Improving efficacy of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae against Sitophilus zeamais through polyamine application

Improving efficacy of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae against Sitophilus zeamais through polyamine application | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Improving efficacy of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae against Sitophilus zeamais through polyamine application Juan G. Colli-Mull, José Luis Castro-Guillén, Jimena Fonseca-Hernández, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3885326/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 6 You are reading this latest preprint version Abstract Post-harvest pests cause large losses worldwide, threatening the global food security due to the reduction of the quality and quantity of grains. Traditional management strategies are based on the use of chemical pesticides and grain protectants, most of which are toxic not only to pest, but also cause damage to the environment and insect resistance. Biological control strategies based on the use of entomopathogenic fungi offer an eco-friendly alternative to agrochemical products. Besides, strategies combining other compounds and organisms to improve the effectiveness of entomopathogenic fungi has been described. Polyamines are essential molecules present in all organisms, in fungi, their physiological functions include regulation of growth, morphogenesis, and stress tolerance. In the present research, the effect of polyamines on germination, viability, and virulence in entomopathogenic fungi to improve the efficiency of controlling insect pests was studied. Conidia of Beauveria bassiana and Metarhizium anisopliae were treated with putrescine, spermidine, and spermine, and a positive effect was observed on spore germination, viability, and an increase was shown in insect mortality in treated spores. Metarhizium anisopliae treated with putrescine and spermidine 0.5 mM, achieved a mortality of 77% and 92%, respectively, compared with 42% of the control. Similarly, B. bassiana treated with spermidine caused a mortality of 65% using 0.1 mM, and 75% with 0.5 mM. Our results suggest that polyamines increased the efficiency of M. anisopliae and B. bassiana conidia against S. zeamais, which might be extrapolated to another pest insect with potential for open-field applications. Biological control Beauveria bassiana Metarhizium anisopliae insect pest management spermidine Figures Figure 1 Introduction Nowadays, worldwide losses on economically important crops vary between 20–40% due to diseases and pests (CABI 2022). More than a thousand species on pests, including insect species, are responsible for grain stored-crops losses mainly in subtropical areas, reflected as the quantitative and qualitative degradation of stored products (Rajendran and Sriranjini, 2008 ; Wakil and Schmitt, 2015 ). Chemical control of stored-grain pests has achieved using synthetic insecticides such as pyrethroids, organophosphates, and carbamates (Zettler et al. , 2000; Attia et al., 2020 ). Nevertheless, its intensive application directly contaminates the soil and groundwater, it also generates the resistance of some pests and, the crops treated with these compounds represent a health risk since they are linked to neurological, cardiovascular, respiratory, and reproductive damage, among others (Silveira et al., 2018 ). Sitophilus zeamais (Motschulsky) (Coleoptera: Curculionidae) is one of the most dangerous croop pest worldwide producing quantitative and qualitative losses of maize (Acheampong et al., 2019 ). In Africa alone, S. zeamais is a serious pest of maize grains, provoking losses of 90% in severe infestations (Giga et al., 1991 ). In México S. zeamais causes losses of 4–25% of stored maize, playing an important role as a serious pest of this stored crop (Ortíz et al. , 2015). On the other hand, biological control has been helped to contribute to minimize the resistance of crop pest insects and to diminishing the environmental impact of chemical pesticides (Fravel, 2005 ). Among the organisms used in biological control, entomopathogenic fungi are widely used due to the broad spectrum of pests they specifically recognize and, more than 700 species have been recently identified (Sandhu et al., 2012 ; Batta and Kavallieratos, 2018 ). B. bassiana and M. anisopliae have been widely used as biological insecticides against different kind of pest, including stored-grain pests form Coleoptera, Lepidoptera, Diptera, among other orders (Fernando et al., 2012 ; Kaur et al., 2014 ; Rumbos and Athanassiou, 2017 ; Kisaakye et al., 2021 ; Hintènou et al., 2023 ; Sari et al., 2023 ). The performance of entomopathogenic fungi can be improved by their combination with natural or synthetic compounds with insecticidal activity and/or beneficial organisms (Athanassiou et al. 2007 ; Wakil et al., 2022 ). In fungi, natural polyamines (putrescine, spermidine, and spermine) are related with processes such as dimorphism, mycelium development, sporulation, and appressoria formation, which also play a crucial role in the infective process (Vega et al., 2012 ; Rocha and Wilson 2019). In this study, we report the effect of application polyamines on germination, viability, and virulence of B. bassiana and M. anisopliae effect against S. zeamais . Materials and methods Entomopathogenic fungi Samples of entomopathogenic fungi were isolated from “Charco Azul Xichú”, a natural protected area in the Sierra Gorda of Guanajuato, México. Samples were kept on ice and transferred to the laboratory for further analysis. The sampling was carried out from June to September 2018. The insect-associated fungi were isolated by direct culture in solid potato dextrose agar (PDA) with streptomycin (5mg/mL). Plates were incubated for 72 h at 28°C before selection, classification, and phenotype identification. Isolates were kept in the microbial culture collection. DNA isolation and Internal Transcriber Spacer amplification DNA was extracted from isolated fungi by using a quick-DNA fungal/bacterial kit (ZYMO RESEARCH). The fragments of small subunit ribosomal RNA gene (internal transcriber spacer 1, 5.8 ribosomal RNA gene) were amplified with the primers ITS1 (tccgtaggtgaacctcgg) and ITS4 (tcctccgcttattgatatgc) reported by Lou and Mitchell (2002). The PCR conditions were determinate as follows: pre-denaturating step at 95°C for 2min, denaturating at 94°C for 50s, annealing at 57°C for 50s, polymerization at 72°C for 1min and post-PCR at 72°C for 10min and 30 cycles. PCR products were analyzed on 1% agarose gel and sequenced. Fungi were identified by BLAST sequences analysis of the amplified 5.8 ribosomal gene. Access numbers were assigned: Beauveria bassiana (BE15) Mk497034 and Metarhizium anisopliae (MA1) Me01SPMO. Culture conditions and polyamine treatment Cultures of M. anisopliae and B. bassiana were cultured for five cycles in a polyamine-free M9 minimal salt medium (Sigma-Aldrich) to remove any polyamine pool. Experimental cultures were started with mycelial plugs of 5–8 day cultures made with a cork borer (4mm in diameter). One mycelial plug was placed in the center of each Petri dish on a polyamine-free M9 medium containing 1.5% of agar and 3% of glucose. All cultures were kept at 25 °C in darkness for 30 days. Triton 0.01% was used to recover conidial suspension, adjusted to 1x10 8 conidia/mL counting by a hemocytometer. Two treatments of 0.1 and 0.5 mM for each polyamine (putrescine, spermidine, spermine), including the negative