Defining microbiota-derived metabolite butyrate as a senomorphic: therapeutic potential in the age-related T cell senescence | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Defining microbiota-derived metabolite butyrate as a senomorphic: therapeutic potential in the age-related T cell senescence Niharika Arora Duggal, Nia Paddison Rees, Jessica Conway, Ben Dugan, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6419928/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Advancing age is accompanied by an accumulation of senescent T cells that secrete pro-inflammatory senescence-associated secretory phenotype (SASP) molecules. Gut-microbiota-derived signals are increasingly recognised as immunomodulators. In the current study, we demonstrated that ageing and the accumulation of senescent T cells is accompanied by a reduction in microbial-derived short-chain fatty acids (SCFAs). Culturing aged T cells in the presence of butyrate supresses the induction of a senescence phenotype and inhibits the secretion of pro-inflammatory SASP factors, such as IL6 and IL8. Administration of faecal supernatants from young mice rich in butyrate prevented in-vivo accumulation of senescent spleen cells in aged mice. The molecular pathways governing butyrate’s senomorphic potential include a reduced expression of DNA damage markers, lower mitochondrial ROS accumulation and downregulation of mTOR activation, which negatively regulates the transcription factor NFκB. Our findings establish butyrate as a potent senomorphic agent and provides the evidence base for future microbiome restitution intervention trials using butyrate supplements for combatting T cell senescence ultimately reducing inflammation and combatting age-related pathologies to extend lifelong health. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Advancing age is accompanied by remodelling of the immune system and an impaired ability to mount robust immune responses, termed immunesenescence (Duggal 2018 ). Replicative stress is associated with repeated antigenic stimulation across the life course, induces a state of cellular senescence, in aged T cells. This is characterised by cell cycle arrest in response to damage dominantly in memory T cells, which is mediated by tumour suppressor p53 in response to persistent DNA damage (Akbar et al. 2016 ). An increased senescent T cell burden is a hallmark of immunesenescence, and these cells have been reported to be enriched in the CD45RA + ve CCR7 -ve EMRA antigen experienced memory T cell population that expands with age. Despite displaying a state of cell cycle arrest in response to stressors, such as DNA damage, senescent T cells are still functional and possess a unique secretome of a range of pro-inflammatory cytokines, such as IL6, IL8 and TNFα, which are collectively termed senescence-associated secretory phenotype (SASP) (Callender et al. 2018 ). Importantly, a recent study in mice revealed that driving premature T cell senescence using genetic strategies induces multiple ageing-related features, including musculoskeletal, cardiovascular and cognitive alterations, highlighting an important role of senescent T cells in accelerating ageing (Desdín-Micó et al. 2021). Moreover, senescent T cells can contribute to development of a persistent state of basal inflammation in aged participants termed inflammaging (Dugan et al 2023) and reduce the ability of older adults to combat infections as confirmed by the higher mortality rate in older adults from SARS-Cov2 infection (Covre et al. 2020 ). An accumulation of senescent T cells has also been reported in age-related diseases, including rheumatoid arthritis (Raza et al. 2025), Alzheimer’s disease (Gate et al. 2020 ) and cardiovascular diseases (Youn et al. 2019 ), suggesting that clearance of these cells could have geroprotective benefits. A frequent approach to eliminate senescent cells from aged tissues and organs is treatment with senolytic drugs or curtailing /neutralising the production of SASP components using senomorphics, such as metformin and rapamycin (Tchkonia et al. 2013 ). Despite showing promise senomorphics possess broad immunosuppressive effects (Baroja-Mazo et al. 2016 ), limiting their widespread adoption and highlighting the need to identify of safer senomorphic therapies for promoting healthy ageing. The human gastrointestinal tract (GIT) houses a complex ecosystem of microbes, the microbiome, comprising diverse microbial communities and products of their metabolism that contribute to maintaining health and promoting the development and functioning of the immune system (Levy et al. 2017 ). Among the resident bacteria, Bacteriodetes and Bifidobacteria ferment non-digestible dietary fibers to produce short-chain fatty acids (SCFAs), that function as key regulators of host health by promoting intestinal epithelial barrier integrity and serving as a main energy source for colonocytes (Riviere et al. 2016). Butyrate possess immunomodulatory functions, such as promoting the expansion of T regs (Furusawa et al. 2013 ) and B regs (Rosser et al. 2020 ), stimulating anti-inflammatory processes associated with protection from auto-immune mechanisms. Furthermore, butyrate can promote the memory potential and antiviral cytotoxic effector functions of CD8 T cells (Bachem et al. 2019 )d cell differentiation and secretion of IgA and IgG antibodies (Kim et al. 2016 ). GIT physiology and its microbiome composition changes with age characterised by a reduction in SCFA producing microbes and expansion of opportunistic pathogens (pathobionts) leading to intestinal microbial dysbiosis (Buford 2017 ). This produces changes in microbial metabolite profiles and decreased levels of faecal SCFAs with advancing age (Salazer et al 2019). The impact of ageing on the GIT microbiome and its associations with immune senescence and inflammaging is an area of active research (Conway and Duggal 2021 ). Consistent with this predicted association, germ-free mice are protected from microbiome dysbiosis and intestinal barrier dysfunction and do not display features of inflammaging or macrophage ageing (Thevaranjan N et al 2017 ). Further evidence of this causal relationship comes from human faecal microbiota transplant (FMT) study in which transplanting faecal samples from a young donor into aged C.difficile infected patients, increased faecal levels of SCFAs, particularly butyrate, in association with restoring microbiome homeostasis and producing a decrease in peripheral senescent T cell numbers ( Monaghan et al 2021 ). In this study, we sought to better understand the host-microbiome-metabolome-immune axis by investigating the role of butyrate in the release of damaging SASP factors in T cells of aged donors and providing mechanistic insights. Considering that butyrate production declines with age, if the potential benefits of this metabolite in governing the activities of senescent cells is proven, butyrate supplementation will be a valuable novel therapeutic target in future geriatric medicine for maintaining immune homeostasis throughout the ageing process. Materials and Methods Study design, blood and stool sample collection Heparinized peripheral blood and paired stool samples were collected from 40 healthy young (aged 18–37 years; 17 males) and 40 healthy aged donors (aged ≥ 60 years; 18 males; 8 of these aged donors were invited for a follow-up visit for in-vitro assays) from whom informed consent was obtained for a study approved by the HRA (Health Research Authority) and Health and Care Research Wales (HRCW) Approval (IRAS 301974). All participants had no infection at the time of testing, no known immunodeficiency, inflammatory diseases or chronic diseases or any history of chemotherapy or radiotherapy and were not receiving any immunosuppressive medications within the last 6 months. Each donor provided a 18 ml blood sample alongside a paired faecal sample. To 1 gm of faeces 5–10 ceramic microbeads were added, and the vial was shaken at 2,500 rpm for 10 minutes at 20 ο C. Samples were then centrifuged at 13,000 rpm x 10 minutes at 20 ο C and collected supernatant was filtered by passing through a Whatman Uniprep filter vial (0.45µm). Samples were analysed by LC-MS using Waters Acquity UPLC coupled to a Waters TQS-µ mass spectrometer operated in positive multiple reaction mode (MRM). Filtrates were quantified to a limit of quantification of 25 µg/ml in the final solution alongside butyric acid standards (50–1000 µg/ml). For quantification, D2-propionic acid was used as internal standard for butyrate. The mass spectrometer was operated in negative electrospray selected ion monitoring mode for parent ion (89.12), fragment ion (43), cone voltage (20) and collision energy (10). Replicative senescence assay in T cells Peripheral blood mononuclear cells (PBMCs) were isolated utilising Ficoll-Paque density gradient centrifugation and T cells were purified by negative selection (Easysep) according to the manufacturer’s instructions. Freshly isolated T cells (1 x 10 6 cells/ml) were incubated with a 2 µg/ml of purified anti-CD3 mAb (Thermo Fisher, UK) in 96 well-round bottom microtitre plates at 37°C for 72 hours in the presence of butyrate (1 mM; Sigma Aldrich). Conditioned medium was collected by centrifugation at 3,000 rpm for 3 minutes at 20 ο C and stored at -80°C until further analysis. IL6, IL8 (CXCL8), IL1β and CCL3 (MIP1α) concentrations were measured in diluted supernatants (1:50 dilution for IL6 and IL1β ELISAs, 1:100 dilution for CCL3 ELISA, 1:200 dilution for IL8 ELISA) using ELISA duo kits (R&D Systems) as per manufacturer’s instructions. T cell phenotyping Post culture, washed cells were stained with a combination of antibodies: 2 µg/ml CD3 PEcy7 (clone UCHT1; eBioscience™, Invitrogen, Hatfield, UK), 5 µg/ml CD4 eFluor™ 450 (clone OKT4; eBioscience™), 3 µg/ml CD45RA PerCP/cy5.5 (clone HI100; Biolegend) and 8 µg/ml CCR7 APCcy7 (clone G043H7; Biolegend) for 20 minutes on ice in the dark. For intracellular staining, the cells were fixed for 15 minutes, followed by permeabilisation using the transcription factor staining buffer set (eBioscience™) and stained with the following antibodies; 5 µg/ml p-p53 APC (clone: 184727; R and D Systems), 5 µg/ml γ H2AX PE (clone: CR55T33; Thermo Fischer) and 5 µg/ml NFkB PE (clone: B33B4WP; eBiosciences™) for 20 minutes at room temperature. Apoptosis was assessed using Annexin V staining. All samples were run using a Miltenyi MACS Quant (BD Milteny Biotech, Germany) flow cytometer and analysed using FlowJo v10.8.1 software (BD Life Sciences, UK). Concentration-matched isotype controls set (eBioscience™) were used to set the gates and single-fluorochrome stained controls were used to compensate for spectral overlap. Flow cytometry data was analysed using Flow Jo v10.8 software (BD Biosciences, USA). Detecting phosphorylated p38 and p-S6 by flow cytometry p38 (pT180/pY182) and p-S6 (m TORC1 target) expression by PBMCs after co-culture (30min) with Ionomycin (500ng/ml; Sigma Aldrich, UK) and phorbol myristate acetate (PMA) (50 ng/ml; Sigma Aldrich, UK) at 37°C in the presence or absence of butyrate. Cells were then washed and stained with a combination of anti-human CD3, CD4, CD45RA and CCR7 cell surface antibodies for 20 minutes in the dark on ice. Cells were then washed and fixed in 4% paraformaldehyde (PFA) for 30 minutes at room temperature in the dark. Post incubation, 1 ml of ice-cold methanol (100%) was added and the cells were incubated for 10 minutes on ice. Subsequently, cells were incubated for 30 minutes in the dark at room temperature with anti-human 5 µg/ml p38 PE (BD Biosciences) or anti-human 5 µg/ml p-S6 PE (BD Biosciences). Post incubation, cells were washed and samples were acquired using a Miltenyi MACS Quant (BD Miltenyi Biotech, Germany) flow cytometer and analysed using FlowJo v10.8.1 software (BD Life Sciences, UK) to determine frequencies of positive cells and expression levels (MFI) within. Autophagic flux (LC3-II) Measurement of autophagic flux in T cells was performed using an flow cytometry antibody-based LC3 assay kit (Luminex) as per the manufacturer’s instructions. T cells post culture with or without butyrate were incubated with or without Reagent A for 2 hours. Cells were harvested post wash in PBS for 15 minutes at 4 ο C, followed by cell surface staining with anti-human CD3, CD4, CD45RA and CCR7 cell surface antibodies for 20 minutes in the dark on ice. Post incubation, cells were washed in 1x assay buffer diluted