An expanded polyglutamine in ATAXIN1 results in a loss-of-function that exacerbates severity of Multiple Sclerosis in an EAE mouse model | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article An expanded polyglutamine in ATAXIN1 results in a loss-of-function that exacerbates severity of Multiple Sclerosis in an EAE mouse model Gourango Talukdar, Lisa Duvick, Praseuth Yang, Brennon O’Callaghan, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5664390/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 30 Apr, 2025 Read the published version in Journal of Neuroinflammation → Version 1 posted 8 You are reading this latest preprint version Abstract Background and Objectives Ataxin-1 (ATXN1) is a protein in which expansion of its polyglutamine tract causes the neurodegenerative disorder spinocerebellar ataxia type 1 (SCA1) via a gain-of-function. Wild type ATXN1 was recently shown to have a protective role in regulating severity of experimental autoimmune encephalomyelitis (EAE), a well-established mouse model for Multiple sclerosis (MS). This study further investigates the role of ATXN1 with an expanded polyglutamine tract in the context of MS using an EAE mouse model. Methods Hemizygous Atxn1 (Atxn1 2Q/− ) mice or f - ATXN1 146Q/2Q , heterozygous mice that have one copy of the endogenous mouse gene replaced with a polyQ expanded pathogenic human ATXN1 gene, were injected with myelin oligodendrocytes glycoprotein (MOG 35 − 55 ) peptide to induce EAE. Immunohistochemical and biochemical approaches were used to analyze the degree of demyelination, cell loss, axonal degeneration as well as detecting the activated immune cells and inflammatory cytokines upon EAE induction in Atxn1 2Q/− and f - ATXN1 146Q/2Q mice. Results Our findings reveal that a loss-of-function of wild type Atxn1 in Atxn1 2Q/− and f-ATXN1 146Q/2Q mice significantly exacerbates the EAE symptoms, leading to increased demyelination, oligodendrocytes loss, heightened axon degeneration, and greater clinical disability in affected mice. Importantly, the data reveals that neurotoxic astrocytes are activated at acute stage of disease (PID-14) and at the chronic stage of disease (PID-30) neurotoxic astrocytes no longer show signs of activation. The data also demonstrated enhanced infiltration of immune cells into the lesions of mutant mice. Discussion These results indicate that ATXN1 plays a protective role in modulating immune responses and maintaining neural integrity during MS. Importantly, expansion of the polyQ tract in ATXN1 results in a loss-of-function in ATXN1’s ability to dampen the immune response. Understanding the functional role of ATXN1 in MS pathogenesis may open new avenues for therapeutic strategies aimed at mitigating disease progression. ATAXIN1 Multiple sclerosis autoimmune demyelination EAE SCA1 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Expansion of the polyglutamine tract in ATAXIN1 (ATXN1), a nuclear protein 1 , causes spinocerebellar ataxia type 1 (SCA1), a heritable neurodegenerative disorder 2 , 3 . Neuroinflammation is a common feature of neurodegenerative disorders 4 – 6 . Recently, the ATXN1 gene was identified as a susceptibility locus for multiple sclerosis (MS) 7 – 10 , a multifaceted autoimmune disorder characterized by chronic inflammation, demyelination, and subsequent neuronal damage within the central nervous system (CNS) 11 – 13 . MS presents a wide spectrum of symptoms, ranging from focal inflammation to neuronal death, axonal and myelin loss, and failure of CNS repair mechanisms to restore the damage 14 . MRI studies show that cortical demyelination is common in early-stage MS, with approximately 30% of patients with a clinically isolated syndrome exhibiting cortical lesions 15 . Furthermore, MS is traditionally viewed as a chronic inflammatory disease of the CNS, leading to the formation of focal demyelinated plaques in white matter 16 . Pathology of MS emphasizes the demyelinating aspects of the disease process, with a preservation of axons in the lesion area 17 . In MS, CNS pathology extends beyond white matter, with grey matter damage occurring early in the disease evolution, correlating with clinical disability and cognitive dysfunction 18 . Regulation of B cell function, B cell receptor signaling, and the expression of specific noncoding RNAs in B cells upon autoimmune demyelination were shown to be aspects of ATXN1’s involvement in the pathogenesis of MS 7 – 10 . The identification of ATXN1 as a susceptibility gene for MS underscores the importance of further understanding its role in the disease process and its potential as a therapeutic target. However, the function of ATXN1 in the pathogenesis and progression of MS in the CNS remains elusive. In the present study, we investigate the role of ATXN1 in CNS autoimmunity, specifically in the pathophysiology of MS diseases progression. We employ the experimental autoimmune encephalomyelitis (EAE) mouse model, to further explore the role of ATXN1 in MS pathogenesis. Our findings indicate that the loss-of-function (via heterozygous knockout or 146Q expansion) of ATXN1 increases autoimmune demyelination, axon degeneration, and oligodendrocyte loss which, is associated with the activation of immune cells and inflammatory cytokines in the site of CNS lesion. Materials and Methods Mice f-ATXN1 146Q/2Q mice are a conditional knock-in mouse model where the coding exons of one allele of the mouse Atxn1 gene was replaced with the human ATXN1 coding exons using site-specific recombination at flanking FRT and LoxN recombination sites 19 . Atxn1 2Q/- mice, heterozygous SCA1 null mice, were generated as described 20 . The University of Minnesota Institutional Animal Care and Use Committee approved all animal use protocols. Mice were housed and managed by Research Animal Resources under specific pathogen-free conditions in an Association for Assessment and Accreditation of Laboratory Animal Care International approved facility. Food and water were provided ad libitum . All mice were age matched (8–9 weeks) within experiments and littermate controls ( Atxn1 2Q/2Q ) were used. Female mice were used for EAE experiments because the MOG-induced EAE model is well established to exhibit a stronger and more consistent disease phenotype in females, reflecting the higher prevalence of MS in women 21 and male mice were used for characterization. All mice were maintained on a C57BL/6 genetic background. Samples were collected at post-immunization day 14 (PID-14, acute phase) and 30 (PID-30, chronic phase) of the disease, representing the relapse and remission states, respectively. We chose PID-14 as it marks the initiation of peak disease progression, which occurs at PID-16/17. EAE immunization Eight-week-old female mice were anesthetized using 1.8% isoflurane and injected subcutaneously in the flank/tail base with 200mg of MOG 35 − 55 peptide (Genemed Synthesis Inc.) emulsified in complete Freund’s adjuvant (BD Biosciences) supplemented with 600mg of Mycobacterium tuberculosis (strain H37Ra; BD Biosciences). Two intraperitoneal injections of 400ng pertussis toxin (Biological Laboratories) were given 0 and 48h later. Clinical scores (0 = healthy, 0.5 = tail shows slight limpness, 1 = flaccid tail, 1.5 = weak hind limbs, 2 = ataxia paresis of hind limbs with abnormal gait, 2.2 = wedge gait duck walk, 2.3 = leg paresis/drag one leg, 2.5 = paralysis of one leg, 2.8 = drag one leg, paralysis another leg, 3 = paralysis of hindlimbs and/or paresis of forelimbs, 3.5 = paralysis of hind limbs, paralysis of one front limb, 4 = tetra-paralysis, 5 = moribund or death) were recorded daily as described previously 21 , 22 . The aggregate EAE clinical score was the sum of daily clinical scores for each individual mouse during the observation period. Immunohistochemistry (IHC) Mice were deeply anesthetized with ketamine and xylazine cocktail by intraperitoneal injection and perfused through the left cardiac ventricle with PBS (in 0.4 mg/ml heparin) followed by 10% buffered formalin phosphate. Half sagittal brain and the cephalic half of the lumbar spinal cord (SC; L1–L3) were postfixed in 10% buffered formalin phosphate for 2h, cryoprotected in 30% sucrose for 48h, embedded in optimum cutting temperature compound, and frozen on dry ice. Frozen sections were cut using a cryostat at a thickness of 16µm. The other half sagittal brain and the caudal half of the lumbar SC (L3–L5) were postfixed in 10% buffered formalin phosphate for 72h, dehydrated through graded alcohols, and embedded in paraffin wax. Paraffin sections were cut using a microtome to a thickness of 5µm. For immunofluorescence, the frozen sections were treated with − 20°C acetone and paraffin section were deparaffinized by treating with xylene and hydrated. The samples were then blocked with PBS containing 10% goat/horse serum and 0.1% Triton X-100, and incubated overnight with the primary antibody diluted in blocking solution. We used the following primary and secondary antibodies for immunohistochemical detection: CC1 (APC7, 1:50; Millipore, RRID:AB_2057371), myelin basic protein (MBP,1:1000; BioLegend, RRID:AB_2616694), CD3 (1:50; BioLegend, RRID:AB_312658), NeuN (1:500; Abcam, RRID:AB_10711040), glial fibrillary acidic protein (GFAP; 1:200; Agilent Technologies, RRID:AB_10013382), Iba1 (1:200; FUJIFILM Wako’s, RRID:AB_839504), and Neurofilament H (NF-H) (1:200; BioLegend, RRID:AB_32715852). Fluorescein (1:200, Thermo Fisher Scientific, anti-rabbit, RRID:AB_2534088; anti-mouse, RRID:AB_2576217), Cy3 (1:200, Jackson ImmunoResearch Labs, anti-rabbit, RRID:AB_2338006), or enzyme-labeled secondary antibodies (1:200, Vector Laboratories, anti-mouse/rabbit, RRID:AB_2336826). Finally, sections were mounted in ProLong Gold Antifade with 4′,6- diamidino-2-phenylindole (DAPI) to visualize nuclei (Thermo Fisher Scientific) for immunofluorescence and in toluene for 3,3'-Diaminobenzidine (DAB) (Vactor laboratories) staining. Immunofluorescence images were acquired on a Leica Stellaris 8 microscope equipped with a Leica HC PLAN APO 63X objective and stitched together with LASX software (Leica) and DAB images were acquired on a Zeiss Axioskop II to allow visualization of the lumbar SC. To quantify cells and axons in the white matter of lumbar spinal cord, we counted immune-positive cells or axons in an area of 0.1mm 2 within the anterior funiculus medially next to the anterior median fissure in the lumbar SC as described previously 21 , 22 . Demyelination and number of cells were quantified using Fiji software. To analyze the cell body of Iba1 + cells we counted both hypertrophic and amoeboid cells using Halo software. RT-qPCR The lumbar spinal cord from each mouse was homogenized in 500µL TRIzol Reagent (Thermo Fisher Scientific, 15596026). RNA isolation was done per the manufacturer’s instructions 19 . cDNA was synthesized in duplicate using 500ng RNA in 10µL iScript Advanced cDNA Synthesis Kit (Bio-Rad, 172–5038). Reactions were diluted 1:5 with water. RT-qPCR was done using 2µL diluted cDNA in 10µL Roche Probes Master (04707494001) reactions on a Roche 480 Lightcycler. Target gene and reference gene reactions were amplified in separate wells under cycling conditions of 95°C for 10s, 60°C for 10s for 35 cycles. Cq (quantitation cycle) values were determined using the Roche second derivative maximum calculation. Relative quantification was done using standard 2 ΔΔCq 19 . Primers used include GFAP forward (5’-AGTTGCAGTCCTTGACCTG-3’) and GFAP reverse (5’-CAGCGCCTCCTGATAACTG-3’); C3 forward (5’-CCTTCCACCTTTTTCCTTCACT-3’) and C3 reverse (5’-CTCCAGCCGTAGGACATTG-3’); Clcf1 forward (5’-CCATCCAGAAAACCTATGACCT-3’) and Clcf1 reverse (5’-GATTGAAGTCAGGCTCGTTGA-3’); Slc1a2 forward (5’-CCATGCTCCTCATTCTCACAG-3’) and Slc1a2 reverse (5’-AAAGAATCGCCCACCACAT-3’); TNFα forward (5’-TTGGTCTGATTGTTGGAGTGA-3’) and TNFα reverse (5’-CTTGGCATCTCTTTGTTAGGCA-3’) with probe (5’-/56-FAM/ TGCTGATGT/ZEN/TAGGACTGGTGAACTGC/3IABkFQ/-3’); INFγ forward (5’-AGTAGTTATCCTGGTATTTGCGT-3’) and reverse (5’-TTGTCTCTAACGTGGCACTT-3’) with probe (5’-/56-FAM/AATGTTACC/ZEN/TAAGTCCTTGCTCTCTGTGG /3IABkFQ/-3’); IL-17 forward (5’-GCTGCCTAAATGACTGTTTGAG-3’) and IL-17 reverse (5’-AGAATGGCGATGAGTGTGATG-3’) with probe (5’-/56-FAM/ CTGGCTTGG/ZEN/GAACTGTGGTATTTGAGA/3IABkFQ/-3’); iNOS forward (5’-GATCCAGTGGTCCAACCTG-3’) and iNOS reverse (5’-GACCTGATGTTGCCATTGTTG-3’) with probe (5’-/56-FAM/CAGATGTGC/ZEN /TGAAACATTTCCTGTGCT/3IABkFQ/-3’); IL-10 forward (5’-CGGAGACTACACTGTGAGAGT-3’) and IL-10 reverse (5’-GGATTCTATCTGCATCTCAGGAG-3’) with probe (5’-/56-FAM/CCCCGTGGA/ZEN/ AGACACCATCATTGG/3IABkFQ/-3’). Statistical analysis Statistics tests were performed in GraphPad Prism version 10.0 (GraphPad Software). Unless indicated otherwise, values are presented as mean ± standard error of the mean (SEM). Areas of Iba1 + cell bodies were calculated using Halo 4.0 (Indica Labs). Statistical differences between the groups were compared using one-way ANOVA or two-way ANOVA with Tukey’s multiple comparison test for multiple groups. P < 0.05 was considered statistically significant. Results Expression of ATXN1 with an expanded polyQ tract does not affect viability and function of spinal cord oligodendrocytes, astrocytes, and motor neurons Spinocerebellar ataxia type 1 (SCA1) is caused by expansion of glutamine(Q) encoding CAG repeats in ATXN1 that results in a toxic gain of ATXN1 function 23 . We first examined whether cells involved in MS are altered in untreated Atxn1 2Q/2Q (WT) mice, f-ATXN1 146Q/2Q ( Atxn1 heterozygous knock-in) mice, and Atxn1 2Q/− ( Atxn1 heterozygous knock-out) mice on a C57BL/6J background. To characterize the mice, we collected the lumbar spinal cord at 8 weeks of age. The spinal cord, more specifically the lumbar spinal cord, is a critical region for EAE mediated lesion 24 . We performed DAB staining with CC1, an antibody marker for oligodendrocytes, and found comparable numbers of oligodendrocytes in the white matter of lumbar spinal cord of WT, f-ATXN1 146Q/2Q , and Atxn1 2Q/− mice (Fig. 1 A, B, C, D). Immunostaining for GFAP (a marker for astrocytes) (Fig. 1 E, F, G, H) and NeuN (a marker for motor neurons) (Fig. 1 I, J, K, L) didn’t show any differences in their numbers in the white matter and grey matter respectively among all the three groups of mice. DAB staining of myelin basic protein (MBP), showed similar degree of myelination in the white matter of lumbar spinal cord (Fig. 1 M, N, O, P), in the cerebellum and brain stem (Supplementary Fig. 1A, B, C) and in the corpus callosum (Supplementary Fig. 1D, E, F). Taken together, these data indicate that neither ATXN1 loss nor ATXN1 with an expanded polyQ impacts neuronal and glial viability, gliosis or myelination in the lumbar spinal cord of 8-week-old mice under normal physiological conditions. ATXN1 loss-of-function exacerbates EAE disease severity To examine the role of ATXN1 in EAE, we immunized 8-week-old WT, f-ATXN1 146Q/2Q , and Atxn1 2Q/− female mice, with myelin oligodendrocyte glycoprotein (MOG) peptide 35 to 55 (MOG 35–55 ) to induce experimental autoimmune encephalomyelitis (EAE). While all the mice showed impairments consistent with EAE, f-ATXN1 146Q/2Q and Atxn1 2Q/− mice had greater clinical scores compared to WT controls indicating exacerbated disease severity (Fig. 2 A). Importantly, compared