control were performed. Polyamine treatments were carried out by applying 10 µL of a polyamine-stock solution to conidial suspension to adjust the final concentration to 0.1 mM and 0.5 mM according to each treatment. Then conidial suspension was incubated 30 min and twice washed with sterilized water and centrifugated at 1000 RPM for 7 min. Conidia was resuspended with 1 mL of distilled water and stored at 4°C until its further use. Conidial germination and viability Aliquots of 50 µL of each fungal conidial suspension (1x10 6 conidia/mL) were plated onto Petri dishes (4 cm diameter) containing 10 mL M9 and incubated in the dark for 18 h at 27°C. A minimum of 100 conidia per plate was observed on agar slices at 40x dyed with lactophenol blue. When the germ tube was twice the size of the conidia and was recorded as germinated. Conidia suspension from entomopathogenic fungi was harvested from M9 solid media as described on the above section. A suspension of 300 spores (150 µL of 1x10 3 spores/mL) was cultured in plates and incubated at room temperature (≈ 25°C) for 120 h. The viable cells were determined by counting the number of UFC (Oliveira et al. 2011 ). Source and rearing of Sitophilus zeamais Adults of S. zeamais were obtained from a continuous rearing culture stablished at the insectarium of the Instituto Tecnológico Superior de Irapuato (ITESI). Insects were reared at 30°C, 70% relative humidity (R.H.). Maize kernels were washed with distilled water and autoclaved. Sitophulis zeamais were cultured on whole maize grains. Ten sexed adults were added to 500 g of maize grains to initiate the culture. At the 15th day, the original adults were removed. Once new adult weevils started to emerge, each culture was checked daily to collect progeny which in turn, was kept in separate jars, until required. Bioassay of susceptibility of Sitophilus zeamays to Metarhizium anisopliae (MA1) and Beauveria bassiana (BE15) conidia treated with polyamines Adult weevils were dipped five times in a suspension of unexposed conidia and polyamine-incubated conidia from each treatment at 1x10 4 conidia/mL. S. zeamais adults were placed in a 50 mL falcon tube with pre-moistened filter paper and then, sealed with parafilm. Insects were monitored every 24 h for 14 days and mortality was recorded at the end of the period. All replicates were maintained in room conditions of 27°C and 70% R.H. Dead insects were removed on days 7 and 14 and placed on wet filter paper to determine how many sporulating hyphae were produced (Bateman et al., 1993 ). Statistical analyses Two-way analysis of variance (ANOVA), Tukey´s test (p < 0.05) using GraphPAD Prism 8.0.1. were applied to evaluate germination, viability, and virulence. For each assay three biological repetitions with three replicates were evaluated. Results and discussion Polyamines had a positive effect in the conidial germination and viability in M. anisopliae (MA1) and Beauveria bassiana (BE15) . Conidial germination was improved by both spermidine treatments (0.1 and 0.5 mM) in M. anisopliae (p < 0.05), but no by putrescine or spermine (Fig. 1 A). In the case of B. bassiana conidia, positive germination response was observed at 0.1 mM for all polyamine treatments compared with the control (Fig. 1 B). Glomus etunicatum an arbuscular mycorrhizal fungus, presented a similar response to the application of spermidine and spermine and additionally, with the application of the three above mentioned polyamines, hyphal growth was promoted (Cheng et al., 2012 ). These responses are related to the effect of polyamines in morphogenesis and differentiation processes (Valdés-Santiago and Ruiz-Herrera 2015 ). This effect is directly related to the development of conidia, since the use of chemical inhibitors of polyamine metabolism, such as difluoromethylornitine (DFMO) or α-difluoromethylarginine (DFMA), resulted in the inhibition of uredospore germination at 0.01, 0.1 and 1.0 mM. The later effect was reversed by addition of putrescine or spermidine at 0.1 mM (Rajam 1989). A similar result was observed on the viability of M. anisopliae conidia, since the application of spermidine and spermine at both concentrations, was increased, and outstandingly, at 0.5 mM the effect was enhanced (Fig. 1 C). Also, the treatment with all polyamines at 0.1 mM on B. bassiana the conidial viability was improved compared with control (Fig. 1 D). As result, the improvement of conidial germination and viability promote a quicker response of the entomopathogenic fungi and therefore, an increase of their virulence is expected. Mortality in Sitophilus zeamais increased with polyamine addition at 0.5 mM. Polyamine-treated and untreated conidia were applied to S. zeamais adults. Polyamines applied at 0.1 mM on M. anisopliae conidia, showed no effect on mortality of adult weevils, but when concentration increased to 0.5 mM, mortalities of 77% and 92% were obtained for the treatments with putrescine and spermidine, respectively; compared with 42% who showed control (Fig. 1 E). On the other hand, conidia of B. bassiana treated with 0.1 mM of spermidine has 65% of mortality compared with 22% who showed control, while spermine- and putrescine-treated conidia had no significant differences in mortality, according to Tukey and ANOVA analyses, p < 0.05 (Fig. 1 F). In a similar way, the conidia treated with 0.5 mM of the polyamines tested, had mortalities of 47%, 75% and 47% for conidia treated with putrescine, spermidine and spermine, respectively; compared with 22% of control, p < 0.05. Furthermore, spermine has been reported to improve infection in the early stage of Glomus etunicatum (Chen et al ., 2012). Recent reports have shown that the performance of entomopathogenic fungi can be improved by applying different agents including plant extracts, essential oils, diatomaceous earth, among others (Shafighi, et al., 2014 ; Farooq et al., 2020 ; Halder et al., 2021 ; Wakil et al., 2023 ), and the use of polyamines could be potentially used as adjuvants or enhancing agents coupled to biological control microorganisms, such as the entomopathogenic fungi. Conclusions Entomopathogenic fungi have proven to be the most versatile tool for biological control since their wide host range. Virulence of these biological control agents can be improved by the presence of other substances and polyamines improved the effectiveness of entomopathogenic fungi M. anisopliae (MA1) and B. bassiana (BE15) in a dose-dependent way, suggesting the great potential of this molecules for future biological control strategies. Declarations Acknowledgments The presented work was supported by Tecnológico Nacional de México (TecNM), project number CI-01/2023. We acknowledge Cardoso Pérez Mariel Alejandra and Murillo Frías María Paloma for providing experimental data. JGCM, JLCG, OL and LVS are members of the National System of Researcher (SNI), Mexico. Authors’ Contributions Conceptualization: Valdés-Santiago, L.; Colli-Mull, J. G.; Loera, O. Data acquisition: Fonseca-Hernández, J. Data analysis: Valdés-Santiago, L.; Colli-Mull, J. G.; Loera, O.; Fonseca-Hernández, J.; Castro-Guillén, J. L. Design of Methodology: Valdés-Santiago, L., Colli-Mull, J. G., Loera, O. Writing and editing: Colli-Mull, J. G.; Valdés-Santiago, L.; Castro-Guillén, J. L. Interest Statement On behalf of all authors, the corresponding author states that there is no conflict of interest. References Acheampong A, Ayertey JN, Eziah VY, Ifie BE (2019) Susceptibility of selected maize seed genotypes to Sitophilus zeamais (Coleoptera: Curculionidae). J Stored Prod Res 81:62–68. https://doi.org/10.1016/j.jspr.2019.01.003 Athanassiou CG, Steenberg T, Kavallieratos NG (2007) Insecticidal effect of diatomaceous earth applied alone or in combination with Beauveria bassiana and beta cyfluthrin against Sitophilus granarius on stored wheat. IOBC Bull 30:25–36 Attia MA, Wahba TF, Shaarawy N, Moustafa FI, Guedes RNC, Dewer Y (2020) Stored grain pest prevalence and insecticide resistance in Egyptian populations of the red flour beetle Tribolium castaneum (Herbst) and the rice weevil Sitophilus oryzae (L). J Stored Prod Res 87:101611. https://doi.org/10.1016/j.jspr.2020.101611 Batta YA, Kavallieratos NG (2018) The use of entomopathogenic fungi for the control of stored-grain insects. Int J Pest Manag 64:77–87. https://doi.org/10.1080/09670874.2017.1329565 Bateman RP, Carey M, Moore D, Prior C (1993) The enhanced infectivity of Metarhizium flavoviride in oil formulations to desert locusts at low humidities. Annals Appl Biol 122:145–152. https://doi.org/10.1111/j.1744-7348.1993.tb04022.x CABI (Centre for Agriculture and Biosciences International) (2022) Global burden of crop loss. https://www.cabi.org/projects/ globalburden-of - crop- loss. Accessed 08 January 2024 Cheng Y, Ma W, Li X, Miao W, Zheng L, Cheng B (2012) Polyamines stimulate hyphal branching and infection in the early stage of Glomus etunicatum colonization. World World J Microbiol Biotechnol 28:1615–1621. https://doi.org/10.1007/s11274-011-0967-0 Farooq MA, Atta B, Gogi MD, Arif MJ, Arain QA (2020) Compatibility of entomopathogenic fungi and Azadirachta indica extract against the cotton pink bollworm, Pectinophora gossypiella (Saunders) (Lepidoptera: Gelechiidae) under controlled conditions. Egypt J Biol Pest Control 30:63. https://doi.org/10.1186/s41938-020-00260-x Fernando EV, Mayling NV, Luagngsaard JJ, Balckwell M (2012) Fungal enthomopathogens. In: Vega FE, Kaya HK (eds) Insect Pathology, 2nd edn. Academic Press, pp 171–220 Fravel DR (2005) Commercialization and implementation of biocontrol. Annu Rev Phytopathol 43:337–359. https://doi.org/10.1146/annurev.phyto.43.032904.092924 Giga D, Mutemerewa S, Moyo G, Neeley D (1991) Assessment and control of losses caused by insect pests in small farmers’. stores in Zimbabwe Crop Prot 10:287–292. https://doi.org/10.1016/0261-2194(91)90007-E Halder J, Divekar PA, Rani AT (2021) Compatibility of entomopathogenic fungi and botanicals against sucking pests of okra: an ecofriendly approach. Egypt J Biol Pest Control 31:30. https://doi.org/10.1186/s41938-021-00378-6 Hintènou MV, Omoloye AA, Douro Kpindou OK, Karlsson MF, Djouaka R, Bokonon-Ganta AH, Tamȯ M (2023) Pathogenicity of Beauveria bassiana (Balsamo-Crivelli) and Metarhizium anisopliae (Metschnikoff) isolates against life stages of Zeugodacus cucurbitae (Coquillett) (Diptera: Tephritidae). Egypt J Biol Pest Control 33:45. https://doi.org/10.1186/s41938-023-00693-0 Kaur S, Thakur A, Rajput M (2014) A laboratory assessment of the potential of Beauveria bassiana (Balsamo) Vuillemin as a biocontrol agent of Corcyra cephalonica Stainton (Lepidoptera: Pyralidae). J Stored Prod Res 59:185–189. https://doi.org/10.1016/j.jspr.2014.08.004 Kisaakye J, Fourie H, Coyne D, Cortada L, Masinde S, Subramanian S, Haukeland S (2021) Evaluation of the Entomopathogenic Potential of Beauveria bassiana , Metarhizium anisopliae and Isaria fumosorosea for Management of Cosmopolites sordidus Germar (Coleoptera: Curculionidae). Agriculture 11:1290. https://doi.org/10.3390/agriculture11121290 Luo G, Mitchell TG (2002) Rapid identification of pathogenic fungi directly from cultures by using multiplex PCR. J Clin Microbiol 40:2860–2865 Oliveira I, Pereira JA, Bento A et al (2011) Viability of Beauveria bassiana isolates after storage under several preservation methods. Ann Microbiol 61:339–344. https://doi.org/10.1007/s13213-010-0147-8 Rajendran S, Sriranjini V (2008) Plant products as fumigants for stored-product insect control. J Stored Prod Res 44:126–135. https://doi.org/10.1016/j.jspr.2007.08.003 Rajam MV, Weinstein LH, Galston AW (1989) Inhibition of Uredospore Germination and Germ Tube Growth by Inhibitors of Polyamine Metabolism in Uromyces phaseoli L. Plant Cell Physiol 30(1):37–41. https://doi.org/10.1093/oxfordjournals.pcp.a077714 Rochad RO, Wilson RA (2019) Essential, deadly, enigmatic: Polyamine metabolism and roles in fungal cells. Fungal Biol Rev 33:47–57. https://doi.org/10.1016/j.fbr.2018.07.003 Rumbos CI, Athanassiou CG (2017) Use of entomopathogenic fungi for the control of stored-product insects: can fungi protect durable commodities? J Pest Sci 90:839–854. https://doi.org/10.1007/s10340-017-0849-9 Sandhu SS, Sharma AK, Beniwal V, Goel G, Batra P, Kumar A, Jaglan S (2012) Mycobiocontrol of insect pests: factors involved, mechanism, and regulation. J Pathol Article ID 126819:10. https://doi.org/10.1155/2012/126819 Sari JMP, Herlinda S, Suwandi S, Elfita (2023) Effect of Beauveria bassiana and Metarhizium anisopliae on the growth of Spodoptera frugiperda by seed inoculation. Biodiversitas 24(4):2350–2357. https://doi.org/10.13057/biodiv/d240449 Shafighi Y, Ziaee M, Ghosta Y (2014) Diatomaceous earth used against insect pests, applied alone or in combination with Metarhizium anisopliae and Beauveria bassiana . J Plant Prot Res 54(1):62–66. https://doi.org/10.2478/jppr-2014-0009 Silveira GAI, Aldana MML, Piri SJ, Valenzuela QAI, Jasa SG, Rodríguez OG (2018) Plaguicidas agrícolas un marco de referencia para evaluar riesgos a la salud en comunidades rurales en el estado de Sonora, México. Rev Int de Contam Ambient 34(1):7–21. https://doi.org/10.20937/rica.2018.34.01.01 Valdés-Santiago L, Ruiz-Herrera J (2015) Polyamines in Fungi: Their distribution, metabolism, and their role in cell differentiation and morphogenesis. CRC Press, Boca Raton. https://doi.org/10.1201/b19200 Vega FE, Meyling NV, Luangsa-ard JJ, Blackwell M (2012) Fungal entomopathogens. In: Vega FE, Kaya HK (eds) Insect Pathology, 2nd edn. Academic Press, Cambridge, pp 171–220. https://doi.org/10.1016/B978-0-12-384984-7.00006-3 Wakil W, Schmitt T (2015) Field trials on the efficacy of Beauveria bassiana , diatomaceous earth and imidacloprid for the protection of wheat grains from four major stored grain insect pests. J Stored Prod Res 64:160–167. https://doi.org/10.1016/j.jspr.2014.10.008 Wakil W, Kavallieratos NG, Ghazanfar MU, Usman M (2022) Labora­tory and field studies on the combined application of Beauveria bassiana and fipronil against four major stored-product coleop-teran insect pests. Environ Sci Pollut Res 29:34912–34929. https://doi.org/10.1007/s11356-021-17527-x Wakil W, Kavallieratos NG, Nika EP, Qayyum MA, Yaseen T, Ghazanfar MU, Yasin M (2023) Combinations of Beauveria bassiana and spinetoram for the management of four important stored-product pests: laboratory and field trials. Environ Sci Pollut Res 30:27698–27715. https://doi.org/10.1007/s11356-022-23753-8 Zettler J, Arthur FH (2000) Chemical control of stored product insects with fumigants and residual treatments. Crop Prot 19:577–582. https://doi.org/10.1016/S0261-2194(00)00075-2 Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major revisions 11 Feb, 2026 Reviewers agreed at journal 26 Jun, 2025 Reviewers invited by journal 25 Jun, 2025 Editor invited by journal 14 Feb, 2024 Editor assigned by journal 22 Jan, 2024 First submitted to journal 20 Jan, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3885326","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":476392128,"identity":"753839c5-5f51-48d5-861f-46e377d60e9e","order_by":0,"name":"Juan