in dH 2 O. Cells were then permeabilised using 1x Reagent B for 5 minutes in the dark on ice and centrifuged at 1,500 rpm for 5 minutes. Pelleted cells were then resuspended in 1:20 LC3-II FITC monoclonal antibody diluted in 1x assay buffer and incubated for 30 minutes in the dark at 20 ο C. Finally, T cells were washed in 1x assay buffer before finally being resuspended in PBS and analysed on the Miltenyi MACS Quant (BD Miltenyi Biotech, Germany) flow cytometer. Autophagic flux was calculated using the following formula: (LC3 Reagent A − LC3 Control ) / LC3 Control . ImageStream assessment of DNA damage Post-culture, T cells were stained to assess DNA damage with phosphorylated histone γH 2 AX and samples were acquired first by single-colour fluorescence (to optimize the laser strength); then, experimental samples were run on the calibrated ImageStream IS100 (Amnis) for simultaneous acquisition of bright field, scatter and twelve fluorescent images for each cell. The data files stored as .rif files were analysed using IDEAS 4.0.735 software. Doublets and debris were excluded using bright field area vs. aspect ratio feature and in-focus single cells and to locate the distribution of signals within cells. The intensity of γH 2 AX foci within the nuclear region identified by DAPI staining were quantified for evaluation of DNA damage. MitoTracker and MitoSOX staining Freshly isolated T cells were stained with either 100 nM MitoTracker green or 2 µM MitoSOX (Thermo Fisher) mitochondrial dyes for 30 minutes at 37°C. Cells were washed with 300 µl of non-sterile PBS at 250 x g for 5 minutes at 4°C and subsequently stained with a combination of anti-human CD3, CD4, CD45RA and CCR7 cell surface antibodies for 20 minutes in the dark on ice. Following this, cells were washed again in 300 µl of non-sterile PBS at 250 x g for 5 minutes at 4°C, the supernatants were discarded, and unfixed cells were resuspended in 300 µl of non-sterile PBS for immediate flow cytometric and ImageStream analysis and recording the MFI values within T cell subsets. Gene expression analysis Total RNA was isolated from 4 x 10 6 T cells from untreated and butyrate-treated T cells using the RNeasy Mini isolation kit (Qiagen, Germany). RNA concentrations and quality were measured using the Agilent 2100 BioAnalyzer. Gene expression analysis was performed using the Pan-Cancer Immune Profiling Panel from NanoString technologies (NanoString, USA) containing probes for 730 immune-related genes and 40 housekeeping genes, representing 24 different immune cell types and common checkpoint inhibitors that cover adaptive and innate immune responses. For each sample, 80 ng of total RNA, with a maximum volume of 7 µL (> 28.6 ng/µL), was used. Hybridisation was performed at 65˚C for 17 hours using a SimpliAmp Thermal Cycler (Applied Biosystems, UK). The nCounter Flex system (NanoString, USA) was used for sample preparation. Raw gene counts were normalised using the most stable housekeeping genes from the panel. The background threshold was determined as the average count of the negative controls + 2 standard deviations. Differential expression of genes between control vs butyrate-treated was tested with Mann-Whitney U tests and Benjamin-Hochberg procedures were used to correct for multiple testing. Animal experiments All mouse experiments were carried out in compliance with the Home Office regulations and LASA guidelines and were approved by the University of East Anglia Animal Welfare and Ethical Review Body. Specific Male specific-pathogen-free C57Bl6 mice (aged 24 months) were housed in individually ventilated cages, fed a standard chow diet, provided with water ad libitum and maintained under a 12-h light:12-h dark cycle were housed. Existing microbiota were depleted by delivery of 3-day broad-spectrum antibiotic cocktail regime by combined oral gavage of unpalatable antibiotics (100 µL of vancomycin, 5 mg/mL; metronidazole, 10 mg/mL) while others were able to be provided in drinking water (ampicillin 1 g/L, neomycin 0.5 g/L). Post-antibiotic washout, recipients were rehoused in clean cages and were orally administered 100µl of a faecal water (20 mg stool from n = 10 young donors was pooled, vortexed and resuspended in PBS, centrifuged to pellet bulk material and 0.22µm filtered) or with 100µl PBS, thrice weekly for four weeks. Spleens were collected 24h after the final gavage and were frozen in OCT and stored at -80°C. Tissues were sectioned (7 µm) using a Leica CM1950 cryostat at − 18°C to − 20°C and fixed in 4% paraformaldehyde in PBS for 10 min TEMP, washed 2x for 5 min with 1x TBS and permeabilized with 0.1% Triton X-100 in PBS for 10 min TEMP. Sections were first incubated 1% BSA at 20 o C for 1 hr followed by anti-rabbit p 53 (ab16048; 1:1000 dilution) for 16h at 4 o C. Sections were then washed 3x for 5 min with 1X‐TBS and then incubated with an anti‐rabbit IgG, Alexa Fluor® 594 conjugated secondary polyclonal antibody (goat; A‐11037; 1:1000 dilution) for 1 hr at 20 o C. Sections were mounted with Prolong Diamond mounting media with DAPI. For immunofluorescence, images were acquired using a Zeiss Axio Images were composed and edited with ImageJ software ( https://imagej.nih.gov/ij/ ), optimal brightness and contrast adjustments were applied to the whole image; parameters for image analysis were quantified using the same software. qRT PCR analysis RNA was isolated from 5 to 10 mg of spleen using the Qiagen lipid RNA isolation kit protocol. RNA quantity and quality were determined using a NanoDrop One Spectrophotometer and a 2100 Bioanalyser.Quantitative. q RT PCR was carried out on 5 ng/µl RNA isolated from mouse spleen samples using the iTaq Universal SYBR Green One-Step Kit (Biorad) on a CFX384 Tough Real-Time PCR Detection System (Biorad). Primer sequences were p53 (forward primer TCCGAAGACTGGATGACTGC; reverse primer GATCGTCCATGCAGTGAGGT) and IL6 (forward primer CTGCAAGAGACTTCCATCCAG; reverse primer AGTGGTATAGACAGGTCTGTTGG). The PCR thermocycler condition was as follows: initial reverse transcription at 50°C for 10 minutes, polymerase activation at 95°C for 5 minutes, 40 cycles of denaturation at 95°C for 10 seconds, annealing at 60°C for 30 seconds and initial elongation at 65°C for 31 seconds followed by 60 cycles of elongation at 65°C for 5 seconds. All samples were run in triplicate. Relative gene expression was calculated using followed by normalisation of the values to the relative gene expression of Epcam. Statistical analysis GraphPad Prism version 9 was used to perform all statistical analysis. Inter-experiment comparisons in T cells cultured in presence vs absence of butyrate were analysed by paired test. The bar graph data represented mean ± SEM. Differences were considered significant when P was < 0.05. Results Age-associated lowered stool microbial metabolite SCFA levels correlate with changes in CD28 − ve CD57 + ve senescent T cells Advancing age is accompanied by an accumulation of senescent CD28 − ve CD57 +ve T cells, displaying a state of replicative arrest (Callender et al. 2018 ). Based on initial evidence that GIT microbiota-derived SCFAs are essential to maintaining immunological homeostasis (Conway and Duggal 2021 ). We hypothesized that age-associated microbiome dysbiosis and the resulting loss of SCFAs contribute towards the development of a senescent T cell phenotype. To test our hypothesis, we collected paired stool and blood samples from healthy young and aged participants. We have observed a decline in stool SCFA levels of butyrate (p = 0.008) in older adults [Figure 1A]. Importantly, we reported for the first time a decline in serum levels of butyrate with age (p = 0.04)[Figure 1B]. To investigate if changes in SCFA levels are associated with the accumulation of senescent T cells, peripheral blood senescent T cell frequencies were enumerated in paired blood samples from healthy young and old participants. Peripheral senescent CD28 − ve CD57 +ve CD4 T cell frequency was negatively associated with stool butyrate levels in older adults (p < 0.001, R 2 = 0.43) [Figure 1C]. Senomorphic properties of butyrate: dampening of the senescence-associated secretory phenotype in aged T cells To test whether butyrate possesses senomorphic properties in humans an in-vitro cellular model of T cell senescence by subjecting healthy T cells to a 3-day T cell-specific activation with anti-CD3 and we confirmed that continuous proliferation can induce DNA double-strand breaks (DSBs) indicated by the increased expression of a marker of DNA damage (γH 2 AX) [Supplementary Fig. 1A], and activation of p-p53 known to elicit cell cycle arrest and induce senescence [Supplementary Fig. 1B]. Furthermore, the secretion of factors specific to senescent cells, termed SASP (senescence-associated secretory phenotype), and an upregulation of IL6 was confirmed in cell conditioned medium [Supplementary Fig. 1C]. This in-vitro senescence assay was used to explore the ability of butyrate to modulate SASP features (senomorphic properties). The data obtained [ Fig. 1D] showed a significant decline in the levels of IL6 in conditioned media of aged T cell treated with 1M and 2M butyrate [Figure 1E]. As shown by Annexin V staining this occurred in the absence of any change in cell viability [Figure 1F]. Importantly, 1mM butyrate promoted a significant reduction in the secretion of signature SASP features, including IL-6, p = 0.003 [Figure 1G], IL-8, p = 0.008 [Figure 1H], IL1β p = 0.04 [Figure 1I] by aged T cells. This downregulation of SASP feature, IL6 by butyrate was more significant in young T cells (p < 0.0001) [Supplementary Fig. 1D]. Butyrate regulates senescence phenotype of aged T cells To determine whether butyrate impacts the exhibition of a senescent phenotype in T cell subsets, we compared the protein expression of phosphorylated p53 in naïve (CD45RA + ve CCR7 +ve ), central memory (CD45RA − ve CCR7 +ve ), effector memory (CD45RA − ve CCR7 −ve ) and terminally differentiated EMRA (CD45RA + ve CCR7 −ve ) CD4 and CD8 T cell subsets. Butyrate did not affect T cell subset distribution [Supplementary Table 1], a significant decrease in the frequency of phosphorylated p53-expressing EMRA CD4 T cells (p = 0.02) [Supplementary Fig. 2A], naïve CD8 T cells (p = 0.01) and EMRA CD8 T cells (p = 0.03) [Figure 2A and 2B] was seen in butyrate-cultured aged T cells compared to untreated controls. A similar decline in EMRA CD4 T cells (p = 0.02), and naïve CD8 T cells (p = 0.004) cultured in the presence of butyrate was also seen [Supplementary Fig. 2B and Fig. 2C]. Next, we assessed if the SASP was dependent on the activation of ATM (Ataxia-telangiectasia mutated) by measuring γH2AX, a direct target of ATM in response to DSBs. A significantly lower frequency of γH2AX-expressing naïve CD4 T cells (p = 0.03; Supplementary Fig. 2C] and naïve CD8 T cells (p = 0.05; Fig. 2D]. Additionally, a decline in the expression (intensity) levels of γH2AX was observed in naïve CD8 T cells (p = 0.03) and EMRA CD8 T cells (p = 0.02) [Figure 2E]. These findings were confirmed by the Image stream analysis [Figure 2F] showing reduced accumulation of DNA double-strand breaks in butyrate-treated cells. Impact of butyrate on nuclear factor kappa B (NFκB), p38 MAPK, mTOR signalling and autophagic pathways in aged CD8 T cells To elucidate the mechanisms by which butyrate may influence the secretion of pro-inflammatory cytokines by T cells, we investigated its impact on NFκB inhibition. A significant decrease in the frequency of phosphorylated NFκB-expressing EM and EMRA CD4 T cells (p = 0.05 and p = 0.03, respectively) [Supplementary Fig. 3A] and EMRA CD8 T cells (p = 0.04) [Figure 3A] was seen in butyrate-cultured T cells compared to untreated controls. A similar decline in EM and EMRA CD4 T cells (p = 0.01 and p = 0.02), and EMRA CD8 T cells (p = 0.02) was observed when cultured in the presence of butyrate [Figure 3B]. Examination of the frequency of phosphorylated p38-expressing CD4 [Supplementary Fig. 3C] and CD8 T cells [Figure 3C], revealed no significant differences in butyrate-cultured T cells compared to non-treated controls. Similarly, p-p38 expression levels showed no significant differences [Figure 3D and Supplementary Fig. 3D]. To test whether butyrate treatment blocked mTOR activity, we analysed ribosomal protein S6 kinase phosphorylation by flow cytometry. Butyrate treatment reduced expression of p-S6 (mTORC1 target) in EMRA CD8 T cells (p = 0.03) [Figure 3E] but not CD4 T cell subsets compared