, oocyte morphology, viability, nuclear maturation, and the expression levels of key maturation-related genes, including CDK1 , CCNB1 , and MAP2K , were evaluated in mature oocytes. Materials and Methods Ethics statement This study was conducted with approval from the Shiraz University of Medical Sciences Animal Ethics Committee (IR.SUMS.REC.1400.566) and also adhered to the guidelines set forth by the ARRIVE (Animal Research: Reporting of In Vivo Experiments) to ensure rigorous reporting, transparency, and reproducibility. Isolation and cultivation of hWJMSCs and production of hWJMSCs Umbilical cords were collected from full-term infants born by cesarean section at Hafez Hospital, after obtaining written informed consent from their parents following the protocols approved by the Ethics Committee of Shiraz University of Medical Sciences (IR.SUMS.REC.1400.566). All the process related to isolation and cultivation of hWJMSCs, characterization, differentiation od the cells, CM and EVs extraction was done according to a previous study ( 17 ). After collection, the umbilical cords were immediately placed in ice-cold phosphate-buffered saline (PBS) (Shellmax, USA). The solution was supplemented with antibiotics (100 U/mL streptomycin and 100 µg/mL penicillin (Gibco, UK)). Initially, the umbilical vein was incised, followed by scraping away the endothelial lining of the vein and the amniotic epithelium, after which both arteries were removed. Later, tiny explant fragments, approximately 4 by 5 mm cultured in α-Minimal Essential Medium (α-MEM) (Shellmax, USA), 10% fetal bovine serum (FBS) (Gibco, UK), 1% L-glutamine (Gibco, UK), 100 U/mL penicillin (Gibco, UK), and 100 µg/mL streptomycin (Gibco, UK) in a culture dish (SPL Lifesciences, Korea). The MSCs started migrating from the explant roughly 15 days later. For the subsequent experiments, the hWJMSC from passages 3 to 6 was employed. Characterization of hWJMSCs Following the growth expansion phase, the isolated MSCs were examined under a light microscope to evaluate cell morphology. Flow cytometry-based assay To examine cell surface markers, hWJMSCs at passage three were subjected to flow cytometry. Using the 0.25% Trypsin-EDTA (Dacell, Iran), the cells were detached from the flask (NEST, China) and were subsequently centrifuged at 1200 rpm for 5 minutes. The cell suspension was adjusted to a final concentration of 10⁶ cells per mL in 100 µL PBS (Shell max, USA) and incubated at 4°C with the following anti-human antibodies: CD73-PE, CD144, phycoerythrin-conjugated CD34, and CD90 for 30 minutes (all purchased from Abcam, UK). Cell surface staining was carried out using fluorescein isothiocyanate or phycoerythrin-conjugated isotype antibodies. Cell analysis was performed using flow cytometry and FlowJo™ software (TreeStar, Ashland, OR, USA). Differentiation into adipocytes and osteocytes Adipogenic and osteogenic differentiation media were applied to passage 3 cells for 3 and 4 weeks, respectively. A fresh medium was provided every 72 hours. The adipogenic differentiation medium was composed of α-MEM (Shellmax, USA) supplemented with 100 nM dexamethasone (Sigma, USA), 50 µg/mL ascorbic acid-2 phosphate (Merck, Germany), 10% FBS (Gibco, UK), and 50 µg/mL indomethacin (Sigma, USA). The differentiation of adipocytes was examined through oil-red O staining. Initially, the cells were fixed using 4% paraformaldehyde (Merck, Germany). In the next step, staining was performed using 0.5% oil-red O (Sigma Aldrich, USA) in isopropyl alcohol (Merck, Germany). The α-MEM supplemented with 10% FBS (Kiazist, Iran), 10 nM dexamethasone (Sigma, USA), 50 µg/mL ascorbic acid-2 phosphate (Merck, Germany), 2.1604 g/L 6-glycerol phosphate, and 10 mM β-glycerophosphate (Sigma, USA), was used as the osteogenic differentiation medium. Methanol (Merck, Germany) was used to fix the cells, and stained with Alizarin-red S (Sigma Aldrich, USA) to determine the MSCs' potential to differentiate into osteoblasts and observed with an inverted phase-contrast microscope. Preparation of conditioned media Conditioned medium (CM) was prepared from human Wharton's jelly mesenchymal stem cells (hWJMSCs). When the cells reached 70–75% confluence, the complete culture medium was removed. The cell monolayer was washed twice with phosphate-buffered saline (PBS), and serum-free medium was added. After 48 hours of culture, the medium was collected and centrifuged (12,000 × g, 10 min, 4°C). The supernatant was then processed: a fresh portion was used for extracellular vesicle (EV) isolation, and the remainder was kept in -80°C to be lyophilized to prepare the CM. Extraction of EVs The Exocib kit (Cib Biotech, Iran) was employed to isolate EVs from MSCs-CM. In short, the MSCs-CM were gathered and centrifuged at 3000 r/min for 10 minutes to remove cell fragments. Afterward, the supernatant and Exocib solution were mixed at a 5:1 ratio and incubated at 4°C for 12 hours at 4°C followed by centrifugation at 3000 r/min for 40 min. Then, after discarding the supernatant, the pellet was mixed again in 100 µL of PBS. After isolation, the EVs were preserved at -20°C. Transmission electron microscopy (TEM ) The size and shape of EVs were assessed by transmission electron microscopy (LEO 906E, Zeiss, Germany). After a 1:10 dilution in PBS (Shell max, USA), the EVs were placed on copper grids, dried at room temperature, and observed via TEM without the use of staining. ImageJ software was used to determine the size distribution of EVs (Java 1.8.0_112). Dynamic light scattering (DLS) The DLS approach allows for the measurement of particle size distributions spanning from 1 nm up to 6 µm. Particles such as EVs disperse light upon being hit by the laser beam. By analyzing changes in scattered light patterns, a mathematical model based on light scattering principles and Brownian motion was developed. Seven EV samples were assessed to calculate the average size distribution. Experiments A total of 84 NMRI (12 in each group) female mice, aged 6–8 weeks and weighing between 30 and 35 grams, were procured from the Comparative and Experimental Medicine Center at Shiraz University of Medical Sciences. The animals were housed in a controlled environment with a 12-hour light/dark cycle and ambient temperatures maintained between 20°C and 24°C. Food and water were provided ad libitum throughout the experimental period. Monitoring the estrous cycle Before experiments, vaginal smears were collected daily between 9:00 and 10:00 AM for 2 weeks to make sure that the animals were mature and had a regular sexual cycle. Vaginal cells were collected by lavage of distilled water, fixed on a slide, and stained by Giemsa to assess the estrous cycle stages, including proestrus, estrus, metestrus, and diestrus. A duration of 4 to 5 days was considered the definition of regular cycles ( 22 ). Establishment of the PCOS mouse model To induce PCOS, adult female NMRI mice received letrozole (Letrax 2.5, Abu Raihan Pharmaceutical Co, Tehran, Iran) at a dose of 90 µg/kg daily for one week by gavage ( 23 , 24 ). PCOS induction confirmation To confirm the establishment of the PCOS model, the blood testosterone levels and the histology of the ovarian tissues were determined. Serum testosterone assay To compare the testosterone levels between control and PCOS mice, the animals were anesthetized using a CO2 chamber. Blood samples were then obtained through cardiac puncture and immediately centrifuged at 3000 rpm for 10 minutes. The resulting serum samples were collected and stored at -80°C. Later, the testosterone concentration was determined using an enzyme-linked immunosorbent assay (ELISA) with commercially available kits (Monobind Inc., USA). Evaluation of the ovarian tissue Following blood collection, the ovaries were excised and fixed in 10% buffered formalin. They were then embedded in paraffin and sectioned serially at a thickness of 5 µm. The tissue sections mounted on slides were stained with hematoxylin and eosin. The different types of ovarian follicles, including primordial, primary, secondary, Graafian, atretic follicles, corpus luteum, and ovarian cysts, were counted in the prepared sections using a light microscope (Olympus, Japan)( 25 ). Experimental design and groups Both pregnant mare serum gonadotropin (PMSG, GONASER®, HIPRA, Amer, Spain) and human chorionic gonadotropin (hCG, Organon, Oss, The Netherlands) were administered at doses of 10 IU via intraperitoneal injection. The animals were divided into seven groups as follows: Control: Mice were administered PMSG followed by hCG 48 hours later. MII oocytes were collected 14 hours post-hCG administration. IVM Group: Mice were administered PMSG. Forty-eight hours later, oocytes at the GV stage were collected and cultured for 24 hours in IVM media ( 26 ). IVM + CM Group: Mice were administered PMSG. Forty-eight hours later, oocytes at the GV stage were collected and cultured for 24 hours in IVM media supplemented with hWJMSCs-derived conditioned media. IVM + EVs Group: Mice were administered PMSG. Forty-eight hours later, oocytes at the GV stage were collected and cultured for 24 hours in IVM media supplemented with hWJMSCs-derived EVs. PCOS IVM Group: PCOS-induced mice were administered PMSG. Forty-eight hours later, oocytes at the GV stage were collected and cultured for 24 hours in IVM media. PCOS IVM + CM Group: PCOS-induced mice were administered PMSG. Forty-eight hours later, oocytes at the GV stage were collected and cultured for 24 hours in IVM media supplemented with hWJMSCs-derived conditioned media. PCOS IVM + EVs Group: PCOS-induced mice were administered PMSG. Forty-eight hours later, oocytes at the GV stage were collected and cultured for 24 hours in IVM media supplemented with hWJMSCs-EVs. Determining the optimal concentration of CM and EVs To determine the optimal concentrations of CM and EVs for IVM, the maturation rate of GV-stage oocytes was assessed in IVM medium supplemented with various doses of these supplements. Initially, the protein concentrations of hWJMSCs-derived CM or EVs were measured using the Bradford Protein Assay Kit (ProtoCib, Cib Biotech, Iran) following the manufacturer's instructions. The protein concentrations were found to be 500 µg/ml for CM and 15 µg/ml for EVs. Following this, GV-stage oocytes were randomly assigned to seven groups and cultured for 24 hours in IVM medium supplemented with different concentrations of hWJMSCs-derived CM or EVs. The optimal concentration was determined based on the oocyte maturation rate. The study identified 50 µg/ml for CM and 5 µg/ml for EVs as the most effective concentrations. COCs collection and IVM procedure In the control group, mature (MII) oocytes were harvested to serve as in vivo-matured of normal oocytes for comparison with those matured in vitro. Maturity was defined by the extrusion of the first polar body. Mice were superovulated via an IP injection of PMSG, followed 48 hours later by an IP injection of hCG. Fourteen hours after hCG administration, the mice were anesthetized using a CO₂ chamber. The oviducts were then transferred into handling medium (G-MOPS™, Vitrolife, Göteborg, Sweden), which was pre-incubated for 24 hours at 37°C. Under a stereomicroscope (Nikon, Tokyo, Japan), the oviducts were dissected using two insulin syringes (Helma Teb, Baspar Sanat Fakher, Saveh, Iran). The cumulus-oocyte complexes were released and collected with flame-polished Pasteur pipettes, and the complexes were placed into a few drops of hyaluronidase (80 IU/mL; Vitrolife) to separate the cumulus cells and harvest MII oocytes. In all six IVM groups, 48 hours after PMSG injection, COCs were collected from ovarian dissection. The COCs were washed in handling medium and then cultured for 24 hours in 50 µl droplets covered with mineral oil, under a controlled environment of 5% CO₂ at 37°C. The culture medium consisted of basal IVM medium—Minimum Essential Medium α (α-MEM) supplemented with 0.1 IU/mL FSH (Follitropin alfa 75 IU, CinnaGen, Iran), 5 mIU/mL hCG (Folignan, DarouPakhsh, Iran), and 75 µg/mL Penicillin, 50 µg/mL streptomycin, and 5% fetal bovine serum (Gibco, UK) either alone or supplemented with hWJMSCs-derived CM or EVs according to the respective experimental groups. Both mature oocytes from the control group and those obtained after IVM were used for subsequent analyses, including assessment of maturation rate, measurement of oocyte diameter, perivitelline space PVS, and ZP thickness. Nuclear maturation was examined using Orcein staining of chromatin, while oocyte viability was assessed with Trypan Blue (TB) staining. Additionally, in each group, a proportion of mature oocytes were stored at -80°C for gene expression profiling of CDk1 , CCNB1 , and MAP2K using real-time PCR. Brilliant Cresyl Blue (BCB) staining To assess the effects of selecting developmentally competent oocytes, the collected COCs were first washed three times with PBS. They were then exposed to 13 µM BCB in PBS at 37°C under humidified air conditions for 90 minutes. After this incubation, the COCs were rinsed three times with PBS and subsequently classified as BCB-positive (BCB+, indicated by blue cytoplasm) or BCB-negative (BCB−, indicated by colorless cytoplasm) ( 27 ). Evaluation of the oocyte maturation rate Oocyte maturation was evaluated using an inverted microscope (Nikon, Japan), and the proportions of oocytes at various stages, GV, MI, MII, or degenerated, were recorded. Mature oocytes were identified by the presence of the first polar body. For further experiments, selected oocytes exhibited a spherical shape, a well-defined zona pellucida, a clear perivitelline space, and a faintly granular cytoplasm without inclusions ( 28 ). Examining nuclear maturation via Orcein staining of chromatin Nuclear maturation of the oocytes was assessed using aceto- orcein staining, categorizing them into GV, GVBD, anaphase-telophase, and MII stages. The oocytes were placed on a glass slide and fixed using a 3:1 acetic acid-ethanol solution for 24 hours. Next, the oocytes were stained with Aceto-Orcein and examined under an inverted microscope to assess nuclear maturation ( 29 ). Trypan blue ( TB ) staining for evaluating oocyte survival Trypan blue (TB) is a dye extensively applied to stain dead cells. The principle of TB staining is that TB is negatively charged and binds only to damaged membranes. Intact cells allow the passage of very few select compounds through the membrane, and therefore do not absorb TB. MII oocytes of control group and those from IVM groups, were stained with TB. Those which did not stained considered to be viable. In contrast, cells with damaged membranes were stained a distinctive blue color, as readily observed under a microscope ( 30 ). Measurement of Oocyte Diameter, PVS and ZP thickness After IVM The MII oocytes harvested from mice in the control group and those harvested from IVM groups, were imaged at 200x magnification using a digital camera (Nikon, Tokyo, Japan) mounted on an inverted microscope (Nikon, Japan). Using image analysis software (ImageJ, ver. 1.41o; National Institutes of Health, Bethesda, MD), the diameter of each oocyte was determined by averaging the two perpendicular measurements including the ZP ( 31 ). Also, the PVS and ZP thickness of each oocyte was measured at four different locations using ImageJ software, and the mean value of these measurements was calculated for each oocyte. Real-time RT-PCR To assess the expression of Cdk1 , Ccnb 1, and Map2k in the mature oocytes, total RNA was extracted from three pools, each containing 25 oocytes in their respective groups using the RNX-Plus kit (Cinnagen, Iran). The primers were initially designed using Primer3 software, and were subsequently verified using NCBI Primer-BLAST to confirm target specificity and produced by Pishgam Tehran Company. The primer sequences are presented in Table 1 .. To synthesize the cDNA, the mixture consists of 1 µg of RNA (which includes 2 µg of total RNA), 1 µg of a 50-µM oligo (dT)18 primer, and 5 µL of RNase-free distilled water. After incubation at 70°C for 10 minutes, the mixture was allowed to cool for at least 2 minutes. Next, a new mixture was prepared by adding 2 µL of 5× M-MLV buffer, 0.5 µL of dNTP mixture (10 mM each), 0.25 µL of 40 U/µL RNase inhibitor, and 0.25 µL of 200 U/µL RTase M-MLV (RNase H⁻), resulting in a final volume of 10 µL. The mixture underwent incubation first at 42°C for 60 minutes, then at 70°C for 15 minutes. Real-time quantitative PCR was performed using the SYBR Green I fluorescent dye reagent (SYBR® Premix Ex Taq™ II, Ampliqon Biotechnology Co., Ltd.) as well as an ABI-Step one Sequence Detection System. The experiment will be conducted three times. The findings will be presented as mean ± standard deviation, and group differences will be assessed using the 2 -ΔΔCT method ( 32 ). Table 1 Primer sequences used for real-time PCR analysis Gene Sequence forward (5′–3′) Sequence reverse (5′–3′) Product size (bp) Cdk1 TGCAATTCGGGAAATCTCTCTAT CCATGGACAGGAACTCAAAGA 116 Map2k GGAGTGGTCTTCAAGGTCTC CTCCCGGATGATCTGGTTC 105 Ccnb1 GCCTGAGCCTGAACCT TTCTGCAGGCGCACATC 118 β-actin TCCTGACCCTGAAGTACCC CACACGCAGCTCATTGTAGA 98 Statistical analysis The data were analyzed using GraphPad Prism 9 software. After confirming normal distribution and homogeneity of variances, an independent t-test was used to compare testosterone levels and the number of ovarian follicles between control and PCOS-induced mice. For other intergroup comparisons, one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test was applied. A p value ≤ 0.05 was considered statistically significant. Results Characterization of hWJMSCs Observations with light microscopy demonstrated that the monolayer MSCs were morphologically homogeneous and spindle-shaped. Using flow cytometry, it was confirmed that the isolated cells expressed MSC markers (CD73, CD90) at high levels and hematopoietic markers (CD34, CD144) at low levels (Fig. 1 . A). Additionally, Oil-Red O staining revealed the presence of lipid droplets in differentiating MSCs (Fig. 1 . B), while Alizarin Red staining indicated calcium deposition, confirming osteoblast differentiation (Fig. 1 . C). Characterization of isolated EVs Transmission electron microscopy Using TEM microscopy, Round or disk-shaped particles were seen in groups (Fig. 2 . A). Dynamic light scattering DLS is a method used to assess the dimensions of EVs. On average, EVs measured 17.82 nm in diameter. Testosterone level Letrozole-induced PCOS led to a significant rise in serum testosterone levels compared to the control group (P < 0.001) (Fig. 2 . B). Ovarian histopathology In the ovaries of mice in the control follicles in different phases of development were observed; however, in the PCOS group cystic follicles were found. Also, the PCOS mice showed significantly lower corpus luteum (Fig. 3 and Table 2 ). Yellow stars show Multiple ovarian cysts in the ovarian tissue of PCOS mice Table 2 The number of follicles, corpus Luteum and cysts in the ovarian tissue of the PCOS and control mice Groups Primordial follicles Primary follicles Secondary follicles Graafian follicles Atretic follicles Corpus Luteum Ovarian cysts Control 9.75 ± 1.4 7.75 ± 0.85 5.80 ± 0.76 0.80 ± 0.41 0.75 ± .55 4.70 ± 0.92 0 PCOS 3.35 ± 1.08* 4.0 ± 0.91* 2.85 ± 1.03* 0.35 ± .48* 8.25 ± 1.11* 0.65 ± 0.67* 9.25 ± 1.16* Data are shown as mean ± SD. * Significant difference between the PCOS and control groups (P < 0.001). The Outcomes of IVM after selecting oocytes with BCB staining The results of BCB staining are summarized in Table 3 . The IVM + CM and IVM + EVs groups exhibited a significantly higher rate of MII oocytes derived from BCB + oocytes compared to the IVM group (P = 0.007 and P = 0.01, respectively). In contrast, the PCOS IVM group showed a significant reduction in the percentage of MII oocytes compared to the IVM group (P = 0.0007). Notably, supplementation with CM or EVs in PCOS oocytes significantly