G. Colli-Mull","email":"","orcid":"","institution":"Higher Technological Institute of Irapuato: Instituto Tecnologico Superior de Irapuato","correspondingAuthor":false,"prefix":"","firstName":"Juan","middleName":"G.","lastName":"Colli-Mull","suffix":""},{"id":476392129,"identity":"3b275c9b-5916-45e7-b05a-63b2e8c72c1b","order_by":1,"name":"José Luis Castro-Guillén","email":"","orcid":"","institution":"Instituto Tecnológico Superior de Irapuato: Instituto Tecnologico Superior de Irapuato","correspondingAuthor":false,"prefix":"","firstName":"José","middleName":"Luis","lastName":"Castro-Guillén","suffix":""},{"id":476392130,"identity":"5086447b-3a30-44b8-9edc-e01288b19d2f","order_by":2,"name":"Jimena Fonseca-Hernández","email":"","orcid":"","institution":"Higher Technological Institute of Irapuato: Instituto Tecnologico Superior de Irapuato","correspondingAuthor":false,"prefix":"","firstName":"Jimena","middleName":"","lastName":"Fonseca-Hernández","suffix":""},{"id":476392131,"identity":"0117dc68-c563-45bc-9eb3-39f4de86733b","order_by":3,"name":"Octavio Loera","email":"","orcid":"","institution":"UAM Iztapalapa: Universidad Autonoma Metropolitana - Iztapalapa","correspondingAuthor":false,"prefix":"","firstName":"Octavio","middleName":"","lastName":"Loera","suffix":""},{"id":476392132,"identity":"868a64a8-f7d7-4a0f-9439-707fb77163cf","order_by":4,"name":"Laura Valdés-Santiago","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABRElEQVRIiWNgGAWjYFAC5gYJGPMAiOADMytAMswN2LUwwrQwQ7SwgTlnQAKMhLUwwLUwtkGksGkwOH6w8caHPwz2/LP7Dx748cuGgY39jNmHn/Nqo/nbgVp+VGzD0HImsdlyZhtD4ow7hxkO9valMbDx5BjP7N12PHfGYcYGxp4zt9G1SDYktknzNjAkMNxIZjjA23MY6LAcYwbebcdyG4BamBnbMLX0P2yT/gN0mDxQy8G/IC38b4wZ/845ljsfhxZ+CaAtQJMZNwC1HOb5AdQikWPMzNtQk7sBp5aHzZa9bRKJG28kGxyWbUjjYZN4Vswsc+xA7kagloNY/MLGn3zwxo8/NvZyNxIff3zzx0aOnz95M+ObmrrceecPH3zwowJDCxRAowYYHTxQkcNg8gAO9UjgD5xVR1jxKBgFo2AUjBQAAEgsdkdH4PT3AAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-2943-7754","institution":"Instituto Tecnológico Superior de Irapuato: Instituto Tecnologico Superior de Irapuato","correspondingAuthor":true,"prefix":"","firstName":"Laura","middleName":"","lastName":"Valdés-Santiago","suffix":""}],"badges":[],"createdAt":"2024-01-21 17:13:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3885326/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3885326/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":85644754,"identity":"11d65fba-e810-4a8e-89cb-1f6981307ce9","added_by":"auto","created_at":"2025-06-30 08:19:33","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1351418,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of polyamines on the germination of conidia (A and B), the viability of conidia (C and D) and the effect of polyamine-treated conidia on the mortality of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eSitophilus zeamais \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e(E and F).\u003c/strong\u003e PUT (conidia with putrescine treatment); SPD (conidia with spermidine treatment); SPM (conidia with spermine treatment), CTRL (conidia without polyamines). Letters express significant differences (p ≤ 0.05) by ANOVA two ways and Tukey test.\u003c/p\u003e","description":"","filename":"Fig.1Full.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3885326/v1/edef49aaacb514aa66207415.jpg"},{"id":85645845,"identity":"141f1b79-ef65-4049-b693-4e4193a4eb14","added_by":"auto","created_at":"2025-06-30 08:35:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2054629,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3885326/v1/e9b972d9-7994-4281-91a7-382fc7892682.pdf"}],"financialInterests":"","formattedTitle":"Improving efficacy of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae against Sitophilus zeamais through polyamine application","fulltext":[{"header":"Introduction","content":"\u003cp\u003eNowadays, worldwide losses on economically important crops vary between 20\u0026ndash;40% due to diseases and pests (CABI 2022). More than a thousand species on pests, including insect species, are responsible for grain stored-crops losses mainly in subtropical areas, reflected as the quantitative and qualitative degradation of stored products (Rajendran and Sriranjini, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Wakil and Schmitt, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Chemical control of stored-grain pests has achieved using synthetic insecticides such as pyrethroids, organophosphates, and carbamates (Zettler \u003cem\u003eet al.\u003c/em\u003e, 2000; Attia et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Nevertheless, its intensive application directly contaminates the soil and groundwater, it also generates the resistance of some pests and, the crops treated with these compounds represent a health risk since they are linked to neurological, cardiovascular, respiratory, and reproductive damage, among others (Silveira et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). \u003cem\u003eSitophilus zeamais\u003c/em\u003e (Motschulsky) (Coleoptera: Curculionidae) is one of the most dangerous croop pest worldwide producing quantitative and qualitative losses of maize (Acheampong et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In Africa alone, \u003cem\u003eS. zeamais\u003c/em\u003e is a serious pest of maize grains, provoking losses of 90% in severe infestations (Giga et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e1991\u003c/span\u003e). In M\u0026eacute;xico \u003cem\u003eS. zeamais\u003c/em\u003e causes losses of 4\u0026ndash;25% of stored maize, playing an important role as a serious pest of this stored crop (Ort\u0026iacute;z \u003cem\u003eet al.\u003c/em\u003e, 2015).\u003c/p\u003e \u003cp\u003eOn the other hand, biological control has been helped to contribute to minimize the resistance of crop pest insects and to diminishing the environmental impact of chemical pesticides (Fravel, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Among the organisms used in biological control, entomopathogenic fungi are widely used due to the broad spectrum of pests they specifically recognize and, more than 700 species have been recently identified (Sandhu et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Batta and Kavallieratos, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). \u003cem\u003eB. bassiana\u003c/em\u003e and \u003cem\u003eM. anisopliae\u003c/em\u003e have been widely used as biological insecticides against different kind of pest, including stored-grain pests form Coleoptera, Lepidoptera, Diptera, among other orders (Fernando et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Kaur et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Rumbos and Athanassiou, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Kisaakye et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Hint\u0026egrave;nou et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Sari et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The performance of entomopathogenic fungi can be improved by their combination with natural or synthetic compounds with insecticidal activity and/or beneficial organisms (Athanassiou et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Wakil et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn fungi, natural polyamines (putrescine, spermidine, and spermine) are related with processes such as dimorphism, mycelium development, sporulation, and appressoria formation, which also play a crucial role in the infective process (Vega et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Rocha and Wilson 2019). In this study, we report the effect of application polyamines on germination, viability, and virulence of \u003cem\u003eB. bassiana\u003c/em\u003e and \u003cem\u003eM. anisopliae\u003c/em\u003e effect against \u003cem\u003eS. zeamais\u003c/em\u003e.