to control T cells [Supplementary Fig. 3E]. To examine autophagy, we tested whether butyrate-induced senomorphic properties were associated with increased autophagic processes. Butyrate treatment did not impact the autophagic flux in CD8 T cell subsets [Figure 3F] and CD4 T cell subsets [Supplementary Fig. 3F], based on comparing autophagy protein microtubule-associated protein 1 light chain alpha (LC3) levels between cells treated with bafilomycin A or controls (Alsaleh et al. 2020 ). Impact of butyrate on mitochondria reactive oxygen species generation We made use of the mitochondria-specific MitoTracker™ green dye, which binds mitochondrial membranes in a mitochondrial membrane potential (MMP) independent manner, to determine changes in mitochondrial mass. A significant decline in MitoTracker™ green expression levels was seen in aged EMRA CD8 T cells (p = 0.02) cultured with butyrate [Figure 4A and 4B] and in aged EMRA CD4 T cells [Supplementary Fig. 4A]. These results were confirmed via ImageStream analysis [Figure 4C]. Damaged mitochondria are usually removed by the process of mitophagy (mitochondria-specific autophagy), but this process too is downregulated in senescent cells, leading to a vicious cycle of further reactive oxygen species generation and DNA damage. ROS production measured using the MitoSOX™ Red mitochondrial superoxide indicator showed that there was a significant decrease in MitoSOX expression in aged EMRA CD8 T cells exposed to butyrate (p = 0.001) (Fig. 4D) but not in aged CD4 T cell subsets [Supplementary Fig. 4B]. Transcriptome signature of aged T cells post-butyrate treatment To identify potential molecular signalling pathways in aged T cells that might contribute towards the senomorphic properties of butyrate, we compared gene expression profiles using the Nanostring nCounter gene expression assay, allowing for the detection of 770 genes in T cells from six healthy aged donors that were cultured in the presence versus the absence of 1 mM butyrate for 72 hours. Firstly, we observed a translational repression in the mean gene expression levels of four senescence-associated genes, such as cyclin-dependent kinase inhibitors (CDKN1A), and nine SASP-associated genes, such as IL6, SERPINB2 and others, that are a part of the SenMayo gene set used to identify senescent cells (Saul et al. 2022 ) [Figure 5]. Key signalling molecules regulating the SASP feature, such as NFκB, MAPK, MIF and STAT3 that promotes age-associated changes in mitochondrial dynamics and T-cell cytokine production (Zukowski et al. 2023 ), were downregulated post-butyrate treatment. Senescent T cells have a distinct phenotype, including downregulated expression of the costimulatory molecules CD27 and high expression of killer cell lectin-like receptor subfamily G member 1 (KLRG-1) (Barbarin et al. 2017 ). In this study, we observed an upregulation of CD27 expression and downregulation of KLRG1 in butyrate-treated aged T cells. Tumour suppressor protein, p53, is also known to upregulate anti-apoptotic molecules, such as bax, which are often used as hallmarks of senescent cells. We observed that butyrate treatment downregulates the expression of bax, reducing their resistance to apoptosis. However, we observed an upregulation of key TCR signalling-associated components (CD3, FYN, GPI and Zap70) in butyrate-treated aged T cells which are known to be compromised in senescent T cells (Zhang et al. 2021 ). Lastly, we observed a downregulation in expression of EST1, a known negative regulator of ribosomal biogenesis (Xiao et al. 2022 ), and pro-inflammatory molecules, such as IL32. Together, our data suggests that butyrate has the capacity to restrain expression of genes closely related to senescence and the SASP spectrum. Treatment with faecal supernatants rich in butyrate restricts accumulation of senescent T lymphocytes in a mouse model To validate the in-vitro findings in an in-vivo context, aged mice per-treated with a cocktail of antibiotics were gavaged with faecal filtrate from young mice that contain 0.3–1.2µg/mg butyrate [Figure 6A, B]. Immunohistology showed that spleens of faecal filtrate-treated aged mice had reduced numbers of senescent T cells [Figure 6C-G]. CD3 and p53 dual staining revealed an increase in the number of senescent cells in aged wild-type mice ( p = 0.009) compared to young mice, whereas faecal filtrate treated aged mice had reduced levels of senescent p53 + T cells ( p = 0.04) [Figure 6H]. We also confirmed that spleens of aged wild-type mice exhibit increased p 53 mRNA expression levels compared to young mice ( p = 0.05), and that p53 mRNA levels were significantly lower in faecal filtrate treated aged mice ( p = 0.02) [Figure 6I]. IL6 levels are correlates of inflammation with spleens of aged wild-type mice exhibiting increased IL6 mRNA expression compared to young mice, ( p = 0.05). Consistent with faecal filtrates from young mice having a positive impact on inflammation, treated aged mice had significantly lower levels of IL6 mRNA compared with non-treated aged animals ( p = 0.04) [Figure 6J]. Discussion Emerging evidence has highlighted the importance of a healthy gut microbiome in maintaining host health as we age by ameliorating the negative effects on immunesenescence and inflammaging (Conway and Duggal 2021 ). Therefore, interventions based on improving microbial homeostasis may be an effective strategy for improved senescence-related phenotypes and extending healthy life span. While there is an abundance of preclinical evidence for the geroprotective effects of senolytics, the short-term and long-term safety profile and efficacy is yet to be fully investigated, strengthening the case for the identification of alternative senotherapeutics. Since many of the negative effects associated with senescence are driven by the SASP, senomorphics that modulate the SASP phenotype are emerging as a promising alternative therapeutic strategy. However, our understanding of the targeted effects of microbiome species and their metabolites in immune ageing remains limited. To our knowledge, the current study is the first to demonstrate that butyrate is a promising microbial metabolite possessing senomorphic properties at low millimolar dosages when cultured in-vitro with aged T cells undergoing extensive proliferation through TCR activation. The effects of butyrate are mediated by downregulating mTOR activation, which targets transcriptional regulators of SASP, such as NFκB, and also ameliorates features of senescent T cells. The proportion of T cells with a senescent phenotype increases with age but varies among individuals (Callender et al. 2018 ). We observed that an increased frequency of senescent-like T cells was associated with reduced stool butyrate levels. Using an in-vitro model of inducing senescence in T cells, we have demonstrated that butyrate prevents the acquisition of phenotypic characteristics of senescence and SASP features in activated primary T cells, confirming the senomorphic effects of butyrate. These findings are in line with a previous study reporting that circulating butyrate alleviates senescence in vascular cells of mouse aorta and reduces SASP expression (Han et al. 2018). Importantly, in-vivo supplementation with stool supernatants from young stool rich is butyrate is accompanied by reduced accumulation of senescent cells in T cell zones of the spleen and inflammation in aged mice; providing scientific evidence that butyrate supplementation will be a valuable novel therapeutic target in future geriatric medicine for maintaining immune homeostasis through the ageing process. Activation of stress response signalling cascades medicated via oxidative stress and DNA damage have been linked with activation of MAPKs, such as p-p38, that govern the transcriptional programs in senescent cells and has been demonstrated to be a central driver of the SASP in senescent CD8 T cells and fibroblasts in-vivo (Chambers et al. 2021 ; Sayegh et al. 2023). Mechanistically, our data suggests that in-vitro butyrate treatment reduced the increased phosphorylation and nuclear accumulation of p-p38. The p38 MAPK pathway is known to fuel DNA damage-dependent activation of NFκB, triggering the production and secretion of SASP factors (Freund et al. 2011 ). We observed that butyrate supresses NFκB activation, which is in line with another study reporting that butyrate inhibits NFκB activation in intestinal epithelial cells (Andoh et al. 1999 ) and human PBMCs (Usami et al. 2008 ). mTOR activation contributes, at least in part, to driving a terminally differentiated T cell phenotype, as CD8 T cells from Tsc2 −/− mice experience T-cell specific hyperactivity, display high positivity for T cell senescence and exhibit proliferation dysfunction after antigenic challenge (Pollizzi et al. 2015 ). In our study, butyrate reduces S6 phosphorylation, a surrogate marker for inhibition of mTOR in treated aged T cells. Reductions in mTOR, which positively regulates glycolytic enzymes such as hexokinase II, glyceraldehyde 3-phosphate dehydrogenase (Sun et al 2011 ) may explain reduced levels of expression of this glycolytic enzyme in seen here in butyrate treated T cells. Thus, the possibility that butyrate acts by inducing changes in metabolic activity in senescent cells that rely on glycolysis should be investigated further. Dysfunctional mitochondria are a promoter of the secretory phenotype termed mitochondria dysfunction-associated senescence (MiDAS) governed by a p53 dependant pathway (Bektas et al. 2019 ). Additionally, mitochondria are the main producers of reactive oxygen species (ROS) that accelerate ageing by contributing to progressive cell damage and activation of stress pathways. Studies have reported that the elimination of mitochondria protects against pro-inflammatory SASP features (Correia-Melo et al. 2016). Our data are consistent with butyrate mitigating mitochondrial ROS generation and reducing total mitochondria mass build-up in aged T cells (Callendar et al. 2020) possibly by promoting the clearance of damaged mitochondria through mitophagy (selective degradation of dysfunctional and damaged mitochondria) or by inhibiting unnecessary mitochondria biogenesis, which can be beneficial in enhancing mitochondrial quality. A number of animal studies provide evidence of the anti-inflammatory potential of butyrate and its use in treating lipopolysaccharide-induced lung injury (Ni et al. 2010), preventing lethality of sepsis (Zhang et al. 2007) and atherosclerosis (Aguilar et al. 2014). SCFA are unsurprisingly being considered as supplementary treatment in the clinical management of inflammatory conditions. To date two studies of butyrate administration have been reported in humans, one reporting successfully amelioration of colonic inflammation in IBD after enema administration (Scheppach et al . 