increased the rate of MII oocytes compared to the PCOS IVM group (P < 0.0001 and P = 0.03, respectively). No significant differences were observed in the rate of MI oocytes between the IVM + CM and IVM + EVs groups compared to the IVM group, nor between the PCOS IVM + CM and PCOS IVM + EVs groups relative to the PCOS IVM group (P > 0.05). The percentage of GV oocytes was significantly lower in the IVM + CM and IVM + EVs groups than in the IVM group (P = 0.03 for both) and the PCOS IVM + CM group when compared to the PCOS IVM group (P = 0.03). Additionally, the PCOS IVM + CM and PCOS IVM + EVs groups had significantly fewer degenerated oocytes than the PCOS IVM group (P = 0.02 for both). The percentage of both MI, GV, and degenerated oocytes was remarkably higher in PCOS IVM when compared to the IVM group (P = 0.03, P = 0.02, and P = 0.008, respectively). Table 3 Maturation rate of mice GV oocytes selected with BCB Groups NO. of oocyte MII (% ± SD) NO. of oocyte MI (% ± SD) NO. of oocyte GV (% ± SD) NO. of oocyte Deg (% ± SD) NO. of oocyte IVM 182 62.08 ± 2.84 (113) 12.08 ± 2.26 ( 22 ) 15.93 ± 0.95 ( 29 ) 9.89 ± 0.48 ( 18 ) IVM + CM 196 73.46 ± 1.34 a (144) 10.20 ± 0.34 ( 20 ) 8.16 ± 1.29 a ( 16 ) 8.16 ± 0.38 ( 16 ) IVM + EVs 201 69.65 ± 1.75 a (140) 10.94 ± 1.84 ( 22 ) 8.95 ± 1.32 a ( 18 ) 10.44 ± 0.35 ( 21 ) PCOS IVM 181 43.09 ± 0.77 a (78) 17.67 ± 1.62 a ( 32 ) 19.88 ± 0.38 a ( 36 ) 19.33 ± 0.45 a ( 35 ) PCOS IVM + CM 190 57.36 ± 0.82 b (109) 15.78 ± 1.25 ( 30 ) 12.63 ± 0.30 b ( 24 ) 14.21 ± 0.30 b ( 27 ) PCOS IVM + EVs 202 49.5 ± 1.15 b,c (100) 17.82 ± 0.94 ( 36 ) 17.82 ± 0.37 c ( 36 ) 14.85 ± 2.33 b ( 30 ) a significant difference vs IVM group, b significant difference vs PCOS IVM group, c significant difference vs PCOS IVM + CM group Oocyte maturation rate without BCB selection of immature oocytes The study evaluated the maturation rates of oocytes across different experimental groups, with a focus on metaphase II as the primary outcome (Fig. 4 . and Table 4 ). The IVM group showed significantly lower MII rates compared to the Control group (P < 0.0001). The IVM group also had higher rates of MI oocytes (P = 0.002) and degenerated oocytes (P = 0.001), indicating reduced maturation efficiency. IVM + CM significantly improved MII rates compared to IVM alone (P = 0.003), while IVM + EVs showed no significant improvement (P = 0.82). Both IVM + CM (P = 0.02) and IVM + EVs (P = 0.04) reduced GV-stage oocytes compared to IVM alone. The PCOS IVM group had significantly lower MII rates than both the Control (P < 0.0001) and standard IVM group (P < 0.0001). PCOS IVM also exhibited higher GV oocytes (P < 0.0001) and degeneration rates (P < 0.0001) compared to Control. PCOS IVM + CM restored MII rates compared to PCOS IVM (P < 0.0001). It also reduced GV oocytes (P = 0.006) and degeneration rates (P = 0.001). PCOS IVM + EVs showed no significant improvement in MII rates (P = 0.12). However, it marginally reduced degeneration (P = 0.03), with no effect on GV retention (P = 0.89). Table 4 Percentage of Mature (MII), MI, GV, and degenerated oocytes in the immature oocytes of experimental groups selected without BCB Groups NO. of oocyte MII (% ± SD) NO. of oocyte MI (% ± SD) NO. of oocyte GV (% ± SD) NO. of oocyte Deg (% ± SD) NO. of oocyte Control 148 71.62 ± 0.71 (106) 9.45 ± 1.1 ( 14 ) 10.81 ± 1.50 ( 16 ) 8.10 ± 2.18 ( 12 ) IVM 191 54.97 ± 1.07 a (105) 15.70 ± 1.43 a ( 30 ) 14.65 ± 1.92 ( 28 ) 14.65 ± 0.93 a ( 28 ) IVM + CM 216 63.88 ± 1.22 b (138) 15.27 ± 1.17 ( 33 ) 9.72 ± 1.07 b ( 21 ) 11.11 ± 0.74 ( 24 ) IVM + EVs 179 56.42 ± 1.79 c (101) 13.40 ± 1.49 ( 24 ) 12.84 ± 1.02 c ( 23 ) 11.73 ± 0.62 ( 21 ) PCOS IVM 187 37.96 ± 1.68 d (71) 15.50 ± 1.85 ( 29 ) 20.85 ± 1.15 d ( 39 ) 25.66 ± 1.99 ( 48 ) PCOS IVM + CM 175 56 ± 1.55 e (98) 12.57 ± 1.5 ( 22 ) 16 ± 0.91 ( 28 ) 15.42 ± 1.26 e ( 27 ) PCOS IVM + EVs 171 40.93 ± 0.98 f (70) 18.71 ± 0.95 f ( 32 ) 20.46 ± 1.19 f ( 35 ) 19.88 ± 1.15 e,f ( 34 ) a Significant difference with the control group, b Significant difference with the IVM group, c Significant difference with IVM + CM group, d Significant difference with IVM, e Significant difference with PCOS IVM group, f Significant difference with PCOS IVM + CM group (P < 0.05). Effects of secretome (CM/EVs) from hWJMSCs on nuclear maturation of oocytes Following orcein staining, it was observed that the proportion of MII oocytes was significantly lower in the IVM group compared to the control group (P < 0.0001). However, this rate increased in the IVM + CM group compared to the IVM group (P = 0.0014). Additionally, the rate was significantly higher in the IVM + CM group than in the IVM + EVs group (P = 0.04). In the PCOS group, the proportion of MII oocytes was lower compared to the non-PCOS IVM group (P = 0.0246). Among PCOS samples, the IVM + CM group showed a higher rate than the PCOS IVM group (P = 0.002). The percentage of degenerated oocytes was significantly higher in the IVM group compared to the control (P = 0.004), but it was significantly reduced in the IVM + EVs group relative to the IVM group (P = 0.0003). These findings are illustrated in Figs. 5 and 6 . Effects of hWJMSCs-derived CM or EVs on the survival rate of MII oocytes Mature oocyte viability was evaluated across experimental groups (Figure. 7A). The proportion of viable metaphase II (MII) oocytes in the IVM group was significantly lower than in the control group (P < 0.0001). However, supplementation with conditioned medium (IVM + CM) or extracellular vesicles (IVM + EVs) significantly improved oocyte viability compared to IVM alone (P < 0.01 and P < 0.001, respectively). In the PCOS model, IVM + CM resulted in fewer viable MII oocytes than standard IVM (P < 0.0001). Conversely, both PCOS IVM + CM and PCOS IVM + EVs exhibited significantly higher oocyte viability compared to PCOS IVM (P < 0.0001 and P < 0.001, respectively). Effects of secretome (CM/EVs) from hWJMSCs on Morphometric parameters of oocytes Comparative analysis of oocyte diameter across experimental groups revealed a significant reduction in the IVM group compared to the control group (P < 0.0001). However, oocyte diameter was significantly higher in the IVM + CM group than in both the IVM (P < 0.0001) and IVM + EVs (P = 0.0057) groups. Furthermore, both CM and EVs significantly increased oocyte diameter compared to the PCOS group (P 0.05) (Figs. 7 B– 7 D). Effects of secretome (CM/EVs) from hWJMSCs on expression of Cdk1, Ccnb1, and Map2k Map2k transcript levels were significantly downregulated in the IVM group relative to controls (P = 0.011) and further diminished in the PCOS IVM group compared to IVM alone (P = 0.012). In contrast, supplementation with CM (conditioned medium) in the IVM group led to a marked increase in Map2k expression (P = 0.003). Similarly, the PCOS IVM + CM group exhibited elevated Map2k levels compared to both PCOS IVM and PCOS IVM + EVs groups (P = 0.005 and P = 0.0485, respectively). For Ccnb1 , expression was significantly reduced in the IVM group versus controls (P = 0.007), while no significant difference was observed between the PCOS IVM and IVM groups (P > 0.05). Although Ccnb1 levels showed an upward trend in IVM + CM and IVM + EVs groups compared to IVM alone, this increase did not reach statistical significance (P > 0.05). However, in the PCOS IVM + CM group, Ccnb1 expression was significantly higher than in PCOS IVM (P = 0.027). Cdk1 expression was significantly lower in the IVM group than in controls (P = 0.006) and exhibited a non-significant increase in the IVM + CM group (P = 0.022). Notably, Cdk1 levels were further reduced in PCOS IVM compared to IVM (P = 0.004). Conversely, the PCOS IVM + CM group displayed a significant upregulation relative to PCOS IVM (P = 0.021) (Fig. 8 ). Discussion This study demonstrates that in vitro maturation efficiency is significantly compromised in both standard and PCOS models, as evidenced by reduced metaphase II oocyte yields, increased GV and degenerated oocytes, and downregulation of key maturation regulators ( Cdk1, Ccnb1, and Map2k). However, supplementation with human Wharton’s jelly mesenchymal stem cell-derived conditioned medium consistently rescued oocyte competence, enhancing nuclear maturation rates, oocyte viability, and morphometric parameters (oocyte diameter and ZP thickness). Notably, BCB + oocytes treated with CM exhibited significantly higher MII rates compared to IVM alone, while PCOS IVM oocytes showed severe maturation defects, which were partially reversed by CM. EVs also improved outcomes but were less effective than CM, particularly in PCOS, where CM restored Map2k and Cdk1 expression—critical for meiotic progression. These findings highlight CM’s superior potential in optimizing IVM, especially in PCOS-associated oocyte dysfunction, likely due to its rich secretome of growth factors and regulatory molecules. The developmental potential of oocytes refers to their capacity to resume meiosis, undergo fertilization, form a blastocyst, and ultimately give rise to healthy offspring ( 33 ). Although efforts have been made, the chances of implantation and live births remain very low for embryos developed from matured oocytes in IVM. On the other hand, research indicates that the cells in these embryos often have chromosomal abnormalities. Therefore, oocyte quality is highly important and studies are looking for the best maturation of immature oocytes and reducing their subsequent complications ( 34 ). To enhance the efficiency of in vitro embryo production, the initial step involves choosing high-quality, suitable immature oocytes that produce the highest quality mature oocytes when transferred to the IVM environment ( 35 , 36 ). The BCB staining method, a non-invasive technique that reveals glucose-6-phosphate dehydrogenase (G6PD) levels, is the optimal way to select immature oocytes. This enzyme is abundant in fresh, high-quality oocytes but declines as the oocyte ages ( 37 ). Research indicates that BCB + oocytes exhibit higher rate of cytoplasmic maturation, improved fertilization rates, and enhanced embryo development to the blastocyst stage compared to BCB- oocytes ( 38 ). Due to the benefits of this staining, we used this staining in this study to select high-quality immature oocytes and examine the effect of CM and EVs in both BCB + and BCB- groups. The current study revealed significant differences in maturation outcomes between BCB-selected and non-selected oocytes during IVM. BCB + oocytes demonstrated superior developmental competence, with significantly higher MII rates in both standard IVM and PCOS models compared to their non-selected counterparts. This enhanced performance was accompanied by reduced rates of degeneration and GV arrest in BCB-selected oocytes, particularly when supplemented with CM. In contrast, non-selected oocytes exhibited poorer outcomes across all parameters, including lower MII rates, higher degeneration, and increased meiotic arrest. These results collectively demonstrate that BCB selection serves as an effective screening tool that not only identifies oocytes with greater developmental potential but also enhances their responsiveness to IVM optimization strategies, particularly in challenging conditions like PCOS. The stark contrast between BCB-selected and non-selected oocytes underscores the importance of pre-IVM competence assessment for improving ART outcomes. This finding agrees with prior studies by Yan-Guang that employed the same staining technique for selecting viable immature mouse oocytes ( 38 ). Besides, in support of our findings of better developmental potential of BCB + oocytes, Opiela et al. (2008) found that BCB + bovine oocytes matured in vitro and then underwent in vitro fertilization (IVM/IVF) had significantly more ability to reach the 2-cell stage and blastocyst stage than BCB- oocytes in their ability ( 39 ). Research indicates that BCB + oocytes exhibit significantly elevated mRNA levels of genes related to mitochondrial biogenesis, suggesting this could contribute to their enhanced developmental potential ( 40 ). Overall, the study demonstrates that both CM and EVs groups showed significantly higher MII oocyte yields compared to standard IVM for normal and PCOS mice, with CM proving more effective than EVs, likely due to its broader spectrum of soluble factors. During maturation, oocytes experience nuclear transformations, exiting the diplotene stage of the first meiotic prophase and advancing to metaphase II, while releasing the first polar body. Observing the chromosomes of oocytes at this stage provides a more dependable method for assessing the progress of in vitro maturation ( 41 ). In this research, we conducted orcein staining for the initial time to assess nuclear maturation in mouse oocytes. Orcein staining confirmed CM's superiority in restoring MII rates even in PCOS oocytes, while EVs were more effective at reducing degeneration, indicating distinct but complementary roles. PCOS oocytes exhibited significantly lower MII rates and higher degeneration, but CM supplementation restored maturation efficiency, highlighting its potential clinical relevance for PCOS patients undergoing IVM. The viability and morphometric assessments collectively demonstrate that CM significantly enhances both oocyte survival rates and morphological parameters, key indicators of developmental competence, particularly in PCOS-derived oocytes, while EVs show more modest improvements. This consistent pattern suggests that although EVs contain essential bioactive factors, CM's richer composition of regulatory components provides more comprehensive support for oocyte maturation by simultaneously improving viability, restoring normal diameter, and maintaining proper ZP thickness. The superior efficacy of CM under challenging conditions like PCOS highlights its multifaceted protective and maturation-promoting effects, implying that while EVs offer therapeutic potential, CM's broader array of factors may be necessary for optimal IVM outcomes, especially in compromised oocytes. Although existing commercial IVM media are costly and show limited effectiveness, MSC-CM holds promise due to its likely paracrine effects, justifying its exploration in this research. Recent decades have seen multiple studies attempting to overcome the absence of a follicular microenvironment in IVM through the addition of exogenous growth factors, follicular fluid, and co-culture systems that use fresh oocytes, denuded oocytes, and oviduct cells to simulate an in vivo setting ( 14 , 42 , 43 ). Similar to our results, Ling et al. demonstrated that MSC-conditioned medium resulted in a greater rate of mouse oocyte maturation than α-MEM. Their findings might vary from ours because of differences in MSC origin, oocyte type, and culture techniques. Highlighting the importance of standardized protocols when comparing IVM outcomes across experimental models ( 44 ). Adib et al. (2020) reported that both human testicular cell-conditioned medium and cumulus cell-conditioned medium (hCCCM) significantly improved oocyte maturation rates. However, these conditioned media were also associated with morphological alterations, including perivitelline space (PVS) enlargement and a higher incidence of irregular oocyte shape compared to control groups ( 45 , 46 ). The human umbilical cord mesenchymal stem cells significantly enhanced the maturation rates of both fresh and vitrified human oocytes. Additionally, it improved oocyte ultrastructures such as increased mitochondria-vesicle complexes, optimized cortical granule distribution, and enhanced mitochondrial-smooth endoplasmic reticulum aggregates. ( 47 ) Several studies have confirmed that oocyte morphology significantly influences embryo development, and high-quality embryos are more likely to be obtained after IVM when morphologically normal oocytes are used ( 48 , 49 ). Among the key abnormalities in the extracytoplasmic components, anomalies in the perivitelline space (PVS) are particularly notable. Some evidence suggests that an enlarged PVS may contribute to higher oocyte degeneration ( 49 ) and reduced fertilization success ( 50 ). Interestingly, however, one study found that oocytes with PVS abnormalities exhibited a significantly higher embryo development rate compared to normal oocytes, which contrasts with earlier findings ( 51 ). Bahrami et al. (2022) reported that granulosa cell-conditioned medium markedly enhanced IVM outcomes by increasing the proportion of oocytes reaching the MII stage, improving mitochondrial membrane potential and oocyte viability, boosting fertilization in vitrified-warmed and IVM oocytes, and regulating the expression of key maturation-related genes in MII oocytes of the mouse ( 52 ). Another study has shown that conditioned media from equine amniotic fluid mesenchymal stem cells promote maturation of porcine oocytes by modulating the expression of critical genes involved in cumulus cell-mediated maturation, improving mitochondrial distribution, enhancing cortical granule positioning, and ultimately enhancing blastocyst quality ( 53 ). Also, exosomes derived from human umbilical cord mesenchymal stem cells improved oocyte quality by increasing maturation rates, optimizing spindle formation, enhancing mitochondrial function, and boosting developmental potential ( 54 ). Recent studies across multiple species demonstrate the critical role of follicular fluid-derived EVs (ffEVs) in enhancing oocyte maturation and developmental competence. In mares and porcines, follicular fluid-derived EVs significantly increased maturation rates ( 55 , 56 ). Bovine studies revealed that ffEVs from preovulatory follicles and ampullary fluid upregulated maturation-related genes and improved fertilization rates, alongside metabolic quality markers ( 57 ). Further, equine ffEVs promoted cumulus expansion, viability, and MAPK pathway activation during maturation ( 58 ). Additional evidence shows that ffEVs enhance embryo development and oocyte resistance to aging ( 59 ). Collectively, these findings highlight ffEVs as conserved regulators of oocyte competence, with species-specific roles in altering gene expression. In human ffEVs isolated from mature follicles, enhanced in vitro maturation of immature oocytes ( 60 ). Conversely, a study showed that ffEV supplementation does not improve nuclear maturation of cat oocytes in vitro ( 61 ). The findings from our study, which demonstrated lower in vitro maturation IVM rates in oocytes from PCOS mice compared to controls, align with previous research highlighting the detrimental effects of PCOS-associated follicular microenvironment on oocyte quality. Liu et al. (2023) reported that EVs derived from the follicular fluid of PCOS women significantly impaired oocyte maturation, leading to increased mitochondrial mislocalization, spindle abnormalities, and upregulated antioxidant gene expression. These observations suggest that the altered composition of follicular fluid in PCOS may contribute to oxidative stress and dysfunctional oocyte maturation, potentially explaining the reduced IVM efficiency observed in our study ( 62 ). Supporting this notion, Madkour et al. (2018) conducted a randomized controlled trial in which supplementation of IVM media with follicular fluid and cumulus-granulosa cell secretions from non-PCOS women significantly improved the maturation rates of immature oocytes from PCOS patients ( 63 ). Consistent with the mentioned results of oocyte maturation and quality, gene expression analysis of maturation-related genes revealead significant alterations in the expression of key regulatory genes, Map2k, Ccnb1, and Cdk1, during IVM under different experimental conditions, particularly in the context of PCOS. The observed downregulation of Map2k in the IVM and PCOS IVM groups suggests impaired MAPK/ERK signaling, a critical pathway for oocyte maturation and metabolic homeostasis. The further reduction in PCOS IVM oocytes may reflect exacerbated