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eEntomopathogenic fungi\u003c/h2\u003e \u003cp\u003eSamples of entomopathogenic fungi were isolated from \u0026ldquo;Charco Azul Xich\u0026uacute;\u0026rdquo;, a natural protected area in the Sierra Gorda of Guanajuato, M\u0026eacute;xico. Samples were kept on ice and transferred to the laboratory for further analysis. The sampling was carried out from June to September 2018. The insect-associated fungi were isolated by direct culture in solid potato dextrose agar (PDA) with streptomycin (5mg/mL). Plates were incubated for 72 h at 28\u0026deg;C before selection, classification, and phenotype identification. Isolates were kept in the microbial culture collection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eDNA isolation and Internal Transcriber Spacer amplification\u003c/h2\u003e \u003cp\u003eDNA was extracted from isolated fungi by using a quick-DNA fungal/bacterial kit (ZYMO RESEARCH). The fragments of small subunit ribosomal RNA gene (internal transcriber spacer 1, 5.8 ribosomal RNA gene) were amplified with the primers ITS1 (tccgtaggtgaacctcgg) and ITS4 (tcctccgcttattgatatgc) reported by Lou and Mitchell (2002). The PCR conditions were determinate as follows: pre-denaturating step at 95\u0026deg;C for 2min, denaturating at 94\u0026deg;C for 50s, annealing at 57\u0026deg;C for 50s, polymerization at 72\u0026deg;C for 1min and post-PCR at 72\u0026deg;C for 10min and 30 cycles. PCR products were analyzed on 1% agarose gel and sequenced. Fungi were identified by BLAST sequences analysis of the amplified 5.8 ribosomal gene. Access numbers were assigned: \u003cem\u003eBeauveria bassiana\u003c/em\u003e (BE15) Mk497034 and \u003cem\u003eMetarhizium anisopliae\u003c/em\u003e (MA1) Me01SPMO.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eCulture conditions and polyamine treatment\u003c/h2\u003e \u003cp\u003eCultures of \u003cem\u003eM. anisopliae\u003c/em\u003e and \u003cem\u003eB. bassiana\u003c/em\u003e were cultured for five cycles in a polyamine-free M9 minimal salt medium (Sigma-Aldrich) to remove any polyamine pool. Experimental cultures were started with mycelial plugs of 5\u0026ndash;8 day cultures made with a cork borer (4mm in diameter). One mycelial plug was placed in the center of each Petri dish on a polyamine-free M9 medium containing 1.5% of agar and 3% of glucose. All cultures were kept at 25 \u0026deg;C in darkness for 30 days. Triton 0.01% was used to recover conidial suspension, adjusted to 1x10\u003csup\u003e8\u003c/sup\u003e conidia/mL counting by a hemocytometer.\u003c/p\u003e \u003cp\u003eTwo treatments of 0.1 and 0.5 mM for each polyamine (putrescine, spermidine, spermine), including the negative control were performed. Polyamine treatments were carried out by applying 10 \u0026micro;L of a polyamine-stock solution to conidial suspension to adjust the final concentration to 0.1 mM and 0.5 mM according to each treatment. Then conidial suspension was incubated 30 min and twice washed with sterilized water and centrifugated at 1000 RPM for 7 min. Conidia was resuspended with 1 mL of distilled water and stored at 4\u0026deg;C until its further use.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eConidial germination and viability\u003c/h2\u003e \u003cp\u003eAliquots of 50 \u0026micro;L of each fungal conidial suspension (1x10\u003csup\u003e6\u003c/sup\u003e conidia/mL) were plated onto Petri dishes (4 cm diameter) containing 10 mL M9 and incubated in the dark for 18 h at 27\u0026deg;C. A minimum of 100 conidia per plate was observed on agar slices at 40x dyed with lactophenol blue. When the germ tube was twice the size of the conidia and was recorded as germinated. Conidia suspension from entomopathogenic fungi was harvested from M9 solid media as described on the above section. A suspension of 300 spores (150 \u0026micro;L of 1x10\u003csup\u003e3\u003c/sup\u003e spores/mL) was cultured in plates and incubated at room temperature (\u0026asymp;\u0026thinsp;25\u0026deg;C) for 120 h. The viable cells were determined by counting the number of UFC (Oliveira et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eSource and rearing of\u003c/b\u003e \u003cb\u003eSitophilus zeamais\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAdults of \u003cem\u003eS. zeamais\u003c/em\u003e were obtained from a continuous rearing culture stablished at the insectarium of the Instituto Tecnol\u0026oacute;gico Superior de Irapuato (ITESI). Insects were reared at 30\u0026deg;C, 70% relative humidity (R.H.). Maize kernels were washed with distilled water and autoclaved. \u003cem\u003eSitophulis zeamais\u003c/em\u003e were cultured on whole maize grains. Ten sexed adults were added to 500 g of maize grains to initiate the culture. At the 15th day, the original adults were removed. Once new adult weevils started to emerge, each culture was checked daily to collect progeny which in turn, was kept in separate jars, until required.\u003c/p\u003e \u003cp\u003e \u003cb\u003eBioassay of susceptibility of\u003c/b\u003e \u003cb\u003eSitophilus zeamays\u003c/b\u003e \u003cb\u003eto\u003c/b\u003e \u003cb\u003eMetarhizium anisopliae\u003c/b\u003e \u003cb\u003e(MA1) and\u003c/b\u003e \u003cb\u003eBeauveria bassiana\u003c/b\u003e \u003cb\u003e(BE15) conidia treated with polyamines\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAdult weevils were dipped five times in a suspension of unexposed conidia and polyamine-incubated conidia from each treatment at 1x10\u003csup\u003e4\u003c/sup\u003e conidia/mL. \u003cem\u003eS. zeamais\u003c/em\u003e adults were placed in a 50 mL falcon tube with pre-moistened filter paper and then, sealed with parafilm. Insects were monitored every 24 h for 14 days and mortality was recorded at the end of the period. All replicates were maintained in room conditions of 27\u0026deg;C and 70% R.H. Dead insects were removed on days 7 and 14 and placed on wet filter paper to determine how many sporulating hyphae were produced (Bateman et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e1993\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eStatistical analyses\u003c/h3\u003e\n\u003cp\u003eTwo-way analysis of variance (ANOVA), Tukey\u0026acute;s test (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) using GraphPAD Prism 8.0.1. were applied to evaluate germination, viability, and virulence. For each assay three biological repetitions with three replicates were evaluated.