1992) and the other in older adults undergoing upper abdominal surgery observed an increase in butyrate concentration in portal vein blood (Van der Beek et al. 2015). These studies establish the safety of therapeutic administration of butyrate administration although key questions regarding dose and formulation in older adults still remain unanswered which requires further investigation before exploiting the potential of SCFAs as an anti-immunesenescence intervention. A key limitation of this study that needs to be acknowledged is that the 1 mM concentration may not accurately reflect physiological concentrations, which vary in-vivo depending on tissue type and can be as high as 20 to 140 mM in the GI tract depending on intestinal microflora composition. We have observed serum levels as low as 0.1 mM, making it difficult to achieve the in-vivo levels of butyrate in the T cell environment in an in-vitro setting. Furthermore, a limitation of the mice experiments is that while the faecal supernatant from young mice was enriched in butyrate, it also contained a complex mixture of other microbial metabolites. Therefore, we cannot attribute the observed reductions in build-up of senescent cells in-vivo solely to butyrate and further studies using purified butyrate supplementation would be necessary to delineate its specific senomoprhic properties in-vivo . In conclusion, our findings provide evidence in support of the use of butyrate to reduce the accumulation of senescent T cells with ageing by increasing butyrate levels through for example, dietary, microbial and therapeutic approaches. A nutritional approach to increase butyrate levels involves increasing the intake of high-fibre foods, like fruits, vegetables, legumes and whole grains, that serve as substrates for commensal microbes to produce SCFAs. Alternatively, consumption of prebiotics, such as inulin and fructooligosaccharides, to selectively stimulate butyrate-producing bacteria or consumption of probiotics with butyrate-producing bacteria are promising strategies. Further, our results provide the evidence base for a future clinical trial using oral sodium supplements or supplementation with butyrate precursors, such as tributyrin supplementation, to not only increase butyrate levels in aged hosts but to also rejuvenate aged T cells. However, this hypothesis needs to be strengthened and there is room for future well-planned studies in humans to help increase the translational potential of these findings. Declarations Authors' contributions NAD gained funding for the study, participated in the design of the study, performed transcriptomic analysis, interpretation of the data and wrote the first draft of the manuscript. NPR participated in sample processing, performed the immune phenotyping, analysed and interpreted the data generated. JC recruited participants, participated in sample processing, performed the immune phenotyping, analysed and interpreted the data generated for the first figure of the manuscript. BD performed the Image J analysis. SRC gained funding for the animal experiments and participated in its experimental design. AP performed the animal experiments and collected the tissues for immunostainings. All authors edited and approved the final version of the manuscript. Declarations of conflict of interest The authors declare that they have no competing interests. Data availability statement The raw flow cytometry data generated during the current study will be made available on Flow repository and the microscopy images generated during the current study will be shared via a google folder. References Alsaleh G, Panse I, Swadling L et al . Autophagy in T cells from aged donors is maintained by spermidine and correlates with function and vaccine responses. Elife 2020; 9: 57950. https://doi.org/10.7554/elife.57950 Andoh A, Fujiyama Y, Hata K, et al Counter-regulatory effect of sodium butyrate on tumour necrosis factor-alpha (TNF-alpha)-induced complement C3 and factor B biosynthesis in human intestinal epithelial cells. Clin Exp Immunol 1999; 118:23–29. https://doi.org/10.1046/j.1365-2249.1999.01038.x Akbar A N, Henson S M, Lanna A. Senescence of T lymphocytes: Implications for enhancing human immunity. Trends Immunol 2016; 12: 866-876. https://doi.org/10.1016/j.it.2016.09.002 Bachem A, Makhlouf C, Binger K J et al . Microbiota-derived short-chain fatty acids promote the memory potential of antigen-activated CD8(+) T cells. Immunity 2019; 51: 285–297. https://doi.org/10.1016/j.immuni.2019.06.002 Baroja-Mazo A, Revilla-Nuin B, Ramirez P, Pons JA. Immunosuppressive potency of mechanistic target of rapamycin inhibitors in solid-organ transplantation. World J Transplant . 2016; 6:183–192. https://doi.org/10.5500/wjt.v6.i1.183 Barbarin A, Cayssials E, Jacomet F et al . Phenotype of NK-Like CD8(+) T Cells with Innate Features in Humans and Their Relevance in Cancer Diseases Frontiers in immunology. 2017; 8 : 316 https://doi.org/10.3389/fimmu.2017.00316 Bektas A, Schurman S H, Gonzalez-Friere M et al . Age-associated changes in human CD4 + T cells point to mitochondrial dysfunction consequent to impaired autophagy. Aging 2019; 11 : 9234–9263. https://doi.org/10.18632/aging.102438 Buford T W. (Dis) Trust your gut: the gut microbiome in age-related inflammation, health, and disease. Microbiome 2017. 5: 1-11. https://doi.org/10.1186/s40168-017-0296-0 Callender L A, Caroll A C, Beal R W J et al. Human CD8+ EMRA T cells display a senescence-associated secretory phenotype regulated by p38 MAPK. Ageing Cell 2018; 12675.8 https://doi.org/10.1111/acel.12675 Callender L A, Caroll A C, Bober E A et al . Mitochondrial mass governs the extent of human T cell senescence. Aging Cell 2020; 19: e13067 https://doi.org/10.1111/acel.13067 Chambers E S, Vukmanovic-Stejic M, Shih BB et al. Recruitment of inflammatory monocytes by senescent fibroblasts inhibits antigen-specific tissue immunity during human aging. Nat Aging 2021; 1: 101-113 https://doi.org/10.1038/s43587-020-00010-6 Conway J and Duggal NA. Ageing of the gut microbiome: Potential influences on immune senescence and inflammageing. Ageing Res Rev . 2021;68:101323. https://doi.org/10.1016/j.arr.2021.101323 Correia- Melo C, Marques F D M, Anderson R et al . Mitochondria are required for pro-ageing features of the senescent phenotype. EMBO 2016; 35:724-742. https://doi.org/10.15252/embj.201592862 Covre L P, De Maeyer R P H, Gomes D C O and Akbar A N. The role of senescent T cells in Immunopathology. Ageing Cell 2020; 12:e13272. https://doi.org/10.1111/acel.13272 Desdín-Micó G, Soto-Heredero G, Aranda J F et al . T cells with dysfunctional mitochondria induce multimorbidity and premature senescence. Science 2020; 368:1371–1376 https://doi.org/10.1126/science.aax0860 Dugan B, Conway J, Duggal. Inflammaging as a target for healthy ageing. Age Ageing 2023; 52:afac328 https://doi.org/10.1093/ageing/afac328 Duggal N A. Reversing the immune ageing clock: lifestyle modifications and pharmacological interventions. Biogerontology 2018; 19:481-496. https://doi.org/10.1007/s10522-018-9771-7 Furusawa Y, Obata Y, Fukuda S et al . Commensal microbe-derived butyrate induces the differentiation of colonic regulatory T cells. Nature 2013; 504: 446–450. https://doi.org/10.1038/nature12721 Freund A, Patil C K , Campisi J. p38 MAPK is a novel DNA damage response-independent regulator of the senescence-associated secretory phenotype. EMBO 2011;30:1536-48. https://doi.org/10.1038/emboj.2011.69 Gate D, Saligrama N, Leventhal O, Yang A C et al . Clonally Expanded CD8 T Cells Patrol the Cerebrospinal Fluid in Alzheimer’s Disease. Nature 2020; 577: 399–404. https://doi.org/10.1038/s41586-019-1895-7 Han Y M, Bedarida T, Ding Y et al . β-Hydroxybutyrate prevents vascular senescence through hnRNP A1-mediated upregulation of Oct 4. Mol Cell 71:1064-1078. https://doi.org/10.1016/j.molcel.2018.07.036 Kim M, Qie Y, Park J, Kim CH. Gut Microbial Metabolites Fuel Host Antibody Responses. Cell Host Microbe 2016;20:202-14. https://doi.org/10.1016/j.chom.2016.07.001 Levy M, Blacher E, Elinav E. Microbiome, metabolites and host immunity. Curr Opin Microbio 2017;25: 8-15 https://doi.org/10.1016/j.mib.2016.10.003 Monaghan TM, Duggal NA, Rosati E, et al . A Multi-Factorial Observational Study on Sequential Fecal Microbiota Transplant in Patients with Medically Refractory Clostridioides difficile Infection. Cells . 2021;10 :3234 https://doi.org/10.3390/cells10113234 Parish S T , Wu J E , Effros R B . Sustained CD28 expression delays multiple features of replicative senescence in human CD8 T lymphocytes. J Clin Immunol 2010; 30:798-805. https://doi.org/10.1007/s10875-010-9449-7 Pollizzi K N, Patel C H, Sun H I et al . m TORC1 and m TORC2 selectively regulate CD8 T cell differentiation. J Clin Invest 2015; 125: 2090- 2108. https://doi.org/10.1172/JCI77746 RazaK, Sharma-OatesA, PadyukovL et al Specific features of immune ageing are detected in the earliest stages in rheumatoid arthritis development. [Under review in eBioMedicine] Rivière A, Selak M, Lantin D, Leroy F, De Vuyst L. Bifidobacteria and butyrate-producing colon bacteria: importance and strategies for their stimulation in the human gut. Front Microbiol. (2016) 7:979. doi: 10.3389/fmicb.2016.00979 Rosser E C, Piper C J M, Matei D E et al . Microbiota-derived metabolites supress arthritis by amplifying aryl-hydrocarbon receptor activation in regulatory B cells. Cell Metabolism 2020; 31: 837-851. https://doi.org/10.1016/j.cmet.2020.03.003 Salazar, N., Arboleya S, Navarro T et al. Age-associated changes in gut microbiota and dietary components related with the immune system in adulthood and old age: a cross sectional study. Nutrients, 2019. 11:17 https://doi.org/10.3390/nu11081765 Saul D, Kosinsky R L, Atkinson E J et al . A new gene set identifies senescent cells and predicts senescence-associated pathways across tissues. Nat Comms 2022; 13:4827.https://doi.org/10.1038/s41467-022-32552-1 Sayegh S, Fantecelle C H, Laphanuwat P et al . Vitamin D3 inhibits p38 MAPK and senescence-associated inflammatory mediator secretion by senescent fibroblasts that impacts immune responses during ageing. Aging Cell 2024; 23:e14093. https://doi.org/10.1111/acel.14093 Sun Q, Chen X, Ma J et al. Mammalian target of rapamycin up-regulation of pyruvate kinase isoenzyme type M2 is critical for aerobic glycolysis and tumorgrowth. Proc. Natl. Acad. Sci. USA 2011; 108, 4129–4134 https://doi.org/10.1073/pnas.1014769108 Tchkonia T, Zhu Y, van Deursen J, Campisi J & Kirkland J L. Cellular senescence and the senescent secretory phenotype: therapeutic opportunities. J. Clin. Invest 2013; 123: 966–972. https://doi.org/10.1172/jci64098 Thevaranjan N, Puchta A, Schulz C, et al . Age-Associated Microbial Dysbiosis Promotes Intestinal Permeability, Systemic Inflammation, and Macrophage Dysfunction. Cell Host Microbe. 2017;21:455-66 e4. https://doi.org/10.1016/j.chom.2017.03.002 Usami M, Kishimoto K, Ohata A et al . Butyrate and trichostatin A attenuate nuclear factor kappaB activation and tumor necrosis factor alpha secretion and increase prostaglandin E2 secretion in human peripheral blood mononuclear cells. Nutr Res 2008; 28, 321–328. https://doi.org/10.1016/j.nutres.2008.02.012 Wiley C D and Campisi J. The metabolic roots of senescence: mechanisms and opportunities for intervention. Nat Metab 2021; 10: 1290-1301. https://doi.org/10.1038/s42255-021-00483-8 Xiao F H, Yu Q, Deng Z L et al ETS1 acts as a regulator of healthy aging via decreasing ribosomal activity. Sci Adv 2022; 8: eabf2017. https://doi.org/10.1126/sciadv.abf2017 Youn J, Jung M K, Yu H T, Kwon J, et al . Increased Frequency of CD4+CD57+ Senescent T Cells with Newly Diagnosed Acute Heart Failure: Exploring New Pathogenic Mechanisms with Clinical Relevance . Scientific Rep 2019; 9: 12887. https://doi.org/10.1038/s41598-019-49332-5 Zhang J, Tianhui H, Xue L et al . Senescent T cells: a potential biomarker and target for cancer therapy. eBioMedicine 2021; 68:103409 https://doi.org/10.1016/j.ebiom.2021.103409 Zukowski E, Sannella M, Rockhold J D et al STAT3 modulates CD4 + T mitochondrial dynamics and function in aging. Ageing Cell 2023; 22: e13996. https://doi.org/10.1111/acel.13996 Additional Declarations The authors declare no competing interests. Supplementary Files SupplementaryFigures.pptx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6419928","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":441159384,"identity":"10d0c29b-f608-47cc-9693-404168960729","order_by":0,"name":"Niharika Arora Duggal","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAx0lEQVRIiWNgGAWjYBADOQMJGJOHSC3GpGtJ3EC0FnMG5mcfPu6xS98u3fx0A0ONHYPBmQP4tVg2sBnPnPEsOXfnnGNmNxiOJTMYnG3Ar8XgAIMxM88B5twNNxKAWtgOMBicJ+AwgwPsn4Fa6tMNbqR/u8HwjygtPCBbDicY3Mgxu8HYdoAIhx3mKWacceC44c4ZOWU3EvuSeSQJed/gePtmhg8HquXNJdK33fjwzU6O70wCAZcxI3MSiI/IUTAKRsEoGAX4AADrl0MxzwjmbQAAAABJRU5ErkJggg==","orcid":"","institution":"Department of Inflammation and Ageing, University of Birmingham","correspondingAuthor":true,"prefix":"","firstName":"Niharika","middleName":"Arora","lastName":"Duggal","suffix":""},{"id":441159385,"identity":"ff7fa202-bb90-41dd-b4e2-116329457c95","order_by":1,"name":"Nia Paddison Rees","email":"","orcid":"","institution":"Department of Inflammation and Ageing, University of Birmingham","correspondingAuthor":false,"prefix":"","firstName":"Nia","middleName":"Paddison","lastName":"Rees","suffix":""},{"id":441159386,"identity":"5c5fefea-7e30-4f3a-ad3a-49dad112b203","order_by":2,"name":"Jessica Conway","email":"","orcid":"","institution":"Department of Inflammation and Ageing, University of Birmingham","correspondingAuthor":false,"prefix":"","firstName":"Jessica","middleName":"","lastName":"Conway","suffix":""},{"id":441159387,"identity":"9d772203-76f9-4a27-a666-e13d404cac70","order_by":3,"name":"Ben Dugan","email":"","orcid":"","institution":"epartment of Inflammation and Ageing, University of Birmingham","correspondingAuthor":false,"prefix":"","firstName":"Ben","middleName":"","lastName":"Dugan","suffix":""},{"id":441159388,"identity":"83d54a15-3aaf-4688-85c4-0a2c0d2bc95e","order_by":4,"name":"Aimee Parker","email":"","orcid":"","institution":"Quadram