dysfunction in PCOS, where aberrant folliculogenesis and oxidative stress are known to disrupt signaling cascades. The restoration of Map2k expression in IVM + CM and PCOS IVM + CM groups implies that conditioned medium (CM) contains factors—possibly growth factors or extracellular vesicles—that rescue MAPK pathway activity, potentially improving oocyte competence. CCcnb1 and CDK1 suppression may contribute to maturation arrest in IVM. While the PCOS IVM group showed no further significant decline in Ccnb1, the marked reduction in Cdk1 suggests a PCOS-specific defect in the oocyte cell cycle. Notably, CM supplementation consistently upregulated both genes in PCOS IVM, reinforcing its potential to mitigate cell cycle disruptions. Collectively, these results provide robust evidence that hWJMSC-derived CM and EVs enhance oocyte developmental competence, particularly in challenging conditions like PCOS, where conventional protocols often yield poorer results. By rescuing Map2k, Ccnb1, and Cdk1 expression, CM may promote nuclear and cytoplasmic maturation, ultimately improving embryo quality. Conclusion The superior performance of CM highlights its potential as an optimized supplement for IVM protocols, while EVs offer a more refined, cell-free alternative that may be advantageous for clinical translation. Future research should employ proteomic/metabolomic profiling to identify key active components in CM/EVs for developing standardized IVM treatment. These findings should then be validated in translational models, with parallel investigation of synergistic effects when combined with adjuvants like antioxidants. Such efforts will optimize IVM protocols, enhancing oocyte quality and maturation rates in both normal and PCOS conditions for clinical application. Abbreviations IVM in vitro maturation CM Conditioned Media EVs Extracellular Vesicles PCOS Poly Cystic Ovarian Syndrome hWJMSCs Human Wharton's Jelly Mesenchymal Stem Cells BCB Brilliant Cresyl Blue TB Trypan Blue PBS Phosphate Buffer Saline Declarations Acknowledgements This study was supported by the Shiraz University of Medical Sciences, Shiraz, Iran (Grant No. 23144). This work is a part of the duties that were done by A Solati for phD program. Author contributions All authors contributed to the conceptualization and design of the study. Experiments were conducted by A.S., M.D., and S.B., Data analysis, interpretation, and preparation of figures and tables were performed by A.Z., S.A., F.Z., Z.KH., and SH. M. A.S., S.A., F.Z. supervised the study. Z. KH., and SH. M. provided methodological guidance. The first draft of the manuscript was written collaboratively by A.S. and S.A., with revisions and editing contributions from all authors. All authors critically reviewed earlier drafts and approved the final manuscript. Funding This study was supported by the Shiraz University of Medical Sciences, Shiraz, Iran (Grant No. 23144). Data availability No data sets were generated or analyzed during the current study. Ethical statement All procedures were approved by the Ethics Committee of Shiraz University of Medical Sciences (IR.SUMS.AEC.1400.566). Consent for publication Not applicable. Declaration of conflicting interests The authors declared no potential conflicts of interest. References Sengupta P, Dutta S. Polycystic Ovary Syndrome Beyond Reproduction: An Ethnic, Endocrine, and Lifestyle Enigma Demanding Holistic and Lifelong Solutions for the Modern Woman. Journal of Infertility and Reproductive Biology. 2025:1-3-1-3. Agarwal S, Krishna D, Praneesh G, Rao KJJIRB. Tetrad of hormonal and biochemical manifestations in phenotypes of polycystic ovary syndrome. 2020;8(4):73–83. Alaee S, Ekramzadeh M, Samare-Najaf M, Jahromi BN, Shokri S, Ghomashi10 F, et al. Nutritional Intake and Lifestyle in Infertile Women with and without Polycystic Ovary Syndrome: A Case-control Study. 2024;12(4):15-30-15-30. Ward CP, Huddleston H, Masharani U, Mason AE, Frassetto L. Stringency in Polycystic Ovary Syndrome (PCOS) Criteria and Application in Clinical Study. Jie H, Zhao M, Alqawasmeh OAM, Chan CPS, Lee TL, Li T, et al. In vitro rescue immature oocytes–a literature review. 2022;25(4):640–50. Grynberg M, Sermondade N, Sellami I, Benoit A, Mayeur A, Sonigo CJF, et al. In vitro maturation of oocytes for fertility preservation: a comprehensive review. 2022;3(4):211–26. Mackens S, Pareyn S, Drakopoulos P, Deckers T, Mostinckx L, Blockeel C, et al. Outcome of in-vitro oocyte maturation in patients with PCOS: does phenotype have an impact? 2020;35(10):2272-9. Jayakrishnan K, Nambiar D, Fency JLJJIRB. Comparison of ovarian response between PCOS and Non-PCOS patients undergoing ICSI with antagonist protocol. 2015;3(3):199–207. Nikmard F, Hosseini E, Bakhtiyari M, Ashrafi M, Amidi F, Aflatoonian R. The boosting effects of melatonin on the expression of related genes to oocyte maturation and antioxidant pathways: a polycystic ovary syndrome- mouse model. J Ovarian Res. 2022;15(1):11. Filatov M, Khramova Y, Semenova M. Molecular Mechanisms of Prophase I Meiotic Arrest Maintenance and Meiotic Resumption in Mammalian Oocytes. Reprod Sci. 2019;26(11):1519–37. Landim-Alvarenga F, Maziero RJAR. Control of oocyte maturation. 2018;11(3):150–8. Jiang Y, He Y, Pan X, Wang P, Yuan X, Ma B. Advances in Oocyte Maturation In Vivo and In Vitro in Mammals. Int J Mol Sci. 2023;24(10):9059. Akbari H. The effect of conditioned media on mouse oocytes ultrastructure following in vitro maturation. Gene Reports. 2020;20:100732. Alaee S, Zal F, Razban V, Talaei-Khozani T, Shokri S, Khodabandeh Z. PRP Influences Maturation and Fertilisation of Immature Mouse Oocytes. Anat Histol Embryol. 2024;53(6):e13112. Alaee S, Asadollahpour R, Hosseinzadeh Colagar A, Talaei-Khozani T. The decellularized ovary as a potential scaffold for maturation of preantral ovarian follicles of prepubertal mice. Systems Biology in Reproductive Medicine. 2021;67(6):413–27. Walls ML, Hart RJ. In vitro maturation. Best Pract Res Clin Obstet Gynaecol. 2018;53:60–72. Bahmyari S, Alaee S, Khodabandeh Z, Talaei-Khozani T, Dara M, Mehdinejadiani S, et al. The effects of Wharton’s jelly MSCs secretomes for restoring busulfan-induced reproductive toxicity in male mice. Human and Experimental Toxicology. 2024;43:09603271241269019. Smolinska V, Bohac M, Danisovic L. Current status of the applications of conditioned media derived from mesenchymal stem cells for regenerative medicine. Physiol Res. 2023;72(S3):S233-S45. Hasan MM. Characterization of follicular fluid-derived extracellular vesicles and their contribution to periconception environment. Tartu; 2022. Worthington EN, Hagood JS. Therapeutic Use of Extracellular Vesicles for Acute and Chronic Lung Disease. Int J Mol Sci. 2020;21(7):2318. Capra E, Lange-Consiglio AJB. The biological function of extracellular vesicles during fertilization, early embryo—maternal crosstalk and their involvement in reproduction: review and overview. 2020;10(11):1510. Alaee S, Bagheri MJ, Ataabadi MS, Koohpeyma F. Capacity of Mentha spicata (spearmint) extracts in alleviating hormonal and folliculogenesis disturbances in a polycystic ovarian syndrome rat model. World J Vet. 2020(3):451–6. Lohrasbi P, Karbalay-Doust S, Mohammad Bagher Tabei S, Azarpira N, Alaee S, Rafiee B, et al. The effects of melatonin and metformin on histological characteristics of the ovary and uterus in letrozole-induced polycystic ovarian syndrome mice: A stereological study. Int J Reprod Biomed. 2022;20(11):973–88. Rafiee B, Karbalay-Doust S, Tabei SMB, Azarpira N, Alaee S, Lohrasbi P, et al. Effects of N-acetylcysteine and metformin treatment on the stereopathological characteristics of uterus and ovary. European journal of translational myology. 2022;32(2):10409. Ataabadi MS, Bahmanpour S, Yousefinejad S, Alaee S. Blood volatile organic compounds as potential biomarkers for poly cystic ovarian syndrome (PCOS): An animal study in the PCOS rat model. The Journal of Steroid Biochemistry Molecular Biology. 2023;226:106215. Zare Z, Abouhamzeh B, Masteri Farahani R, Salehi M, Mohammadi M. Supplementation of L-carnitine during in vitro maturation of mouse oocytes affects expression of genes involved in oocyte and embryo competence: An experimental study. Int J Reprod Biomed. 2017;15(12):779–86. Murin M, Strejcek F, Bartkova A, Morovic M, Benc M, Prochazka R, et al. Intranuclear characteristics of pig oocytes stained with brilliant cresyl blue and nucleologenesis of resulting embryos. Zygote. 2019;27(4):232–40. Jafarzadeh H, Nazarian H, Ghaffari Novin M, Shams Mofarahe Z, Eini F, Piryaei A. Improvement of oocyte in vitro maturation from mice with polycystic ovary syndrome by human mesenchymal stromal cell–conditioned media. Journal of cellular biochemistry. 2018;119(12):10365–75. Fazelian-Dehkordi K, Talaei‐Khozani T. Three‐dimensional in vitro maturation of rabbit oocytes enriched with sheep decellularized greater omentum. Veterinary Medicine and Science. 2022;8(5):2092–103. Zand E, Fathi R, Nasrabadi MH, Atrabi MJ, Spears N, Akbarinejad V. Maturational gene upregulation and mitochondrial activity enhancement in mouse in vitro matured oocytes and using granulosa cell conditioned medium. Zygote. 2018;26(5):366–71. Kim J, You J, Hyun SH, Lee G, Lim J, Lee E. Developmental competence of morphologically poor oocytes in relation to follicular size and oocyte diameter in the pig. Mol Reprod Dev. 2010;77(4):330–9. Liu J, Lu X, Wang W, Zhu J, Li Y, Luo L, et al. Activity of MPF and expression of its related genes in mouse MI oocytes exposed to cadmium. Food Chem Toxicol. 2018;112:332–41. Sirard MA, Richard F, Blondin P, Robert C. Contribution of the oocyte to embryo quality. Theriogenology. 2006;65(1):126–36. Anderiesz C, Fong CY, Bongso A, Trounson AO. Regulation of human and mouse oocyte maturation in vitro with 6-dimethylaminopurine. Hum Reprod. 2000;15(2):379–88. Vernunft A, Alm H, Tuchscherer A, Kanitz W, Hinrichs K, Torner HJT. Chromatin and cytoplasmic characteristics of equine oocytes recovered by transvaginal ultrasound-guided follicle aspiration are influenced by the developmental stage of their follicle of origin. 2013;80(1):1–9. Opiela J, Lipiński D, Słomski R, Kątska-Książkiewicz LJARS. Transcript expression of mitochondria related genes is correlated with bovine oocyte selection by BCB test. 2010;118(2–4):188–93. Alm H, Torner H, Löhrke B, Viergutz T, Ghoneim I, Kanitz WJT. Bovine blastocyst development rate in vitro is influenced by selection of oocytes by brillant cresyl blue staining before IVM as indicator for glucose-6-phosphate dehydrogenase activity. 2005;63(8):2194–205. Wu YG, Liu Y, Zhou P, Lan GC, Han D, Miao DQ, et al. Selection of oocytes for in vitro maturation by brilliant cresyl blue staining: a study using the mouse model. Cell Res. 2007;17(8):722–31. Opiela J, Kątska-Książkiewicz L, Lipiński D, Słomski R, Bzowska M, Ryńska B. Interactions among activity of glucose-6-phosphate dehydrogenase in immature oocytes, expression of apoptosis-related genes Bcl-2 and Bax, and developmental competence following IVP in cattle. Theriogenology. 2008;69(5):546–55. Opiela J, Lipiński D, Słomski R, Kątska-Książkiewicz L. Transcript expression of mitochondria related genes is correlated with bovine oocyte selection by BCB test. Animal Reproduction Science. 2010;118(2–4):188–93. El-Sokary MM, Kandiel MM, Mahmoud KGM, Abouel-Roos ME, Sosa GA. Evaluation of viability and nuclear status in vitrified mature buffalo oocytes. Glob Vet. 2013;10:297–302. Lee SH. Effects of Human Endothelial Progenitor Cell and Its Conditioned Medium on Oocyte Development and Subsequent Embryo Development. Int J Mol Sci. 2020;21(21):7983. Bhardwaj R, Ansari MM, Parmar MS, Chandra V, Sharma GT. Stem Cell Conditioned Media Contains Important Growth Factors and Improves In Vitro Buffalo Embryo Production. Anim Biotechnol. 2016;27(2):118–25. Ling B, Feng DQ, Zhou Y, Gao T, Wei HM, Tian ZG. Effect of conditioned medium of mesenchymal stem cells on the in vitro maturation and subsequent development of mouse oocyte. Braz J Med Biol Res. 2008;41(11):978–85. Adib M, Seifati SM, Ashkezari MD, Akyash F, Khoradmehr A, Aflatoonian B. Effect of human testicular cells conditioned medium on in vitro maturation and morphology of mouse oocytes. International Journal of Fertility & Sterility. 2020;14(3):176. Adib M, Seifati SM, Ashkezari MD, Khoradmehr A, Rezaee-Ranjbar-Sardari R, Tahajjodi SS, et al. The effect of the human cumulus cells-conditioned medium on in vitro maturation of mouse oocyte: An experimental study. International Journal of Reproductive BioMedicine. 2020;18(12):1019. Akbari H, Vaghefi SHE, Shahedi A, Habibzadeh V, Mirshekari TR, Shekari MA, et al. Conditioned mediums and human oocytes in vitro maturation. Int J Pharm Phytopharm Res (eIJPPR). 2018;8(2):64–71. Khalili MA, Mojibian M, Sultan A-M. Role of oocyte morphology on fertilization and embryo formation in assisted reproductive techniques. Cell Journal (Yakhteh). 2005. Mikkelsen AL, Lindenberg S. Morphology of in-vitro matured oocytes: impact on fertility potential and embryo quality. Human Reproduction. 2001;16(8):1714–8. Plachot M, Selva J, Wolf J, Bastit P, De Mouzon J. Consequences of oocyte dysmorphy on the fertilization rate and embryo development after intracytoplasmic sperm injection. A prospective multicenter study. Gynecologie, Obstetrique Fertilite. 2002;30(10):772–9. Hassa H, Aydın Y, Taplamacıoğlu F. The role of perivitelline space abnormalities of oocytes in the developmental potential of embryos. Journal of the Turkish German Gynecological Association. 2014;15(3):161. Bahrami Z, Hatamian N, Talkhabi M, Zand E, Mottershead DG, Fathi R. Granulosa Cell Conditioned Medium Enhances The Rate of Mouse Oocyte In Vitro Maturation and Embryo Formation. Cell Journal (Yakhteh). 2022;24(10):620. Park A, Oh HJ, Ji K, Choi EM, Kim D, Kim E, et al. Effect of passage number of conditioned medium collected from equine amniotic fluid mesenchymal stem cells: porcine oocyte maturation and embryo development. International Journal of Molecular Sciences. 2022;23(12):6569. Song J, Guo X, Zhang B, Zhang Q, Han Y, Cao D, et al. Human umbilical cord mesenchymal stem cells derived exosomes improved the aged mouse IVM oocytes quality. Reproductive Sciences. 2024;31(9):2808–19. Gabryś J, Kij-Mitka B, Sawicki S, Kochan J, Nowak A, Łojko J, et al. Extracellular vesicles from follicular fluid may improve the nuclear maturation rate of in vitro matured mare oocytes. Theriogenology. 2022;188:116–24. Kang H, Bang S, Kim H, Han A, Miura S, Park HS, et al. Follicular fluid-derived extracellular vesicles improve in vitro maturation and embryonic development of porcine oocytes. Korean Journal of Veterinary Research. 2023;63(4):40.1-.7. Pakniyat Z, Azari M, Kafi M, Ghaemi M, Hashemipour SMA, Safaie A, et al. The effect of follicular and ampullary fluid extracellular vesicles on bovine oocyte competence and in vitro fertilization rates. Plos One. 2025;20(6):e0325268. Gabryś J, Gurgul A, Szmatoła T, Kij-Mitka B, Andronowska A, Karnas E, et al. Follicular fluid-derived extracellular vesicles influence on in vitro maturation of equine oocyte: impact on cumulus cell viability, expansion and transcriptome. International Journal of Molecular Sciences. 2024;25(6):3262. Shedova E, Singina G, Uzbekova S, Uzbekov R, Lukanina V, Tsyndrina E. Effect of extracellular vesicles of follicular origin during in vitro maturation and ageing of bovine oocytes on embryo development after in vitro fertilization. Sel'skokhozyaistvennaya Biologiya. 2022. Makieva S, Saenz-de-Juano MD, Almiñana C, Bauersachs S, Bernal-Ulloa S, Xie M, et al. Treatment of human oocytes with extracellular vesicles from follicular fluid during rescue in vitro maturation enhances maturation rates and modulates oocyte proteome and ultrastructure. bioRxiv. 2025:2025.02. 05.636623. Dahal R, Nagashima J, Songsasen N, Wood T. 150 The influence of follicular fluid extracellular vesicles on in vitro maturation of oocytes in the domestic cat. Reproduction, Fertility and Development. 2021;34(2):313-. Liu C, Wang M, Yao H, Cui M, Gong X, Wang L, et al. Inhibition of oocyte maturation by follicular extracellular vesicles of nonhyperandrogenic PCOS patients requiring IVF. The Journal of Clinical Endocrinology & Metabolism. 2023;108(6):1394–404. Madkour A, Bouamoud N, Kaarouch I, Louanjli N, Saadani B, Assou S, et al. Follicular fluid and supernatant from cultured cumulus-granulosa cells improve in vitro maturation in patients with polycystic ovarian syndrome. Fertility and sterility. 2018;110(4):710–9. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 27 Dec, 2025 Read the published version in BioMedical Engineering OnLine → Version 1 posted Editorial decision: Revision requested 30 Sep, 2025 Reviews received at journal 30 Sep, 2025 Reviews received at journal 29 Sep, 2025 Reviews received at journal 26 Sep, 2025 Reviewers agreed at journal 02 Sep, 2025 Reviewers agreed at journal 02 Sep, 2025 Reviewers agreed at journal 29 Aug, 2025 Reviewers agreed at journal 28 Aug, 2025 Reviewers invited by journal 28 Aug, 2025 Editor assigned by journal 20 Aug, 2025 Submission checks completed at journal 20 Aug, 2025 First submitted to journal 19 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7410176","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":509439762,"identity":"5a23eb1c-15be-455c-a7ba-acfe6a2cd5df","order_by":0,"name":"Arezoo Solati","email":"","orcid":"","institution":"Shiraz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Arezoo","middleName":"","lastName":"Solati","suffix":""},{"id":509439763,"identity":"856d2bb5-1f02-4bae-b61f-47ea0f4d0bbf","order_by":1,"name":"Sanaz Alaee","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAu0lEQVRIiWNgGAWjYDACdhBRAedKEKGFGUScIVkLYxsp7uJvZn744OO8usS1/QcYP/xgsMgnqEXiMJux4cxthxO33UhgluxhkLBsIKjnMIOZNO+2A0AtDAzSQCMMCOqQP8z+/fffOXWJ284fYP5NlBaDwzxmzIwNzInbDiSwEWeL4WGeYsmeY4eNt91IbLPsMSBCi9zx9o0fftTUyW47f/jwjR8VdYS1IAHGBqA7SdEwCkbBKBgFowAnAACz/zfvmMiKCgAAAABJRU5ErkJggg==","orcid":"","institution":"Shiraz University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Sanaz","middleName":"","lastName":"Alaee","suffix":""},{"id":509439764,"identity":"46511ff7-21c0-402a-b8de-82209066d3e6","order_by":2,"name":"Fatemeh Zal","email":"","orcid":"","institution":"Shiraz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Fatemeh","middleName":"","lastName":"Zal","suffix":""},{"id":509439765,"identity":"58fe5b83-dd0b-4425-bbd9-948bd5295363","order_by":3,"name":"Zahra Khodabandeh","email":"","orcid":"","institution":"Shiraz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Zahra","middleName":"","lastName":"Khodabandeh","suffix":""},{"id":509439766,"identity":"142f88c8-1df9-4a4a-8ad0-b75ea0347ccb","order_by":4,"name":"Mahintaj Dara","email":"","orcid":"","institution":"Shiraz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mahintaj","middleName":"","lastName":"Dara","suffix":""},{"id":509439767,"identity":"c1bb72a9-b4e3-44c5-9295-44f639a51e47","order_by":5,"name":"Shayesteh Mehdinejadiani","email":"","orcid":"","institution":"University of Calgary","correspondingAuthor":false,"prefix":"","firstName":"Shayesteh","middleName":"","lastName":"Mehdinejadiani","suffix":""},{"id":509439768,"identity":"66271ac3-ca3d-465c-b02f-6477f5a3c3c5","order_by":6,"name":"Sedigheh Bahmyari","email":"","orcid":"","institution":"Shiraz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Sedigheh","middleName":"","lastName":"Bahmyari","suffix":""}],"badges":[],"createdAt":"2025-08-19 15:38:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7410176/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7410176/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12938-025-01500-7","type":"published","date":"2025-12-27T15:57:50+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":90589503,"identity":"849b0907-8266-40bf-b711-64e0b66df1d9","added_by":"auto","created_at":"2025-09-04 12:11:31","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":616201,"visible":true,"origin":"","legend":"\u003cp\u003eCharacterization of human Wharton's jelly mesenchymal stem cells (hWJMSCs); (A) Surface marker expression profile analyzed by flow cytometry\u003cbr\u003e\n(B) Adipogenic differentiation potential demonstrated by Oil Red O staining\u003cbr\u003e\n(C) Osteogenic differentiation capacity shown by Alizarin Red staining\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-7410176/v1/1177ad5f9f40fcf48e5dd24a.png"},{"id":90589552,"identity":"36e6e0d7-d211-4b37-bc1e-55a98b685dc8","added_by":"auto","created_at":"2025-09-04 12:11:57","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":195709,"visible":true,"origin":"","legend":"\u003cp\u003eA: The TEM image of hWJMSCs-derived EVs, and B: Significant increase in serum testosterone levels in Letrozole-induced PCOS mice compared to the control group (P \u0026lt; 0.001)\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-7410176/v1/f35035c9f66c2a1cdde8b691.png"},{"id":90589510,"identity":"eefad775-4f09-4465-bb9d-00a2e23e21fa","added_by":"auto","created_at":"2025-09-04 12:11:31","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":592458,"visible":true,"origin":"","legend":"\u003cp\u003eHistological sections of ovarian tissue from control (A) and PCOS mice (B).