to WT littermates f-ATXN1 146Q/2Q and Atxn1 2Q/− mice also had impaired recovery (Fig. 2 A). Although there were no differences in the onset and early disease progression, f-ATXN1 146Q/2Q and Atxn1 2Q/− mice exhibited a higher peak score (Fig. 2 B) and higher mean aggregate score (Fig. 2 C) than WT mice. Disease recovery from peak (PID-16) to remission (PID-30) was attenuated in f-ATXN1 146Q/2Q and Atxn1 2Q/− mice when compared to WT mice (Fig. 2 D). We observed no differences in disease onset, disease progression, and remission between f-ATXN1 146Q/2Q and Atxn1 2Q/− mice (Fig. 2 A, B, C), indicating that ATXN1 genetic modification by polyQ expansion and by knock-out has similar effects on EAE disease course. ATXN1 loss-of-function enhances oligodendrocyte loss and demyelination during EAE Previous studies show that loss of PERK signaling in oligodendrocytes increases susceptibility to inflammation, resulting in exacerbation of demyelination in EAE 25 . Additionally, ATF6α deficiencies linked to exacerbated oligodendrocyte loss during EAE, highlighting the importance of specific signaling pathways in maintaining oligodendrocyte viability and myelin integrity 21 . Furthermore, demyelination and oligodendrocyte loss are features of EAE lesions 26 . Inflammatory demyelination induces axonal injury and neuronal apoptosis, emphasizing the interconnection of these processes in neuroinflammatory conditions 27 . To assess how ATXN1 loss impacts oligodendrocyte number and demyelination, 8-week-old mice were immunized with MOG 35–55 and tissues collected from lumbar spinal cord at PID-14 and PID-30 (Fig. 3 A). DAB staining of CC1 revealed that few oligodendrocytes remained in the lesions of lumbar spinal cord of each genotype, whereas f-ATXN1 146Q/2Q and Atxn1 2Q/− mice showed significantly higher reductions in oligodendrocyte numbers compared to WT mice at peak disease progression at PID-14 (Fig. 3 B, C, D, N). During the disease remission period at PID-30, the numbers of newly generated oligodendrocytes were reduced in the lumbar spinal cord of f-ATXN1 146Q/2Q and Atxn1 2Q/− mice compared to WT mice (Fig. 3 E, F, G, N). Furthermore, quantitative analysis of MBP IHC showed around 50% of the white matter of lumbar spinal cord of f-ATXN1 146Q/2Q and Atxn1 2Q/− mice was demyelinated at PID-14 which was significantly higher than in WT mice (< 35%) (Fig. 3 H, I, J, O). Despite remyelination in the recovery period at PID-30, the demyelinated area continued to be higher in the white matter of lumbar spinal cord of f-ATXN1 146Q/2Q and Atxn1 2Q/− mice than WT mice (Fig. 3 K, L, M, O). Interestingly, there were no differences in oligodendrocyte loss and the degree of demyelination between f-ATXN1 146Q/2Q and Atxn1 2Q/− mice at PID-14 and PID-30 (Fig. 3 N, O). ATXN1 deficiency promotes axonal degeneration during EAE Axonal degeneration is a critical aspect of neurological deficits in autoimmune conditions such as EAE and MS. Studies show that axonal degeneration contributes significantly to the development of non-remitting neurological deficits and disability in MS 28 . Axonal degeneration within spinal cord lesions of EAE animals has been well characterized 25 . Furthermore, axonal degeneration is associated with the development of neurological disability in MS and EAE 29 . Therefore, we performed immunofluorescence staining of the non-phosphorylated neurofilament-H (NF-H, previously identified as SMI-32), a marker for degenerating axons, in the lumbar spinal cord of each genotype of naïve 8-week-old mice, PID-14, and PID-30. As expected, no degenerating axons were seen in the white matter of lumbar spinal cord in 8-week-old under normal conditions (Fig. 4 A, B, C, J). There was substantial axonal degeneration in the white matter of lumbar spinal cord at PID-14 and the number of degenerating axons was significantly higher in f-ATXN1 146Q/2Q and Atxn1 2Q/− mice than WT mice. We found no differences in the number of degenerating axons between f-ATXN1 146Q/2Q and Atxn1 2Q/− mice (Fig. 4 D, E, F, J). With recovery the number of degenerating axons was greatly reduced in the white matter of lumbar spinal cord of WT mice, but significantly less so in f-ATXN1 146Q/2Q and Atxn1 2Q/− mice. The number of degenerating axons was comparable in f-ATXN1 146Q/2Q and Atxn1 2Q/− mice at PID-30 (Fig. 4 G, H, I, J). These data suggest that the normal function of ATXN1 supports axonal survivability upon EAE challenges. Mutant ATXN1-mediated activation of astrocytes plays a dual role during EAE Reactive astrocytes play a crucial role in the pathophysiology of EAE and respond to insults by undergoing a process known as reactive astrogliosis, which involves activation, hypertrophy, and proliferation 30 . Reactive astrocytes can have both beneficial and detrimental effects in EAE. As reactive astrocytes may serve to protect the CNS from injury by releasing growth factors 31 , inhibition of reactive astrogliosis can lead to more severe inflammation and clinical symptoms 32 . Immunofluorescence staining of GFAP revealed a reduced number of reactive astrocytes in the white matter of lumbar spinal cord at the time of severe disease progression at PID-14 (Fig. 5 A, B, C, G) and increased number of reactive astrocytes at the time of remission at PID-30 (Fig. 5 D, E, F, G) in f-ATXN1 146Q/2Q and Atxn1 2Q/− mice compared to WT mice. Quantitative analysis showed that the severe inflammation during EAE has a similar effect on the number of reactive astrocytes between f-ATXN1 146Q/2Q and Atxn1 2Q/− mice (Fig. 5 G). We performed RT-qPCR to investigate whether the astrocytes are A1 neurotoxic ( C3 ) or A2 neuroprotective ( Clcf1 and Slc1a2 ). The GFAP mRNA level was significantly reduced in f-ATXN1 146Q/2Q and Atxn1 2Q/− mice compared to WT mice at PID-14 but no significant differences were detected at PID-30 (Fig. 5 H, I). The expression of C3 was higher in f-ATXN1 146Q/2Q and Atxn1 2Q/− mice than in WT mice at PID-14 but unchanged at PID-30 (Fig. 5 H, I). No significant changes were observed in the expression of A2 markers Clcf1 and Slc1a2 among the three groups of mice at either PID-14 or PID-30 (Fig. 5 H, I). These data reveal that the loss of ATXN1 activates neurotoxic astrocytes at PID-14 of EAE. In contrast, astrocytes no longer show signs of activation at PID-30 of EAE. Elevated numbers of infiltrated T cells and macrophages/microglia in the lesions of the lumbar spinal cord (white matter) upon EAE The initiation of EAE is characterized by the peripheral formation of myelin-reactive encephalitogenic T lymphocytes that migrate to the CNS, where they trigger neuroinflammation in collaboration with microglia and infiltrated macrophages 33 . The intricate balance between effector T cells and regulatory T cell subsets influences the development and progression of EAE, highlighting the complexity of T cell responses in autoimmune demyelinating diseases. To assess the number of infiltrated T cells in the lesions of lumbar spinal cord upon EAE, we performed DAB staining of CD3 (a marker for T cells) at PID-14 and PID-30. Higher numbers of activated T cells and a cluster of activated T cells were seen at PID-14 (Fig. 6 A, B, C, M) as well as at PID-30 (Fig. 6 D, E. F, M) in the lumbar spinal cord of f-ATXN1 146Q/2Q and Atxn1 2Q/− mice than WT mice. DAB staining of Iba1 (a macrophages/microglia marker) showed significantly higher numbers of macrophages/microglia at the inflammatory lesion in the lumbar spinal cord of f-ATXN1 146Q/2Q and Atxn1 2Q/− mice compared to WT mice at PID-14 (Fig. 6 G, H, I, N) and PID-30 (Fig. 6 J, K, L, N). To determine morphological changes of macrophages/microglia we further analyzed the DAB staining of Iba1 by parametric approach (Supplementary Fig. 2). Morphology analysis showed the higher number of hypertrophic and/or amoeboid macrophages/microglia in the lumbar spinal cord of f-ATXN1 146Q/2Q and Atxn1 2Q/− mice compared to WT mice at PID-14 (Fig. 6 G, H, I, O) and PID-30 (Fig. 6 J, K, L, O). A significantly higher number of hypertrophic and/or amoeboid macrophages/microglia were observed at PID-14, but their numbers were comparable between the f-ATXN1 146Q/2Q and Atxn1 2Q/− mice at PID-30 (Fig. 6 G, H, I, O). The elevated expression of hypertrophic and/or amoeboid macrophages/microglia at PID-14 in the lumbar spinal cord of f-ATXN1 146Q/2Q mice compared to Atxn1 2Q/− mice may be due to expanded polyQ mediated activation. These results indicate that loss of ATXN1 exacerbates immune activation in EAE. Altered immune cytokine gene expression in the lumbar spinal cord in response to inflammation during EAE The expression of various cytokines during EAE reflects the complex interplay between pro-inflammatory and anti-inflammatory responses that dictate disease progression and severity. RT-qPCR analysis showed higher expression of TNFα and IFNγ in the lumbar spinal cord of f-ATXN1 146Q/2Q and Atxn1 2Q/− mice compared to WT mice at PID-14 (Fig. 7 A). No significant differences in the expression of TNFα and IFNγ were seen in the chronic phase of the EAE at PID-30 (Fig. 7 B). Similarly, no changes in IL-17 and IL-10 levels were observed among all three groups of mice at PID-14 and PID-30 (Fig. 7 A, B). Previous research showed that the role of iNOS may shift, potentially influencing the resolution of inflammation and tissue repair processes in chronic phases 34 , 35 . Consistent with this, our RT-qPCR showed the lower levels of iNOS in lumbar spinal cord of Atxn1 2Q/− compared to WT control at PID-30 (Fig. 7 B), but no significant differences at PID-14 among these three groups of mice (Fig. 7 A). Taken together, these data indicate that mutant ATXN1 alters inflammation in the CNS of mice during EAE more specifically in the acute phase of the disease. Discussion Genome-wide genomic screens link the ATXN1 locus with an increased risk of developing MS 9 . In the present study, using two different genetic modifications of Atxn1 in mice, we demonstrated that haploinsufficiency of Atxn1 and expansion of the CAG repeat exacerbate clinical EAE symptoms as well as underlying pathology, including axonal degeneration, oligodendrocyte loss and demyelination, and immune activation during acute and chronic phases of the disease progression. Thus, expansion of the polyQ tract in ATXN1 impacts EAE severity through a loss-of-function mechanism. Importantly, neither of these ATXN1 genetic modifications caused cellular loss nor demyelination in the spinal cord of mice in absence of EAE. ATXN1 expression is controlled by hypomethylation at specific genomic sites within the ATXN1 sequence in B cells at clinical onset of the disease 10 . This regulation suggests that ATXN1 may enhance B cell function, which is crucial since B cells contribute to the autoimmune response observed in MS. The ability of ATXN1 to modulate B cell activity can influence the production of antibodies and cytokines, thereby affecting the overall inflammatory response in the central nervous system (CNS). Moreover, ATXN1 has been shown to regulate the signaling pathways involved in B cell receptor (BCR) signaling. Ma and Didonna reported that ATXN1 affects the extracellular signal-regulated kinase (ERK) and signal transducer and activator of transcription (STAT) pathways, which are critical for B cell activation and proliferation 8 . By fine-tuning these signaling pathways, WT ATXN1 may help maintain a balance between pro-inflammatory and anti-inflammatory responses, potentially mitigating MS severity. Previous studies highlighted that CIC deficiency leads to upregulation of TNF-α in liver macrophages, suggesting that CIC may similarly regulate cytokine expression in other immune contexts, including EAE 36 . This regulation is crucial, as TNF-α is known to enhance the activation of T cells and the recruitment of inflammatory cells to the central nervous system (CNS) during EAE 37 . In the context of MS, ATXN1 was found to regulate B cell function, impacting the severity of autoimmune experimental encephalomyelitis 7 . The ablation of ATXN1 in B cells results in aberrant expression of key molecules involved in proinflammatory T cell differentiation, suggesting a role for ATXN1 in modulating immune responses 7 . Consistent with these observations, our data showed that the disease severity upon EAE is associated with the recruitment of a higher number of activated T cells and macrophage/microglia to the lesion sites. TNFα is known to be upregulated in EAE and contributes significantly to initiation and amplification of the immune response within the CNS. TNFα promotes the recruitment and activation of various immune cells, including macrophages and T cells, which infiltrate the CNS and exacerbate inflammation 38 . The presence of TNFα is associated with increased blood-brain barrier permeability, facilitating immune cell entry into the CNS and leading to further tissue damage 39 . Similarly, IFNγ plays a crucial role in the pathogenesis of EAE. IFNγ enhances macrophage and microglia activation, leading to increased production of pro-inflammatory cytokines and mediators, including TNFα itself 40 . IFNγ is also involved in the differentiation of naive T cells into Th1 cells, thereby perpetuating the inflammatory cycle 41 . Research has demonstrated that mice deficient in IFNγ exhibit increased susceptibility to EAE, highlighting its protective role in modulating the immune response 42 . Consequently, the elevated production of inflammatory cytokines like TNFα and IFNγ in the CNS during EAE are notable. Although IFNγ and TNFα play important roles in the first attack, they are not major contributors to relapse 42 , which is consistent with our findings. Furthermore, studies show that mutant ATXN1 mediated activation of astrocytes and microglia at early ages in SCA1 models lead to a pro-inflammatory environment, that may closely relate to neuronal dysfunction and damage 5 , 43 . Activation of neurotoxic astrocytes at an early stage (PID-14) of disease contributes to increase severity, whereas the absence of neurotoxic astrocytes activation at a later stage (PID-30) presumably allows the initiation of recovery from disease-related damage. The interaction between the activated glial cells and CD3-positive T cells in the cerebellum of SCA1 mice reflects the involvement of T cells in the neuroinflammatory response associated with the disease, indicating a potential link between immune activation and the degeneration of Purkinje cells. Additionally, GFAP expressions can differ during early phases and in remitting EAE. GFAP levels were significantly elevated, reflecting broad activation of astrocytes in response to inflammatory cues and tissue damage 44 . Studies have also shown reduced levels of GFAP in spinal cord at the acute phase of disease during EAE 45 , 46 which is consistent with our findings. During EAE progression, microglia become activated and release various pro-inflammatory cytokines, including IL-1α and TNF-α, contributing to the synthesis of C3 in astrocytes and enhancing neurotoxic activity 47 . A complex interplay between microglia and astrocytes where microglial activity initiates the release of C3 and induces increased expression in neighboring astrocytes, creating a feedback loop that may exacerbate inflammatory responses in EAE. Therefore, severe phagocytic