Institute","correspondingAuthor":false,"prefix":"","firstName":"Aimee","middleName":"","lastName":"Parker","suffix":""},{"id":441159389,"identity":"0271af22-30f5-4e57-9d8f-7cbcf0ef2055","order_by":5,"name":"Simon R Carding","email":"","orcid":"","institution":"Quadram Institute","correspondingAuthor":false,"prefix":"","firstName":"Simon","middleName":"R","lastName":"Carding","suffix":""}],"badges":[],"createdAt":"2025-04-10 11:55:55","currentVersionCode":1,"declarations":{"humanSubjects":true,"vertebrateSubjects":true,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":true,"humanSubjectConsent":true,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":true},"doi":"10.21203/rs.3.rs-6419928/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6419928/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":80393912,"identity":"ca1607be-1050-4c6e-8971-9e8f8ed5a39e","added_by":"auto","created_at":"2025-04-11 11:57:47","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":712987,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Slide1.png","url":"https://assets-eu.researchsquare.com/files/rs-6419928/v1/435100456ee9a2633929f4a3.png"},{"id":80392997,"identity":"9f6bdf00-56e3-4dcc-bca1-98681517eb10","added_by":"auto","created_at":"2025-04-11 11:49:47","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":972959,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Slide2.png","url":"https://assets-eu.researchsquare.com/files/rs-6419928/v1/2a0cd070588945a2c247053b.png"},{"id":80392998,"identity":"c534220e-2b32-4db1-91c1-5987a93d5b64","added_by":"auto","created_at":"2025-04-11 11:49:47","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":521618,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Slide3.png","url":"https://assets-eu.researchsquare.com/files/rs-6419928/v1/c36bb3150d19156fd75d44db.png"},{"id":80393006,"identity":"30686113-12b3-4473-a43d-ff2be6f6bb70","added_by":"auto","created_at":"2025-04-11 11:49:47","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":507449,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Slide4.png","url":"https://assets-eu.researchsquare.com/files/rs-6419928/v1/0e1f4baba2bf18d999943c37.png"},{"id":80393004,"identity":"800fc1b1-7746-4be6-b53b-b6b560568633","added_by":"auto","created_at":"2025-04-11 11:49:47","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":351028,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Slide5.png","url":"https://assets-eu.researchsquare.com/files/rs-6419928/v1/f4565ac2db847e5611c1fbe8.png"},{"id":80393002,"identity":"a4f263ef-656d-4aa0-8d1b-5c51c4f5ab71","added_by":"auto","created_at":"2025-04-11 11:49:47","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1776564,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Slide6.png","url":"https://assets-eu.researchsquare.com/files/rs-6419928/v1/7ffba88475be56f1b7785916.png"},{"id":80394659,"identity":"71b149bc-0b26-4e8e-8030-d831cbedebcc","added_by":"auto","created_at":"2025-04-11 12:13:50","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6279977,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6419928/v1/42f7fea8-89ef-4675-885e-358eb52f4394.pdf"},{"id":80393911,"identity":"22432298-8f1b-4b3a-b980-2e9906b914c3","added_by":"auto","created_at":"2025-04-11 11:57:47","extension":"pptx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1420824,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigures.pptx","url":"https://assets-eu.researchsquare.com/files/rs-6419928/v1/0fe037a2a51a5cd076b45412.pptx"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eDefining microbiota-derived metabolite butyrate as a senomorphic: therapeutic potential in the age-related T cell senescence\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAdvancing age is accompanied by remodelling of the immune system and an impaired ability to mount robust immune responses, termed immunesenescence (Duggal \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Replicative stress is associated with repeated antigenic stimulation across the life course, induces a state of cellular senescence, in aged T cells. This is characterised by cell cycle arrest in response to damage dominantly in memory T cells, which is mediated by tumour suppressor p53 in response to persistent DNA damage (Akbar et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). An increased senescent T cell burden is a hallmark of immunesenescence, and these cells have been reported to be enriched in the CD45RA\u003csup\u003e+\u0026thinsp;ve\u003c/sup\u003eCCR7\u003csup\u003e-ve\u003c/sup\u003e EMRA antigen experienced memory T cell population that expands with age. Despite displaying a state of cell cycle arrest in response to stressors, such as DNA damage, senescent T cells are still functional and possess a unique secretome of a range of pro-inflammatory cytokines, such as IL6, IL8 and TNFα, which are collectively termed senescence-associated secretory phenotype (SASP) (Callender et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Importantly, a recent study in mice revealed that driving premature T cell senescence using genetic strategies induces multiple ageing-related features, including musculoskeletal, cardiovascular and cognitive alterations, highlighting an important role of senescent T cells in accelerating ageing (Desd\u0026iacute;n-Mic\u0026oacute; \u003cem\u003eet al.\u003c/em\u003e 2021). Moreover, senescent T cells can contribute to development of a persistent state of basal inflammation in aged participants termed inflammaging (Dugan \u003cem\u003eet al\u003c/em\u003e 2023) and reduce the ability of older adults to combat infections as confirmed by the higher mortality rate in older adults from SARS-Cov2 infection (Covre et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). An accumulation of senescent T cells has also been reported in age-related diseases, including rheumatoid arthritis (Raza \u003cem\u003eet al.\u003c/em\u003e 2025), Alzheimer\u0026rsquo;s disease (Gate et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) and cardiovascular diseases (Youn et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), suggesting that clearance of these cells could have geroprotective benefits. A frequent approach to eliminate senescent cells from aged tissues and organs is treatment with senolytic drugs or curtailing /neutralising the production of SASP components using senomorphics, such as metformin and rapamycin (Tchkonia et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Despite showing promise senomorphics possess broad immunosuppressive effects (Baroja-Mazo et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), limiting their widespread adoption and highlighting the need to identify of safer senomorphic therapies for promoting healthy ageing.\u003c/p\u003e \u003cp\u003eThe human gastrointestinal tract (GIT) houses a complex ecosystem of microbes, the microbiome, comprising diverse microbial communities and products of their metabolism that contribute to maintaining health and promoting the development and functioning of the immune system (Levy et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Among the resident bacteria, \u003cem\u003eBacteriodetes\u003c/em\u003e and \u003cem\u003eBifidobacteria\u003c/em\u003e ferment non-digestible dietary fibers to produce short-chain fatty acids (SCFAs), that function as key regulators of host health by promoting intestinal epithelial barrier integrity and serving as a main energy source for colonocytes (Riviere \u003cem\u003eet al.\u003c/em\u003e 2016). Butyrate possess immunomodulatory functions, such as promoting the expansion of T\u003csub\u003eregs\u003c/sub\u003e (Furusawa et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) and B\u003csub\u003eregs\u003c/sub\u003e (Rosser et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), stimulating anti-inflammatory processes associated with protection from auto-immune mechanisms. Furthermore, butyrate can promote the memory potential and antiviral cytotoxic effector functions of CD8 T cells (Bachem et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2019\u003c/span\u003e)d cell differentiation and secretion of IgA and IgG antibodies (Kim et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGIT physiology and its microbiome composition changes with age characterised by a reduction in SCFA producing microbes and expansion of opportunistic pathogens (pathobionts) leading to intestinal microbial dysbiosis (Buford \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). This produces changes in microbial metabolite profiles and decreased levels of faecal SCFAs with advancing age (Salazer \u003cem\u003eet al\u003c/em\u003e 2019). The impact of ageing on the GIT microbiome and its associations with immune senescence and inflammaging is an area of active research (Conway and Duggal \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Consistent with this predicted association, germ-free mice are protected from microbiome dysbiosis and intestinal barrier dysfunction and do not display features of inflammaging or macrophage ageing (Thevaranjan N et al \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Further evidence of this causal relationship comes from human faecal microbiota transplant (FMT) study in which transplanting faecal samples from a young donor into aged \u003cem\u003eC.difficile\u003c/em\u003e infected patients, increased faecal levels of SCFAs, particularly butyrate, in association with restoring microbiome homeostasis and producing a decrease in peripheral senescent T cell numbers ( Monaghan et al \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this study, we sought to better understand the host-microbiome-metabolome-immune axis by investigating the role of butyrate in the release of damaging SASP factors in T cells of aged donors and providing mechanistic insights. Considering that butyrate production declines with age, if the potential benefits of this metabolite in governing the activities of senescent cells is proven, butyrate supplementation will be a valuable novel therapeutic target in future geriatric medicine for maintaining immune homeostasis throughout the ageing process.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStudy design, blood and stool sample collection\u003c/h2\u003e \u003cp\u003eHeparinized peripheral blood and paired stool samples were collected from 40 healthy young (aged 18\u0026ndash;37 years; 17 males) and 40 healthy aged donors (aged\u0026thinsp;\u0026ge;\u0026thinsp;60 years; 18 males; 8 of these aged donors were invited for a follow-up visit for \u003cem\u003ein-vitro\u003c/em\u003e assays) from whom informed consent was obtained for a study approved by the HRA (Health Research Authority) and Health and Care Research Wales (HRCW) Approval (IRAS 301974). All participants had no infection at the time of testing, no known immunodeficiency, inflammatory diseases or chronic diseases or any history of chemotherapy or radiotherapy and were not receiving any immunosuppressive medications within the last 6 months. Each donor provided a 18 ml blood sample alongside a paired faecal sample. To 1 gm of faeces 5\u0026ndash;10 ceramic microbeads were added, and the vial was shaken at 2,500 rpm for 10 minutes at 20\u003csup\u003eο\u003c/sup\u003eC. Samples were then centrifuged at 13,000 rpm x 10 minutes at 20\u003csup\u003eο\u003c/sup\u003eC and collected supernatant was filtered by passing through a Whatman Uniprep filter vial (0.45\u0026micro;m). Samples were analysed by LC-MS using Waters Acquity UPLC coupled to a Waters TQS-\u0026micro; mass spectrometer operated in positive multiple reaction mode (MRM). Filtrates were quantified to a limit of quantification of 25 \u0026micro;g/ml in the final solution alongside butyric acid standards (50\u0026ndash;1000 \u0026micro;g/ml). For quantification, D2-propionic acid was used as internal standard for butyrate. The mass spectrometer was operated in negative electrospray selected ion monitoring mode for parent ion (89.12), fragment ion (43), cone voltage (20) and collision energy (10).