\u003cbr\u003e\nYellow stars show Multiple ovarian cysts in the ovarian tissue of PCOS mice\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-7410176/v1/53a995534770bd9232f0d32a.png"},{"id":90589725,"identity":"0a68a131-c0c7-48cb-b769-e7d8f1f7daa0","added_by":"auto","created_at":"2025-09-04 12:19:31","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":597585,"visible":true,"origin":"","legend":"\u003cp\u003eA and B: Representative images of oocytes at different maturation stages. Germinal Vesicle (GV), Germinal Vesicle Breakdown (GVBD), Metaphase I (MI), and Metaphase II (MII)\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-7410176/v1/e487366a974a9c7e9472d117.png"},{"id":90589508,"identity":"c546b978-e7f6-4dfc-8404-be250be21d5a","added_by":"auto","created_at":"2025-09-04 12:11:31","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":740563,"visible":true,"origin":"","legend":"\u003cp\u003eNuclear maturation assessment using Aceto-Orcein staining in mouse IVM-derived oocytes. (A) MII stage oocyte with the first polar body. (B) Anaphase-Telophase stage where a pair of homologous chromosomes is pulled towards the poles. (C) GVBD stage of the oocyte with a nucleus without a membrane and condensed chromatin. (D) GV stage oocyte with a distinct nucleus and nuclear membrane.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-7410176/v1/75107596f7e98f0a72ae7f35.png"},{"id":90589506,"identity":"392fea81-c58e-4db0-88c4-9b4d274124d6","added_by":"auto","created_at":"2025-09-04 12:11:31","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":439284,"visible":true,"origin":"","legend":"\u003cp\u003eThe percentage of MII, Ana-Tel, GVBD, GV and degenerated oocytes after staining with Aceto-Orcein. Data presented as mean ± SEM. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001 and ****P \u0026lt; 0.0001\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-7410176/v1/31bc7eac4076c5d5196e0405.png"},{"id":90589523,"identity":"41d92450-7a57-4d7b-91ac-3eb9258d6699","added_by":"auto","created_at":"2025-09-04 12:11:31","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":650283,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Percentage of viable MII oocytes, B) Oocyte diameter, (C) Zona pellucida (ZP) thickness, and (D) Perivitelline space (PVS) diameter in different experimental groups. Data presented as mean ± SEM. **P \u0026lt; 0.01, ***P \u0026lt; 0.001 and ****P \u0026lt; 0.0001\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-7410176/v1/32ddcac099f012752661ea39.png"},{"id":90590621,"identity":"a94917fa-73eb-4b63-bc77-4754dee0a378","added_by":"auto","created_at":"2025-09-04 12:27:31","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":392172,"visible":true,"origin":"","legend":"\u003cp\u003eRelative gene expression level of Cdk1, Ccnb1, Map2k in different experimental groups. Data presented as mean ± SEM. *P \u0026lt; 0.05 and **P \u0026lt;01\u003c/p\u003e","description":"","filename":"image8.png","url":"https://assets-eu.researchsquare.com/files/rs-7410176/v1/6e002a777ea573fb9aa53d3a.png"},{"id":99172475,"identity":"b399f95f-cab9-4ce4-8dc6-e35aa5d56d92","added_by":"auto","created_at":"2025-12-29 16:10:03","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5974779,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7410176/v1/8b8bd3ed-f4f4-4a57-8189-8c06a09cf6f6.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Conditioned Media and Extracellular Vesicles Derived from Human Wharton's Jelly Mesenchymal Stem Cells Improve the in vitro Maturation of Immature Oocytes in Normal and PCOS Mouse Model","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePolycystic ovary syndrome is a common hormone disorder that affects women during their childbearing years. The number of women diagnosed with PCOS varies depending on the set of diagnostic rules used (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). During fertility treatments, women with PCOS typically produce more eggs when given ovary-stimulating hormones compared to women without PCOS (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). However, because of alterations in the follicular fluid, hormonal imbalance, and oocyte microenvironment, a significant proportion of these oocytes remain immature, compromising their developmental potential (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eCurrently, in vitro maturation (IVM) serves as an effective approach to rescue oocytes that fail to mature in vivo following ovarian stimulation, enabling their progression to mature oocytes at the stage of metaphase II (MII) (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Consequently, IVM has been proposed as a tailored approach for PCOS patients undergoing Assisted Reproductive Techniques (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). However, despite its potential, the clinical application of IVM remains limited due to low maturation and fertilization rates, ultimately resulting in lower pregnancy success even in non-PCOS patients (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eA key challenge in IVM lies in replicating the physiological follicular environment in vitro, as current culture conditions fail to support oocyte maturation fully (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe process of oocyte maturation involves coordinated signaling pathways and cell cycle regulators, including CDC2 (also known as CDK1), CCNB1 (cyclin B1), and MAP2K (MEK1/2)(\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). CDC2/CDK1, in complex with cyclin B1, forms the maturation-promoting factor (MPF), which is crucial for the germinal vesicle breakdown, spindle formation, chromosome condensation, and consequently, oocyte progression of the maturation oocyte (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe levels and activity of CCNB1 are tightly regulated, ensuring the timely activation and inactivation of MPF during maturation. Additionally, MAP2K (MEK1/2), part of the MAPK/ERK signaling pathway, modulates cytoplasmic and nuclear maturation processes by regulating the activity of cyclin-dependent kinases and other downstream effectors (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Activation of the MAPK pathway is essential for spindle assembly, oocyte cytoplasmic maturation, and successful completion of meiosis II (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Together, CDC2, CCNB1, and MAP2K orchestrate the intricate signaling networks that underpin oocyte maturation, ensuring the oocyte reaches developmental competence for fertilization (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eRecent advances in IVM research have focused on optimizing culture conditions to enhance meiotic resumption and cytoplasmic maturation- two critical determinants of oocyte quality (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). In this context, novel culture medium additives have emerged as potential tools to improve oocyte maturation efficiency and developmental outcomes (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eNowadays, mesenchymal stem cells (MSCs) are recognized as potential therapeutic agents for treating a wide range of diseases largely attributed to their capacity to secrete bioactive molecules (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). Conditioned medium (CM) derived from MSCs has shown significant clinical relevance, as it contains a complex mixture of bioactive factors capable of exerting therapeutic effects (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). MSC-derived CM are rich in growth factors, cytokines, and tissue regeneration mediators that can modulate in vitro maturation (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eExtracellular Vesicles (EVs) are membrane-enclosed particles present in various biological fluids, including plasma, urine, follicular fluid, and culture supernatants of MSCs (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). The cells secrete these lipid bilayer vesicles into the extracellular environment, where they coordinate communication between cells by transporting diverse cargoes such as cytokines, proteins, microRNAs, and lipids (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Many of the regenerative effects associated with MSC therapy are mediated through EVs (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). In the process of reproduction, EVs influence key reproductive processes, including oocyte maturation, sperm capacitation, fertilization, and the development and implantation of the embryo (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eTherefore, the IVM medium was supplemented with CM or EVs of human Wharton\u0026rsquo;s jelly mesenchymal stem cells (hWJMSCs) in a mouse model of PCOS. After conducting the IVM, the maturation rates (GV, MI, MII stages), oocyte quality parameters such as zona pellucida thickness, perivitelline space size, and oocyte diameter, oocyte morphology, viability, nuclear maturation, and the expression levels of key maturation-related genes, including \u003cem\u003eCDK1\u003c/em\u003e, \u003cem\u003eCCNB1\u003c/em\u003e, and \u003cem\u003eMAP2K\u003c/em\u003e, were evaluated in mature oocytes.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eEthics statement\u003c/h2\u003e\u003cp\u003e This study was conducted with approval from the Shiraz University of Medical Sciences Animal Ethics Committee (IR.SUMS.REC.1400.566) and also adhered to the guidelines set forth by the ARRIVE (Animal Research: Reporting of In Vivo Experiments) to ensure rigorous reporting, transparency, and reproducibility.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eIsolation and cultivation of hWJMSCs and production of hWJMSCs\u003c/h3\u003e\n\u003cp\u003eUmbilical cords were collected from full-term infants born by cesarean section at Hafez Hospital, after obtaining written informed consent from their parents following the protocols approved by the Ethics Committee of Shiraz University of Medical Sciences (IR.SUMS.REC.1400.566). All the process related to isolation and cultivation of hWJMSCs, characterization, differentiation od the cells, CM and EVs extraction was done according to a previous study (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). After collection, the umbilical cords were immediately placed in ice-cold phosphate-buffered saline (PBS) (Shellmax, USA). The solution was supplemented with antibiotics (100 U/mL streptomycin and 100 \u0026micro;g/mL penicillin (Gibco, UK)). Initially, the umbilical vein was incised, followed by scraping away the endothelial lining of the vein and the amniotic epithelium, after which both arteries were removed. Later, tiny explant fragments, approximately 4 by 5 mm cultured in α-Minimal Essential Medium (α-MEM) (Shellmax, USA), 10% fetal bovine serum (FBS) (Gibco, UK), 1% L-glutamine (Gibco, UK), 100 U/mL penicillin (Gibco, UK), and 100 \u0026micro;g/mL streptomycin (Gibco, UK) in a culture dish (SPL Lifesciences, Korea). The MSCs started migrating from the explant roughly 15 days later. For the subsequent experiments, the hWJMSC from passages 3 to 6 was employed.\u003c/p\u003e\n\u003ch3\u003eCharacterization of hWJMSCs\u003c/h3\u003e\n\u003cp\u003eFollowing the growth expansion phase, the isolated MSCs were examined under a light microscope to evaluate cell morphology.\u003c/p\u003e\n\u003ch3\u003eFlow cytometry-based assay\u003c/h3\u003e\n\u003cp\u003eTo examine cell surface markers, hWJMSCs at passage three were subjected to flow cytometry. Using the 0.25% Trypsin-EDTA (Dacell, Iran), the cells were detached from the flask (NEST, China) and were subsequently centrifuged at 1200 rpm for 5 minutes. The cell suspension was adjusted to a final concentration of 10⁶ cells per mL in 100 \u0026micro;L PBS (Shell max, USA) and incubated at 4\u0026deg;C with the following anti-human antibodies: CD73-PE, CD144, phycoerythrin-conjugated CD34, and CD90 for 30 minutes (all purchased from Abcam, UK). Cell surface staining was carried out using fluorescein isothiocyanate or phycoerythrin-conjugated isotype antibodies. Cell analysis was performed using flow cytometry and FlowJo\u0026trade; software (TreeStar, Ashland, OR, USA).\u003c/p\u003e\n\u003ch3\u003eDifferentiation into adipocytes and osteocytes\u003c/h3\u003e\n\u003cp\u003eAdipogenic and osteogenic differentiation media were applied to passage 3 cells for 3 and 4 weeks, respectively. A fresh medium was provided every 72 hours. The adipogenic differentiation medium was composed of α-MEM (Shellmax, USA) supplemented with 100 nM dexamethasone (Sigma, USA), 50 \u0026micro;g/mL ascorbic acid-2 phosphate (Merck, Germany), 10% FBS (Gibco, UK), and 50 \u0026micro;g/mL indomethacin (Sigma, USA). The differentiation of adipocytes was examined through oil-red O staining. Initially, the cells were fixed using 4% paraformaldehyde (Merck, Germany). In the next step, staining was performed using 0.5% oil-red O (Sigma Aldrich, USA) in isopropyl alcohol (Merck, Germany). The α-MEM supplemented with 10% FBS (Kiazist, Iran), 10 nM dexamethasone (Sigma, USA), 50 \u0026micro;g/mL ascorbic acid-2 phosphate (Merck, Germany), 2.1604 g/L 6-glycerol phosphate, and 10 mM β-glycerophosphate (Sigma, USA), was used as the osteogenic differentiation medium. Methanol (Merck, Germany) was used to fix the cells, and stained with Alizarin-red S (Sigma Aldrich, USA) to determine the MSCs' potential to differentiate into osteoblasts and observed with an inverted phase-contrast microscope.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003ePreparation of conditioned media\u003c/h2\u003e\u003cp\u003eConditioned medium (CM) was prepared from human Wharton's jelly mesenchymal stem cells (hWJMSCs). When the cells reached 70\u0026ndash;75% confluence, the complete culture medium was removed. The cell monolayer was washed twice with phosphate-buffered saline (PBS), and serum-free medium was added. After 48 hours of culture, the medium was collected and centrifuged (12,000 \u0026times; g, 10 min, 4\u0026deg;C). The supernatant was then processed: a fresh portion was used for extracellular vesicle (EV) isolation, and the remainder was kept in -80\u0026deg;C to be lyophilized to prepare the CM.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eExtraction of EVs\u003c/h3\u003e\n\u003cp\u003eThe Exocib kit (Cib Biotech, Iran) was employed to isolate EVs from MSCs-CM. In short, the MSCs-CM were gathered and centrifuged at 3000 r/min for 10 minutes to remove cell fragments. Afterward, the supernatant and Exocib solution were mixed at a 5:1 ratio and incubated at 4\u0026deg;C for 12 hours at 4\u0026deg;C followed by centrifugation at 3000 r/min for 40 min. Then, after discarding the supernatant, the pellet was mixed again in 100 \u0026micro;L of PBS. After isolation, the EVs were preserved at -20\u0026deg;C.\u003c/p\u003e\u003cp\u003e\u003cb\u003eTransmission electron microscopy (TEM\u003c/b\u003e)\u003c/p\u003e\u003cp\u003eThe size and shape of EVs were assessed by transmission electron microscopy (LEO 906E, Zeiss, Germany). After a 1:10 dilution in PBS (Shell max, USA), the EVs were placed on copper grids, dried at room temperature, and observed via TEM without the use of staining. ImageJ software was used to determine the size distribution of EVs (Java 1.8.0_112).\u003c/p\u003e\n\u003ch3\u003eDynamic light scattering (DLS)\u003c/h3\u003e\n\u003cp\u003eThe DLS approach allows for the measurement of particle size distributions spanning from 1 nm up to 6 \u0026micro;m. Particles such as EVs disperse light upon being hit by the laser beam.\u003c/p\u003e\u003cp\u003eBy analyzing changes in scattered light patterns, a mathematical model based on light scattering principles and Brownian motion was developed. Seven EV samples were assessed to calculate the average size distribution.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eExperiments\u003c/h2\u003e\u003cp\u003eA total of 84 NMRI (12 in each group) female mice, aged 6\u0026ndash;8 weeks and weighing between 30 and 35 grams, were procured from the Comparative and Experimental Medicine Center at Shiraz University of Medical Sciences. The animals were housed in a controlled environment with a 12-hour light/dark cycle and ambient temperatures maintained between 20\u0026deg;C and 24\u0026deg;C. Food and water were provided ad libitum throughout the experimental period.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eMonitoring the estrous cycle\u003c/h2\u003e\u003cp\u003eBefore experiments, vaginal smears were collected daily between 9:00 and 10:00 AM for 2 weeks to make sure that the animals were mature and had a regular sexual cycle. Vaginal cells were collected by lavage of distilled water, fixed on a slide, and stained by Giemsa to assess the estrous cycle stages, including proestrus, estrus, metestrus, and diestrus. A duration of 4 to 5 days was considered the definition of regular cycles (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eEstablishment of the PCOS mouse model\u003c/h2\u003e\u003cp\u003eTo induce PCOS, adult female NMRI mice received letrozole (Letrax 2.5, Abu Raihan Pharmaceutical Co, Tehran, Iran) at a dose of 90 \u0026micro;g/kg daily for one week by gavage (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003ePCOS induction confirmation\u003c/h2\u003e\u003cp\u003eTo confirm the establishment of the PCOS model, the blood testosterone levels and the histology of the ovarian tissues were determined.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eSerum testosterone assay\u003c/h2\u003e\u003cp\u003eTo compare the testosterone levels between control and PCOS mice, the animals were anesthetized using a CO2 chamber. Blood samples were then obtained through cardiac puncture and immediately centrifuged at 3000 rpm for 10 minutes. The resulting serum samples were collected and stored at -80\u0026deg;C. Later, the testosterone concentration was determined using an enzyme-linked immunosorbent assay (ELISA) with commercially available kits (Monobind Inc., USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eEvaluation of the ovarian tissue\u003c/h2\u003e\u003cp\u003eFollowing blood collection, the ovaries were excised and fixed in 10% buffered formalin. They were then embedded in paraffin and sectioned serially at a thickness of 5 \u0026micro;m. The tissue sections mounted on slides were stained with hematoxylin and eosin. The different types of ovarian follicles, including primordial, primary, secondary, Graafian, atretic follicles, corpus luteum, and ovarian cysts, were counted in the prepared sections using a light microscope (Olympus, Japan)(\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eExperimental design and groups\u003c/h2\u003e\u003cp\u003eBoth pregnant mare serum gonadotropin (PMSG, GONASER\u0026reg;, HIPRA, Amer, Spain) and human chorionic gonadotropin (hCG, Organon, Oss, The Netherlands) were administered at doses of 10 IU via intraperitoneal injection.