activity of microglia might also contribute to reduced levels of astrocytes (both cells and mRNA) at the acute phase (PID-14) of EAE (Fig. 5 ) in the mutant mice. The increased levels of GFAP at the white matter of lumbar spinal cord, despite similar mRNA levels in the whole lumbar spinal cord at PID-30, may be due to the differential responses of white and grey matter to EAE-induced inflammation. Intriguingly, we found that loss of ATXN1 caused a reduced number of reactive astrocytes during acute EAE disease progression in Atxn1 2Q/− mice while a higher number of reactive astrocytes was present in the white matter of lumbar spinal cord of these mice during remission of the disease. Studies show that depletion of reactive astrocytes during the acute phase is associated with worsening EAE outcomes 48 . Reactive astrocytes orchestrate inflammatory responses of resident and peripheral immune cells in the CNS during EAE 30 . They can suppress remyelination and contribute to the inflammatory milieu by releasing cytokines and chemokines 30 . A common aspect of neurodegenerative disease is neuroinflammation 4 . In particular, signs of neuroinflammation are detected in mouse models of SCA3 6 and SCA1 49 . We speculate that a loss-of-function in ATXN1 with an expanded polyQ tract has the ability to dampen immune responses might result in increased neuroinflammation during SCA1 pathogenesis. In conclusion, loss-of-function of ATXN1 enhances severity of MS, potentially through its involvement in gene expression regulation, immune responses, and interactions with nuclear transport pathways. Further research into the specific mechanisms by which ATXN1 influences the pathogenesis of MS could provide valuable insights into novel therapeutic targets for this complex autoimmune inflammatory disease. Abbreviations Ataxin-1: (ATXN1) SCA1: Spinocerebellar ataxia type 1 EAE: Experimental autoimmune encephalomyelitis MS: Multiple sclerosis MOG: Myelin oligodendrocyte glycoprotein CNS: Central nervous system PID: Post-immunization day SC: Spinal cord MBP: Myelin basic protein GFAP: Glial fibrillary acidic protein DAPI: 4′,6- diamidino-2-phenylindole DAB: 3,3'-Diaminobenzidine RT-qPCR: Real-time quantitative polymerase chain reaction C3: Complement C3 Clcf1: Cardiotrophin-like cytokine factor 1 Slc1a2: Solute carrier family 1 member 2 TNF α: Tumor necrosis factor alpha IFNγ: Interferon gamma iNOS: Inducible nitric oxide synthase IL-17: Interleukin 17 IL-10: Interleukin 10 ATF6: Activating transcription factor 6 Declarations Ethics approval and consent to participate: Not applicable Consent for publication: Not applicable Availability of data and material: No datasets were generated or analyzed during the current study. Conflict of interest: The authors declare no competing financial interests. Funding: The study was supported by NIH grant R35NS127248 (H.T.O.). Author’s contribution: GT and HTO designed the study, GT, LD, and PY performed research experiments, GT, GJF, and LD analyzed data, GT, MC, and HTO wrote the manuscript, HTO, MC, BO, and LD edited the manuscript. Acknowledgement: The authors thank Orion Rainwater, Shannah Serres, and Joyce Meints for their support to accomplish the study. The authors thank Laura Berg for editing the manuscript. References Klement IA, Skinner PJ, Kaytor MD, et al. Ataxin-1 Nuclear Localization and Aggregation: Role in Polyglutamine-Induced Disease in SCA1 Transgenic Mice. Orr HT, Chung M yi, Banfi S, et al. Expansion of an unstable trinucleotide CAG repeat in spinocerebellar ataxia type 1. Nat Genet . 1993;4(3):221-226. doi:10.1038/ng0793-221 Globas C, Du Montcel ST, Baliko L, et al. Early symptoms in spinocerebellar ataxia type 1, 2, 3, and 6. Movement Disorders . 2008;23(15):2232-2238. doi:10.1002/mds.22288 Guzman-Martinez L, Maccioni RB, Andrade V, Navarrete LP, Pastor MG, Ramos-Escobar N. Neuroinflammation as a Common Feature of Neurodegenerative Disorders. Front Pharmacol . 2019;10:1008. doi:10.3389/fphar.2019.01008 Cvetanovic M, Ingram M, Orr H, Opal P. Early activation of microglia and astrocytes in mouse models of spinocerebellar ataxia type 1. Neuroscience . 2015;289:289-299. doi:10.1016/j.neuroscience.2015.01.003 Chiu YJ, Lin SA, Chen WL, et al. Pathomechanism characterization and potential therapeutics identification for SCA3 targeting neuroinflammation. Aging . 2020;12(23):23619-23646. doi:10.18632/aging.103700 Didonna A, Canto Puig E, Ma Q, et al. Ataxin-1 regulates B cell function and the severity of autoimmune experimental encephalomyelitis. Proc Natl Acad Sci USA . 2020;117(38):23742-23750. doi:10.1073/pnas.2003798117 Ma Q, Didonna A. The novel multiple sclerosis susceptibility gene ATXN1 regulates B cell receptor signaling in B-1a cells. Mol Brain . 2021;14(1):19. doi:10.1186/s13041-020-00715-0 Ma Q, Didonna A. Ataxin‐1 controls the expression of specific noncoding RNAs in B cells upon autoimmune demyelination. Immunol Cell Biol . 2023;101(4):358-367. doi:10.1111/imcb.12622 Ma Q, Oksenberg JR, Didonna A. Epigenetic control of ataxin‐1 in multiple sclerosis. Ann Clin Transl Neurol . 2022;9(8):1186-1194. doi:10.1002/acn3.51618 Takeuchi H. Midkine and multiple sclerosis. British J Pharmacology . 2014;171(4):931-935. doi:10.1111/bph.12499 Calabrese M, Atzori M, Bernardi V, et al. Cortical atrophy is relevant in multiple sclerosis at clinical onset. J Neurol . 2007;254(9):1212-1220. doi:10.1007/s00415-006-0503-6 Meyer R, Weissert R, Diem R, et al. Acute Neuronal Apoptosis in a Rat Model of Multiple Sclerosis. J Neurosci . 2001;21(16):6214-6220. doi:10.1523/JNEUROSCI.21-16-06214.2001 Bross M, Hackett M, Bernitsas E. Approved and Emerging Disease Modifying Therapies on Neurodegeneration in Multiple Sclerosis. IJMS . 2020;21(12):4312. doi:10.3390/ijms21124312 Lucchinetti CF, Popescu BFG, Bunyan RF, et al. Inflammatory Cortical Demyelination in Early Multiple Sclerosis. N Engl J Med . 2011;365(23):2188-2197. doi:10.1056/NEJMoa1100648 Lassmann H. New concepts on progressive multiple sclerosis. Curr Neurol Neurosci Rep . 2007;7(3):239-244. doi:10.1007/s11910-007-0036-0 Lycke JN, Karlsson JE, Andersen O, Rosengren LE. Neurofilament protein in cerebrospinal fluid: a potential marker of activity in multiple sclerosis. Journal of Neurology, Neurosurgery & Psychiatry . 1998;64(3):402-404. doi:10.1136/jnnp.64.3.402 Senol AD, Pinto G, Beau M, et al. Alterations of the axon initial segment in multiple sclerosis grey matter. Brain Communications . 2022;4(6):fcac284. doi:10.1093/braincomms/fcac284 Duvick L, Southern WM, Benzow KA, et al. Mapping SCA1 regional vulnerabilities reveals neural and skeletal muscle contributions to disease. JCI Insight . 2024;9(9):e176057. doi:10.1172/jci.insight.176057 Matilla A, Roberson ED, Banfi S, et al. Mice Lacking Ataxin-1 Display Learning Deficits and Decreased Hippocampal Paired-Pulse Facilitation. J Neurosci . 1998;18(14):5508-5516. doi:10.1523/JNEUROSCI.18-14-05508.1998 Stone S, Wu S, Jamison S, Durose W, Pallais JP, Lin W. Activating transcription factor 6α deficiency exacerbates oligodendrocyte death and myelin damage in immune‐mediated demyelinating diseases. Glia . 2018;66(7):1331-1345. doi:10.1002/glia.23307 Lei Z, Yue Y, Stone S, Wu S, Lin W. NF-κB Activation Accounts for the Cytoprotective Effects of PERK Activation on Oligodendrocytes during EAE. J Neurosci . 2020;40(33):6444-6456. doi:10.1523/JNEUROSCI.1156-20.2020 Zoghbi HY, Orr HT. Pathogenic Mechanisms of a Polyglutamine-mediated Neurodegenerative Disease, Spinocerebellar Ataxia Type 1. Journal of Biological Chemistry . 2009;284(12):7425-7429. doi:10.1074/jbc.R800041200 Liu H, Jin H, Yue X, et al. PET Imaging Study of S1PR1 Expression in a Rat Model of Multiple Sclerosis. Mol Imaging Biol . 2016;18(5):724-732. doi:10.1007/s11307-016-0944-y Hussien Y, Cavener DR, Popko B. Genetic inactivation of PERK signaling in mouse oligodendrocytes: Normal developmental myelination with increased susceptibility to inflammatory demyelination: Oligodendrocyte-Specific PERK Inactivation. Glia . 2014;62(5):680-691. doi:10.1002/glia.22634 Hou B, Yin J, Liu S, et al. Inhibiting the NLRP3 Inflammasome with MCC950 Alleviates Neurological Impairment in the Brain of EAE Mice. Mol Neurobiol . 2024;61(3):1318-1330. doi:10.1007/s12035-023-03618-y Shindler KS, Ventura E, Dutt M, Rostami A. Inflammatory demyelination induces axonal injury and retinal ganglion cell apoptosis in experimental optic neuritis. Experimental Eye Research . 2008;87(3):208-213. doi:10.1016/j.exer.2008.05.017 Craner MJ. Co-localization of sodium channel Nav1.6 and the sodium-calcium exchanger at sites of axonal injury in the spinal cord in EAE. Brain . 2004;127(2):294-303. doi:10.1093/brain/awh032 Lo AC, Saab CY, Black JA, Waxman SG. Phenytoin Protects Spinal Cord Axons and Preserves Axonal Conduction and Neurological Function in a Model of Neuroinflammation In Vivo. Journal of Neurophysiology . 2003;90(5):3566-3571. doi:10.1152/jn.00434.2003 Brambilla R, Morton PD, Ashbaugh JJ, Karmally S, Lambertsen KL, Bethea JR. Astrocytes play a key role in EAE pathophysiology by orchestrating in the CNS the inflammatory response of resident and peripheral immune cells and by suppressing remyelination. Glia . 2014;62(3):452-467. doi:10.1002/glia.22616 Giraud SN, Caron CM, Pham-Dinh D, Kitabgi P, Nicot AB. Estradiol inhibits ongoing autoimmune neuroinflammation and NFκB-dependent CCL2 expression in reactive astrocytes. Proc Natl Acad Sci USA . 2010;107(18):8416-8421. doi:10.1073/pnas.0910627107 Wang X, Haroon F, Karray S, Martina Deckert, Schlüter D. Astrocytic F as ligand expression is required to induce T ‐cell apoptosis and recovery from experimental autoimmune encephalomyelitis. Eur J Immunol . 2013;43(1):115-124. doi:10.1002/eji.201242679 Hao W, Decker Y, Schnöder L, et al. Deficiency of IκB Kinase β in Myeloid Cells Reduces Severity of Experimental Autoimmune Encephalomyelitis. The American Journal of Pathology . 2016;186(5):1245-1257. doi:10.1016/j.ajpath.2016.01.004 Sonar SA, Lal G. The iNOS Activity During an Immune Response Controls the CNS Pathology in Experimental Autoimmune Encephalomyelitis. Front Immunol . 2019;10:710. doi:10.3389/fimmu.2019.00710 Warnecke A, Musunuri S, N’diaye M, et al. Nitration of MOG diminishes its encephalitogenicity depending on MHC haplotype. Journal of Neuroimmunology . 2017;303:1-12. doi:10.1016/j.jneuroim.2016.11.008 Kim E, Park S, Choi N, et al. Deficiency of Capicua disrupts bile acid homeostasis. Sci Rep . 2015;5(1):8272. doi:10.1038/srep08272 Jahan‐Abad AJ, Karima S, Shateri S, et al. Serum pro‐inflammatory and anti‐inflammatory cytokines and the pathogenesis of experimental autoimmune encephalomyelitis. Neuropathology . 2020;40(1):84-92. doi:10.1111/neup.12612 Kemp K, Gordon D, Wraith DC, et al. Fusion between human mesenchymal stem cells and rodent cerebellar Purkinje cells. Neuropathology and Applied Neurobiology . 2011;37(2):166-178. doi:10.1111/j.1365-2990.2010.01122.x Valentin-Torres A, Savarin C, Hinton DR, Phares TW, Bergmann CC, Stohlman SA. Sustained TNF production by central nervous system infiltrating macrophages promotes progressive autoimmune encephalomyelitis. J Neuroinflammation . 2016;13(1):46. doi:10.1186/s12974-016-0513-y Kemp K, Gray E, Mallam E, Scolding N, Wilkins A. Inflammatory Cytokine Induced Regulation of Superoxide Dismutase 3 Expression by Human Mesenchymal Stem Cells. Stem Cell Rev and Rep . 2010;6(4):548-559. doi:10.1007/s12015-010-9178-6 Hou Y, Ryu CH, Park KY, Kim SM, Jeong CH, Jeun SS. Effective combination of human bone marrow mesenchymal stem cells and minocycline in experimental autoimmune encephalomyelitis mice. Stem Cell Res Ther . 2013;4(4):77. doi:10.1186/scrt228 Hidaka Y, Inaba Y, Matsuda K, et al. Cytokine production profiles in chronic relapsing–remitting experimental autoimmune encephalomyelitis: IFN-γ and TNF-α are important participants in the first attack but not in the relapse. Journal of the Neurological Sciences . 2014;340(1-2):117-122. doi:10.1016/j.jns.2014.02.039 Rosa JG, Hamel K, Sheeler C, et al. Spatial and Temporal Diversity of Astrocyte Phenotypes in Spinocerebellar Ataxia Type 1 Mice. Cells . 2022;11(20):3323. doi:10.3390/cells11203323 Jukkola P, Guerrero T, Gray V, Gu C. Astrocytes differentially respond to inflammatory autoimmune insults and imbalances of neural activity. acta neuropathol commun . 2013;1(1):70. doi:10.1186/2051-5960-1-70 Remlinger J, Bagnoud M, Meli I, et al. Modelling MOG antibody-associated disorder and neuromyelitis optica spectrum disorder in animal models: Spinal cord manifestations. Multiple Sclerosis and Related Disorders . 2023;78:104892. doi:10.1016/j.msard.2023.104892 Voskuhl RR, Peterson RS, Song B, et al. Reactive Astrocytes Form Scar-Like Perivascular Barriers to Leukocytes during Adaptive Immune Inflammation of the CNS. J Neurosci . 2009;29(37):11511-11522. doi:10.1523/JNEUROSCI.1514-09.2009 Yadav SK, Ito N, Soin D, Ito K, Dhib-Jalbut S. Dimethyl Fumarate Suppresses Demyelination and Axonal Loss through Reduction in Pro-Inflammatory Macrophage-Induced Reactive Astrocytes and Complement C3 Deposition. JCM . 2021;10(4):857. doi:10.3390/jcm10040857 Mayo L, Trauger SA, Blain M, et al. Regulation of astrocyte activation by glycolipids drives chronic CNS inflammation. Nat Med . 2014;20(10):1147-1156. doi:10.1038/nm.3681 Qu W, Johnson A, Kim JH, Lukowicz A, Svedberg D, Cvetanovic M. Inhibition of colony-stimulating factor 1 receptor early in disease ameliorates motor deficits in SCA1 mice. J Neuroinflammation . 