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eReplicative senescence assay in T cells\u003c/h3\u003e\n\u003cp\u003ePeripheral blood mononuclear cells (PBMCs) were isolated utilising Ficoll-Paque density gradient centrifugation and T cells were purified by negative selection (Easysep) according to the manufacturer\u0026rsquo;s instructions. Freshly isolated T cells (1 x 10\u003csup\u003e6\u003c/sup\u003e cells/ml) were incubated with a 2 \u0026micro;g/ml of purified anti-CD3 mAb (Thermo Fisher, UK) in 96 well-round bottom microtitre plates at 37\u0026deg;C for 72 hours in the presence of butyrate (1 mM; Sigma Aldrich). Conditioned medium was collected by centrifugation at 3,000 rpm for 3 minutes at 20\u003csup\u003eο\u003c/sup\u003eC and stored at -80\u0026deg;C until further analysis. IL6, IL8 (CXCL8), IL1β and CCL3 (MIP1α) concentrations were measured in diluted supernatants (1:50 dilution for IL6 and IL1β ELISAs, 1:100 dilution for CCL3 ELISA, 1:200 dilution for IL8 ELISA) using ELISA duo kits (R\u0026amp;D Systems) as per manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n\u003ch3\u003eT cell phenotyping\u003c/h3\u003e\n\u003cp\u003ePost culture, washed cells were stained with a combination of antibodies: 2 \u0026micro;g/ml CD3 PEcy7 (clone UCHT1; eBioscience\u0026trade;, Invitrogen, Hatfield, UK), 5 \u0026micro;g/ml CD4 eFluor\u0026trade; 450 (clone OKT4; eBioscience\u0026trade;), 3 \u0026micro;g/ml CD45RA PerCP/cy5.5 (clone HI100; Biolegend) and 8 \u0026micro;g/ml CCR7 APCcy7 (clone G043H7; Biolegend) for 20 minutes on ice in the dark. For intracellular staining, the cells were fixed for 15 minutes, followed by permeabilisation using the transcription factor staining buffer set (eBioscience\u0026trade;) and stained with the following antibodies; 5 \u0026micro;g/ml p-p53 APC (clone: 184727; R and D Systems), 5 \u0026micro;g/ml γ H2AX PE (clone: CR55T33; Thermo Fischer) and 5 \u0026micro;g/ml NFkB PE (clone: B33B4WP; eBiosciences\u0026trade;) for 20 minutes at room temperature. Apoptosis was assessed using Annexin V staining. All samples were run using a Miltenyi MACS Quant (BD Milteny Biotech, Germany) flow cytometer and analysed using FlowJo v10.8.1 software (BD Life Sciences, UK). Concentration-matched isotype controls set (eBioscience\u0026trade;) were used to set the gates and single-fluorochrome stained controls were used to compensate for spectral overlap. Flow cytometry data was analysed using Flow Jo v10.8 software (BD Biosciences, USA).\u003c/p\u003e\n\u003ch3\u003eDetecting phosphorylated p38 and p-S6 by flow cytometry\u003c/h3\u003e\n\u003cp\u003ep38 (pT180/pY182) and p-S6 (m TORC1 target) expression by PBMCs after co-culture (30min) with Ionomycin (500ng/ml; Sigma Aldrich, UK) and phorbol myristate acetate (PMA) (50 ng/ml; Sigma Aldrich, UK) at 37\u0026deg;C in the presence or absence of butyrate. Cells were then washed and stained with a combination of anti-human CD3, CD4, CD45RA and CCR7 cell surface antibodies for 20 minutes in the dark on ice. Cells were then washed and fixed in 4% paraformaldehyde (PFA) for 30 minutes at room temperature in the dark. Post incubation, 1 ml of ice-cold methanol (100%) was added and the cells were incubated for 10 minutes on ice. Subsequently, cells were incubated for 30 minutes in the dark at room temperature with anti-human 5 \u0026micro;g/ml p38 PE (BD Biosciences) or anti-human 5 \u0026micro;g/ml p-S6 PE (BD Biosciences). Post incubation, cells were washed and samples were acquired using a Miltenyi MACS Quant (BD Miltenyi Biotech, Germany) flow cytometer and analysed using FlowJo v10.8.1 software (BD Life Sciences, UK) to determine frequencies of positive cells and expression levels (MFI) within.\u003c/p\u003e\n\u003ch3\u003eAutophagic flux (LC3-II)\u003c/h3\u003e\n\u003cp\u003eMeasurement of autophagic flux in T cells was performed using an flow cytometry antibody-based LC3 assay kit (Luminex) as per the manufacturer\u0026rsquo;s instructions. T cells post culture with or without butyrate were incubated with or without Reagent A for 2 hours. Cells were harvested post wash in PBS for 15 minutes at 4\u003csup\u003eο\u003c/sup\u003eC, followed by cell surface staining with anti-human CD3, CD4, CD45RA and CCR7 cell surface antibodies for 20 minutes in the dark on ice. Post incubation, cells were washed in 1x assay buffer diluted in dH\u003csub\u003e2\u003c/sub\u003eO. Cells were then permeabilised using 1x Reagent B for 5 minutes in the dark on ice and centrifuged at 1,500 rpm for 5 minutes. Pelleted cells were then resuspended in 1:20 LC3-II FITC monoclonal antibody diluted in 1x assay buffer and incubated for 30 minutes in the dark at 20\u003csup\u003eο\u003c/sup\u003eC. Finally, T cells were washed in 1x assay buffer before finally being resuspended in PBS and analysed on the Miltenyi MACS Quant (BD Miltenyi Biotech, Germany) flow cytometer. Autophagic flux was calculated using the following formula: (LC3\u003csub\u003eReagent A \u0026minus;\u003c/sub\u003e LC3\u003csub\u003eControl\u003c/sub\u003e) / LC3\u003csub\u003eControl\u003c/sub\u003e.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eImageStream assessment of DNA damage\u003c/h2\u003e \u003cp\u003ePost-culture, T cells were stained to assess DNA damage with phosphorylated histone γH\u003csub\u003e2\u003c/sub\u003eAX and samples were acquired first by single-colour fluorescence (to optimize the laser strength); then, experimental samples were run on the calibrated ImageStream IS100 (Amnis) for simultaneous acquisition of bright field, scatter and twelve fluorescent images for each cell. The data files stored as .rif files were analysed using IDEAS 4.0.735 software. Doublets and debris were excluded using bright field area vs. aspect ratio feature and in-focus single cells and to locate the distribution of signals within cells. The intensity of γH\u003csub\u003e2\u003c/sub\u003eAX foci within the nuclear region identified by DAPI staining were quantified for evaluation of DNA damage.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMitoTracker and MitoSOX staining\u003c/h3\u003e\n\u003cp\u003eFreshly isolated T cells were stained with either 100 nM MitoTracker green or 2 \u0026micro;M MitoSOX (Thermo Fisher) mitochondrial dyes for 30 minutes at 37\u0026deg;C. Cells were washed with 300 \u0026micro;l of non-sterile PBS at 250 x g for 5 minutes at 4\u0026deg;C and subsequently stained with a combination of anti-human CD3, CD4, CD45RA and CCR7 cell surface antibodies for 20 minutes in the dark on ice. Following this, cells were washed again in 300 \u0026micro;l of non-sterile PBS at 250 x g for 5 minutes at 4\u0026deg;C, the supernatants were discarded, and unfixed cells were resuspended in 300 \u0026micro;l of non-sterile PBS for immediate flow cytometric and ImageStream analysis and recording the MFI values within T cell subsets.\u003c/p\u003e\n\u003ch3\u003eGene expression analysis\u003c/h3\u003e\n\u003cp\u003eTotal RNA was isolated from 4 x 10\u003csup\u003e6\u003c/sup\u003e T cells from untreated and butyrate-treated T cells using the RNeasy Mini isolation kit (Qiagen, Germany). RNA concentrations and quality were measured using the Agilent 2100 BioAnalyzer. Gene expression analysis was performed using the Pan-Cancer Immune Profiling Panel from NanoString technologies (NanoString, USA) containing probes for 730 immune-related genes and 40 housekeeping genes, representing 24 different immune cell types and common checkpoint inhibitors that cover adaptive and innate immune responses. For each sample, 80 ng of total RNA, with a maximum volume of 7 \u0026micro;L (\u0026gt;\u0026thinsp;28.6 ng/\u0026micro;L), was used. Hybridisation was performed at 65˚C for 17 hours using a SimpliAmp Thermal Cycler (Applied Biosystems, UK). The nCounter Flex system (NanoString, USA) was used for sample preparation. Raw gene counts were normalised using the most stable housekeeping genes from the panel. The background threshold was determined as the average count of the negative controls\u0026thinsp;+\u0026thinsp;2 standard deviations. Differential expression of genes between control vs butyrate-treated was tested with Mann-Whitney U tests and Benjamin-Hochberg procedures were used to correct for multiple testing.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eAnimal experiments\u003c/h2\u003e \u003cp\u003eAll mouse experiments were carried out in compliance with the Home Office regulations and LASA guidelines and were approved by the University of East Anglia Animal Welfare and Ethical Review Body. Specific Male specific-pathogen-free C57Bl6 mice (aged 24 months) were housed in individually ventilated cages, fed a standard chow diet, provided with water ad libitum and maintained under a 12-h light:12-h dark cycle were housed. Existing microbiota were depleted by delivery of 3-day broad-spectrum antibiotic cocktail regime by combined oral gavage of unpalatable antibiotics (100 \u0026micro;L of vancomycin, 5 mg/mL; metronidazole, 10 mg/mL) while others were able to be provided in drinking water (ampicillin 1 g/L, neomycin 0.5 g/L). Post-antibiotic washout, recipients were rehoused in clean cages and were orally administered 100\u0026micro;l of a faecal water (20 mg stool from n\u0026thinsp;=\u0026thinsp;10 young donors was pooled, vortexed and resuspended in PBS, centrifuged to pellet bulk material and 0.22\u0026micro;m filtered) or with 100\u0026micro;l PBS, thrice weekly for four weeks. Spleens were collected 24h after the final gavage and were frozen in OCT and stored at -80\u0026deg;C. Tissues were sectioned (7 \u0026micro;m) using a Leica CM1950 cryostat at \u0026minus;\u0026thinsp;18\u0026deg;C to \u0026minus;\u0026thinsp;20\u0026deg;C and fixed in 4% paraformaldehyde in PBS for 10 min TEMP, washed 2x for 5 min with 1x TBS and permeabilized with 0.1% Triton X-100 in PBS for 10 min TEMP. Sections were first incubated 1% BSA at 20\u003csup\u003eo\u003c/sup\u003eC for 1 hr followed by anti-rabbit p 53 (ab16048; 1:1000 dilution) for 16h at 4\u003csup\u003eo\u003c/sup\u003eC. Sections were then washed 3x for 5 min with 1X‐TBS and then incubated with an anti‐rabbit IgG, Alexa Fluor\u0026reg; 594 conjugated secondary polyclonal antibody (goat; A‐11037; 1:1000 dilution) for 1 hr at 20\u003csup\u003eo\u003c/sup\u003eC. Sections were mounted with Prolong Diamond mounting media with DAPI. For immunofluorescence, images were acquired using a Zeiss Axio Images were composed and edited with ImageJ software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://imagej.nih.gov/ij/\u003c/span\u003e\u003cspan address=\"https://imagej.nih.gov/ij/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), optimal brightness and contrast adjustments were applied to the whole image; parameters for image analysis were quantified using the same software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eqRT PCR analysis\u003c/h2\u003e \u003cp\u003eRNA was isolated from 5 to 10 mg of spleen using the Qiagen lipid RNA isolation kit protocol. RNA quantity and quality were determined using a NanoDrop One Spectrophotometer and a 2100 Bioanalyser.Quantitative. q RT PCR was carried out on 5 ng/\u0026micro;l RNA isolated from mouse spleen samples using the iTaq Universal SYBR Green One-Step Kit (Biorad) on a CFX384 Tough Real-Time PCR Detection System (Biorad). Primer sequences were p53 (forward primer TCCGAAGACTGGATGACTGC; reverse primer GATCGTCCATGCAGTGAGGT) and IL6 (forward primer CTGCAAGAGACTTCCATCCAG; reverse primer AGTGGTATAGACAGGTCTGTTGG). The PCR thermocycler condition was as follows: initial reverse transcription at 50\u0026deg;C for 10 minutes, polymerase activation at 95\u0026deg;C for 5 minutes, 40 cycles of denaturation at 95\u0026deg;C for 10 seconds, annealing at 60\u0026deg;C for 30 seconds and initial elongation at 65\u0026deg;C for 31 seconds followed by 60 cycles of elongation at 65\u0026deg;C for 5 seconds. All samples were run in triplicate. Relative gene expression was calculated using followed by normalisation of the values to the relative gene expression of Epcam.