\u003c/p\u003e\u003cp\u003eThe animals were divided into seven groups as follows:\u003c/p\u003e\u003cp\u003eControl: Mice were administered PMSG followed by hCG 48 hours later. MII oocytes were collected 14 hours post-hCG administration.\u003c/p\u003e\u003cp\u003eIVM Group: Mice were administered PMSG. Forty-eight hours later, oocytes at the GV stage were collected and cultured for 24 hours in IVM media (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIVM\u0026thinsp;+\u0026thinsp;CM Group: Mice were administered PMSG. Forty-eight hours later, oocytes at the GV stage were collected and cultured for 24 hours in IVM media supplemented with hWJMSCs-derived conditioned media.\u003c/p\u003e\u003cp\u003eIVM\u0026thinsp;+\u0026thinsp;EVs Group: Mice were administered PMSG. Forty-eight hours later, oocytes at the GV stage were collected and cultured for 24 hours in IVM media supplemented with hWJMSCs-derived EVs.\u003c/p\u003e\u003cp\u003ePCOS IVM Group: PCOS-induced mice were administered PMSG. Forty-eight hours later, oocytes at the GV stage were collected and cultured for 24 hours in IVM media.\u003c/p\u003e\u003cp\u003ePCOS IVM\u0026thinsp;+\u0026thinsp;CM Group: PCOS-induced mice were administered PMSG. Forty-eight hours later, oocytes at the GV stage were collected and cultured for 24 hours in IVM media supplemented with hWJMSCs-derived conditioned media.\u003c/p\u003e\u003cp\u003ePCOS IVM\u0026thinsp;+\u0026thinsp;EVs Group: PCOS-induced mice were administered PMSG. Forty-eight hours later, oocytes at the GV stage were collected and cultured for 24 hours in IVM media supplemented with hWJMSCs-EVs.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eDetermining the optimal concentration of CM and EVs\u003c/h2\u003e\u003cp\u003eTo determine the optimal concentrations of CM and EVs for IVM, the maturation rate of GV-stage oocytes was assessed in IVM medium supplemented with various doses of these supplements. Initially, the protein concentrations of hWJMSCs-derived CM or EVs were measured using the Bradford Protein Assay Kit (ProtoCib, Cib Biotech, Iran) following the manufacturer's instructions. The protein concentrations were found to be 500 \u0026micro;g/ml for CM and 15 \u0026micro;g/ml for EVs.\u003c/p\u003e\u003cp\u003eFollowing this, GV-stage oocytes were randomly assigned to seven groups and cultured for 24 hours in IVM medium supplemented with different concentrations of hWJMSCs-derived CM or EVs. The optimal concentration was determined based on the oocyte maturation rate. The study identified 50 \u0026micro;g/ml for CM and 5 \u0026micro;g/ml for EVs as the most effective concentrations.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eCOCs collection and IVM procedure\u003c/h2\u003e\u003cp\u003eIn the control group, mature (MII) oocytes were harvested to serve as in vivo-matured of normal oocytes for comparison with those matured in vitro. Maturity was defined by the extrusion of the first polar body. Mice were superovulated via an IP injection of PMSG, followed 48 hours later by an IP injection of hCG. Fourteen hours after hCG administration, the mice were anesthetized using a CO₂ chamber. The oviducts were then transferred into handling medium (G-MOPS\u0026trade;, Vitrolife, G\u0026ouml;teborg, Sweden), which was pre-incubated for 24 hours at 37\u0026deg;C. Under a stereomicroscope (Nikon, Tokyo, Japan), the oviducts were dissected using two insulin syringes (Helma Teb, Baspar Sanat Fakher, Saveh, Iran). The cumulus-oocyte complexes were released and collected with flame-polished Pasteur pipettes, and the complexes were placed into a few drops of hyaluronidase (80 IU/mL; Vitrolife) to separate the cumulus cells and harvest MII oocytes.\u003c/p\u003e\u003cp\u003eIn all six IVM groups, 48 hours after PMSG injection, COCs were collected from ovarian dissection. The COCs were washed in handling medium and then cultured for 24 hours in 50 \u0026micro;l droplets covered with mineral oil, under a controlled environment of 5% CO₂ at 37\u0026deg;C. The culture medium consisted of basal IVM medium\u0026mdash;Minimum Essential Medium α (α-MEM) supplemented with 0.1 IU/mL FSH (Follitropin alfa 75 IU, CinnaGen, Iran), 5 mIU/mL hCG (Folignan, DarouPakhsh, Iran), and 75 \u0026micro;g/mL Penicillin, 50 \u0026micro;g/mL streptomycin, and 5% fetal bovine serum (Gibco, UK) either alone or supplemented with hWJMSCs-derived CM or EVs according to the respective experimental groups.\u003c/p\u003e\u003cp\u003eBoth mature oocytes from the control group and those obtained after IVM were used for subsequent analyses, including assessment of maturation rate, measurement of oocyte diameter, perivitelline space PVS, and ZP thickness. Nuclear maturation was examined using Orcein staining of chromatin, while oocyte viability was assessed with Trypan Blue (TB) staining. Additionally, in each group, a proportion of mature oocytes were stored at -80\u0026deg;C for gene expression profiling of \u003cem\u003eCDk1\u003c/em\u003e, \u003cem\u003eCCNB1\u003c/em\u003e, and \u003cem\u003eMAP2K\u003c/em\u003e using real-time PCR.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eBrilliant Cresyl Blue (BCB) staining\u003c/h2\u003e\u003cp\u003eTo assess the effects of selecting developmentally competent oocytes, the collected COCs were first washed three times with PBS. They were then exposed to 13 \u0026micro;M BCB in PBS at 37\u0026deg;C under humidified air conditions for 90 minutes. After this incubation, the COCs were rinsed three times with PBS and subsequently classified as BCB-positive (BCB+, indicated by blue cytoplasm) or BCB-negative (BCB\u0026minus;, indicated by colorless cytoplasm) (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eEvaluation of the oocyte maturation rate\u003c/h2\u003e\u003cp\u003eOocyte maturation was evaluated using an inverted microscope (Nikon, Japan), and the proportions of oocytes at various stages, GV, MI, MII, or degenerated, were recorded. Mature oocytes were identified by the presence of the first polar body. For further experiments, selected oocytes exhibited a spherical shape, a well-defined zona pellucida, a clear perivitelline space, and a faintly granular cytoplasm without inclusions (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003eExamining nuclear maturation via Orcein staining of chromatin\u003c/h2\u003e\u003cp\u003eNuclear maturation of the oocytes was assessed using aceto- orcein staining, categorizing them into GV, GVBD, anaphase-telophase, and MII stages. The oocytes were placed on a glass slide and fixed using a 3:1 acetic acid-ethanol solution for 24 hours. Next, the oocytes were stained with Aceto-Orcein and examined under an inverted microscope to assess nuclear maturation (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eTrypan blue\u003c/b\u003e (\u003cb\u003eTB\u003c/b\u003e) \u003cb\u003estaining for evaluating oocyte survival\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTrypan blue (TB) is a dye extensively applied to stain dead cells. The principle of TB staining is that TB is negatively charged and binds only to damaged membranes. Intact cells allow the passage of very few select compounds through the membrane, and therefore do not absorb TB. MII oocytes of control group and those from IVM groups, were stained with TB. Those which did not stained considered to be viable. In contrast, cells with damaged membranes were stained a distinctive blue color, as readily observed under a microscope (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e).\u003c/p\u003e\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\u003ch2\u003eMeasurement of Oocyte Diameter, PVS and ZP thickness After IVM\u003c/h2\u003e\u003cp\u003eThe MII oocytes harvested from mice in the control group and those harvested from IVM groups, were imaged at 200x magnification using a digital camera (Nikon, Tokyo, Japan) mounted on an inverted microscope (Nikon, Japan). Using image analysis software (ImageJ, ver. 1.41o; National Institutes of Health, Bethesda, MD), the diameter of each oocyte was determined by averaging the two perpendicular measurements including the ZP (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). Also, the PVS and ZP thickness of each oocyte was measured at four different locations using ImageJ software, and the mean value of these measurements was calculated for each oocyte.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003eReal-time RT-PCR\u003c/h2\u003e\u003cp\u003eTo assess the expression of \u003cem\u003eCdk1\u003c/em\u003e, \u003cem\u003eCcnb\u003c/em\u003e1, and \u003cem\u003eMap2k\u003c/em\u003e in the mature oocytes, total RNA was extracted from three pools, each containing 25 oocytes in their respective groups using the RNX-Plus kit (Cinnagen, Iran). The primers were initially designed using Primer3 software, and were subsequently verified using NCBI Primer-BLAST to confirm target specificity and produced by Pishgam Tehran Company. The primer sequences are presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.. To synthesize the cDNA, the mixture consists of 1 \u0026micro;g of RNA (which includes 2 \u0026micro;g of total RNA), 1 \u0026micro;g of a 50-\u0026micro;M oligo (dT)18 primer, and 5 \u0026micro;L of RNase-free distilled water. After incubation at 70\u0026deg;C for 10 minutes, the mixture was allowed to cool for at least 2 minutes. Next, a new mixture was prepared by adding 2 \u0026micro;L of 5\u0026times; M-MLV buffer, 0.5 \u0026micro;L of dNTP mixture (10 mM each), 0.25 \u0026micro;L of 40 U/\u0026micro;L RNase inhibitor, and 0.25 \u0026micro;L of 200 U/\u0026micro;L RTase M-MLV (RNase H⁻), resulting in a final volume of 10 \u0026micro;L. The mixture underwent incubation first at 42\u0026deg;C for 60 minutes, then at 70\u0026deg;C for 15 minutes. Real-time quantitative PCR was performed using the SYBR Green I fluorescent dye reagent (SYBR\u0026reg; Premix Ex Taq\u0026trade; II, Ampliqon Biotechnology Co., Ltd.) as well as an ABI-Step one Sequence Detection System. The experiment will be conducted three times. The findings will be presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation, and group differences will be assessed using the 2\u003csup\u003e-ΔΔCT\u003c/sup\u003e method (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003e\u003cb\u003ePrimer sequences used for real-time PCR analysis\u003c/b\u003e\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSequence forward (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSequence reverse (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eProduct size (bp)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eCdk1\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGCAATTCGGGAAATCTCTCTAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCATGGACAGGAACTCAAAGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e116\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eMap2k\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGAGTGGTCTTCAAGGTCTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTCCCGGATGATCTGGTTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e105\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eCcnb1\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCCTGAGCCTGAACCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTCTGCAGGCGCACATC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e118\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eβ-actin\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCCTGACCCTGAAGTACCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCACACGCAGCTCATTGTAGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e98\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec25\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eThe data were analyzed using GraphPad Prism 9 software. After confirming normal distribution and homogeneity of variances, an independent t-test was used to compare testosterone levels and the number of ovarian follicles between control and PCOS-induced mice. For other intergroup comparisons, one-way analysis of variance (ANOVA) followed by Tukey\u0026rsquo;s post-hoc test was applied. A p value\u0026thinsp;\u0026le;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec27\" class=\"Section2\"\u003e\u003ch2\u003eCharacterization of hWJMSCs\u003c/h2\u003e\u003cp\u003eObservations with light microscopy demonstrated that the monolayer MSCs were morphologically homogeneous and spindle-shaped. Using flow cytometry, it was confirmed that the isolated cells expressed MSC markers (CD73, CD90) at high levels and hematopoietic markers (CD34, CD144) at low levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. A). Additionally, Oil-Red O staining revealed the presence of lipid droplets in differentiating MSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. B), while Alizarin Red staining indicated calcium deposition, confirming osteoblast differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. C).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec28\" class=\"Section2\"\u003e\u003ch2\u003eCharacterization of isolated EVs\u003c/h2\u003e\u003cdiv id=\"Sec29\" class=\"Section3\"\u003e\u003ch2\u003eTransmission electron microscopy\u003c/h2\u003e\u003cp\u003eUsing TEM microscopy, Round or disk-shaped particles were seen in groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. A).\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\n\u003ch3\u003eDynamic light scattering\u003c/h3\u003e\n\u003cp\u003eDLS is a method used to assess the dimensions of EVs. On average, EVs measured 17.82 nm in diameter.\u003c/p\u003e\u003cdiv id=\"Sec31\" class=\"Section2\"\u003e\u003ch2\u003eTestosterone level\u003c/h2\u003e\u003cp\u003eLetrozole-induced PCOS led to a significant rise in serum testosterone levels compared to the control group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. B).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec32\" class=\"Section2\"\u003e\u003ch2\u003eOvarian histopathology\u003c/h2\u003e\u003cp\u003eIn the ovaries of mice in the control follicles in different phases of development were observed; however, in the PCOS group cystic follicles were found. Also, the PCOS mice showed significantly lower corpus luteum (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e and Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eYellow stars show Multiple ovarian cysts in the ovarian tissue of PCOS mice\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThe number of follicles, corpus Luteum and cysts in the ovarian tissue of the PCOS and control mice\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"8\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGroups\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimordial follicles\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePrimary follicles\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSecondary follicles\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eGraafian follicles\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eAtretic follicles\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eCorpus Luteum\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u003cp\u003eOvarian cysts\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eControl\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e9.75\u0026thinsp;\u0026plusmn;\u0026thinsp;1.4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e7.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.85\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e5.80\u0026thinsp;\u0026plusmn;\u0026thinsp;0.76\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e0.80\u0026thinsp;\u0026plusmn;\u0026thinsp;0.41\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e\u003cp\u003e0.75\u0026thinsp;\u0026plusmn;\u0026thinsp;.55\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e\u003cp\u003e4.70\u0026thinsp;\u0026plusmn;\u0026thinsp;0.92\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ePCOS\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e3.35\u0026thinsp;\u0026plusmn;\u0026thinsp;1.08*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e4.0\u0026thinsp;\u0026plusmn;\u0026thinsp;0.91*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e2.85\u0026thinsp;\u0026plusmn;\u0026thinsp;1.03*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e0.35\u0026thinsp;\u0026plusmn;\u0026thinsp;.48*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e\u003cp\u003e8.25\u0026thinsp;\u0026plusmn;\u0026thinsp;1.11*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e\u003cp\u003e0.65\u0026thinsp;\u0026plusmn;\u0026thinsp;0.67*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e9.25\u0026thinsp;\u0026plusmn;\u0026thinsp;1.16*\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eData are shown as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD.\u003c/p\u003e\u003cp\u003e* Significant difference between the PCOS and control groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e\u003cdiv id=\"Sec33\" class=\"Section3\"\u003e\u003ch2\u003eThe Outcomes of IVM after selecting oocytes with BCB staining\u003c/h2\u003e\u003cp\u003eThe results of BCB staining are summarized in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. The IVM\u0026thinsp;+\u0026thinsp;CM and IVM\u0026thinsp;+\u0026thinsp;EVs groups exhibited a significantly higher rate of MII oocytes derived from BCB\u0026thinsp;+\u0026thinsp;oocytes compared to the IVM group (P\u0026thinsp;=\u0026thinsp;0.007 and P\u0026thinsp;=\u0026thinsp;0.01, respectively). In contrast, the PCOS IVM group showed a significant reduction in the percentage of MII oocytes compared to the IVM group (P\u0026thinsp;=\u0026thinsp;0.0007). Notably, supplementation with CM or EVs in PCOS oocytes significantly increased the rate of MII oocytes compared to the PCOS IVM group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 and P\u0026thinsp;=\u0026thinsp;0.03, respectively).\u003c/p\u003e\u003cp\u003eNo significant differences were observed in the rate of MI oocytes between the IVM\u0026thinsp;+\u0026thinsp;CM and IVM\u0026thinsp;+\u0026thinsp;EVs groups compared to the IVM group, nor between the PCOS IVM\u0026thinsp;+\u0026thinsp;CM and PCOS IVM\u0026thinsp;+\u0026thinsp;EVs groups relative to the PCOS IVM group (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003eThe percentage of GV oocytes was significantly lower in the IVM\u0026thinsp;+\u0026thinsp;CM and IVM\u0026thinsp;+\u0026thinsp;EVs groups than in the IVM group (P\u0026thinsp;=\u0026thinsp;0.03 for both) and the PCOS IVM\u0026thinsp;+\u0026thinsp;CM group when compared to the PCOS IVM group (P\u0026thinsp;=\u0026thinsp;0.03). Additionally, the PCOS IVM\u0026thinsp;+\u0026thinsp;CM and PCOS IVM\u0026thinsp;+\u0026thinsp;EVs groups had significantly fewer degenerated oocytes than the PCOS IVM group (P\u0026thinsp;=\u0026thinsp;0.02 for both).\u003c/p\u003e\u003cp\u003eThe percentage of both MI, GV, and degenerated oocytes was remarkably higher in PCOS IVM when compared to the IVM group (P\u0026thinsp;=\u0026thinsp;0.03, P\u0026thinsp;=\u0026thinsp;0.02, and P\u0026thinsp;=\u0026thinsp;0.008, respectively).