2017;14(1):107. doi:10.1186/s12974-017-0880-z Additional Declarations No competing interests reported. Supplementary Files Supplementaryfigure.docx Cite Share Download PDF Status: Published Journal Publication published 30 Apr, 2025 Read the published version in Journal of Neuroinflammation → Version 1 posted Editorial decision: Accepted 17 Apr, 2025 Reviews received at journal 14 Apr, 2025 Reviewers agreed at journal 10 Apr, 2025 Reviews received at journal 10 Apr, 2025 Reviewers agreed at journal 10 Apr, 2025 Reviewers invited by journal 10 Apr, 2025 Submission checks completed at journal 10 Apr, 2025 First submitted to journal 09 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5664390","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":441432559,"identity":"8c5d1d3f-f155-42ea-9c4a-c493a5f4d4ad","order_by":0,"name":"Gourango Talukdar","email":"","orcid":"","institution":"University of Minnesota","correspondingAuthor":false,"prefix":"","firstName":"Gourango","middleName":"","lastName":"Talukdar","suffix":""},{"id":441432560,"identity":"70123de0-9b0b-428d-8772-a0550dd2e641","order_by":1,"name":"Lisa Duvick","email":"","orcid":"","institution":"University of Minnesota","correspondingAuthor":false,"prefix":"","firstName":"Lisa","middleName":"","lastName":"Duvick","suffix":""},{"id":441432561,"identity":"2592705e-d5c0-4f4e-9cc9-d6fcabbf2705","order_by":2,"name":"Praseuth Yang","email":"","orcid":"","institution":"University of Minnesota","correspondingAuthor":false,"prefix":"","firstName":"Praseuth","middleName":"","lastName":"Yang","suffix":""},{"id":441432562,"identity":"607c441d-14ab-46d0-b07a-22653ed88287","order_by":3,"name":"Brennon O’Callaghan","email":"","orcid":"","institution":"University of Minnesota","correspondingAuthor":false,"prefix":"","firstName":"Brennon","middleName":"","lastName":"O’Callaghan","suffix":""},{"id":441432563,"identity":"0039aa56-3e47-4cae-810a-b54d6da5c507","order_by":4,"name":"Gavin J. Fuchs","email":"","orcid":"","institution":"University of Minnesota","correspondingAuthor":false,"prefix":"","firstName":"Gavin","middleName":"J.","lastName":"Fuchs","suffix":""},{"id":441432564,"identity":"5c3ead16-5846-44fa-a020-2c9d10f47c55","order_by":5,"name":"Marija Cvetanovic","email":"","orcid":"","institution":"University of Minnesota","correspondingAuthor":false,"prefix":"","firstName":"Marija","middleName":"","lastName":"Cvetanovic","suffix":""},{"id":441432565,"identity":"d11445df-f704-425a-91ba-d240a721e454","order_by":6,"name":"Harry T. Orr","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAt0lEQVRIiWNgGAWjYNACAwk5fgiLmVgtFTbGkg2kaTmTlrjhALFa+KXPPpPmbTvMuPlGdtoDhgrrxAZCWiT70o0NZ7YdZja7kbvdgOFMOmEtBmfYGB98bDvMBtSyTYKx7TBRWhgOJLYd5jGeAdLyjzgtjA8+nEmTMJAAaWkgQotkDxuz4YwKGwOJM2+3SSQcSzcmqIWfh41NmsdAor6/HWjLhxprWYJaUEECacpHwSgYBaNgFOACAOV5Oq+9vzPlAAAAAElFTkSuQmCC","orcid":"","institution":"University of Minnesota","correspondingAuthor":true,"prefix":"","firstName":"Harry","middleName":"T.","lastName":"Orr","suffix":""}],"badges":[],"createdAt":"2024-12-17 19:53:03","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5664390/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5664390/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12974-025-03450-2","type":"published","date":"2025-04-30T15:57:15+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":80554924,"identity":"8a0b2015-14b2-4ff8-aeed-6e775d04eae9","added_by":"auto","created_at":"2025-04-14 15:28:53","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":753899,"visible":true,"origin":"","legend":"\u003cp\u003eNerve and glial cell viability and myelination are not altered at the age of 8 weeks in \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand\u003cem\u003e Atxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice. (\u003cstrong\u003eA–D)\u003c/strong\u003e CC1 IHC (DAB stain) showed a comparable number of oligodendrocytes in the lumbar spinal cord of WT mice, \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003emice, and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice. (\u003cstrong\u003eE–H\u003c/strong\u003e) GFAP stain showed no differences in astrocytes (green) number, with nuclear counterstain DAPI (Blue), at the white matter of the lumbar spinal cord among the groups. (\u003cstrong\u003eI–L)\u003c/strong\u003e NeuN stain showed similar number of motor neurons (purple), with nuclear counterstain DAPI (Blue), in the grey matter of the lumbar spinal cord among all groups of mice. MBP IHC showed a comparable degree of myelination in lumbar spinal cord of the WT mice, \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003emice, and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice (\u003cstrong\u003eM–P\u003c/strong\u003e). N = 4 animals each. Scale bars: 40 μm (\u003cstrong\u003eA–C\u003c/strong\u003e, \u003cstrong\u003eE–G\u003c/strong\u003e, \u003cstrong\u003eI–K\u003c/strong\u003e). Statistical analyses were done with a one-way ANOVA with a Tukey’s multiple comparison test. Error bars represent SEM; ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-5664390/v1/767ed45255e3544f04f7a666.png"},{"id":80553939,"identity":"8d9da7dc-41ad-4191-884b-f11b3ddf486c","added_by":"auto","created_at":"2025-04-14 15:20:53","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":302419,"visible":true,"origin":"","legend":"\u003cp\u003eEAE severity is enhanced in \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand\u003cem\u003e Atxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice. (\u003cstrong\u003eA)\u003c/strong\u003e Mean EAE clinical scores showed an identical more severe disease course in \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice compared to WT control mice. (\u003cstrong\u003eB\u003c/strong\u003e) Peak EAE clinical score for individual mice. (\u003cstrong\u003eC\u003c/strong\u003e) The mean aggregate EAE clinical score was higher in \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice compared to WT control mice. (\u003cstrong\u003eD\u003c/strong\u003e) Mean EAE clinical scores PID-16 and PID-30 for WT (N = 21), \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003e(N = 13), and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice (N = 10). Error bars represent SEM. Differences between scores on each day were assessed by two-way ANOVA with Tukey’s multiple comparison test (\u003cstrong\u003eA, D\u003c/strong\u003e) and one-way ANOVA with Tukey’s multiple comparison test (\u003cstrong\u003eB, C\u003c/strong\u003e). *(knock-in vs. wildtype;\u0026nbsp; heterozygous vs. wildtype); *p≤ 0.05, **p≤ 0.01, ***p≤ 0.001, ****p≤ 0.0001, ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-5664390/v1/1e98c44e306a5d05fa20e6af.png"},{"id":80553941,"identity":"8c9729f8-735e-48be-b7bf-345c03341205","added_by":"auto","created_at":"2025-04-14 15:20:53","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":674094,"visible":true,"origin":"","legend":"\u003cp\u003eEAE-induced oligodendrocyte loss and demyelination are more severe in \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand\u003cem\u003e Atxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice. (\u003cstrong\u003eA\u003c/strong\u003e) Diagram depicting the sample collection protocol. (\u003cstrong\u003eB–G, N\u003c/strong\u003e) DAB staining of the CC1 in the lumbar spinal cord showed significantly higher loss of oligodendrocytes in \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e mice during peak disease at PID-14 (\u003cstrong\u003eB–D\u003c/strong\u003e) and during remission at PID-30 (\u003cstrong\u003eE–G\u003c/strong\u003e), as with WT mice. There were no differences in the level of oligodendrocyte loss between \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003emice and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice at PID-14 and PID-30. (\u003cstrong\u003eH–M, O\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eDAB staining of the MBP showed that the percentage of demyelinated area in the lumbar spinal cord was significantly increased in \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003emice and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice compared to WT mice at PID-14 (\u003cstrong\u003eH–J\u003c/strong\u003e) and PID-30 (\u003cstrong\u003eK–M\u003c/strong\u003e). No significant differences in the degree of demyelination in the lumbar spinal cord were observed between \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice at PID-14 and PID-30. N = 4 animals each. Scale bars: 40 μm (\u003cstrong\u003eB–G\u003c/strong\u003e) and 100 μm (\u003cstrong\u003eH–M\u003c/strong\u003e). Statistical analyses were done with one-way ANOVA with Tukey’s multiple comparison test. Error bars represent SEM; *p≤ 0.05, **p≤ 0.01, ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-5664390/v1/465ce7dc3215c91078ff04b9.png"},{"id":80554925,"identity":"d52843be-1d04-4822-9bf4-f90d0e176c27","added_by":"auto","created_at":"2025-04-14 15:28:53","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":490553,"visible":true,"origin":"","legend":"\u003cp\u003eEAE-induced axon degeneration is enhanced in \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand\u003cem\u003e Atxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice. (\u003cstrong\u003eA–C, J\u003c/strong\u003e)\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003eImmunofluorescence\u003cstrong\u003e \u003c/strong\u003estaining of the NF-H for degenerating axons in the lumbar spinal cord showed that no axon degeneration was found in Naïve mice at age of 8 weeks (\u003cstrong\u003eA–C\u003c/strong\u003e). (\u003cstrong\u003eD–F, J\u003c/strong\u003e)\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003eImmunofluorescence\u003cstrong\u003e \u003c/strong\u003estaining of NF-H in lumbar spinal cord displayed significantly higher number of degenerating axons in \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice during accelerated disease progression at PID-14 (\u003cstrong\u003eD–F\u003c/strong\u003e) and during remission at PID-30 (\u003cstrong\u003eG–I\u003c/strong\u003e) compared to WT mice. (\u003cstrong\u003eJ\u003c/strong\u003e) \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice showed comparable number of degenerating axons at both time points. N = 4 animals each. Scale bars: 40 μm. Statistical analyses were done with one-way ANOVA with Tukey’s multiple comparison test. Error bars represent SEM; *p≤ 0.05, **p≤ 0.01, ***p≤ 0.001, ****p≤ 0.001, ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-5664390/v1/b8c8e2cfa2b277941aa6fa0a.png"},{"id":80553948,"identity":"c7b2c555-ba2d-4861-8ef7-47a8b4fae12e","added_by":"auto","created_at":"2025-04-14 15:20:53","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":999159,"visible":true,"origin":"","legend":"\u003cp\u003eAlteration in EAE-induced reactive astrocytes at early and late Post Immunization Days. GFAP immunofluorescence staining (green) and nuclear counterstain, DAPI (blue) showed ablation of reactive astrocytes in the white matter of lumbar spinal cord of \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice compare to WT controls in the acute phage of disease\u003cdel\u003es\u003c/del\u003e progression at PID-14 (\u003cstrong\u003eA–C, G\u003c/strong\u003e). In the chronic phage of diseases progression at PID-30 (\u003cstrong\u003eD–f, G\u003c/strong\u003e), the elevated number of reactive astrocytes were counted in the white matter of lumbar spinal cord of both\u003cem\u003e f-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice compared to WT controls. N = 4 animals each. Scale bars: 40 μm. RT-qPCR analysis showing the lower levels of \u003cem\u003eGFAP\u003c/em\u003e and higher levels of \u003cem\u003eC3\u003c/em\u003e in the lumbar spinal cord of \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice compared to WT controls at PID-14 (\u003cstrong\u003eH\u003c/strong\u003e), while levels were comparable among three groups at PID-30 (\u003cstrong\u003eI\u003c/strong\u003e). No significant differences of \u003cem\u003eClcf1\u003c/em\u003e and \u003cem\u003eSlc1a2\u003c/em\u003e expressions were observed in the lumbar spinal cord of WT, \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e,\u003csup\u003e\u003cem\u003e \u003c/em\u003e\u003c/sup\u003eand \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice at either PID-14 (\u003cstrong\u003eH\u003c/strong\u003e) or PID-30 (\u003cstrong\u003eI\u003c/strong\u003e). N = 4\u003cstrong\u003e–\u003c/strong\u003e5 animals each. Statistical analyses were done with one-way ANOVA with Tukey’s multiple comparison test. Error bars represent SEM; *p≤ 0.05, **p≤ 0.01, ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-5664390/v1/3067d392428a700a3c176ab6.png"},{"id":80555415,"identity":"70e672d6-cb31-4983-b7ce-b16b3bbbd128","added_by":"auto","created_at":"2025-04-14 15:36:53","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":517281,"visible":true,"origin":"","legend":"\u003cp\u003eInfiltration of inflammatory T cells and macrophages/microglia in the white matter of EAE-induced lumbar spinal cord lesions at early and late Post Immunization Days. (\u003cstrong\u003eA–F, M\u003c/strong\u003e) DAB staining of CD3 (T cells) showed higher number of T cells at PID-14 (\u003cstrong\u003eA–C\u003c/strong\u003e) as well as at PID-30 (\u003cstrong\u003eD–F\u003c/strong\u003e) in the lumbar spinal cord of \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice compared to WT controls. No significant differences were seen between the lumbar spinal cord of \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice. (\u003cstrong\u003eG–J, N\u003c/strong\u003e) DAB staining of Iba1 (macrophages/microglia) showed a higher number of macrophages/microglia at PID-14 (\u003cstrong\u003eG–I\u003c/strong\u003e) as well as at PID-30 (\u003cstrong\u003eJ–L\u003c/strong\u003e) in the lumbar spinal cord of \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice compared to WT controls. No significant differences were seen between the lumbar spinal cord of \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice. (\u003cstrong\u003eG–J, O\u003c/strong\u003e) Morphology analysis showed a higher number of hypertrophic and/or amoeboid macrophages/microglia at PID-14\u0026nbsp; as well as at PID-30\u0026nbsp; in the lumbar spinal cord of \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice compared to WT controls (\u003cstrong\u003eO\u003c/strong\u003e). A significantly higher number of hypertrophic and/or amoeboid macrophages/microglia were observed at PID-14, but their numbers were comparable between the \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice at PID-30 (\u003cstrong\u003eO\u003c/strong\u003e). N = 4 animals each. Scale bars: 40 μm. Black arrows indicate single cells, and red arrows indicate clusters of activated T cells and macrophages/microglia. Statistical analyses were done with one-way ANOVA with Tukey’s multiple comparison test. Error bars represent SEM; *p≤ 0.05, **p≤ 0.01, ***p≤ 0.001, ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-5664390/v1/a59a325175fa6de664e52282.png"},{"id":80553952,"identity":"b9804677-1d21-4843-a726-d5d9bcac695a","added_by":"auto","created_at":"2025-04-14 15:20:53","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":548337,"visible":true,"origin":"","legend":"\u003cp\u003eInflammatory cytokines at the lesion of lumbar spinal cord during EAE. RT-qPCR analysis showing the higher levels of \u003cem\u003eTNFα\u003c/em\u003e and \u003cem\u003eIFNγ\u003c/em\u003e in the lumbar spinal cord of \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice compared to WT controls at PID-14 (\u003cstrong\u003eA\u003c/strong\u003e) but comparable at PID-30 (\u003cstrong\u003eB\u003c/strong\u003e). No significant differences of\u0026nbsp; \u003cem\u003eTNFα\u003c/em\u003e and \u003cem\u003eIFNγ\u003c/em\u003e levels were seen between the lumbar spinal cord of \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice (\u003cstrong\u003eA, B\u003c/strong\u003e). No significant differences of \u003cem\u003eIL-17\u003c/em\u003e and \u003cem\u003eIL-10\u003c/em\u003e levels were seen among the lumbar spinal cord of WT, \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q \u003c/em\u003e\u003c/sup\u003eand \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice\u0026nbsp; at PID-14 (\u003cstrong\u003eA\u003c/strong\u003e) and PID-30 (\u003cstrong\u003eB\u003c/strong\u003e). At PID-30, \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice showed lower levels of \u003cem\u003eiNOS\u003c/em\u003e compared to WT controls, whereas no significant differences were observed among all three groups of mice at PID-14 (\u003cstrong\u003eA\u003c/strong\u003e, \u003cstrong\u003eB\u003c/strong\u003e). N = 5 animals each. Statistical analyses were done with one-way ANOVA with Tukey’s multiple comparison test. Error bars represent SEM; *p≤ 0.05, ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-5664390/v1/877d49aa49c43e8aad3c53a8.png"},{"id":81987685,"identity":"2473c680-4d71-4ddb-becb-133cb1ebf219","added_by":"auto","created_at":"2025-05-05 16:04:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5447246,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5664390/v1/5a1d0ff9-a45e-44c7-9e85-96ec040609b9.pdf"},{"id":80553945,"identity":"83068c9e-a6ec-4267-ba6d-0e1818af5b32","added_by":"auto","created_at":"2025-04-14 15:20:53","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":397506,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfigure.docx","url":"https://assets-eu.researchsquare.com/files/rs-5664390/v1/771093330e510e04d125f9ea.