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eGraphPad Prism version 9 was used to perform all statistical analysis. Inter-experiment comparisons in T cells cultured in presence vs absence of butyrate were analysed by paired test. The bar graph data represented mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. Differences were considered significant when \u003cem\u003eP\u003c/em\u003e was \u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eAge-associated lowered stool microbial metabolite SCFA levels correlate with changes in CD28\u003c/span\u003e \u003csup\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003e\u0026minus;\u0026thinsp;ve\u003c/span\u003e \u003c/sup\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eCD57\u003c/span\u003e\u003csup\u003e\u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003e+\u0026thinsp;ve\u003c/span\u003e\u003c/sup\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003esenescent T cells\u003c/span\u003e\u003c/p\u003e \u003cp\u003eAdvancing age is accompanied by an accumulation of senescent CD28\u003csup\u003e\u0026minus;\u0026thinsp;ve\u003c/sup\u003eCD57\u003csup\u003e+ve\u003c/sup\u003e T cells, displaying a state of replicative arrest (Callender et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Based on initial evidence that GIT microbiota-derived SCFAs are essential to maintaining immunological homeostasis (Conway and Duggal \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). We hypothesized that age-associated microbiome dysbiosis and the resulting loss of SCFAs contribute towards the development of a senescent T cell phenotype. To test our hypothesis, we collected paired stool and blood samples from healthy young and aged participants. We have observed a decline in stool SCFA levels of butyrate (p\u0026thinsp;=\u0026thinsp;0.008) in older adults [Figure 1A]. Importantly, we reported for the first time a decline in serum levels of butyrate with age (p\u0026thinsp;=\u0026thinsp;0.04)[Figure 1B]. To investigate if changes in SCFA levels are associated with the accumulation of senescent T cells, peripheral blood senescent T cell frequencies were enumerated in paired blood samples from healthy young and old participants. Peripheral senescent CD28\u003csup\u003e\u0026minus;\u0026thinsp;ve\u003c/sup\u003eCD57\u003csup\u003e+ve\u003c/sup\u003e CD4 T cell frequency was negatively associated with stool butyrate levels in older adults (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.43) [Figure 1C].\u003c/p\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eSenomorphic properties of butyrate: dampening of the senescence-associated secretory phenotype in aged T cells\u003c/h2\u003e \u003cp\u003eTo test whether butyrate possesses senomorphic properties in humans an \u003cem\u003ein-vitro\u003c/em\u003e cellular model of T cell senescence by subjecting healthy T cells to a 3-day T cell-specific activation with anti-CD3 and we confirmed that continuous proliferation can induce DNA double-strand breaks (DSBs) indicated by the increased expression of a marker of DNA damage (γH\u003csub\u003e2\u003c/sub\u003eAX) [Supplementary Fig.\u0026nbsp;1A], and activation of p-p53 known to elicit cell cycle arrest and induce senescence [Supplementary Fig.\u0026nbsp;1B]. Furthermore, the secretion of factors specific to senescent cells, termed SASP (senescence-associated secretory phenotype), and an upregulation of IL6 was confirmed in cell conditioned medium [Supplementary Fig.\u0026nbsp;1C].\u003c/p\u003e \u003cp\u003eThis in-vitro senescence assay was used to explore the ability of butyrate to modulate SASP features (senomorphic properties). The data obtained [ Fig.\u0026nbsp;1D] showed a significant decline in the levels of IL6 in conditioned media of aged T cell treated with 1M and 2M butyrate [Figure 1E]. As shown by Annexin V staining this occurred in the absence of any change in cell viability [Figure 1F]. Importantly, 1mM butyrate promoted a significant reduction in the secretion of signature SASP features, including IL-6, p\u0026thinsp;=\u0026thinsp;0.003 [Figure 1G], IL-8, p\u0026thinsp;=\u0026thinsp;0.008 [Figure 1H], IL1β p\u0026thinsp;=\u0026thinsp;0.04 [Figure 1I] by aged T cells. This downregulation of SASP feature, IL6 by butyrate was more significant in young T cells (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) [Supplementary Fig.\u0026nbsp;1D].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eButyrate regulates senescence phenotype of aged T cells\u003c/h2\u003e \u003cp\u003eTo determine whether butyrate impacts the exhibition of a senescent phenotype in T cell subsets, we compared the protein expression of phosphorylated p53 in na\u0026iuml;ve (CD45RA\u003csup\u003e+\u0026thinsp;ve\u003c/sup\u003eCCR7\u003csup\u003e+ve\u003c/sup\u003e), central memory (CD45RA\u003csup\u003e\u0026minus;\u0026thinsp;ve\u003c/sup\u003eCCR7\u003csup\u003e+ve\u003c/sup\u003e), effector memory (CD45RA\u003csup\u003e\u0026minus;\u0026thinsp;ve\u003c/sup\u003eCCR7\u003csup\u003e\u0026minus;ve\u003c/sup\u003e) and terminally differentiated EMRA (CD45RA\u003csup\u003e+\u0026thinsp;ve\u003c/sup\u003eCCR7\u003csup\u003e\u0026minus;ve\u003c/sup\u003e) CD4 and CD8 T cell subsets. Butyrate did not affect T cell subset distribution [Supplementary Table\u0026nbsp;1], a significant decrease in the frequency of phosphorylated p53-expressing EMRA CD4 T cells (p\u0026thinsp;=\u0026thinsp;0.02) [Supplementary Fig.\u0026nbsp;2A], na\u0026iuml;ve CD8 T cells (p\u0026thinsp;=\u0026thinsp;0.01) and EMRA CD8 T cells (p\u0026thinsp;=\u0026thinsp;0.03) [Figure 2A and 2B] was seen in butyrate-cultured aged T cells compared to untreated controls. A similar decline in EMRA CD4 T cells (p\u0026thinsp;=\u0026thinsp;0.02), and na\u0026iuml;ve CD8 T cells (p\u0026thinsp;=\u0026thinsp;0.004) cultured in the presence of butyrate was also seen [Supplementary Fig.\u0026nbsp;2B and Fig.\u0026nbsp;2C].\u003c/p\u003e \u003cp\u003eNext, we assessed if the SASP was dependent on the activation of ATM (Ataxia-telangiectasia mutated) by measuring γH2AX, a direct target of ATM in response to DSBs. A significantly lower frequency of γH2AX-expressing na\u0026iuml;ve CD4 T cells (p\u0026thinsp;=\u0026thinsp;0.03; Supplementary Fig.\u0026nbsp;2C] and na\u0026iuml;ve CD8 T cells (p\u0026thinsp;=\u0026thinsp;0.05; Fig.\u0026nbsp;2D]. Additionally, a decline in the expression (intensity) levels of γH2AX was observed in na\u0026iuml;ve CD8 T cells (p\u0026thinsp;=\u0026thinsp;0.03) and EMRA CD8 T cells (p\u0026thinsp;=\u0026thinsp;0.02) [Figure 2E]. These findings were confirmed by the Image stream analysis [Figure 2F] showing reduced accumulation of DNA double-strand breaks in butyrate-treated cells.\u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eImpact of butyrate on nuclear factor kappa B (NFκB), p38 MAPK, mTOR signalling and autophagic pathways in aged CD8 T cells\u003c/span\u003e \u003c/p\u003e \u003cp\u003eTo elucidate the mechanisms by which butyrate may influence the secretion of pro-inflammatory cytokines by T cells, we investigated its impact on NFκB inhibition. A significant decrease in the frequency of phosphorylated NFκB-expressing EM and EMRA CD4 T cells (p\u0026thinsp;=\u0026thinsp;0.05 and p\u0026thinsp;=\u0026thinsp;0.03, respectively) [Supplementary Fig.\u0026nbsp;3A] and EMRA CD8 T cells (p\u0026thinsp;=\u0026thinsp;0.04) [Figure 3A] was seen in butyrate-cultured T cells compared to untreated controls. A similar decline in EM and EMRA CD4 T cells (p\u0026thinsp;=\u0026thinsp;0.01 and p\u0026thinsp;=\u0026thinsp;0.02), and EMRA CD8 T cells (p\u0026thinsp;=\u0026thinsp;0.02) was observed when cultured in the presence of butyrate [Figure 3B].\u003c/p\u003e \u003cp\u003eExamination of the frequency of phosphorylated p38-expressing CD4 [Supplementary Fig.\u0026nbsp;3C] and CD8 T cells [Figure 3C], revealed no significant differences in butyrate-cultured T cells compared to non-treated controls. Similarly, p-p38 expression levels showed no significant differences [Figure 3D and Supplementary Fig.\u0026nbsp;3D].\u003c/p\u003e \u003cp\u003eTo test whether butyrate treatment blocked mTOR activity, we analysed ribosomal protein S6 kinase phosphorylation by flow cytometry. Butyrate treatment reduced expression of p-S6 (mTORC1 target) in EMRA CD8 T cells (p\u0026thinsp;=\u0026thinsp;0.03) [Figure 3E] but not CD4 T cell subsets compared to control T cells [Supplementary Fig.\u0026nbsp;3E].\u003c/p\u003e \u003cp\u003eTo examine autophagy, we tested whether butyrate-induced senomorphic properties were associated with increased autophagic processes. Butyrate treatment did not impact the autophagic flux in CD8 T cell subsets [Figure 3F] and CD4 T cell subsets [Supplementary Fig.\u0026nbsp;3F], based on comparing autophagy protein microtubule-associated protein 1 light chain alpha (LC3) levels between cells treated with bafilomycin A or controls (Alsaleh et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eImpact of butyrate on mitochondria reactive oxygen species generation\u003c/h2\u003e \u003cp\u003eWe made use of the mitochondria-specific MitoTracker\u0026trade; green dye, which binds mitochondrial membranes in a mitochondrial membrane potential (MMP) independent manner, to determine changes in mitochondrial mass. A significant decline in MitoTracker\u0026trade; green expression levels was seen in aged EMRA CD8 T cells (p\u0026thinsp;=\u0026thinsp;0.02) cultured with butyrate [Figure 4A and 4B] and in aged EMRA CD4 T cells [Supplementary Fig.\u0026nbsp;4A]. These results were confirmed via ImageStream analysis [Figure 4C]. Damaged mitochondria are usually removed by the process of mitophagy (mitochondria-specific autophagy), but this process too is downregulated in senescent cells, leading to a vicious cycle of further reactive oxygen species generation and DNA damage. ROS production measured using the MitoSOX\u0026trade; Red mitochondrial superoxide indicator showed that there was a significant decrease in MitoSOX expression in aged EMRA CD8 T cells exposed to butyrate (p\u0026thinsp;=\u0026thinsp;0.001) (Fig.\u0026nbsp;4D) but not in aged CD4 T cell subsets [Supplementary Fig.\u0026nbsp;4B].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eTranscriptome signature of aged T cells post-butyrate treatment\u003c/h2\u003e \u003cp\u003eTo identify potential molecular signalling pathways in aged T cells that might contribute towards the senomorphic properties of butyrate, we compared gene expression profiles using the Nanostring nCounter gene expression assay, allowing for the detection of 770 genes in T cells from six healthy aged donors that were cultured in the presence versus the absence of 1 mM butyrate for 72 hours. Firstly, we observed a translational repression in the mean gene expression levels of four senescence-associated genes, such as cyclin-dependent kinase inhibitors (CDKN1A), and nine SASP-associated genes, such as IL6, SERPINB2 and others, that are a part of the SenMayo gene set used to identify senescent cells (Saul et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) [Figure 5]. Key signalling molecules regulating the SASP feature, such as NFκB, MAPK, MIF and STAT3 that promotes age-associated changes in mitochondrial dynamics and T-cell cytokine production (Zukowski et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), were downregulated post-butyrate treatment. Senescent T cells have a distinct phenotype, including downregulated expression of the costimulatory molecules CD27 and high expression of killer cell lectin-like receptor subfamily G member 1 (KLRG-1) (Barbarin et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In this study, we observed an upregulation of CD27 expression and downregulation of KLRG1 in butyrate-treated aged T cells. Tumour suppressor protein, p53, is also known to upregulate anti-apoptotic molecules, such as bax, which are often used as hallmarks of senescent cells. We observed that butyrate treatment downregulates the expression of bax, reducing their resistance to apoptosis. However, we observed an upregulation of key TCR signalling-associated components (CD3, FYN, GPI and Zap70) in butyrate-treated aged T cells which are known to be compromised in senescent T cells (Zhang et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Lastly, we observed a downregulation in expression of EST1, a known negative regulator of ribosomal biogenesis (Xiao et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), and pro-inflammatory molecules, such as IL32. Together, our data suggests that butyrate has the capacity to restrain expression of genes closely related to senescence and the SASP spectrum.