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eMaturation rate of mice GV oocytes selected with BCB\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eGroups\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eNO. of oocyte\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eMII (% \u0026plusmn; SD)\u003c/em\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eNO. of oocyte\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cem\u003eMI (% \u0026plusmn; SD)\u003c/em\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eNO. of oocyte\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003eGV (% \u0026plusmn; SD)\u003c/em\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eNO. of oocyte\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cem\u003eDeg (% \u0026plusmn; SD)\u003c/em\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eNO. of oocyte\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIVM\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003e182\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003e62.08\u0026thinsp;\u0026plusmn;\u0026thinsp;2.84\u003c/em\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003e(113)\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cem\u003e12.08\u0026thinsp;\u0026plusmn;\u0026thinsp;2.26\u003c/em\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003e15.93\u0026thinsp;\u0026plusmn;\u0026thinsp;0.95\u003c/em\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cem\u003e9.89\u0026thinsp;\u0026plusmn;\u0026thinsp;0.48\u003c/em\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIVM\u0026thinsp;+\u0026thinsp;CM\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003e196\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003e73.46\u0026thinsp;\u0026plusmn;\u0026thinsp;1.34\u003c/em\u003e \u003csup\u003e\u003cem\u003ea\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003e(144)\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cem\u003e10.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.34\u003c/em\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003e8.16\u0026thinsp;\u0026plusmn;\u0026thinsp;1.29\u003c/em\u003e\u003csup\u003e\u003cem\u003ea\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cem\u003e8.16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.38\u003c/em\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIVM\u0026thinsp;+\u0026thinsp;EVs\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003e201\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003e69.65\u0026thinsp;\u0026plusmn;\u0026thinsp;1.75\u003c/em\u003e \u003csup\u003e\u003cem\u003ea\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003e(140)\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cem\u003e10.94\u0026thinsp;\u0026plusmn;\u0026thinsp;1.84\u003c/em\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003e8.95\u0026thinsp;\u0026plusmn;\u0026thinsp;1.32\u003c/em\u003e\u003csup\u003e\u003cem\u003ea\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cem\u003e10.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.35\u003c/em\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ePCOS IVM\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003e181\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003e43.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.77\u003c/em\u003e \u003csup\u003e\u003cem\u003ea\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003e(78)\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cem\u003e17.67\u0026thinsp;\u0026plusmn;\u0026thinsp;1.62\u003c/em\u003e \u003csup\u003e\u003cem\u003ea\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003e19.88\u0026thinsp;\u0026plusmn;\u0026thinsp;0.38\u003c/em\u003e\u003csup\u003e\u003cem\u003ea\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cem\u003e19.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.45\u003c/em\u003e \u003csup\u003e\u003cem\u003ea\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ePCOS IVM\u0026thinsp;+\u0026thinsp;CM\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003e190\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003e57.36\u0026thinsp;\u0026plusmn;\u0026thinsp;0.82\u003c/em\u003e\u003csup\u003e\u003cem\u003eb\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003e(109)\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cem\u003e15.78\u0026thinsp;\u0026plusmn;\u0026thinsp;1.25\u003c/em\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003e12.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.30\u003c/em\u003e\u003csup\u003e\u003cem\u003eb\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cem\u003e14.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.30\u003c/em\u003e \u003csup\u003e\u003cem\u003eb\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ePCOS IVM\u0026thinsp;+\u0026thinsp;EVs\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003e202\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003e49.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.15\u003c/em\u003e \u003csup\u003e\u003cem\u003eb,c\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003e(100)\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cem\u003e17.82\u0026thinsp;\u0026plusmn;\u0026thinsp;0.94\u003c/em\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003e17.82\u0026thinsp;\u0026plusmn;\u0026thinsp;0.37\u003c/em\u003e\u003csup\u003e\u003cem\u003ec\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cem\u003e14.85\u0026thinsp;\u0026plusmn;\u0026thinsp;2.33\u003c/em\u003e \u003csup\u003e\u003cem\u003eb\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"6\"\u003e\u003csup\u003ea\u003c/sup\u003e significant difference vs IVM group, \u003csup\u003eb\u003c/sup\u003e significant difference vs PCOS IVM group, \u003csup\u003ec\u003c/sup\u003e significant difference vs PCOS IVM\u0026thinsp;+\u0026thinsp;CM group\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec34\" class=\"Section3\"\u003e\u003ch2\u003eOocyte maturation rate without BCB selection of immature oocytes\u003c/h2\u003e\u003cp\u003eThe study evaluated the maturation rates of oocytes across different experimental groups, with a focus on metaphase II as the primary outcome (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. and Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The IVM group showed significantly lower MII rates compared to the Control group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). The IVM group also had higher rates of MI oocytes (P\u0026thinsp;=\u0026thinsp;0.002) and degenerated oocytes (P\u0026thinsp;=\u0026thinsp;0.001), indicating reduced maturation efficiency.\u003c/p\u003e\u003cp\u003eIVM\u0026thinsp;+\u0026thinsp;CM significantly improved MII rates compared to IVM alone (P\u0026thinsp;=\u0026thinsp;0.003), while IVM\u0026thinsp;+\u0026thinsp;EVs showed no significant improvement (P\u0026thinsp;=\u0026thinsp;0.82). Both IVM\u0026thinsp;+\u0026thinsp;CM (P\u0026thinsp;=\u0026thinsp;0.02) and IVM\u0026thinsp;+\u0026thinsp;EVs (P\u0026thinsp;=\u0026thinsp;0.04) reduced GV-stage oocytes compared to IVM alone.\u003c/p\u003e\u003cp\u003eThe PCOS IVM group had significantly lower MII rates than both the Control (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and standard IVM group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). PCOS IVM also exhibited higher GV oocytes (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and degeneration rates (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) compared to Control.\u003c/p\u003e\u003cp\u003ePCOS IVM\u0026thinsp;+\u0026thinsp;CM restored MII rates compared to PCOS IVM (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). It also reduced GV oocytes (P\u0026thinsp;=\u0026thinsp;0.006) and degeneration rates (P\u0026thinsp;=\u0026thinsp;0.001). PCOS IVM\u0026thinsp;+\u0026thinsp;EVs showed no significant improvement in MII rates (P\u0026thinsp;=\u0026thinsp;0.12). However, it marginally reduced degeneration (P\u0026thinsp;=\u0026thinsp;0.03), with no effect on GV retention (P\u0026thinsp;=\u0026thinsp;0.89).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePercentage of Mature (MII), MI, GV, and degenerated oocytes in the immature oocytes of experimental groups selected without BCB\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGroups\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNO. of oocyte\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMII (% \u0026plusmn; SD)\u003c/p\u003e\u003cp\u003eNO. of oocyte\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMI (% \u0026plusmn; SD)\u003c/p\u003e\u003cp\u003eNO. of oocyte\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eGV (% \u0026plusmn; SD)\u003c/p\u003e\u003cp\u003eNO. of oocyte\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eDeg (% \u0026plusmn; SD)\u003c/p\u003e\u003cp\u003eNO. of oocyte\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eControl\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e148\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e71.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.71\u003c/p\u003e\u003cp\u003e(106)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e9.45\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e10.81\u0026thinsp;\u0026plusmn;\u0026thinsp;1.50\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e8.10\u0026thinsp;\u0026plusmn;\u0026thinsp;2.18\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIVM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e191\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e54.97\u0026thinsp;\u0026plusmn;\u0026thinsp;1.07\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(105)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e15.70\u0026thinsp;\u0026plusmn;\u0026thinsp;1.43\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e14.65\u0026thinsp;\u0026plusmn;\u0026thinsp;1.92\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e14.65\u0026thinsp;\u0026plusmn;\u0026thinsp;0.93\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIVM\u0026thinsp;+\u0026thinsp;CM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e216\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e63.88\u0026thinsp;\u0026plusmn;\u0026thinsp;1.22\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(138)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e15.27\u0026thinsp;\u0026plusmn;\u0026thinsp;1.17\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e9.72\u0026thinsp;\u0026plusmn;\u0026thinsp;1.07\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e11.11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.74\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIVM\u0026thinsp;+\u0026thinsp;EVs\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e179\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e56.42\u0026thinsp;\u0026plusmn;\u0026thinsp;1.79\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(101)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e13.40\u0026thinsp;\u0026plusmn;\u0026thinsp;1.49\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e12.84\u0026thinsp;\u0026plusmn;\u0026thinsp;1.02\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e11.73\u0026thinsp;\u0026plusmn;\u0026thinsp;0.62\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePCOS IVM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e187\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e37.96\u0026thinsp;\u0026plusmn;\u0026thinsp;1.68\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(71)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e15.50\u0026thinsp;\u0026plusmn;\u0026thinsp;1.85\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e20.85\u0026thinsp;\u0026plusmn;\u0026thinsp;1.15\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e25.66\u0026thinsp;\u0026plusmn;\u0026thinsp;1.99\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePCOS IVM\u0026thinsp;+\u0026thinsp;CM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e175\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e56\u0026thinsp;\u0026plusmn;\u0026thinsp;1.55\u003csup\u003ee\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(98)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e12.57\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.91\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e15.42\u0026thinsp;\u0026plusmn;\u0026thinsp;1.26\u003csup\u003ee\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePCOS IVM\u0026thinsp;+\u0026thinsp;EVs\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e171\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e40.93\u0026thinsp;\u0026plusmn;\u0026thinsp;0.98\u003csup\u003ef\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(70)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e18.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.95\u003csup\u003ef\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e20.46\u0026thinsp;\u0026plusmn;\u0026thinsp;1.19\u003csup\u003ef\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e19.88\u0026thinsp;\u0026plusmn;\u0026thinsp;1.15 \u003csup\u003ee,f\u003c/sup\u003e\u003c/p\u003e\u003cp\u003e(\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003csup\u003e\u003cem\u003ea\u003c/em\u003e\u003c/sup\u003e Significant difference with the control group, \u003csup\u003e\u003cem\u003eb\u003c/em\u003e\u003c/sup\u003e Significant difference with the IVM group, c Significant difference with IVM\u0026thinsp;+\u0026thinsp;CM group, d Significant difference with IVM, \u003csup\u003ee\u003c/sup\u003e Significant difference with PCOS IVM group, f Significant difference with PCOS IVM\u0026thinsp;+\u0026thinsp;CM group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003e\u003cb\u003eEffects of secretome (CM/EVs) from hWJMSCs on nuclear maturation of oocytes\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFollowing orcein staining, it was observed that the proportion of MII oocytes was significantly lower in the IVM group compared to the control group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). However, this rate increased in the IVM\u0026thinsp;+\u0026thinsp;CM group compared to the IVM group (P\u0026thinsp;=\u0026thinsp;0.0014). Additionally, the rate was significantly higher in the IVM\u0026thinsp;+\u0026thinsp;CM group than in the IVM\u0026thinsp;+\u0026thinsp;EVs group (P\u0026thinsp;=\u0026thinsp;0.04).\u003c/p\u003e\u003cp\u003eIn the PCOS group, the proportion of MII oocytes was lower compared to the non-PCOS IVM group (P\u0026thinsp;=\u0026thinsp;0.0246). Among PCOS samples, the IVM\u0026thinsp;+\u0026thinsp;CM group showed a higher rate than the PCOS IVM group (P\u0026thinsp;=\u0026thinsp;0.002).\u003c/p\u003e\u003cp\u003eThe percentage of degenerated oocytes was significantly higher in the IVM group compared to the control (P\u0026thinsp;=\u0026thinsp;0.004), but it was significantly reduced in the IVM\u0026thinsp;+\u0026thinsp;EVs group relative to the IVM group (P\u0026thinsp;=\u0026thinsp;0.0003). These findings are illustrated in Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\n\u003ch3\u003eEffects of hWJMSCs-derived CM or EVs on the survival rate of MII oocytes\u003c/h3\u003e\n\u003cp\u003eMature oocyte viability was evaluated across experimental groups (Figure. 7A). The proportion of viable metaphase II (MII) oocytes in the IVM group was significantly lower than in the control group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). However, supplementation with conditioned medium (IVM\u0026thinsp;+\u0026thinsp;CM) or extracellular vesicles (IVM\u0026thinsp;+\u0026thinsp;EVs) significantly improved oocyte viability compared to IVM alone (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 and P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, respectively).\u003c/p\u003e\u003cp\u003eIn the PCOS model, IVM\u0026thinsp;+\u0026thinsp;CM resulted in fewer viable MII oocytes than standard IVM (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Conversely, both PCOS IVM\u0026thinsp;+\u0026thinsp;CM and PCOS IVM\u0026thinsp;+\u0026thinsp;EVs exhibited significantly higher oocyte viability compared to PCOS IVM (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 and P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, respectively).\u003c/p\u003e\n\u003ch3\u003eEffects of secretome (CM/EVs) from hWJMSCs on Morphometric parameters of oocytes\u003c/h3\u003e\n\u003cp\u003eComparative analysis of oocyte diameter across experimental groups revealed a significant reduction in the IVM group compared to the control group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). However, oocyte diameter was significantly higher in the IVM\u0026thinsp;+\u0026thinsp;CM group than in both the IVM (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and IVM\u0026thinsp;+\u0026thinsp;EVs (P\u0026thinsp;=\u0026thinsp;0.0057) groups. Furthermore, both CM and EVs significantly increased oocyte diameter compared to the PCOS group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 for both).\u003c/p\u003e\u003cp\u003eZP thickness in PCOS IVM\u0026thinsp;+\u0026thinsp;CM increased significantly compared to PCOS IVM group (P\u0026thinsp;=\u0026thinsp;0.0036).\u003c/p\u003e\u003cp\u003eThere was no significant difference in PVS size among the studied groups (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB\u0026ndash;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec37\" class=\"Section2\"\u003e\u003ch2\u003eEffects of secretome (CM/EVs) from hWJMSCs on expression of \u003cem\u003eCdk1, Ccnb1, and Map2k\u003c/em\u003e\u003c/h2\u003e\u003cp\u003e\u003cem\u003eMap2k\u003c/em\u003e transcript levels were significantly downregulated in the IVM group relative to controls (P\u0026thinsp;=\u0026thinsp;0.011) and further diminished in the PCOS IVM group compared to IVM alone (P\u0026thinsp;=\u0026thinsp;0.012). In contrast, supplementation with CM (conditioned medium) in the IVM group led to a marked increase in \u003cem\u003eMap2k\u003c/em\u003e expression (P\u0026thinsp;=\u0026thinsp;0.003). Similarly, the PCOS IVM\u0026thinsp;+\u0026thinsp;CM group exhibited elevated \u003cem\u003eMap2k\u003c/em\u003e levels compared to both PCOS IVM and PCOS IVM\u0026thinsp;+\u0026thinsp;EVs groups (P\u0026thinsp;=\u0026thinsp;0.005 and P\u0026thinsp;=\u0026thinsp;0.0485, respectively).\u003c/p\u003e\u003cp\u003eFor \u003cem\u003eCcnb1\u003c/em\u003e, expression was significantly reduced in the IVM group versus controls (P\u0026thinsp;=\u0026thinsp;0.007), while no significant difference was observed between the PCOS IVM and IVM groups (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Although \u003cem\u003eCcnb1\u003c/em\u003e levels showed an upward trend in IVM\u0026thinsp;+\u0026thinsp;CM and IVM\u0026thinsp;+\u0026thinsp;EVs groups compared to IVM alone, this increase did not reach statistical significance (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). However, in the PCOS IVM\u0026thinsp;+\u0026thinsp;CM group, \u003cem\u003eCcnb1\u003c/em\u003e expression was significantly higher than in PCOS IVM (P\u0026thinsp;=\u0026thinsp;0.027).\u003c/p\u003e\u003cp\u003e\u003cem\u003eCdk1\u003c/em\u003e expression was significantly lower in the IVM group than in controls (P\u0026thinsp;=\u0026thinsp;0.006) and exhibited a non-significant increase in the IVM\u0026thinsp;+\u0026thinsp;CM group (P\u0026thinsp;=\u0026thinsp;0.022). Notably, \u003cem\u003eCdk1\u003c/em\u003e levels were further reduced in PCOS IVM compared to IVM (P\u0026thinsp;=\u0026thinsp;0.004). Conversely, the PCOS IVM\u0026thinsp;+\u0026thinsp;CM group displayed a significant upregulation relative to PCOS IVM (P\u0026thinsp;=\u0026thinsp;0.021) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study demonstrates that in vitro maturation efficiency is significantly compromised in both standard and PCOS models, as evidenced by reduced metaphase II oocyte yields, increased GV and degenerated oocytes, and downregulation of key maturation regulators (\u003cem\u003eCdk1, Ccnb1, and Map2k).\u003c/em\u003e However, supplementation with human Wharton\u0026rsquo;s jelly mesenchymal stem cell-derived conditioned medium consistently rescued oocyte competence, enhancing nuclear maturation rates, oocyte viability, and morphometric parameters (oocyte diameter and ZP thickness). Notably, BCB\u0026thinsp;+\u0026thinsp;oocytes treated with CM exhibited significantly higher MII rates compared to IVM alone, while PCOS IVM oocytes showed severe maturation defects, which were partially reversed by CM. EVs also improved outcomes but were less effective than CM, particularly in PCOS, where CM restored \u003cem\u003eMap2k\u003c/em\u003e and \u003cem\u003eCdk1\u003c/em\u003e expression\u0026mdash;critical for meiotic progression. These findings highlight CM\u0026rsquo;s superior potential in optimizing IVM, especially in PCOS-associated oocyte dysfunction, likely due to its rich secretome of growth factors and regulatory molecules.