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"An expanded polyglutamine in ATAXIN1 results in a loss-of-function that exacerbates severity of Multiple Sclerosis in an EAE mouse model","fulltext":[{"header":"Introduction","content":"\u003cp\u003eExpansion of the polyglutamine tract in ATAXIN1 (ATXN1), a nuclear protein\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e, causes spinocerebellar ataxia type 1 (SCA1), a heritable neurodegenerative disorder\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Neuroinflammation is a common feature of neurodegenerative disorders\u003csup\u003e\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Recently, the \u003cem\u003eATXN1\u003c/em\u003e gene was identified as a susceptibility locus for multiple sclerosis (MS)\u003csup\u003e\u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e, a multifaceted autoimmune disorder characterized by chronic inflammation, demyelination, and subsequent neuronal damage within the central nervous system (CNS)\u003csup\u003e\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. MS presents a wide spectrum of symptoms, ranging from focal inflammation to neuronal death, axonal and myelin loss, and failure of CNS repair mechanisms to restore the damage\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. MRI studies show that cortical demyelination is common in early-stage MS, with approximately 30% of patients with a clinically isolated syndrome exhibiting cortical lesions\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Furthermore, MS is traditionally viewed as a chronic inflammatory disease of the CNS, leading to the formation of focal demyelinated plaques in white matter\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Pathology of MS emphasizes the demyelinating aspects of the disease process, with a preservation of axons in the lesion area\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. In MS, CNS pathology extends beyond white matter, with grey matter damage occurring early in the disease evolution, correlating with clinical disability and cognitive dysfunction\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eRegulation of B cell function, B cell receptor signaling, and the expression of specific noncoding RNAs in B cells upon autoimmune demyelination were shown to be aspects of ATXN1\u0026rsquo;s involvement in the pathogenesis of MS\u003csup\u003e\u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. The identification of \u003cem\u003eATXN1\u003c/em\u003e as a susceptibility gene for MS underscores the importance of further understanding its role in the disease process and its potential as a therapeutic target. However, the function of ATXN1 in the pathogenesis and progression of MS in the CNS remains elusive. In the present study, we investigate the role of ATXN1 in CNS autoimmunity, specifically in the pathophysiology of MS diseases progression. We employ the experimental autoimmune encephalomyelitis (EAE) mouse model, to further explore the role of ATXN1 in MS pathogenesis. Our findings indicate that the loss-of-function (via heterozygous knockout or 146Q expansion) of ATXN1 increases autoimmune demyelination, axon degeneration, and oligodendrocyte loss which, is associated with the activation of immune cells and inflammatory cytokines in the site of CNS lesion.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMice\u003c/h2\u003e \u003cp\u003e\u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e mice are a conditional knock-in mouse model where the coding exons of one allele of the mouse \u003cem\u003eAtxn1\u003c/em\u003e gene was replaced with the human \u003cem\u003eATXN1\u003c/em\u003e coding exons using site-specific recombination at flanking FRT and LoxN recombination sites\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/-\u003c/em\u003e\u003c/sup\u003e mice, heterozygous SCA1 null mice, were generated as described\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. The University of Minnesota Institutional Animal Care and Use Committee approved all animal use protocols. Mice were housed and managed by Research Animal Resources under specific pathogen-free conditions in an Association for Assessment and Accreditation of Laboratory Animal Care International approved facility. Food and water were provided \u003cem\u003ead libitum\u003c/em\u003e. All mice were age matched (8\u0026ndash;9 weeks) within experiments and littermate controls (\u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/2Q\u003c/em\u003e\u003c/sup\u003e) were used. Female mice were used for EAE experiments because the MOG-induced EAE model is well established to exhibit a stronger and more consistent disease phenotype in females, reflecting the higher prevalence of MS in women\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e and male mice were used for characterization. All mice were maintained on a C57BL/6 genetic background. Samples were collected at post-immunization day 14 (PID-14, acute phase) and 30 (PID-30, chronic phase) of the disease, representing the relapse and remission states, respectively. We chose PID-14 as it marks the initiation of peak disease progression, which occurs at PID-16/17.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eEAE immunization\u003c/h3\u003e\n\u003cp\u003eEight-week-old female mice were anesthetized using 1.8% isoflurane and injected subcutaneously in the flank/tail base with 200mg of MOG\u003csub\u003e35\u0026thinsp;\u0026minus;\u0026thinsp;55\u003c/sub\u003e peptide (Genemed Synthesis Inc.) emulsified in complete Freund\u0026rsquo;s adjuvant (BD Biosciences) supplemented with 600mg of \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e (strain H37Ra; BD Biosciences). Two intraperitoneal injections of 400ng pertussis toxin (Biological Laboratories) were given 0 and 48h later. Clinical scores (0\u0026thinsp;=\u0026thinsp;healthy, 0.5\u0026thinsp;=\u0026thinsp;tail shows slight limpness, 1\u0026thinsp;=\u0026thinsp;flaccid tail, 1.5\u0026thinsp;=\u0026thinsp;weak hind limbs, 2\u0026thinsp;=\u0026thinsp;ataxia paresis of hind limbs with abnormal gait, 2.2\u0026thinsp;=\u0026thinsp;wedge gait duck walk, 2.3\u0026thinsp;=\u0026thinsp;leg paresis/drag one leg, 2.5\u0026thinsp;=\u0026thinsp;paralysis of one leg, 2.8\u0026thinsp;=\u0026thinsp;drag one leg, paralysis another leg, 3\u0026thinsp;=\u0026thinsp;paralysis of hindlimbs and/or paresis of forelimbs, 3.5\u0026thinsp;=\u0026thinsp;paralysis of hind limbs, paralysis of one front limb, 4\u0026thinsp;=\u0026thinsp;tetra-paralysis, 5\u0026thinsp;=\u0026thinsp;moribund or death) were recorded daily as described previously\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. The aggregate EAE clinical score was the sum of daily clinical scores for each individual mouse during the observation period.\u003c/p\u003e\n\u003ch3\u003eImmunohistochemistry (IHC)\u003c/h3\u003e\n\u003cp\u003eMice were deeply anesthetized with ketamine and xylazine cocktail by intraperitoneal injection and perfused through the left cardiac ventricle with PBS (in 0.4 mg/ml heparin) followed by 10% buffered formalin phosphate. Half sagittal brain and the cephalic half of the lumbar spinal cord (SC; L1\u0026ndash;L3) were postfixed in 10% buffered formalin phosphate for 2h, cryoprotected in 30% sucrose for 48h, embedded in optimum cutting temperature compound, and frozen on dry ice. Frozen sections were cut using a cryostat at a thickness of 16\u0026micro;m. The other half sagittal brain and the caudal half of the lumbar SC (L3\u0026ndash;L5) were postfixed in 10% buffered formalin phosphate for 72h, dehydrated through graded alcohols, and embedded in paraffin wax. Paraffin sections were cut using a microtome to a thickness of 5\u0026micro;m. For immunofluorescence, the frozen sections were treated with \u0026minus;\u0026thinsp;20\u0026deg;C acetone and paraffin section were deparaffinized by treating with xylene and hydrated. The samples were then blocked with PBS containing 10% goat/horse serum and 0.1% Triton X-100, and incubated overnight with the primary antibody diluted in blocking solution.\u003c/p\u003e \u003cp\u003eWe used the following primary and secondary antibodies for immunohistochemical detection: CC1 (APC7, 1:50; Millipore, RRID:AB_2057371), myelin basic protein (MBP,1:1000; BioLegend, RRID:AB_2616694), CD3 (1:50; BioLegend, RRID:AB_312658), NeuN (1:500; Abcam, RRID:AB_10711040), glial fibrillary acidic protein (GFAP; 1:200; Agilent Technologies, RRID:AB_10013382), Iba1 (1:200; FUJIFILM Wako\u0026rsquo;s, RRID:AB_839504), and Neurofilament H (NF-H) (1:200; BioLegend, RRID:AB_32715852). Fluorescein (1:200, Thermo Fisher Scientific, anti-rabbit, RRID:AB_2534088; anti-mouse, RRID:AB_2576217), Cy3 (1:200, Jackson ImmunoResearch Labs, anti-rabbit, RRID:AB_2338006), or enzyme-labeled secondary antibodies (1:200, Vector Laboratories, anti-mouse/rabbit, RRID:AB_2336826). Finally, sections were mounted in ProLong Gold Antifade with 4\u0026prime;,6- diamidino-2-phenylindole (DAPI) to visualize nuclei (Thermo Fisher Scientific) for immunofluorescence and in toluene for 3,3'-Diaminobenzidine (DAB) (Vactor laboratories) staining. Immunofluorescence images were acquired on a Leica Stellaris 8 microscope equipped with a Leica HC PLAN APO 63X objective and stitched together with LASX software (Leica) and DAB images were acquired on a Zeiss Axioskop II to allow visualization of the lumbar SC. To quantify cells and axons in the white matter of lumbar spinal cord, we counted immune-positive cells or axons in an area of 0.1mm\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e within the anterior funiculus medially next to the anterior median fissure in the lumbar SC as described previously\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. Demyelination and number of cells were quantified using Fiji software. To analyze the cell body of Iba1\u003csup\u003e+\u003c/sup\u003e cells we counted both hypertrophic and amoeboid cells using Halo software.\u003c/p\u003e\n\u003ch3\u003eRT-qPCR\u003c/h3\u003e\n\u003cp\u003eThe lumbar spinal cord from each mouse was homogenized in 500\u0026micro;L TRIzol Reagent (Thermo Fisher Scientific, 15596026). RNA isolation was done per the manufacturer\u0026rsquo;s instructions\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. cDNA was synthesized in duplicate using 500ng RNA in 10\u0026micro;L iScript Advanced cDNA Synthesis Kit (Bio-Rad, 172\u0026ndash;5038). Reactions were diluted 1:5 with water. RT-qPCR was done using 2\u0026micro;L diluted cDNA in 10\u0026micro;L Roche Probes Master (04707494001) reactions on a Roche 480 Lightcycler. Target gene and reference gene reactions were amplified in separate wells under cycling conditions of 95\u0026deg;C for 10s, 60\u0026deg;C for 10s for 35 cycles. Cq (quantitation cycle) values were determined using the Roche second derivative maximum calculation. Relative quantification was done using standard 2\u003csup\u003eΔΔCq\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePrimers used include GFAP forward (5\u0026rsquo;-AGTTGCAGTCCTTGACCTG-3\u0026rsquo;) and GFAP reverse (5\u0026rsquo;-CAGCGCCTCCTGATAACTG-3\u0026rsquo;); C3 forward (5\u0026rsquo;-CCTTCCACCTTTTTCCTTCACT-3\u0026rsquo;) and C3 reverse (5\u0026rsquo;-CTCCAGCCGTAGGACATTG-3\u0026rsquo;); Clcf1 forward (5\u0026rsquo;-CCATCCAGAAAACCTATGACCT-3\u0026rsquo;) and Clcf1 reverse (5\u0026rsquo;-GATTGAAGTCAGGCTCGTTGA-3\u0026rsquo;); Slc1a2 forward (5\u0026rsquo;-CCATGCTCCTCATTCTCACAG-3\u0026rsquo;) and Slc1a2 reverse (5\u0026rsquo;-AAAGAATCGCCCACCACAT-3\u0026rsquo;); TNFα forward (5\u0026rsquo;-TTGGTCTGATTGTTGGAGTGA-3\u0026rsquo;) and TNFα reverse (5\u0026rsquo;-CTTGGCATCTCTTTGTTAGGCA-3\u0026rsquo;) with probe (5\u0026rsquo;-/56-FAM/ TGCTGATGT/ZEN/TAGGACTGGTGAACTGC/3IABkFQ/-3\u0026rsquo;); INFγ forward (5\u0026rsquo;-AGTAGTTATCCTGGTATTTGCGT-3\u0026rsquo;) and reverse (5\u0026rsquo;-TTGTCTCTAACGTGGCACTT-3\u0026rsquo;) with probe (5\u0026rsquo;-/56-FAM/AATGTTACC/ZEN/TAAGTCCTTGCTCTCTGTGG /3IABkFQ/-3\u0026rsquo;); IL-17 forward (5\u0026rsquo;-GCTGCCTAAATGACTGTTTGAG-3\u0026rsquo;) and IL-17 reverse (5\u0026rsquo;-AGAATGGCGATGAGTGTGATG-3\u0026rsquo;) with probe (5\u0026rsquo;-/56-FAM/ CTGGCTTGG/ZEN/GAACTGTGGTATTTGAGA/3IABkFQ/-3\u0026rsquo;); iNOS forward (5\u0026rsquo;-GATCCAGTGGTCCAACCTG-3\u0026rsquo;) and iNOS reverse (5\u0026rsquo;-GACCTGATGTTGCCATTGTTG-3\u0026rsquo;) with probe (5\u0026rsquo;-/56-FAM/CAGATGTGC/ZEN /TGAAACATTTCCTGTGCT/3IABkFQ/-3\u0026rsquo;); IL-10 forward (5\u0026rsquo;-CGGAGACTACACTGTGAGAGT-3\u0026rsquo;) and IL-10 reverse (5\u0026rsquo;-GGATTCTATCTGCATCTCAGGAG-3\u0026rsquo;) with probe (5\u0026rsquo;-/56-FAM/CCCCGTGGA/ZEN/ AGACACCATCATTGG/3IABkFQ/-3\u0026rsquo;).\u003c/p\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistics tests were performed in GraphPad Prism version 10.0 (GraphPad Software). Unless indicated otherwise, values are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM). Areas of Iba1\u003csup\u003e+\u003c/sup\u003e cell bodies were calculated using Halo 4.0 (Indica Labs). Statistical differences between the groups were compared using one-way ANOVA or two-way ANOVA with Tukey\u0026rsquo;s multiple comparison test for multiple groups. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eExpression of ATXN1 with an expanded polyQ tract does not affect viability and function of spinal cord oligodendrocytes, astrocytes, and motor neurons\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSpinocerebellar ataxia type 1 (SCA1) is caused by expansion of glutamine(Q) encoding CAG repeats in \u003cem\u003eATXN1\u003c/em\u003e that results in a toxic gain of ATXN1 function\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. We first examined whether cells involved in MS are altered in untreated \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/2Q\u003c/em\u003e\u003c/sup\u003e (WT) mice, \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e (\u003cem\u003eAtxn1\u003c/em\u003e heterozygous knock-in) mice, and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e (\u003cem\u003eAtxn1\u003c/em\u003e heterozygous knock-out) mice on a C57BL/6J background. To characterize the mice, we collected the lumbar spinal cord at 8 weeks of age. The spinal cord, more specifically the lumbar spinal cord, is a critical region for EAE mediated lesion\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. We performed DAB staining with CC1, an antibody marker for oligodendrocytes, and found comparable numbers of oligodendrocytes in the white matter of lumbar spinal cord of WT, \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e, and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, B, C, D). Immunostaining for GFAP (a marker for astrocytes) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, F, G, H) and NeuN (a marker for motor neurons) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eI, J, K, L) didn\u0026rsquo;t show any differences in their numbers in the white matter and grey matter respectively among all the three groups of mice. DAB staining of myelin basic protein (MBP), showed similar degree of myelination in the white matter of lumbar spinal cord (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eM, N, O, P), in the cerebellum and brain stem (Supplementary Fig.