\u003c/p\u003e"},{"header":"Results and discussion","content":"\u003cp\u003e \u003cb\u003ePolyamines had a positive effect in the conidial germination and viability in\u003c/b\u003e \u003cb\u003eM. anisopliae\u003c/b\u003e \u003cb\u003e(MA1) and\u003c/b\u003e \u003cb\u003eBeauveria bassiana\u003c/b\u003e \u003cb\u003e(BE15)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eConidial germination was improved by both spermidine treatments (0.1 and 0.5 mM) in \u003cem\u003eM. anisopliae\u003c/em\u003e (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), but no by putrescine or spermine (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). In the case of \u003cem\u003eB. bassiana\u003c/em\u003e conidia, positive germination response was observed at 0.1 mM for all polyamine treatments compared with the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). \u003cem\u003eGlomus etunicatum\u003c/em\u003e an arbuscular mycorrhizal fungus, presented a similar response to the application of spermidine and spermine and additionally, with the application of the three above mentioned polyamines, hyphal growth was promoted (Cheng et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). These responses are related to the effect of polyamines in morphogenesis and differentiation processes (Vald\u0026eacute;s-Santiago and Ruiz-Herrera \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). This effect is directly related to the development of conidia, since the use of chemical inhibitors of polyamine metabolism, such as difluoromethylornitine (DFMO) or α-difluoromethylarginine (DFMA), resulted in the inhibition of uredospore germination at 0.01, 0.1 and 1.0 mM. The later effect was reversed by addition of putrescine or spermidine at 0.1 mM (Rajam 1989).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eA similar result was observed on the viability of \u003cem\u003eM. anisopliae\u003c/em\u003e conidia, since the application of spermidine and spermine at both concentrations, was increased, and outstandingly, at 0.5 mM the effect was enhanced (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Also, the treatment with all polyamines at 0.1 mM on \u003cem\u003eB. bassiana\u003c/em\u003e the conidial viability was improved compared with control (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). As result, the improvement of conidial germination and viability promote a quicker response of the entomopathogenic fungi and therefore, an increase of their virulence is expected.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMortality in\u003c/b\u003e \u003cb\u003eSitophilus zeamais\u003c/b\u003e \u003cb\u003eincreased with polyamine addition at 0.5 mM.\u003c/b\u003e\u003c/p\u003e \u003cp\u003ePolyamine-treated and untreated conidia were applied to \u003cem\u003eS. zeamais\u003c/em\u003e adults. Polyamines applied at 0.1 mM on \u003cem\u003eM. anisopliae\u003c/em\u003e conidia, showed no effect on mortality of adult weevils, but when concentration increased to 0.5 mM, mortalities of 77% and 92% were obtained for the treatments with putrescine and spermidine, respectively; compared with 42% who showed control (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). On the other hand, conidia of \u003cem\u003eB. bassiana\u003c/em\u003e treated with 0.1 mM of spermidine has 65% of mortality compared with 22% who showed control, while spermine- and putrescine-treated conidia had no significant differences in mortality, according to Tukey and ANOVA analyses, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). In a similar way, the conidia treated with 0.5 mM of the polyamines tested, had mortalities of 47%, 75% and 47% for conidia treated with putrescine, spermidine and spermine, respectively; compared with 22% of control, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Furthermore, spermine has been reported to improve infection in the early stage of \u003cem\u003eGlomus etunicatum\u003c/em\u003e (Chen \u003cem\u003eet al\u003c/em\u003e., 2012). Recent reports have shown that the performance of entomopathogenic fungi can be improved by applying different agents including plant extracts, essential oils, diatomaceous earth, among others (Shafighi, et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Farooq et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Halder et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Wakil et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), and the use of polyamines could be potentially used as adjuvants or enhancing agents coupled to biological control microorganisms, such as the entomopathogenic fungi.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eEntomopathogenic fungi have proven to be the most versatile tool for biological control since their wide host range. Virulence of these biological control agents can be improved by the presence of other substances and polyamines improved the effectiveness of entomopathogenic fungi \u003cem\u003eM. anisopliae\u003c/em\u003e (MA1) and \u003cem\u003eB. bassiana\u003c/em\u003e (BE15) in a dose-dependent way, suggesting the great potential of this molecules for future biological control strategies.\u003c/p\u003e"},{"header":"Declarations","content":"\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe presented work was supported by Tecnol\u0026oacute;gico Nacional de M\u0026eacute;xico (TecNM), project number CI-01/2023. We acknowledge Cardoso P\u0026eacute;rez Mariel Alejandra and Murillo Fr\u0026iacute;as Mar\u0026iacute;a Paloma for providing experimental data. JGCM, JLCG, OL and LVS are members of the National System of Researcher (SNI), Mexico.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization: Vald\u0026eacute;s-Santiago, L.; Colli-Mull, J. G.; Loera, O.\u003c/p\u003e\n\u003cp\u003eData acquisition: Fonseca-Hern\u0026aacute;ndez, J.\u003c/p\u003e\n\u003cp\u003eData analysis: Vald\u0026eacute;s-Santiago, L.; Colli-Mull, J. G.; Loera, O.; Fonseca-Hern\u0026aacute;ndez, J.; Castro-Guill\u0026eacute;n, J. L.\u003c/p\u003e\n\u003cp\u003eDesign of Methodology: Vald\u0026eacute;s-Santiago, L., Colli-Mull, J. G., Loera, O.\u003c/p\u003e\n\u003cp\u003eWriting and editing: Colli-Mull, J. G.; Vald\u0026eacute;s-Santiago, L.; Castro-Guill\u0026eacute;n, J. L.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInterest Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOn behalf of all authors, the corresponding author states that there is no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAcheampong A, Ayertey JN, Eziah VY, Ifie BE (2019) Susceptibility of selected maize seed genotypes to \u003cem\u003eSitophilus zeamais\u003c/em\u003e (Coleoptera: Curculionidae). J Stored Prod Res 81:62\u0026ndash;68. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jspr.2019.01.003\u003c/span\u003e\u003cspan address=\"10.1016/j.jspr.2019.01.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAthanassiou CG, Steenberg T, Kavallieratos NG (2007) Insecticidal effect of diatomaceous earth applied alone or in combination with \u003cem\u003eBeauveria bassiana\u003c/em\u003e and beta cyfluthrin against \u003cem\u003eSitophilus granarius\u003c/em\u003e on stored wheat. IOBC Bull 30:25\u0026ndash;36\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAttia MA, Wahba TF, Shaarawy N, Moustafa FI, Guedes RNC, Dewer Y (2020) Stored grain pest prevalence and insecticide resistance in Egyptian populations of the red flour beetle \u003cem\u003eTribolium castaneum\u003c/em\u003e (Herbst) and the rice weevil \u003cem\u003eSitophilus oryzae\u003c/em\u003e (L). J Stored Prod Res 87:101611. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jspr.2020.101611\u003c/span\u003e\u003cspan address=\"10.1016/j.jspr.2020.101611\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBatta YA, Kavallieratos NG (2018) The use of entomopathogenic fungi for the control of stored-grain insects. Int J Pest Manag 64:77\u0026ndash;87. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/09670874.2017.1329565\u003c/span\u003e\u003cspan address=\"10.1080/09670874.2017.1329565\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBateman RP, Carey M, Moore D, Prior C (1993) The enhanced infectivity of \u003cem\u003eMetarhizium flavoviride\u003c/em\u003e in oil formulations to desert locusts at low humidities. Annals Appl Biol 122:145\u0026ndash;152. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1744-7348.1993.tb04022.