\u003c/p\u003e\u003cp\u003eThe developmental potential of oocytes refers to their capacity to resume meiosis, undergo fertilization, form a blastocyst, and ultimately give rise to healthy offspring (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). Although efforts have been made, the chances of implantation and live births remain very low for embryos developed from matured oocytes in IVM. On the other hand, research indicates that the cells in these embryos often have chromosomal abnormalities. Therefore, oocyte quality is highly important and studies are looking for the best maturation of immature oocytes and reducing their subsequent complications (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eTo enhance the efficiency of in vitro embryo production, the initial step involves choosing high-quality, suitable immature oocytes that produce the highest quality mature oocytes when transferred to the IVM environment (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). The BCB staining method, a non-invasive technique that reveals glucose-6-phosphate dehydrogenase (G6PD) levels, is the optimal way to select immature oocytes. This enzyme is abundant in fresh, high-quality oocytes but declines as the oocyte ages (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). Research indicates that BCB\u0026thinsp;+\u0026thinsp;oocytes exhibit higher rate of cytoplasmic maturation, improved fertilization rates, and enhanced embryo development to the blastocyst stage compared to BCB- oocytes (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). Due to the benefits of this staining, we used this staining in this study to select high-quality immature oocytes and examine the effect of CM and EVs in both BCB\u0026thinsp;+\u0026thinsp;and BCB- groups.\u003c/p\u003e\u003cp\u003eThe current study revealed significant differences in maturation outcomes between BCB-selected and non-selected oocytes during IVM. BCB\u0026thinsp;+\u0026thinsp;oocytes demonstrated superior developmental competence, with significantly higher MII rates in both standard IVM and PCOS models compared to their non-selected counterparts. This enhanced performance was accompanied by reduced rates of degeneration and GV arrest in BCB-selected oocytes, particularly when supplemented with CM. In contrast, non-selected oocytes exhibited poorer outcomes across all parameters, including lower MII rates, higher degeneration, and increased meiotic arrest. These results collectively demonstrate that BCB selection serves as an effective screening tool that not only identifies oocytes with greater developmental potential but also enhances their responsiveness to IVM optimization strategies, particularly in challenging conditions like PCOS. The stark contrast between BCB-selected and non-selected oocytes underscores the importance of pre-IVM competence assessment for improving ART outcomes.\u003c/p\u003e\u003cp\u003eThis finding agrees with prior studies by Yan-Guang that employed the same staining technique for selecting viable immature mouse oocytes (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). Besides, in support of our findings of better developmental potential of BCB\u0026thinsp;+\u0026thinsp;oocytes, Opiela et al. (2008) found that BCB\u0026thinsp;+\u0026thinsp;bovine oocytes matured in vitro and then underwent in vitro fertilization (IVM/IVF) had significantly more ability to reach the 2-cell stage and blastocyst stage than BCB- oocytes in their ability (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e). Research indicates that BCB\u0026thinsp;+\u0026thinsp;oocytes exhibit significantly elevated mRNA levels of genes related to mitochondrial biogenesis, suggesting this could contribute to their enhanced developmental potential (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eOverall, the study demonstrates that both CM and EVs groups showed significantly higher MII oocyte yields compared to standard IVM for normal and PCOS mice, with CM proving more effective than EVs, likely due to its broader spectrum of soluble factors.\u003c/p\u003e\u003cp\u003eDuring maturation, oocytes experience nuclear transformations, exiting the diplotene stage of the first meiotic prophase and advancing to metaphase II, while releasing the first polar body. Observing the chromosomes of oocytes at this stage provides a more dependable method for assessing the progress of in vitro maturation (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). In this research, we conducted orcein staining for the initial time to assess nuclear maturation in mouse oocytes.\u003c/p\u003e\u003cp\u003eOrcein staining confirmed CM's superiority in restoring MII rates even in PCOS oocytes, while EVs were more effective at reducing degeneration, indicating distinct but complementary roles. PCOS oocytes exhibited significantly lower MII rates and higher degeneration, but CM supplementation restored maturation efficiency, highlighting its potential clinical relevance for PCOS patients undergoing IVM.\u003c/p\u003e\u003cp\u003eThe viability and morphometric assessments collectively demonstrate that CM significantly enhances both oocyte survival rates and morphological parameters, key indicators of developmental competence, particularly in PCOS-derived oocytes, while EVs show more modest improvements. This consistent pattern suggests that although EVs contain essential bioactive factors, CM's richer composition of regulatory components provides more comprehensive support for oocyte maturation by simultaneously improving viability, restoring normal diameter, and maintaining proper ZP thickness. The superior efficacy of CM under challenging conditions like PCOS highlights its multifaceted protective and maturation-promoting effects, implying that while EVs offer therapeutic potential, CM's broader array of factors may be necessary for optimal IVM outcomes, especially in compromised oocytes.\u003c/p\u003e\u003cp\u003eAlthough existing commercial IVM media are costly and show limited effectiveness, MSC-CM holds promise due to its likely paracrine effects, justifying its exploration in this research. Recent decades have seen multiple studies attempting to overcome the absence of a follicular microenvironment in IVM through the addition of exogenous growth factors, follicular fluid, and co-culture systems that use fresh oocytes, denuded oocytes, and oviduct cells to simulate an in vivo setting (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eSimilar to our results, Ling et al. demonstrated that MSC-conditioned medium resulted in a greater rate of mouse oocyte maturation than α-MEM. Their findings might vary from ours because of differences in MSC origin, oocyte type, and culture techniques. Highlighting the importance of standardized protocols when comparing IVM outcomes across experimental models (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eAdib et al. (2020) reported that both human testicular cell-conditioned medium and cumulus cell-conditioned medium (hCCCM) significantly improved oocyte maturation rates. However, these conditioned media were also associated with morphological alterations, including perivitelline space (PVS) enlargement and a higher incidence of irregular oocyte shape compared to control groups (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe human umbilical cord mesenchymal stem cells significantly enhanced the maturation rates of both fresh and vitrified human oocytes. Additionally, it improved oocyte ultrastructures such as increased mitochondria-vesicle complexes, optimized cortical granule distribution, and enhanced mitochondrial-smooth endoplasmic reticulum aggregates. (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e)\u003c/p\u003e\u003cp\u003eSeveral studies have confirmed that oocyte morphology significantly influences embryo development, and high-quality embryos are more likely to be obtained after IVM when morphologically normal oocytes are used (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e). Among the key abnormalities in the extracytoplasmic components, anomalies in the perivitelline space (PVS) are particularly notable. Some evidence suggests that an enlarged PVS may contribute to higher oocyte degeneration (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e) and reduced fertilization success (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e). Interestingly, however, one study found that oocytes with PVS abnormalities exhibited a significantly higher embryo development rate compared to normal oocytes, which contrasts with earlier findings (\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eBahrami et al. (2022) reported that granulosa cell-conditioned medium markedly enhanced IVM outcomes by increasing the proportion of oocytes reaching the MII stage, improving mitochondrial membrane potential and oocyte viability, boosting fertilization in vitrified-warmed and IVM oocytes, and regulating the expression of key maturation-related genes in MII oocytes of the mouse (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eAnother study has shown that conditioned media from equine amniotic fluid mesenchymal stem cells promote maturation of porcine oocytes by modulating the expression of critical genes involved in cumulus cell-mediated maturation, improving mitochondrial distribution, enhancing cortical granule positioning, and ultimately enhancing blastocyst quality (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e). Also, exosomes derived from human umbilical cord mesenchymal stem cells improved oocyte quality by increasing maturation rates, optimizing spindle formation, enhancing mitochondrial function, and boosting developmental potential (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eRecent studies across multiple species demonstrate the critical role of follicular fluid-derived EVs (ffEVs) in enhancing oocyte maturation and developmental competence. In mares and porcines, follicular fluid-derived EVs significantly increased maturation rates (\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e). Bovine studies revealed that ffEVs from preovulatory follicles and ampullary fluid upregulated maturation-related genes and improved fertilization rates, alongside metabolic quality markers (\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e). Further, equine ffEVs promoted cumulus expansion, viability, and MAPK pathway activation during maturation (\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e). Additional evidence shows that ffEVs enhance embryo development and oocyte resistance to aging (\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e). Collectively, these findings highlight ffEVs as conserved regulators of oocyte competence, with species-specific roles in altering gene expression.\u003c/p\u003e\u003cp\u003eIn human ffEVs isolated from mature follicles, enhanced in vitro maturation of immature oocytes (\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e). Conversely, a study showed that ffEV supplementation does not improve nuclear maturation of cat oocytes in vitro (\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe findings from our study, which demonstrated lower in vitro maturation IVM rates in oocytes from PCOS mice compared to controls, align with previous research highlighting the detrimental effects of PCOS-associated follicular microenvironment on oocyte quality. Liu et al. (2023) reported that EVs derived from the follicular fluid of PCOS women significantly impaired oocyte maturation, leading to increased mitochondrial mislocalization, spindle abnormalities, and upregulated antioxidant gene expression. These observations suggest that the altered composition of follicular fluid in PCOS may contribute to oxidative stress and dysfunctional oocyte maturation, potentially explaining the reduced IVM efficiency observed in our study (\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eSupporting this notion, Madkour et al. (2018) conducted a randomized controlled trial in which supplementation of IVM media with follicular fluid and cumulus-granulosa cell secretions from non-PCOS women significantly improved the maturation rates of immature oocytes from PCOS patients (\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eConsistent with the mentioned results of oocyte maturation and quality, gene expression analysis of maturation-related genes revealead significant alterations in the expression of key regulatory genes, Map2k, Ccnb1, and Cdk1, during IVM under different experimental conditions, particularly in the context of PCOS. The observed downregulation of Map2k in the IVM and PCOS IVM groups suggests impaired MAPK/ERK signaling, a critical pathway for oocyte maturation and metabolic homeostasis. The further reduction in PCOS IVM oocytes may reflect exacerbated dysfunction in PCOS, where aberrant folliculogenesis and oxidative stress are known to disrupt signaling cascades. The restoration of Map2k expression in IVM\u0026thinsp;+\u0026thinsp;CM and PCOS IVM\u0026thinsp;+\u0026thinsp;CM groups implies that conditioned medium (CM) contains factors\u0026mdash;possibly growth factors or extracellular vesicles\u0026mdash;that rescue MAPK pathway activity, potentially improving oocyte competence.\u003c/p\u003e\u003cp\u003eCCcnb1 and CDK1 suppression may contribute to maturation arrest in IVM. While the PCOS IVM group showed no further significant decline in Ccnb1, the marked reduction in Cdk1 suggests a PCOS-specific defect in the oocyte cell cycle. Notably, CM supplementation consistently upregulated both genes in PCOS IVM, reinforcing its potential to mitigate cell cycle disruptions.\u003c/p\u003e\u003cp\u003eCollectively, these results provide robust evidence that hWJMSC-derived CM and EVs enhance oocyte developmental competence, particularly in challenging conditions like PCOS, where conventional protocols often yield poorer results. By rescuing Map2k, Ccnb1, and Cdk1 expression, CM may promote nuclear and cytoplasmic maturation, ultimately improving embryo quality.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe superior performance of CM highlights its potential as an optimized supplement for IVM protocols, while EVs offer a more refined, cell-free alternative that may be advantageous for clinical translation.\u003c/p\u003e\u003cp\u003eFuture research should employ proteomic/metabolomic profiling to identify key active components in CM/EVs for developing standardized IVM treatment. These findings should then be validated in translational models, with parallel investigation of synergistic effects when combined with adjuvants like antioxidants. Such efforts will optimize IVM protocols, enhancing oocyte quality and maturation rates in both normal and PCOS conditions for clinical application.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eIVM\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ein vitro maturation\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eCM\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eConditioned Media\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eEVs\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eExtracellular Vesicles\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003ePCOS\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ePoly Cystic Ovarian Syndrome\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003ehWJMSCs\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eHuman Wharton's Jelly Mesenchymal Stem Cells\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eBCB\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eBrilliant Cresyl Blue\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eTB\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eTrypan Blue\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003ePBS\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ePhosphate Buffer Saline\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Shiraz University of Medical Sciences, Shiraz, Iran (Grant No. 23144). This work is a part of the duties that were done by A Solati for phD program.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the conceptualization and design of the study. Experiments were conducted by A.S., M.D., and S.B., Data analysis, interpretation, and preparation of figures and tables were performed by A.Z., S.A., F.Z., Z.KH., and SH. M. A.S., S.A., F.Z. supervised the study. Z. KH., and SH. M. provided methodological guidance. The first draft of the manuscript was written collaboratively by A.S. and S.A., with revisions and editing contributions from all authors. All authors critically reviewed earlier drafts and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Shiraz University of Medical Sciences, Shiraz, Iran (Grant No. 23144).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo data sets were generated or analyzed during the current study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll procedures were approved by the Ethics Committee of Shiraz University of Medical Sciences (IR.SUMS.AEC.1400.566).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of conflicting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declared no potential conflicts of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSengupta P, Dutta S. Polycystic Ovary Syndrome Beyond Reproduction: An Ethnic, Endocrine, and Lifestyle Enigma Demanding Holistic and Lifelong Solutions for the Modern Woman. Journal of Infertility and Reproductive Biology. 2025:1-3-1-3.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAgarwal S, Krishna D, Praneesh G, Rao KJJIRB. Tetrad of hormonal and biochemical manifestations in phenotypes of polycystic ovary syndrome. 2020;8(4):73\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlaee S, Ekramzadeh M, Samare-Najaf M, Jahromi BN, Shokri S, Ghomashi10 F, et al. Nutritional Intake and Lifestyle in Infertile Women with and without Polycystic Ovary Syndrome: A Case-control Study. 2024;12(4):15-30-15-30.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWard CP, Huddleston H, Masharani U, Mason AE, Frassetto L. Stringency in Polycystic Ovary Syndrome (PCOS) Criteria and Application in Clinical Study.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJie H, Zhao M, Alqawasmeh OAM, Chan CPS, Lee TL, Li T, et al. In vitro rescue immature oocytes\u0026ndash;a literature review. 2022;25(4):640\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGrynberg M, Sermondade N, Sellami I, Benoit A, Mayeur A, Sonigo CJF, et al. In vitro maturation of oocytes for fertility preservation: a comprehensive review. 2022;3(4):211\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMackens S, Pareyn S, Drakopoulos P, Deckers T, Mostinckx L, Blockeel C, et al. Outcome of in-vitro oocyte maturation in patients with PCOS: does phenotype have an impact? 2020;35(10):2272-9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJayakrishnan K, Nambiar D, Fency JLJJIRB. Comparison of ovarian response between PCOS and Non-PCOS patients undergoing ICSI with antagonist protocol. 2015;3(3):199\u0026ndash;207.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNikmard F, Hosseini E, Bakhtiyari M, Ashrafi M, Amidi F, Aflatoonian R. The boosting effects of melatonin on the expression of related genes to oocyte maturation and antioxidant pathways: a polycystic ovary syndrome- mouse model. J Ovarian Res. 2022;15(1):11.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFilatov M, Khramova Y, Semenova M. Molecular Mechanisms of Prophase I Meiotic Arrest Maintenance and Meiotic Resumption in Mammalian Oocytes. Reprod Sci. 2019;26(11):1519\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLandim-Alvarenga F, Maziero RJAR. Control of oocyte maturation. 