\u0026nbsp;1A, B, C) and in the corpus callosum (Supplementary Fig.\u0026nbsp;1D, E, F). Taken together, these data indicate that neither ATXN1 loss nor ATXN1 with an expanded polyQ impacts neuronal and glial viability, gliosis or myelination in the lumbar spinal cord of 8-week-old mice under normal physiological conditions.\u003c/p\u003e\n\u003ch3\u003eATXN1 loss-of-function exacerbates EAE disease severity\u003c/h3\u003e\n\u003cp\u003eTo examine the role of ATXN1 in EAE, we immunized 8-week-old WT, \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e, and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e female mice, with myelin oligodendrocyte glycoprotein (MOG) peptide 35 to 55 (MOG\u003csub\u003e35\u0026ndash;55\u003c/sub\u003e) to induce experimental autoimmune encephalomyelitis (EAE). While all the mice showed impairments consistent with EAE, \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice had greater clinical scores compared to WT controls indicating exacerbated disease severity (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Importantly, compared to WT littermates \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice also had impaired recovery (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Although there were no differences in the onset and early disease progression, \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice exhibited a higher peak score (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB) and higher mean aggregate score (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC) than WT mice. Disease recovery from peak (PID-16) to remission (PID-30) was attenuated in \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice when compared to WT mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). We observed no differences in disease onset, disease progression, and remission between \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, B, C), indicating that \u003cem\u003eATXN1\u003c/em\u003e genetic modification by polyQ expansion and by knock-out has similar effects on EAE disease course.\u003c/p\u003e\n\u003ch3\u003eATXN1 loss-of-function enhances oligodendrocyte loss and demyelination during EAE\u003c/h3\u003e\n\u003cp\u003ePrevious studies show that loss of PERK signaling in oligodendrocytes increases susceptibility to inflammation, resulting in exacerbation of demyelination in EAE\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Additionally, ATF6α deficiencies linked to exacerbated oligodendrocyte loss during EAE, highlighting the importance of specific signaling pathways in maintaining oligodendrocyte viability and myelin integrity\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Furthermore, demyelination and oligodendrocyte loss are features of EAE lesions\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Inflammatory demyelination induces axonal injury and neuronal apoptosis, emphasizing the interconnection of these processes in neuroinflammatory conditions\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. To assess how ATXN1 loss impacts oligodendrocyte number and demyelination, 8-week-old mice were immunized with MOG\u003csub\u003e35\u0026ndash;55\u003c/sub\u003e and tissues collected from lumbar spinal cord at PID-14 and PID-30 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). DAB staining of CC1 revealed that few oligodendrocytes remained in the lesions of lumbar spinal cord of each genotype, whereas \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice showed significantly higher reductions in oligodendrocyte numbers compared to WT mice at peak disease progression at PID-14 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, C, D, N). During the disease remission period at PID-30, the numbers of newly generated oligodendrocytes were reduced in the lumbar spinal cord of \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice compared to WT mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, F, G, N). Furthermore, quantitative analysis of MBP IHC showed around 50% of the white matter of lumbar spinal cord of \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice was demyelinated at PID-14 which was significantly higher than in WT mice (\u0026lt;\u0026thinsp;35%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH, I, J, O). Despite remyelination in the recovery period at PID-30, the demyelinated area continued to be higher in the white matter of lumbar spinal cord of \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice than WT mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eK, L, M, O). Interestingly, there were no differences in oligodendrocyte loss and the degree of demyelination between \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice at PID-14 and PID-30 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eN, O).\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eATXN1 deficiency promotes axonal degeneration during EAE\u003c/h2\u003e \u003cp\u003eAxonal degeneration is a critical aspect of neurological deficits in autoimmune conditions such as EAE and MS. Studies show that axonal degeneration contributes significantly to the development of non-remitting neurological deficits and disability in MS\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Axonal degeneration within spinal cord lesions of EAE animals has been well characterized\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Furthermore, axonal degeneration is associated with the development of neurological disability in MS and EAE\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Therefore, we performed immunofluorescence staining of the non-phosphorylated neurofilament-H (NF-H, previously identified as SMI-32), a marker for degenerating axons, in the lumbar spinal cord of each genotype of na\u0026iuml;ve 8-week-old mice, PID-14, and PID-30. As expected, no degenerating axons were seen in the white matter of lumbar spinal cord in 8-week-old under normal conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B, C, J). There was substantial axonal degeneration in the white matter of lumbar spinal cord at PID-14 and the number of degenerating axons was significantly higher in \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice than WT mice. We found no differences in the number of degenerating axons between \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD, E, F, J). With recovery the number of degenerating axons was greatly reduced in the white matter of lumbar spinal cord of WT mice, but significantly less so in \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice. The number of degenerating axons was comparable in \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice at PID-30 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG, H, I, J). These data suggest that the normal function of ATXN1 supports axonal survivability upon EAE challenges.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eMutant ATXN1-mediated activation of astrocytes plays a dual role during EAE\u003c/h2\u003e \u003cp\u003eReactive astrocytes play a crucial role in the pathophysiology of EAE and respond to insults by undergoing a process known as reactive astrogliosis, which involves activation, hypertrophy, and proliferation\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Reactive astrocytes can have both beneficial and detrimental effects in EAE. As reactive astrocytes may serve to protect the CNS from injury by releasing growth factors\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e, inhibition of reactive astrogliosis can lead to more severe inflammation and clinical symptoms\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. Immunofluorescence staining of GFAP revealed a reduced number of reactive astrocytes in the white matter of lumbar spinal cord at the time of severe disease progression at PID-14 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, B, C, G) and increased number of reactive astrocytes at the time of remission at PID-30 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD, E, F, G) in \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e2Q/\u0026minus;\u003c/sup\u003e mice compared to WT mice. Quantitative analysis showed that the severe inflammation during EAE has a similar effect on the number of reactive astrocytes between \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG). We performed RT-qPCR to investigate whether the astrocytes are A1 neurotoxic (\u003cem\u003eC3\u003c/em\u003e) or A2 neuroprotective (\u003cem\u003eClcf1\u003c/em\u003e and \u003cem\u003eSlc1a2\u003c/em\u003e). The \u003cem\u003eGFAP\u003c/em\u003e mRNA level was significantly reduced in \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice compared to WT mice at PID-14 but no significant differences were detected at PID-30 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH, I). The expression of \u003cem\u003eC3\u003c/em\u003e was higher in \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice than in WT mice at PID-14 but unchanged at PID-30 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH, I). No significant changes were observed in the expression of A2 markers \u003cem\u003eClcf1\u003c/em\u003e and \u003cem\u003eSlc1a2\u003c/em\u003e among the three groups of mice at either PID-14 or PID-30 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH, I). These data reveal that the loss of ATXN1 activates neurotoxic astrocytes at PID-14 of EAE. In contrast, astrocytes no longer show signs of activation at PID-30 of EAE.\u003c/p\u003e \u003cp\u003e \u003cb\u003eElevated numbers of infiltrated T cells and macrophages/microglia in the lesions of the lumbar spinal cord (white matter) upon EAE\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe initiation of EAE is characterized by the peripheral formation of myelin-reactive encephalitogenic T lymphocytes that migrate to the CNS, where they trigger neuroinflammation in collaboration with microglia and infiltrated macrophages\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. The intricate balance between effector T cells and regulatory T cell subsets influences the development and progression of EAE, highlighting the complexity of T cell responses in autoimmune demyelinating diseases. To assess the number of infiltrated T cells in the lesions of lumbar spinal cord upon EAE, we performed DAB staining of CD3 (a marker for T cells) at PID-14 and PID-30. Higher numbers of activated T cells and a cluster of activated T cells were seen at PID-14 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, B, C, M) as well as at PID-30 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD, E. F, M) in the lumbar spinal cord of \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice than WT mice.\u003c/p\u003e \u003cp\u003eDAB staining of Iba1 (a macrophages/microglia marker) showed significantly higher numbers of macrophages/microglia at the inflammatory lesion in the lumbar spinal cord of \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice compared to WT mice at PID-14 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG, H, I, N) and PID-30 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eJ, K, L, N). To determine morphological changes of macrophages/microglia we further analyzed the DAB staining of Iba1 by parametric approach (Supplementary Fig.\u0026nbsp;2). Morphology analysis showed the higher number of hypertrophic and/or amoeboid macrophages/microglia in the lumbar spinal cord of \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice compared to WT mice at PID-14 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG, H, I, O) and PID-30 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eJ, K, L, O). A significantly higher number of hypertrophic and/or amoeboid macrophages/microglia were observed at PID-14, but their numbers were comparable between the \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice at PID-30 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG, H, I, O). The elevated expression of hypertrophic and/or amoeboid macrophages/microglia at PID-14 in the lumbar spinal cord of \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e mice compared to \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice may be due to expanded polyQ mediated activation. These results indicate that loss of ATXN1 exacerbates immune activation in EAE.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAltered immune cytokine gene expression in the lumbar spinal cord in response to inflammation during EAE\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe expression of various cytokines during EAE reflects the complex interplay between pro-inflammatory and anti-inflammatory responses that dictate disease progression and severity. RT-qPCR analysis showed higher expression of \u003cem\u003eTNFα\u003c/em\u003e and \u003cem\u003eIFNγ\u003c/em\u003e in the lumbar spinal cord of \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice compared to WT mice at PID-14 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). No significant differences in the expression of \u003cem\u003eTNFα\u003c/em\u003e and \u003cem\u003eIFNγ\u003c/em\u003e were seen in the chronic phase of the EAE at PID-30 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). Similarly, no changes in \u003cem\u003eIL-17\u003c/em\u003e and \u003cem\u003eIL-10\u003c/em\u003e levels were observed among all three groups of mice at PID-14 and PID-30 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, B). Previous research showed that the role of \u003cem\u003eiNOS\u003c/em\u003e may shift, potentially influencing the resolution of inflammation and tissue repair processes in chronic phases\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e,\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Consistent with this, our RT-qPCR showed the lower levels of \u003cem\u003eiNOS\u003c/em\u003e in lumbar spinal cord of \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e compared to WT control at PID-30 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB), but no significant differences at PID-14 among these three groups of mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). Taken together, these data indicate that mutant ATXN1 alters inflammation in the CNS of mice during EAE more specifically in the acute phase of the disease.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eGenome-wide genomic screens link the \u003cem\u003eATXN1\u003c/em\u003e locus with an increased risk of developing MS\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. In the present study, using two different genetic modifications of \u003cem\u003eAtxn1\u003c/em\u003e in mice, we demonstrated that haploinsufficiency of \u003cem\u003eAtxn1\u003c/em\u003e and expansion of the CAG repeat exacerbate clinical EAE symptoms as well as underlying pathology, including axonal degeneration, oligodendrocyte loss and demyelination, and immune activation during acute and chronic phases of the disease progression. Thus, expansion of the polyQ tract in ATXN1 impacts EAE severity through a loss-of-function mechanism. Importantly, neither of these ATXN1 genetic modifications caused cellular loss nor demyelination in the spinal cord of mice in absence of EAE.