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1744-7348.1993.tb04022.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCABI (Centre for Agriculture and Biosciences International) (2022) Global burden of crop loss. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.cabi.org/projects/ globalburden-of\u003c/span\u003e\u003cspan address=\"https://www.cabi.org/projects/ globalburden-of\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e- crop- loss. Accessed 08 January 2024\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng Y, Ma W, Li X, Miao W, Zheng L, Cheng B (2012) Polyamines stimulate hyphal branching and infection in the early stage of \u003cem\u003eGlomus etunicatum\u003c/em\u003e colonization. World World J Microbiol Biotechnol 28:1615\u0026ndash;1621. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11274-011-0967-0\u003c/span\u003e\u003cspan address=\"10.1007/s11274-011-0967-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFarooq MA, Atta B, Gogi MD, Arif MJ, Arain QA (2020) Compatibility of entomopathogenic fungi and \u003cem\u003eAzadirachta indica\u003c/em\u003e extract against the cotton pink bollworm, \u003cem\u003ePectinophora gossypiella\u003c/em\u003e (Saunders) (Lepidoptera: Gelechiidae) under controlled conditions. Egypt J Biol Pest Control 30:63. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s41938-020-00260-x\u003c/span\u003e\u003cspan address=\"10.1186/s41938-020-00260-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFernando EV, Mayling NV, Luagngsaard JJ, Balckwell M (2012) Fungal enthomopathogens. In: Vega FE, Kaya HK (eds) Insect Pathology, 2nd edn. Academic Press, pp 171\u0026ndash;220\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFravel DR (2005) Commercialization and implementation of biocontrol. Annu Rev Phytopathol 43:337\u0026ndash;359. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev.phyto.43.032904.092924\u003c/span\u003e\u003cspan address=\"10.1146/annurev.phyto.43.032904.092924\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGiga D, Mutemerewa S, Moyo G, Neeley D (1991) Assessment and control of losses caused by insect pests in small farmers\u0026rsquo;. stores in Zimbabwe Crop Prot 10:287\u0026ndash;292. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0261-2194(91)90007-E\u003c/span\u003e\u003cspan address=\"10.1016/0261-2194(91)90007-E\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHalder J, Divekar PA, Rani AT (2021) Compatibility of entomopathogenic fungi and botanicals against sucking pests of okra: an ecofriendly approach. Egypt J Biol Pest Control 31:30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s41938-021-00378-6\u003c/span\u003e\u003cspan address=\"10.1186/s41938-021-00378-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHint\u0026egrave;nou MV, Omoloye AA, Douro Kpindou OK, Karlsson MF, Djouaka R, Bokonon-Ganta AH, Tamȯ M (2023) Pathogenicity of \u003cem\u003eBeauveria bassiana\u003c/em\u003e (Balsamo-Crivelli) and \u003cem\u003eMetarhizium anisopliae\u003c/em\u003e (Metschnikoff) isolates against life stages of \u003cem\u003eZeugodacus cucurbitae\u003c/em\u003e (Coquillett) (Diptera: Tephritidae). Egypt J Biol Pest Control 33:45. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s41938-023-00693-0\u003c/span\u003e\u003cspan address=\"10.1186/s41938-023-00693-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaur S, Thakur A, Rajput M (2014) A laboratory assessment of the potential of \u003cem\u003eBeauveria bassiana\u003c/em\u003e (Balsamo) Vuillemin as a biocontrol agent of \u003cem\u003eCorcyra cephalonica\u003c/em\u003e Stainton (Lepidoptera: Pyralidae). J Stored Prod Res 59:185\u0026ndash;189. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jspr.2014.08.004\u003c/span\u003e\u003cspan address=\"10.1016/j.jspr.2014.08.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKisaakye J, Fourie H, Coyne D, Cortada L, Masinde S, Subramanian S, Haukeland S (2021) Evaluation of the Entomopathogenic Potential of \u003cem\u003eBeauveria bassiana\u003c/em\u003e, \u003cem\u003eMetarhizium anisopliae\u003c/em\u003e and \u003cem\u003eIsaria fumosorosea\u003c/em\u003e for Management of \u003cem\u003eCosmopolites sordidus\u003c/em\u003e Germar (Coleoptera: Curculionidae). Agriculture 11:1290. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/agriculture11121290\u003c/span\u003e\u003cspan address=\"10.3390/agriculture11121290\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo G, Mitchell TG (2002) Rapid identification of pathogenic fungi directly from cultures by using multiplex PCR. J Clin Microbiol 40:2860\u0026ndash;2865\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOliveira I, Pereira JA, Bento A et al (2011) Viability of \u003cem\u003eBeauveria bassiana\u003c/em\u003e isolates after storage under several preservation methods. Ann Microbiol 61:339\u0026ndash;344. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13213-010-0147-8\u003c/span\u003e\u003cspan address=\"10.1007/s13213-010-0147-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRajendran S, Sriranjini V (2008) Plant products as fumigants for stored-product insect control. J Stored Prod Res 44:126\u0026ndash;135. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jspr.2007.08.003\u003c/span\u003e\u003cspan address=\"10.1016/j.jspr.2007.08.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRajam MV, Weinstein LH, Galston AW (1989) Inhibition of Uredospore Germination and Germ Tube Growth by Inhibitors of Polyamine Metabolism in \u003cem\u003eUromyces phaseoli\u003c/em\u003e L. Plant Cell Physiol 30(1):37\u0026ndash;41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/oxfordjournals.pcp.a077714\u003c/span\u003e\u003cspan address=\"10.1093/oxfordjournals.pcp.a077714\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRochad RO, Wilson RA (2019) Essential, deadly, enigmatic: Polyamine metabolism and roles in fungal cells. Fungal Biol Rev 33:47\u0026ndash;57. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fbr.2018.07.003\u003c/span\u003e\u003cspan address=\"10.1016/j.fbr.2018.07.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRumbos CI, Athanassiou CG (2017) Use of entomopathogenic fungi for the control of stored-product insects: can fungi protect durable commodities? J Pest Sci 90:839\u0026ndash;854. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10340-017-0849-9\u003c/span\u003e\u003cspan address=\"10.1007/s10340-017-0849-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSandhu SS, Sharma AK, Beniwal V, Goel G, Batra P, Kumar A, Jaglan S (2012) Mycobiocontrol of insect pests: factors involved, mechanism, and regulation. J Pathol Article ID 126819:10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2012/126819\u003c/span\u003e\u003cspan address=\"10.1155/2012/126819\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSari JMP, Herlinda S, Suwandi S, Elfita (2023) Effect of \u003cem\u003eBeauveria bassiana\u003c/em\u003e and \u003cem\u003eMetarhizium anisopliae\u003c/em\u003e on the growth of \u003cem\u003eSpodoptera frugiperda\u003c/em\u003e by seed inoculation. Biodiversitas 24(4):2350\u0026ndash;2357. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.13057/biodiv/d240449\u003c/span\u003e\u003cspan address=\"10.13057/biodiv/d240449\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShafighi Y, Ziaee M, Ghosta Y (2014) Diatomaceous earth used against insect pests, applied alone or in combination with \u003cem\u003eMetarhizium anisopliae\u003c/em\u003e and \u003cem\u003eBeauveria bassiana\u003c/em\u003e. J Plant Prot Res 54(1):62\u0026ndash;66. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2478/jppr-2014-0009\u003c/span\u003e\u003cspan address=\"10.2478/jppr-2014-0009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSilveira GAI, Aldana MML, Piri SJ, Valenzuela QAI, Jasa SG, Rodr\u0026iacute;guez OG (2018) Plaguicidas agr\u0026iacute;colas un marco de referencia para evaluar riesgos a la salud en comunidades rurales en el estado de Sonora, M\u0026eacute;xico. Rev Int de Contam Ambient 34(1):7\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.20937/rica.2018.34.01.01\u003c/span\u003e\u003cspan address=\"10.20937/rica.2018.34.01.01\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVald\u0026eacute;s-Santiago L, Ruiz-Herrera J (2015) Polyamines in Fungi: Their distribution, metabolism, and their role in cell differentiation and morphogenesis. CRC Press, Boca Raton. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1201/b19200\u003c/span\u003e\u003cspan address=\"10.1201/b19200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVega FE, Meyling NV, Luangsa-ard JJ, Blackwell M (2012) Fungal entomopathogens. In: Vega FE, Kaya HK (eds) Insect Pathology, 2nd edn. Academic Press, Cambridge, pp 171\u0026ndash;220. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/B978-0-12-384984-7.00006-3\u003c/span\u003e\u003cspan address=\"10.1016/B978-0-12-384984-7.00006-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWakil W, Schmitt T (2015) Field trials on the efficacy of \u003cem\u003eBeauveria bassiana\u003c/em\u003e, diatomaceous earth and imidacloprid for the protection of wheat grains from four major stored grain insect pests. J Stored Prod Res 64:160\u0026ndash;167. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jspr.2014.10.008\u003c/span\u003e\u003cspan address=\"10.1016/j.jspr.2014.10.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWakil W, Kavallieratos NG, Ghazanfar MU, Usman M (2022) Labora\u0026shy;tory and field studies on the combined application of \u003cem\u003eBeauveria bassiana\u003c/em\u003e and fipronil against four major stored-product coleop-teran insect pests. Environ Sci Pollut Res 29:34912\u0026ndash;34929. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11356-021-17527-x\u003c/span\u003e\u003cspan address=\"10.1007/s11356-021-17527-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWakil W, Kavallieratos NG, Nika EP, Qayyum MA, Yaseen T, Ghazanfar MU, Yasin M (2023) Combinations of \u003cem\u003eBeauveria bassiana\u003c/em\u003e and spinetoram for the management of four important stored-product pests: laboratory and field trials. Environ Sci Pollut Res 30:27698\u0026ndash;27715. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11356-022-23753-8\u003c/span\u003e\u003cspan address=\"10.1007/s11356-022-23753-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZettler J, Arthur FH (2000) Chemical control of stored product insects with fumigants and residual treatments. Crop Prot 19:577\u0026ndash;582. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0261-2194(00)00075-2\u003c/span\u003e\u003cspan address=\"10.1016/S0261-2194(00)00075-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"international-journal-of-tropical-insect-science","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jtis","sideBox":"Learn more about [International Journal of Tropical Insect Science](http://link.springer.com/journal/42690)","snPcode":"42690","submissionUrl":"https://www.editorialmanager.com/jtis/default2.aspx","title":"International Journal of Tropical Insect Science","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Biological control, Beauveria bassiana, Metarhizium anisopliae, insect pest management, spermidine","lastPublishedDoi":"10.21203/rs.3.rs-3885326/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3885326/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePost-harvest pests cause large losses worldwide, threatening the global food security due to the reduction of the quality and quantity of grains. Traditional management strategies are based on the use of chemical pesticides and grain protectants, most of which are toxic not only to pest, but also cause damage to the environment and insect resistance. Biological control strategies based on the use of entomopathogenic fungi offer an eco-friendly alternative to agrochemical products. Besides, strategies combining other compounds and organisms to improve the effectiveness of entomopathogenic fungi has been described. Polyamines are essential molecules present in all organisms, in fungi, their physiological functions include regulation of growth, morphogenesis, and stress tolerance. In the present research, the effect of polyamines on germination, viability, and virulence in entomopathogenic fungi to improve the efficiency of controlling insect pests was studied. Conidia of \u003cem\u003eBeauveria bassiana \u003c/em\u003eand \u003cem\u003eMetarhizium anisopliae \u003c/em\u003ewere treated with putrescine, spermidine, and spermine, and a positive effect was observed on spore germination, viability, and an increase was shown in insect mortality in treated spores. \u003cem\u003eMetarhizium anisopliae \u003c/em\u003etreated with\u003cem\u003e \u003c/em\u003eputrescine and spermidine 0.5 mM, achieved a mortality of 77% and 92%, respectively, compared with 42% of the control.\u003cem\u003e \u003c/em\u003eSimilarly, \u003cem\u003eB. bassiana \u003c/em\u003etreated with spermidine caused a mortality of 65% using 0.1 mM, and 75% with 0.5 mM. Our results suggest that polyamines increased the efficiency of \u003cem\u003eM. anisopliae \u003c/em\u003eand \u003cem\u003eB. bassiana \u003c/em\u003econidia against \u003cem\u003eS. zeamais, \u003c/em\u003ewhich might be extrapolated to another pest insect with potential for open-field applications.\u003c/p\u003e","manuscriptTitle":"Improving efficacy of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae against Sitophilus zeamais through polyamine application","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-30 08:19:29","doi":"10.21203/rs.3.rs-3885326/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revisions","date":"2026-02-11T09:35:27+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2025-06-26T07:06:30+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-06-25T14:45:19+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"International Journal of Tropical Insect Science","date":"2024-02-14T14:42:19+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-01-22T14:16:20+00:00","index":"","fulltext":""},{"type":"submitted","content":"International Journal of Tropical Insect Science","date":"2024-01-20T23:06:19+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"international-journal-of-tropical-insect-science","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jtis","sideBox":"Learn more about [International Journal of Tropical Insect Science](http://link.springer.com/journal/42690)","snPcode":"42690","submissionUrl":"https://www.editorialmanager.com/jtis/default2.aspx","title":"International Journal of Tropical Insect Science","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"0fbb7b06-e39b-4fd7-99c3-92dd276a992e","owner":[],"postedDate":"June 30th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-13T23:56:49+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-30 08:19:29","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3885326","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3885326","identity":"rs-3885326","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}