2018;11(3):150\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJiang Y, He Y, Pan X, Wang P, Yuan X, Ma B. Advances in Oocyte Maturation In Vivo and In Vitro in Mammals. Int J Mol Sci. 2023;24(10):9059.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAkbari H. The effect of conditioned media on mouse oocytes ultrastructure following in vitro maturation. Gene Reports. 2020;20:100732.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlaee S, Zal F, Razban V, Talaei-Khozani T, Shokri S, Khodabandeh Z. PRP Influences Maturation and Fertilisation of Immature Mouse Oocytes. Anat Histol Embryol. 2024;53(6):e13112.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlaee S, Asadollahpour R, Hosseinzadeh Colagar A, Talaei-Khozani T. The decellularized ovary as a potential scaffold for maturation of preantral ovarian follicles of prepubertal mice. Systems Biology in Reproductive Medicine. 2021;67(6):413\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWalls ML, Hart RJ. In vitro maturation. Best Pract Res Clin Obstet Gynaecol. 2018;53:60\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBahmyari S, Alaee S, Khodabandeh Z, Talaei-Khozani T, Dara M, Mehdinejadiani S, et al. The effects of Wharton\u0026rsquo;s jelly MSCs secretomes for restoring busulfan-induced reproductive toxicity in male mice. Human and Experimental Toxicology. 2024;43:09603271241269019.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSmolinska V, Bohac M, Danisovic L. Current status of the applications of conditioned media derived from mesenchymal stem cells for regenerative medicine. Physiol Res. 2023;72(S3):S233-S45.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHasan MM. Characterization of follicular fluid-derived extracellular vesicles and their contribution to periconception environment. Tartu; 2022.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWorthington EN, Hagood JS. Therapeutic Use of Extracellular Vesicles for Acute and Chronic Lung Disease. Int J Mol Sci. 2020;21(7):2318.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCapra E, Lange-Consiglio AJB. The biological function of extracellular vesicles during fertilization, early embryo\u0026mdash;maternal crosstalk and their involvement in reproduction: review and overview. 2020;10(11):1510.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlaee S, Bagheri MJ, Ataabadi MS, Koohpeyma F. Capacity of Mentha spicata (spearmint) extracts in alleviating hormonal and folliculogenesis disturbances in a polycystic ovarian syndrome rat model. World J Vet. 2020(3):451\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLohrasbi P, Karbalay-Doust S, Mohammad Bagher Tabei S, Azarpira N, Alaee S, Rafiee B, et al. The effects of melatonin and metformin on histological characteristics of the ovary and uterus in letrozole-induced polycystic ovarian syndrome mice: A stereological study. Int J Reprod Biomed. 2022;20(11):973\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRafiee B, Karbalay-Doust S, Tabei SMB, Azarpira N, Alaee S, Lohrasbi P, et al. Effects of N-acetylcysteine and metformin treatment on the stereopathological characteristics of uterus and ovary. European journal of translational myology. 2022;32(2):10409.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAtaabadi MS, Bahmanpour S, Yousefinejad S, Alaee S. Blood volatile organic compounds as potential biomarkers for poly cystic ovarian syndrome (PCOS): An animal study in the PCOS rat model. The Journal of Steroid Biochemistry Molecular Biology. 2023;226:106215.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZare Z, Abouhamzeh B, Masteri Farahani R, Salehi M, Mohammadi M. Supplementation of L-carnitine during in vitro maturation of mouse oocytes affects expression of genes involved in oocyte and embryo competence: An experimental study. Int J Reprod Biomed. 2017;15(12):779\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMurin M, Strejcek F, Bartkova A, Morovic M, Benc M, Prochazka R, et al. Intranuclear characteristics of pig oocytes stained with brilliant cresyl blue and nucleologenesis of resulting embryos. Zygote. 2019;27(4):232\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJafarzadeh H, Nazarian H, Ghaffari Novin M, Shams Mofarahe Z, Eini F, Piryaei A. Improvement of oocyte in vitro maturation from mice with polycystic ovary syndrome by human mesenchymal stromal cell\u0026ndash;conditioned media. Journal of cellular biochemistry. 2018;119(12):10365\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFazelian-Dehkordi K, Talaei‐Khozani T. Three‐dimensional in vitro maturation of rabbit oocytes enriched with sheep decellularized greater omentum. Veterinary Medicine and Science. 2022;8(5):2092\u0026ndash;103.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZand E, Fathi R, Nasrabadi MH, Atrabi MJ, Spears N, Akbarinejad V. Maturational gene upregulation and mitochondrial activity enhancement in mouse in vitro matured oocytes and using granulosa cell conditioned medium. Zygote. 2018;26(5):366\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKim J, You J, Hyun SH, Lee G, Lim J, Lee E. Developmental competence of morphologically poor oocytes in relation to follicular size and oocyte diameter in the pig. Mol Reprod Dev. 2010;77(4):330\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu J, Lu X, Wang W, Zhu J, Li Y, Luo L, et al. Activity of MPF and expression of its related genes in mouse MI oocytes exposed to cadmium. Food Chem Toxicol. 2018;112:332\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSirard MA, Richard F, Blondin P, Robert C. Contribution of the oocyte to embryo quality. Theriogenology. 2006;65(1):126\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAnderiesz C, Fong CY, Bongso A, Trounson AO. Regulation of human and mouse oocyte maturation in vitro with 6-dimethylaminopurine. Hum Reprod. 2000;15(2):379\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVernunft A, Alm H, Tuchscherer A, Kanitz W, Hinrichs K, Torner HJT. Chromatin and cytoplasmic characteristics of equine oocytes recovered by transvaginal ultrasound-guided follicle aspiration are influenced by the developmental stage of their follicle of origin. 2013;80(1):1\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOpiela J, Lipiński D, Słomski R, Kątska-Książkiewicz LJARS. Transcript expression of mitochondria related genes is correlated with bovine oocyte selection by BCB test. 2010;118(2\u0026ndash;4):188\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlm H, Torner H, L\u0026ouml;hrke B, Viergutz T, Ghoneim I, Kanitz WJT. Bovine blastocyst development rate in vitro is influenced by selection of oocytes by brillant cresyl blue staining before IVM as indicator for glucose-6-phosphate dehydrogenase activity. 2005;63(8):2194\u0026ndash;205.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu YG, Liu Y, Zhou P, Lan GC, Han D, Miao DQ, et al. Selection of oocytes for in vitro maturation by brilliant cresyl blue staining: a study using the mouse model. Cell Res. 2007;17(8):722\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOpiela J, Kątska-Książkiewicz L, Lipiński D, Słomski R, Bzowska M, Ryńska B. Interactions among activity of glucose-6-phosphate dehydrogenase in immature oocytes, expression of apoptosis-related genes Bcl-2 and Bax, and developmental competence following IVP in cattle. Theriogenology. 2008;69(5):546\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOpiela J, Lipiński D, Słomski R, Kątska-Książkiewicz L. Transcript expression of mitochondria related genes is correlated with bovine oocyte selection by BCB test. Animal Reproduction Science. 2010;118(2\u0026ndash;4):188\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEl-Sokary MM, Kandiel MM, Mahmoud KGM, Abouel-Roos ME, Sosa GA. Evaluation of viability and nuclear status in vitrified mature buffalo oocytes. Glob Vet. 2013;10:297\u0026ndash;302.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLee SH. Effects of Human Endothelial Progenitor Cell and Its Conditioned Medium on Oocyte Development and Subsequent Embryo Development. Int J Mol Sci. 2020;21(21):7983.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBhardwaj R, Ansari MM, Parmar MS, Chandra V, Sharma GT. Stem Cell Conditioned Media Contains Important Growth Factors and Improves In Vitro Buffalo Embryo Production. Anim Biotechnol. 2016;27(2):118\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLing B, Feng DQ, Zhou Y, Gao T, Wei HM, Tian ZG. Effect of conditioned medium of mesenchymal stem cells on the in vitro maturation and subsequent development of mouse oocyte. Braz J Med Biol Res. 2008;41(11):978\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAdib M, Seifati SM, Ashkezari MD, Akyash F, Khoradmehr A, Aflatoonian B. Effect of human testicular cells conditioned medium on in vitro maturation and morphology of mouse oocytes. International Journal of Fertility \u0026amp; Sterility. 2020;14(3):176.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAdib M, Seifati SM, Ashkezari MD, Khoradmehr A, Rezaee-Ranjbar-Sardari R, Tahajjodi SS, et al. The effect of the human cumulus cells-conditioned medium on in vitro maturation of mouse oocyte: An experimental study. International Journal of Reproductive BioMedicine. 2020;18(12):1019.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAkbari H, Vaghefi SHE, Shahedi A, Habibzadeh V, Mirshekari TR, Shekari MA, et al. Conditioned mediums and human oocytes in vitro maturation. Int J Pharm Phytopharm Res (eIJPPR). 2018;8(2):64\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKhalili MA, Mojibian M, Sultan A-M. Role of oocyte morphology on fertilization and embryo formation in assisted reproductive techniques. Cell Journal (Yakhteh). 2005.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMikkelsen AL, Lindenberg S. Morphology of in-vitro matured oocytes: impact on fertility potential and embryo quality. Human Reproduction. 2001;16(8):1714\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePlachot M, Selva J, Wolf J, Bastit P, De Mouzon J. Consequences of oocyte dysmorphy on the fertilization rate and embryo development after intracytoplasmic sperm injection. A prospective multicenter study. Gynecologie, Obstetrique Fertilite. 2002;30(10):772\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHassa H, Aydın Y, Taplamacıoğlu F. The role of perivitelline space abnormalities of oocytes in the developmental potential of embryos. Journal of the Turkish German Gynecological Association. 2014;15(3):161.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBahrami Z, Hatamian N, Talkhabi M, Zand E, Mottershead DG, Fathi R. Granulosa Cell Conditioned Medium Enhances The Rate of Mouse Oocyte In Vitro Maturation and Embryo Formation. Cell Journal (Yakhteh). 2022;24(10):620.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePark A, Oh HJ, Ji K, Choi EM, Kim D, Kim E, et al. Effect of passage number of conditioned medium collected from equine amniotic fluid mesenchymal stem cells: porcine oocyte maturation and embryo development. International Journal of Molecular Sciences. 2022;23(12):6569.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSong J, Guo X, Zhang B, Zhang Q, Han Y, Cao D, et al. Human umbilical cord mesenchymal stem cells derived exosomes improved the aged mouse IVM oocytes quality. Reproductive Sciences. 2024;31(9):2808\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGabryś J, Kij-Mitka B, Sawicki S, Kochan J, Nowak A, Łojko J, et al. Extracellular vesicles from follicular fluid may improve the nuclear maturation rate of in vitro matured mare oocytes. Theriogenology. 2022;188:116\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKang H, Bang S, Kim H, Han A, Miura S, Park HS, et al. Follicular fluid-derived extracellular vesicles improve in vitro maturation and embryonic development of porcine oocytes. Korean Journal of Veterinary Research. 2023;63(4):40.1-.7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePakniyat Z, Azari M, Kafi M, Ghaemi M, Hashemipour SMA, Safaie A, et al. The effect of follicular and ampullary fluid extracellular vesicles on bovine oocyte competence and in vitro fertilization rates. Plos One. 2025;20(6):e0325268.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGabryś J, Gurgul A, Szmatoła T, Kij-Mitka B, Andronowska A, Karnas E, et al. Follicular fluid-derived extracellular vesicles influence on in vitro maturation of equine oocyte: impact on cumulus cell viability, expansion and transcriptome. International Journal of Molecular Sciences. 2024;25(6):3262.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShedova E, Singina G, Uzbekova S, Uzbekov R, Lukanina V, Tsyndrina E. Effect of extracellular vesicles of follicular origin during in vitro maturation and ageing of bovine oocytes on embryo development after in vitro fertilization. Sel'skokhozyaistvennaya Biologiya. 2022.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMakieva S, Saenz-de-Juano MD, Almi\u0026ntilde;ana C, Bauersachs S, Bernal-Ulloa S, Xie M, et al. Treatment of human oocytes with extracellular vesicles from follicular fluid during rescue in vitro maturation enhances maturation rates and modulates oocyte proteome and ultrastructure. bioRxiv. 2025:2025.02. 05.636623.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDahal R, Nagashima J, Songsasen N, Wood T. 150 The influence of follicular fluid extracellular vesicles on in vitro maturation of oocytes in the domestic cat. Reproduction, Fertility and Development. 2021;34(2):313-.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu C, Wang M, Yao H, Cui M, Gong X, Wang L, et al. Inhibition of oocyte maturation by follicular extracellular vesicles of nonhyperandrogenic PCOS patients requiring IVF. The Journal of Clinical Endocrinology \u0026amp; Metabolism. 2023;108(6):1394\u0026ndash;404.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMadkour A, Bouamoud N, Kaarouch I, Louanjli N, Saadani B, Assou S, et al. Follicular fluid and supernatant from cultured cumulus-granulosa cells improve in vitro maturation in patients with polycystic ovarian syndrome. Fertility and sterility. 2018;110(4):710\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"biomedical-engineering-online","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bmeo","sideBox":"Learn more about [BioMedical Engineering OnLine](http://biomedical-engineering-online.biomedcentral.com/)","snPcode":"12938","submissionUrl":"https://submission.nature.com/new-submission/12938/3","title":"BioMedical Engineering OnLine","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Extracellular Vesicles, PCOS, IVM, Conditioned media, Oocyte","lastPublishedDoi":"10.21203/rs.3.rs-7410176/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7410176/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eThe effects of conditioned medium (CM) and extracellular Vesicles (EVs) derived from human Wharton\u0026rsquo;s jelly mesenchymal stem cells (hWJMSCs) on in vitro maturation (IVM) of immature oocytes in both normal and polycystic ovary syndrome (PCOS)-induced mice were investigated. PCOS was induced in adult female NMRI mice by administering letrozole (90 \u0026micro;g/kg/day) via gavage for one week. Germinal vesicle (GV) oocytes were collected from both PCOS-induced and normal mice, while mature oocytes (MII) were obtained from superovulated normal mice to serve as controls. The experimental groups included 7 groups: Control (MII oocytes), 3 IVM groups (In vitro maturation of GV oocytes): IVM (with simple IVM media), IVM\u0026thinsp;+\u0026thinsp;CM and IVM\u0026thinsp;+\u0026thinsp;EVs (IVM media supplemented with CM and EVs, respectively), and three PCOS groups (In vitro maturation of GV oocytes from PCOS-induced mice): PCOS IVM (with simple IVM media), PCOS IVM\u0026thinsp;+\u0026thinsp;CM and PCOS IVM\u0026thinsp;+\u0026thinsp;EVs (IVM media supplemented with CM and EVs, respectively). After IVM was conducted in all groups, mature oocytes were harvested and assessed for maturation rate, morphology, viability, and gene expression profiles of key regulators (CDK1, CCNB1, MAP2K). Developmentally competent oocytes were selected using Brilliant Cresyl Blue staining and then subjected to in vitro maturation with or without CM or EVs supplementation. Nuclear maturation was evaluated via orcein staining, while viability was assessed using Trypan Blue. Morphometric parameters were measured using ImageJ software. Real-time PCR was utilized for the evaluation of gene expression of targeted genes.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eResults demonstrated that in BCB\u0026thinsp;+\u0026thinsp;oocytes, CM and EVs significantly improved mature oocytes compared to IVM (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Oocytes from PCOS-induced mice exhibited reduced maturation and increased degeneration, which were rescued by CM and EV treatment. Gene expression analysis revealed downregulation of MAP2K, CCNB1, and CDK1 in IVM and PCOS IVM groups compared to the control group, while CM supplementation restored their expression. Oocyte diameter and viability were significantly enhanced in IVM\u0026thinsp;+\u0026thinsp;CM compared to IVM (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e\u003cp\u003eThese findings suggest that hWJMSC-derived secretomes, particularly CM, enhance oocyte maturation and quality, offering potential therapeutic benefits for IVM in both normal and PCOS conditions.\u003c/p\u003e","manuscriptTitle":"Conditioned Media and Extracellular Vesicles Derived from Human Wharton's Jelly Mesenchymal Stem Cells Improve the in vitro Maturation of Immature Oocytes in Normal and PCOS Mouse Model","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-04 12:11:26","doi":"10.21203/rs.3.rs-7410176/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-09-30T14:45:19+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-30T09:09:58+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-29T04:29:42+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-26T16:43:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"222723781759970873271176570750862313496","date":"2025-09-02T07:11:02+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"245899310778797069198931091054043041631","date":"2025-09-02T07:05:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"18223007554054019819038497317909838558","date":"2025-08-29T10:23:05+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"300728950969093010873978405669764426793","date":"2025-08-28T11:28:23+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-08-28T06:34:13+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-20T12:39:10+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-20T12:38:50+00:00","index":"","fulltext":""},{"type":"submitted","content":"BioMedical Engineering OnLine","date":"2025-08-19T15:32:01+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"biomedical-engineering-online","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bmeo","sideBox":"Learn more about [BioMedical Engineering OnLine](http://biomedical-engineering-online.biomedcentral.com/)","snPcode":"12938","submissionUrl":"https://submission.nature.com/new-submission/12938/3","title":"BioMedical Engineering OnLine","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"38d02725-abc9-4200-8e12-82cbaade5fce","owner":[],"postedDate":"September 4th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-12-29T16:04:55+00:00","versionOfRecord":{"articleIdentity":"rs-7410176","link":"https://doi.org/10.1186/s12938-025-01500-7","journal":{"identity":"biomedical-engineering-online","isVorOnly":false,"title":"BioMedical Engineering OnLine"},"publishedOn":"2025-12-27 15:57:50","publishedOnDateReadable":"December 27th, 2025"},"versionCreatedAt":"2025-09-04 12:11:26","video":"","vorDoi":"10.1186/s12938-025-01500-7","vorDoiUrl":"https://doi.org/10.1186/s12938-025-01500-7","workflowStages":[]},"version":"v1","identity":"rs-7410176","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7410176","identity":"rs-7410176","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.