\u003c/p\u003e \u003cp\u003eATXN1 expression is controlled by hypomethylation at specific genomic sites within the ATXN1 sequence in B cells at clinical onset of the disease\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. This regulation suggests that ATXN1 may enhance B cell function, which is crucial since B cells contribute to the autoimmune response observed in MS. The ability of ATXN1 to modulate B cell activity can influence the production of antibodies and cytokines, thereby affecting the overall inflammatory response in the central nervous system (CNS). Moreover, ATXN1 has been shown to regulate the signaling pathways involved in B cell receptor (BCR) signaling. Ma and Didonna reported that ATXN1 affects the extracellular signal-regulated kinase (ERK) and signal transducer and activator of transcription (STAT) pathways, which are critical for B cell activation and proliferation\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. By fine-tuning these signaling pathways, WT ATXN1 may help maintain a balance between pro-inflammatory and anti-inflammatory responses, potentially mitigating MS severity. Previous studies highlighted that CIC deficiency leads to upregulation of TNF-α in liver macrophages, suggesting that CIC may similarly regulate cytokine expression in other immune contexts, including EAE\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. This regulation is crucial, as TNF-α is known to enhance the activation of T cells and the recruitment of inflammatory cells to the central nervous system (CNS) during EAE\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn the context of MS, ATXN1 was found to regulate B cell function, impacting the severity of autoimmune experimental encephalomyelitis\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. The ablation of ATXN1 in B cells results in aberrant expression of key molecules involved in proinflammatory T cell differentiation, suggesting a role for ATXN1 in modulating immune responses\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Consistent with these observations, our data showed that the disease severity upon EAE is associated with the recruitment of a higher number of activated T cells and macrophage/microglia to the lesion sites. TNFα is known to be upregulated in EAE and contributes significantly to initiation and amplification of the immune response within the CNS. TNFα promotes the recruitment and activation of various immune cells, including macrophages and T cells, which infiltrate the CNS and exacerbate inflammation\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. The presence of TNFα is associated with increased blood-brain barrier permeability, facilitating immune cell entry into the CNS and leading to further tissue damage\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. Similarly, IFNγ plays a crucial role in the pathogenesis of EAE. IFNγ enhances macrophage and microglia activation, leading to increased production of pro-inflammatory cytokines and mediators, including TNFα itself\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. IFNγ is also involved in the differentiation of naive T cells into Th1 cells, thereby perpetuating the inflammatory cycle\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. Research has demonstrated that mice deficient in IFNγ exhibit increased susceptibility to EAE, highlighting its protective role in modulating the immune response\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. Consequently, the elevated production of inflammatory cytokines like TNFα and IFNγ in the CNS during EAE are notable. Although IFNγ and TNFα play important roles in the first attack, they are not major contributors to relapse\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e, which is consistent with our findings.\u003c/p\u003e \u003cp\u003eFurthermore, studies show that mutant ATXN1 mediated activation of astrocytes and microglia at early ages in SCA1 models lead to a pro-inflammatory environment, that may closely relate to neuronal dysfunction and damage\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. Activation of neurotoxic astrocytes at an early stage (PID-14) of disease contributes to increase severity, whereas the absence of neurotoxic astrocytes activation at a later stage (PID-30) presumably allows the initiation of recovery from disease-related damage. The interaction between the activated glial cells and CD3-positive T cells in the cerebellum of SCA1 mice reflects the involvement of T cells in the neuroinflammatory response associated with the disease, indicating a potential link between immune activation and the degeneration of Purkinje cells.\u003c/p\u003e \u003cp\u003eAdditionally, GFAP expressions can differ during early phases and in remitting EAE. GFAP levels were significantly elevated, reflecting broad activation of astrocytes in response to inflammatory cues and tissue damage\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. Studies have also shown reduced levels of GFAP in spinal cord at the acute phase of disease during EAE\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e,\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e which is consistent with our findings. During EAE progression, microglia become activated and release various pro-inflammatory cytokines, including IL-1α and TNF-α, contributing to the synthesis of C3 in astrocytes and enhancing neurotoxic activity\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. A complex interplay between microglia and astrocytes where microglial activity initiates the release of C3 and induces increased expression in neighboring astrocytes, creating a feedback loop that may exacerbate inflammatory responses in EAE. Therefore, severe phagocytic activity of microglia might also contribute to reduced levels of astrocytes (both cells and mRNA) at the acute phase (PID-14) of EAE (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e) in the mutant mice. The increased levels of GFAP at the white matter of lumbar spinal cord, despite similar mRNA levels in the whole lumbar spinal cord at PID-30, may be due to the differential responses of white and grey matter to EAE-induced inflammation.\u003c/p\u003e \u003cp\u003eIntriguingly, we found that loss of ATXN1 caused a reduced number of reactive astrocytes during acute EAE disease progression in \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice while a higher number of reactive astrocytes was present in the white matter of lumbar spinal cord of these mice during remission of the disease. Studies show that depletion of reactive astrocytes during the acute phase is associated with worsening EAE outcomes\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. Reactive astrocytes orchestrate inflammatory responses of resident and peripheral immune cells in the CNS during EAE\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. They can suppress remyelination and contribute to the inflammatory milieu by releasing cytokines and chemokines\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. A common aspect of neurodegenerative disease is neuroinflammation\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. In particular, signs of neuroinflammation are detected in mouse models of SCA3\u003csup\u003e6\u003c/sup\u003e and SCA1\u003csup\u003e49\u003c/sup\u003e. We speculate that a loss-of-function in ATXN1 with an expanded polyQ tract has the ability to dampen immune responses might result in increased neuroinflammation during SCA1 pathogenesis.\u003c/p\u003e \u003cp\u003eIn conclusion, loss-of-function of ATXN1 enhances severity of MS, potentially through its involvement in gene expression regulation, immune responses, and interactions with nuclear transport pathways. Further research into the specific mechanisms by which ATXN1 influences the pathogenesis of MS could provide valuable insights into novel therapeutic targets for this complex autoimmune inflammatory disease.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003e\u003cstrong\u003eAtaxin-1:\u003c/strong\u003e (ATXN1)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSCA1:\u003c/strong\u003e Spinocerebellar ataxia type 1\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEAE:\u003c/strong\u003e Experimental autoimmune encephalomyelitis\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMS:\u0026nbsp;\u003c/strong\u003eMultiple sclerosis\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMOG:\u003c/strong\u003e Myelin oligodendrocyte glycoprotein\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCNS:\u003c/strong\u003e Central nervous system\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePID:\u003c/strong\u003e Post-immunization day\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSC:\u003c/strong\u003e Spinal cord\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMBP:\u003c/strong\u003e Myelin basic protein\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGFAP:\u003c/strong\u003e Glial fibrillary acidic protein\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDAPI:\u0026nbsp;\u003c/strong\u003e4\u0026prime;,6- diamidino-2-phenylindole\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDAB:\u003c/strong\u003e 3,3\u0026apos;-Diaminobenzidine\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRT-qPCR:\u003c/strong\u003e Real-time quantitative polymerase chain reaction\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eC3:\u0026nbsp;\u003c/strong\u003eComplement C3\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClcf1:\u0026nbsp;\u003c/strong\u003eCardiotrophin-like cytokine factor 1\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSlc1a2:\u0026nbsp;\u003c/strong\u003eSolute carrier family 1 member 2\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTNF\u003c/strong\u003e\u003cstrong\u003e\u0026alpha;:\u003c/strong\u003e Tumor necrosis factor alpha\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIFN\u0026gamma;:\u003c/strong\u003e Interferon gamma\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eiNOS:\u003c/strong\u003e Inducible nitric oxide synthase\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIL-17:\u003c/strong\u003e Interleukin 17\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIL-10:\u003c/strong\u003e Interleukin 10\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eATF6:\u003c/strong\u003e Activating transcription factor 6\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate:\u003c/strong\u003e Not applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u003c/strong\u003e Not applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material:\u0026nbsp;\u003c/strong\u003eNo datasets were generated or analyzed during the current study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest:\u003c/strong\u003e The authors declare no competing financial interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThe study was supported by NIH grant R35NS127248 (H.T.O.).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor\u0026rsquo;s contribution:\u003c/strong\u003e GT and HTO designed the study, GT, LD, and PY performed research experiments, GT, GJF, and LD analyzed data, GT, MC, and HTO wrote the manuscript, HTO, MC, BO, and LD edited the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgement:\u003c/strong\u003e The authors thank Orion Rainwater, Shannah Serres, and Joyce Meints for their support to accomplish the study. The authors thank Laura Berg for editing the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKlement IA, Skinner PJ, Kaytor MD, et al. Ataxin-1 Nuclear Localization and Aggregation: Role in Polyglutamine-Induced Disease in SCA1 Transgenic Mice.\u003c/li\u003e\n\u003cli\u003eOrr HT, Chung M yi, Banfi S, et al. Expansion of an unstable trinucleotide CAG repeat in spinocerebellar ataxia type 1. \u003cem\u003eNat Genet\u003c/em\u003e. 1993;4(3):221-226. doi:10.1038/ng0793-221\u003c/li\u003e\n\u003cli\u003eGlobas C, Du Montcel ST, Baliko L, et al. Early symptoms in spinocerebellar ataxia type 1, 2, 3, and 6. \u003cem\u003eMovement Disorders\u003c/em\u003e. 2008;23(15):2232-2238. doi:10.1002/mds.22288\u003c/li\u003e\n\u003cli\u003eGuzman-Martinez L, Maccioni RB, Andrade V, Navarrete LP, Pastor MG, Ramos-Escobar N. Neuroinflammation as a Common Feature of Neurodegenerative Disorders. \u003cem\u003eFront Pharmacol\u003c/em\u003e. 2019;10:1008. doi:10.3389/fphar.2019.01008\u003c/li\u003e\n\u003cli\u003eCvetanovic M, Ingram M, Orr H, Opal P. Early activation of microglia and astrocytes in mouse models of spinocerebellar ataxia type 1. \u003cem\u003eNeuroscience\u003c/em\u003e. 2015;289:289-299. doi:10.1016/j.neuroscience.2015.01.003\u003c/li\u003e\n\u003cli\u003eChiu YJ, Lin SA, Chen WL, et al. Pathomechanism characterization and potential therapeutics identification for SCA3 targeting neuroinflammation. \u003cem\u003eAging\u003c/em\u003e. 2020;12(23):23619-23646. doi:10.18632/aging.103700\u003c/li\u003e\n\u003cli\u003eDidonna A, Canto Puig E, Ma Q, et al. Ataxin-1 regulates B cell function and the severity of autoimmune experimental encephalomyelitis. \u003cem\u003eProc Natl Acad Sci USA\u003c/em\u003e. 2020;117(38):23742-23750. doi:10.1073/pnas.2003798117\u003c/li\u003e\n\u003cli\u003eMa Q, Didonna A. The novel multiple sclerosis susceptibility gene ATXN1 regulates B cell receptor signaling in B-1a cells. \u003cem\u003eMol Brain\u003c/em\u003e. 2021;14(1):19. doi:10.1186/s13041-020-00715-0\u003c/li\u003e\n\u003cli\u003eMa Q, Didonna A. Ataxin‐1 controls the expression of specific noncoding RNAs in B cells upon autoimmune demyelination. \u003cem\u003eImmunol Cell Biol\u003c/em\u003e. 2023;101(4):358-367. doi:10.1111/imcb.12622\u003c/li\u003e\n\u003cli\u003eMa Q, Oksenberg JR, Didonna A. Epigenetic control of ataxin‐1 in multiple sclerosis. \u003cem\u003eAnn Clin Transl Neurol\u003c/em\u003e. 2022;9(8):1186-1194. doi:10.1002/acn3.51618\u003c/li\u003e\n\u003cli\u003eTakeuchi H. Midkine and multiple sclerosis. \u003cem\u003eBritish J Pharmacology\u003c/em\u003e. 2014;171(4):931-935. doi:10.1111/bph.12499\u003c/li\u003e\n\u003cli\u003eCalabrese M, Atzori M, Bernardi V, et al. Cortical atrophy is relevant in multiple sclerosis at clinical onset. \u003cem\u003eJ Neurol\u003c/em\u003e. 2007;254(9):1212-1220. doi:10.1007/s00415-006-0503-6\u003c/li\u003e\n\u003cli\u003eMeyer R, Weissert R, Diem R, et al. Acute Neuronal Apoptosis in a Rat Model of Multiple Sclerosis. \u003cem\u003eJ Neurosci\u003c/em\u003e. 2001;21(16):6214-6220. doi:10.1523/JNEUROSCI.21-16-06214.2001\u003c/li\u003e\n\u003cli\u003eBross M, Hackett M, Bernitsas E. Approved and Emerging Disease Modifying Therapies on Neurodegeneration in Multiple Sclerosis. \u003cem\u003eIJMS\u003c/em\u003e. 2020;21(12):4312. doi:10.3390/ijms21124312\u003c/li\u003e\n\u003cli\u003eLucchinetti CF, Popescu BFG, Bunyan RF, et al. Inflammatory Cortical Demyelination in Early Multiple Sclerosis. \u003cem\u003eN Engl J Med\u003c/em\u003e. 2011;365(23):2188-2197. doi:10.1056/NEJMoa1100648\u003c/li\u003e\n\u003cli\u003eLassmann H. New concepts on progressive multiple sclerosis. \u003cem\u003eCurr Neurol Neurosci Rep\u003c/em\u003e. 2007;7(3):239-244. doi:10.1007/s11910-007-0036-0\u003c/li\u003e\n\u003cli\u003eLycke JN, Karlsson JE, Andersen O, Rosengren LE. Neurofilament protein in cerebrospinal fluid: a potential marker of activity in multiple sclerosis. \u003cem\u003eJournal of Neurology, Neurosurgery \u0026amp; Psychiatry\u003c/em\u003e. 1998;64(3):402-404. doi:10.1136/jnnp.64.3.402\u003c/li\u003e\n\u003cli\u003eSenol AD, Pinto G, Beau M, et al. Alterations of the axon initial segment in multiple sclerosis grey matter. \u003cem\u003eBrain Communications\u003c/em\u003e. 2022;4(6):fcac284. doi:10.1093/braincomms/fcac284\u003c/li\u003e\n\u003cli\u003eDuvick L, Southern WM, Benzow KA, et al. Mapping SCA1 regional vulnerabilities reveals neural and skeletal muscle contributions to disease. \u003cem\u003eJCI Insight\u003c/em\u003e. 2024;9(9):e176057. doi:10.1172/jci.insight.176057\u003c/li\u003e\n\u003cli\u003eMatilla A, Roberson ED, Banfi S, et al. Mice Lacking Ataxin-1 Display Learning Deficits and Decreased Hippocampal Paired-Pulse Facilitation. \u003cem\u003eJ Neurosci\u003c/em\u003e. 1998;18(14):5508-5516. doi:10.1523/JNEUROSCI.18-14-05508.1998\u003c/li\u003e\n\u003cli\u003eStone S, Wu S, Jamison S, Durose W, Pallais JP, Lin W. Activating transcription factor 6\u0026alpha; deficiency exacerbates oligodendrocyte death and myelin damage in immune‐mediated demyelinating diseases. \u003cem\u003eGlia\u003c/em\u003e. 2018;66(7):1331-1345. doi:10.1002/glia.23307\u003c/li\u003e\n\u003cli\u003eLei Z, Yue Y, Stone S, Wu S, Lin W. NF-\u0026kappa;B Activation Accounts for the Cytoprotective Effects of PERK Activation on Oligodendrocytes during EAE. \u003cem\u003eJ Neurosci\u003c/em\u003e. 2020;40(33):6444-6456. doi:10.1523/JNEUROSCI.1156-20.2020\u003c/li\u003e\n\u003cli\u003eZoghbi HY, Orr HT. Pathogenic Mechanisms of a Polyglutamine-mediated Neurodegenerative Disease, Spinocerebellar Ataxia Type 1. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e. 2009;284(12):7425-7429. doi:10.1074/jbc.R800041200\u003c/li\u003e\n\u003cli\u003eLiu H, Jin H, Yue X, et al. PET Imaging Study of S1PR1 Expression in a Rat Model of Multiple Sclerosis. \u003cem\u003eMol Imaging Biol\u003c/em\u003e. 2016;18(5):724-732. doi:10.1007/s11307-016-0944-y\u003c/li\u003e\n\u003cli\u003eHussien Y, Cavener DR, Popko B. Genetic inactivation of PERK signaling in mouse oligodendrocytes: Normal developmental myelination with increased susceptibility to inflammatory demyelination: Oligodendrocyte-Specific PERK Inactivation. \u003cem\u003eGlia\u003c/em\u003e. 2014;62(5):680-691. doi:10.1002/glia.22634\u003c/li\u003e\n\u003cli\u003eHou B, Yin J, Liu S, et al. Inhibiting the NLRP3 Inflammasome with MCC950 Alleviates Neurological Impairment in the Brain of EAE Mice. \u003cem\u003eMol Neurobiol\u003c/em\u003e. 2024;61(3):1318-1330. doi:10.1007/s12035-023-03618-y\u003c/li\u003e\n\u003cli\u003eShindler KS, Ventura E, Dutt M, Rostami A. Inflammatory demyelination induces axonal injury and retinal ganglion cell apoptosis in experimental optic neuritis. \u003cem\u003eExperimental Eye Research\u003c/em\u003e. 2008;87(3):208-213. doi:10.1016/j.exer.2008.05.017\u003c/li\u003e\n\u003cli\u003eCraner MJ. Co-localization of sodium channel Nav1.6 and the sodium-calcium exchanger at sites of axonal injury in the spinal cord in EAE. \u003cem\u003eBrain\u003c/em\u003e. 2004;127(2):294-303. doi:10.1093/brain/awh032\u003c/li\u003e\n\u003cli\u003eLo AC, Saab CY, Black JA, Waxman SG. Phenytoin Protects Spinal Cord Axons and Preserves Axonal Conduction and Neurological Function in a Model of Neuroinflammation In Vivo. \u003cem\u003eJournal of Neurophysiology\u003c/em\u003e. 2003;90(5):3566-3571. doi:10.1152/jn.00434.2003\u003c/li\u003e\n\u003cli\u003eBrambilla R, Morton PD, Ashbaugh JJ, Karmally S, Lambertsen KL, Bethea JR. Astrocytes play a key role in EAE pathophysiology by orchestrating in the CNS the inflammatory response of resident and peripheral immune cells and by suppressing remyelination. \u003cem\u003eGlia\u003c/em\u003e. 2014;62(3):452-467. doi:10.1002/glia.22616\u003c/li\u003e\n\u003cli\u003eGiraud SN, Caron CM, Pham-Dinh D, Kitabgi P, Nicot AB. Estradiol inhibits ongoing autoimmune neuroinflammation and NF\u0026kappa;B-dependent CCL2 expression in reactive astrocytes. \u003cem\u003eProc Natl Acad Sci USA\u003c/em\u003e. 2010;107(18):8416-8421. doi:10.1073/pnas.0910627107\u003c/li\u003e\n\u003cli\u003eWang X, Haroon F, Karray S, Martina Deckert, Schl\u0026uuml;ter D. Astrocytic F as ligand expression is required to induce T ‐cell apoptosis and recovery from experimental autoimmune encephalomyelitis. \u003cem\u003eEur J Immunol\u003c/em\u003e. 2013;43(1):115-124. doi:10.1002/eji.201242679\u003c/li\u003e\n\u003cli\u003eHao W, Decker Y, Schn\u0026ouml;der L, et al. Deficiency of I\u0026kappa;B Kinase \u0026beta; in Myeloid Cells Reduces Severity of Experimental Autoimmune Encephalomyelitis. \u003cem\u003eThe American Journal of Pathology\u003c/em\u003e. 2016;186(5):1245-1257. doi:10.1016/j.ajpath.2016.01.004\u003c/li\u003e\n\u003cli\u003eSonar SA, Lal G. The iNOS Activity During an Immune Response Controls the CNS Pathology in Experimental Autoimmune Encephalomyelitis. \u003cem\u003eFront Immunol\u003c/em\u003e. 2019;10:710. doi:10.3389/fimmu.2019.00710\u003c/li\u003e\n\u003cli\u003eWarnecke A, Musunuri S, N\u0026rsquo;diaye M, et al. Nitration of MOG diminishes its encephalitogenicity depending on MHC haplotype. \u003cem\u003eJournal of Neuroimmunology\u003c/em\u003e. 2017;303:1-12. doi:10.1016/j.jneuroim.2016.11.008\u003c/li\u003e\n\u003cli\u003eKim E, Park S, Choi N, et al. Deficiency of Capicua disrupts bile acid homeostasis. \u003cem\u003eSci Rep\u003c/em\u003e. 2015;5(1):8272. doi:10.1038/srep08272\u003c/li\u003e\n\u003cli\u003eJahan‐Abad AJ, Karima S, Shateri S, et al. Serum pro‐inflammatory and anti‐inflammatory cytokines and the pathogenesis of experimental autoimmune encephalomyelitis. \u003cem\u003eNeuropathology\u003c/em\u003e. 2020;40(1):84-92. doi:10.1111/neup.12612\u003c/li\u003e\n\u003cli\u003eKemp K, Gordon D, Wraith DC, et al. Fusion between human mesenchymal stem cells and rodent cerebellar Purkinje cells. \u003cem\u003eNeuropathology and Applied Neurobiology\u003c/em\u003e. 2011;37(2):166-178. doi:10.1111/j.1365-2990.2010.01122.x\u003c/li\u003e\n\u003cli\u003eValentin-Torres A, Savarin C, Hinton DR, Phares TW, Bergmann CC, Stohlman SA. Sustained TNF production by central nervous system infiltrating macrophages promotes progressive autoimmune encephalomyelitis. \u003cem\u003eJ Neuroinflammation\u003c/em\u003e. 2016;13(1):46. doi:10.1186/s12974-016-0513-y\u003c/li\u003e\n\u003cli\u003eKemp K, Gray E, Mallam E, Scolding N, Wilkins A. Inflammatory Cytokine Induced Regulation of Superoxide Dismutase 3 Expression by Human Mesenchymal Stem Cells. \u003cem\u003eStem Cell Rev and Rep\u003c/em\u003e. 2010;6(4):548-559. doi:10.1007/s12015-010-9178-6\u003c/li\u003e\n\u003cli\u003eHou Y, Ryu CH, Park KY, Kim SM, Jeong CH, Jeun SS. Effective combination of human bone marrow mesenchymal stem cells and minocycline in experimental autoimmune encephalomyelitis mice. \u003cem\u003eStem Cell Res Ther\u003c/em\u003e. 2013;4(4):77. doi:10.1186/scrt228\u003c/li\u003e\n\u003cli\u003eHidaka Y, Inaba Y, Matsuda K, et al. Cytokine production profiles in chronic relapsing\u0026ndash;remitting experimental autoimmune encephalomyelitis: IFN-\u0026gamma; and TNF-\u0026alpha; are important participants in the first attack but not in the relapse. \u003cem\u003eJournal of the Neurological Sciences\u003c/em\u003e. 2014;340(1-2):117-122. doi:10.1016/j.jns.2014.02.039\u003c/li\u003e\n\u003cli\u003eRosa JG, Hamel K, Sheeler C, et al. Spatial and Temporal Diversity of Astrocyte Phenotypes in Spinocerebellar Ataxia Type 1 Mice. \u003cem\u003eCells\u003c/em\u003e. 2022;11(20):3323. doi:10.3390/cells11203323\u003c/li\u003e\n\u003cli\u003eJukkola P, Guerrero T, Gray V, Gu C. Astrocytes differentially respond to inflammatory autoimmune insults and imbalances of neural activity. \u003cem\u003eacta neuropathol commun\u003c/em\u003e. 2013;1(1):70. doi:10.1186/2051-5960-1-70\u003c/li\u003e\n\u003cli\u003eRemlinger J, Bagnoud M, Meli I, et al. Modelling MOG antibody-associated disorder and neuromyelitis optica spectrum disorder in animal models: Spinal cord manifestations. \u003cem\u003eMultiple Sclerosis and Related Disorders\u003c/em\u003e. 2023;78:104892. doi:10.1016/j.msard.2023.104892\u003c/li\u003e\n\u003cli\u003eVoskuhl RR, Peterson RS, Song B, et al. Reactive Astrocytes Form Scar-Like Perivascular Barriers to Leukocytes during Adaptive Immune Inflammation of the CNS. \u003cem\u003eJ Neurosci\u003c/em\u003e. 2009;29(37):11511-11522. doi:10.1523/JNEUROSCI.1514-09.2009\u003c/li\u003e\n\u003cli\u003eYadav SK, Ito N, Soin D, Ito K, Dhib-Jalbut S. Dimethyl Fumarate Suppresses Demyelination and Axonal Loss through Reduction in Pro-Inflammatory Macrophage-Induced Reactive Astrocytes and Complement C3 Deposition. \u003cem\u003eJCM\u003c/em\u003e. 2021;10(4):857. doi:10.3390/jcm10040857\u003c/li\u003e\n\u003cli\u003eMayo L, Trauger SA, Blain M, et al. Regulation of astrocyte activation by glycolipids drives chronic CNS inflammation. \u003cem\u003eNat Med\u003c/em\u003e. 2014;20(10):1147-1156. doi:10.1038/nm.3681\u003c/li\u003e\n\u003cli\u003eQu W, Johnson A, Kim JH, Lukowicz A, Svedberg D, Cvetanovic M. Inhibition of colony-stimulating factor 1 receptor early in disease ameliorates motor deficits in SCA1 mice. \u003cem\u003eJ Neuroinflammation\u003c/em\u003e. 2017;14(1):107. doi:10.1186/s12974-017-0880-z\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"journal-of-neuroinflammation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jneu","sideBox":"Learn more about [Journal of Neuroinflammation](http://jneuroinflammation.biomedcentral.com)","snPcode":"12974","submissionUrl":"https://submission.nature.com/new-submission/12974/3","title":"Journal of Neuroinflammation","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"ATAXIN1, Multiple sclerosis, autoimmune, demyelination, EAE, SCA1","lastPublishedDoi":"10.21203/rs.3.rs-5664390/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5664390/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground and Objectives\u003c/h2\u003e \u003cp\u003eAtaxin-1 (ATXN1) is a protein in which expansion of its polyglutamine tract causes the neurodegenerative disorder spinocerebellar ataxia type 1 (SCA1) via a gain-of-function. Wild type ATXN1 was recently shown to have a protective role in regulating severity of experimental autoimmune encephalomyelitis (EAE), a well-established mouse model for Multiple sclerosis (MS). This study further investigates the role of ATXN1 with an expanded polyglutamine tract in the context of MS using an EAE mouse model.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eHemizygous \u003cem\u003eAtxn1 (Atxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e) mice or \u003cem\u003ef\u003c/em\u003e-\u003cem\u003eATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e, heterozygous mice that have one copy of the endogenous mouse gene replaced with a polyQ expanded pathogenic human \u003cem\u003eATXN1\u003c/em\u003e gene, were injected with myelin oligodendrocytes glycoprotein (MOG\u003csub\u003e35\u0026thinsp;\u0026minus;\u0026thinsp;55\u003c/sub\u003e) peptide to induce EAE. Immunohistochemical and biochemical approaches were used to analyze the degree of demyelination, cell loss, axonal degeneration as well as detecting the activated immune cells and inflammatory cytokines upon EAE induction in \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003ef\u003c/em\u003e-\u003cem\u003eATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e mice.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eOur findings reveal that a loss-of-function of wild type \u003cem\u003eAtxn1\u003c/em\u003e in \u003cem\u003eAtxn1\u003c/em\u003e\u003csup\u003e\u003cem\u003e2Q/\u0026minus;\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003ef-ATXN1\u003c/em\u003e\u003csup\u003e\u003cem\u003e146Q/2Q\u003c/em\u003e\u003c/sup\u003e mice significantly exacerbates the EAE symptoms, leading to increased demyelination, oligodendrocytes loss, heightened axon degeneration, and greater clinical disability in affected mice. Importantly, the data reveals that neurotoxic astrocytes are activated at acute stage of disease (PID-14) and at the chronic stage of disease (PID-30) neurotoxic astrocytes no longer show signs of activation. The data also demonstrated enhanced infiltration of immune cells into the lesions of mutant mice.\u003c/p\u003e\u003ch2\u003eDiscussion\u003c/h2\u003e \u003cp\u003eThese results indicate that ATXN1 plays a protective role in modulating immune responses and maintaining neural integrity during MS. Importantly, expansion of the polyQ tract in ATXN1 results in a loss-of-function in ATXN1\u0026rsquo;s ability to dampen the immune response. Understanding the functional role of ATXN1 in MS pathogenesis may open new avenues for therapeutic strategies aimed at mitigating disease progression.\u003c/p\u003e","manuscriptTitle":"An expanded polyglutamine in ATAXIN1 results in a loss-of-function that exacerbates severity of Multiple Sclerosis in an EAE mouse model","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-14 15:20:48","doi":"10.21203/rs.3.rs-5664390/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Accepted","date":"2025-04-18T00:52:06+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-14T23:43:53+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"303133037541156933554058399141855995636","date":"2025-04-11T02:57:33+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-11T00:28:28+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"153691625681784902186460935364663196241","date":"2025-04-10T23:59:47+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-10T23:30:43+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-04-10T09:17:42+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Neuroinflammation","date":"2025-04-09T19:11:11+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"journal-of-neuroinflammation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jneu","sideBox":"Learn more about [Journal of Neuroinflammation](http://jneuroinflammation.biomedcentral.com)","snPcode":"12974","submissionUrl":"https://submission.nature.com/new-submission/12974/3","title":"Journal of Neuroinflammation","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"83d77188-baf3-4196-ab04-94f8f7fec867","owner":[],"postedDate":"April 14th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-05-05T15:59:43+00:00","versionOfRecord":{"articleIdentity":"rs-5664390","link":"https://doi.org/10.1186/s12974-025-03450-2","journal":{"identity":"journal-of-neuroinflammation","isVorOnly":false,"title":"Journal of Neuroinflammation"},"publishedOn":"2025-04-30 15:57:15","publishedOnDateReadable":"April 30th, 2025"},"versionCreatedAt":"2025-04-14 15:20:48","video":"","vorDoi":"10.1186/s12974-025-03450-2","vorDoiUrl":"https://doi.org/10.1186/s12974-025-03450-2","workflowStages":[]},"version":"v1","identity":"rs-5664390","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5664390","identity":"rs-5664390","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.