\u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eTreatment with faecal supernatants rich in butyrate restricts accumulation of senescent T lymphocytes in a mouse model\u003c/span\u003e \u003c/p\u003e \u003cp\u003eTo validate the \u003cem\u003ein-vitro\u003c/em\u003e findings in an \u003cem\u003ein-vivo\u003c/em\u003e context, aged mice per-treated with a cocktail of antibiotics were gavaged with faecal filtrate from young mice that contain 0.3\u0026ndash;1.2\u0026micro;g/mg butyrate [Figure 6A, B]. Immunohistology showed that spleens of faecal filtrate-treated aged mice had reduced numbers of senescent T cells [Figure 6C-G]. CD3 and p53 dual staining revealed an increase in the number of senescent cells in aged wild-type mice (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.009) compared to young mice, whereas faecal filtrate treated aged mice had reduced levels of senescent p53\u003csup\u003e+\u003c/sup\u003e T cells (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.04) [Figure 6H]. We also confirmed that spleens of aged wild-type mice exhibit increased p 53 mRNA expression levels compared to young mice (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.05), and that p53 mRNA levels were significantly lower in faecal filtrate treated aged mice (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.02) [Figure 6I]. IL6 levels are correlates of inflammation with spleens of aged wild-type mice exhibiting increased IL6 mRNA expression compared to young mice, (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.05). Consistent with faecal filtrates from young mice having a positive impact on inflammation, treated aged mice had significantly lower levels of IL6 mRNA compared with non-treated aged animals (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.04) [Figure 6J].\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eEmerging evidence has highlighted the importance of a healthy gut microbiome in maintaining host health as we age by ameliorating the negative effects on immunesenescence and inflammaging (Conway and Duggal \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Therefore, interventions based on improving microbial homeostasis may be an effective strategy for improved senescence-related phenotypes and extending healthy life span. While there is an abundance of preclinical evidence for the geroprotective effects of senolytics, the short-term and long-term safety profile and efficacy is yet to be fully investigated, strengthening the case for the identification of alternative senotherapeutics. Since many of the negative effects associated with senescence are driven by the SASP, senomorphics that modulate the SASP phenotype are emerging as a promising alternative therapeutic strategy. However, our understanding of the targeted effects of microbiome species and their metabolites in immune ageing remains limited. To our knowledge, the current study is the first to demonstrate that butyrate is a promising microbial metabolite possessing senomorphic properties at low millimolar dosages when cultured \u003cem\u003ein-vitro\u003c/em\u003e with aged T cells undergoing extensive proliferation through TCR activation. The effects of butyrate are mediated by downregulating mTOR activation, which targets transcriptional regulators of SASP, such as NFκB, and also ameliorates features of senescent T cells.\u003c/p\u003e \u003cp\u003eThe proportion of T cells with a senescent phenotype increases with age but varies among individuals (Callender et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). We observed that an increased frequency of senescent-like T cells was associated with reduced stool butyrate levels. Using an \u003cem\u003ein-vitro\u003c/em\u003e model of inducing senescence in T cells, we have demonstrated that butyrate prevents the acquisition of phenotypic characteristics of senescence and SASP features in activated primary T cells, confirming the senomorphic effects of butyrate. These findings are in line with a previous study reporting that circulating butyrate alleviates senescence in vascular cells of mouse aorta and reduces SASP expression (Han \u003cem\u003eet al.\u003c/em\u003e 2018). Importantly, in-vivo supplementation with stool supernatants from young stool rich is butyrate is accompanied by reduced accumulation of senescent cells in T cell zones of the spleen and inflammation in aged mice; providing scientific evidence that butyrate supplementation will be a valuable novel therapeutic target in future geriatric medicine for maintaining immune homeostasis through the ageing process.\u003c/p\u003e \u003cp\u003eActivation of stress response signalling cascades medicated via oxidative stress and DNA damage have been linked with activation of MAPKs, such as p-p38, that govern the transcriptional programs in senescent cells and has been demonstrated to be a central driver of the SASP in senescent CD8 T cells and fibroblasts \u003cem\u003ein-vivo\u003c/em\u003e (Chambers et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Sayegh \u003cem\u003eet al.\u003c/em\u003e 2023). Mechanistically, our data suggests that \u003cem\u003ein-vitro\u003c/em\u003e butyrate treatment reduced the increased phosphorylation and nuclear accumulation of p-p38. The p38 MAPK pathway is known to fuel DNA damage-dependent activation of NFκB, triggering the production and secretion of SASP factors (Freund et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). We observed that butyrate supresses NFκB activation, which is in line with another study reporting that butyrate inhibits NFκB activation in intestinal epithelial cells (Andoh et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e1999\u003c/span\u003e) and human PBMCs (Usami et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2008\u003c/span\u003e).\u003c/p\u003e \u003cp\u003emTOR activation contributes, at least in part, to driving a terminally differentiated T cell phenotype, as CD8 T cells from Tsc2\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice experience T-cell specific hyperactivity, display high positivity for T cell senescence and exhibit proliferation dysfunction after antigenic challenge (Pollizzi et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In our study, butyrate reduces S6 phosphorylation, a surrogate marker for inhibition of mTOR in treated aged T cells. Reductions in mTOR, which positively regulates glycolytic enzymes such as hexokinase II, glyceraldehyde 3-phosphate dehydrogenase (Sun et al \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) may explain reduced levels of expression of this glycolytic enzyme in seen here in butyrate treated T cells. Thus, the possibility that butyrate acts by inducing changes in metabolic activity in senescent cells that rely on glycolysis should be investigated further.\u003c/p\u003e \u003cp\u003eDysfunctional mitochondria are a promoter of the secretory phenotype termed mitochondria dysfunction-associated senescence (MiDAS) governed by a p53 dependant pathway (Bektas et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Additionally, mitochondria are the main producers of reactive oxygen species (ROS) that accelerate ageing by contributing to progressive cell damage and activation of stress pathways. Studies have reported that the elimination of mitochondria protects against pro-inflammatory SASP features (Correia-Melo \u003cem\u003eet al.\u003c/em\u003e 2016). Our data are consistent with butyrate mitigating mitochondrial ROS generation and reducing total mitochondria mass build-up in aged T cells (Callendar \u003cem\u003eet al.\u003c/em\u003e 2020) possibly by promoting the clearance of damaged mitochondria through mitophagy (selective degradation of dysfunctional and damaged mitochondria) or by inhibiting unnecessary mitochondria biogenesis, which can be beneficial in enhancing mitochondrial quality.\u003c/p\u003e \u003cp\u003eA number of animal studies provide evidence of the anti-inflammatory potential of butyrate and its use in treating lipopolysaccharide-induced lung injury (Ni \u003cem\u003eet al.\u003c/em\u003e 2010), preventing lethality of sepsis (Zhang \u003cem\u003eet al.\u003c/em\u003e 2007) and atherosclerosis (Aguilar et \u003cem\u003eal.\u003c/em\u003e 2014). SCFA are unsurprisingly being considered as supplementary treatment in the clinical management of inflammatory conditions. To date two studies of butyrate administration have been reported in humans, one reporting successfully amelioration of colonic inflammation in IBD after enema administration (Scheppach \u003cem\u003eet al\u003c/em\u003e. 1992) and the other in older adults undergoing upper abdominal surgery observed an increase in butyrate concentration in portal vein blood (Van der Beek \u003cem\u003eet al.\u003c/em\u003e 2015). These studies establish the safety of therapeutic administration of butyrate administration although key questions regarding dose and formulation in older adults still remain unanswered which requires further investigation before exploiting the potential of SCFAs as an anti-immunesenescence intervention.\u003c/p\u003e \u003cp\u003eA key limitation of this study that needs to be acknowledged is that the 1 mM concentration may not accurately reflect physiological concentrations, which vary \u003cem\u003ein-vivo\u003c/em\u003e depending on tissue type and can be as high as 20 to 140 mM in the GI tract depending on intestinal microflora composition. We have observed serum levels as low as 0.1 mM, making it difficult to achieve the \u003cem\u003ein-vivo\u003c/em\u003e levels of butyrate in the T cell environment in an \u003cem\u003ein-vitro\u003c/em\u003e setting. Furthermore, a limitation of the mice experiments is that while the faecal supernatant from young mice was enriched in butyrate, it also contained a complex mixture of other microbial metabolites. Therefore, we cannot attribute the observed reductions in build-up of senescent cells \u003cem\u003ein-vivo\u003c/em\u003e solely to butyrate and further studies using purified butyrate supplementation would be necessary to delineate its specific senomoprhic properties \u003cem\u003ein-vivo\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eIn conclusion, our findings provide evidence in support of the use of butyrate to reduce the accumulation of senescent T cells with ageing by increasing butyrate levels through for example, dietary, microbial and therapeutic approaches. A nutritional approach to increase butyrate levels involves increasing the intake of high-fibre foods, like fruits, vegetables, legumes and whole grains, that serve as substrates for commensal microbes to produce SCFAs. Alternatively, consumption of prebiotics, such as inulin and fructooligosaccharides, to selectively stimulate butyrate-producing bacteria or consumption of probiotics with butyrate-producing bacteria are promising strategies. Further, our results provide the evidence base for a future clinical trial using oral sodium supplements or supplementation with butyrate precursors, such as tributyrin supplementation, to not only increase butyrate levels in aged hosts but to also rejuvenate aged T cells. However, this hypothesis needs to be strengthened and there is room for future well-planned studies in humans to help increase the translational potential of these findings.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNAD\u0026nbsp;\u003c/strong\u003egained funding for the study, participated in the design of the study, performed transcriptomic analysis, interpretation of the data and wrote the first draft of the manuscript. \u003cstrong\u003eNPR\u003c/strong\u003e participated in sample processing, performed the immune phenotyping, analysed and interpreted the data generated. \u003cstrong\u003eJC\u0026nbsp;\u003c/strong\u003erecruited participants, participated in sample processing, performed the immune phenotyping, analysed and interpreted the data generated for the first figure of the manuscript. \u003cstrong\u003eBD\u003c/strong\u003e performed the Image J analysis. \u003cstrong\u003eSRC\u003c/strong\u003e gained funding for the animal experiments and participated in its experimental design. \u003cstrong\u003eAP\u003c/strong\u003e performed the animal experiments and collected the tissues for immunostainings. All authors edited and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclarations of conflict of interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe raw flow cytometry data generated during the current study will be made available on Flow repository and the microscopy images generated during the current study will be shared via a google folder.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAlsaleh G, Panse I, Swadling L \u003cem\u003eet al\u003c/em\u003e. Autophagy in T cells from aged donors is maintained by spermidine and correlates with function and vaccine responses. \u003cem\u003eElife\u003c/em\u003e 2020; 9: 57950. https://doi.org/10.7554/elife.57950\u003c/li\u003e\n\u003cli\u003eAndoh A, Fujiyama Y, Hata K, \u003cem\u003eet al \u003c/em\u003eCounter-regulatory effect of sodium butyrate on tumour necrosis factor-alpha (TNF-alpha)-induced complement C3 and factor B biosynthesis in human intestinal epithelial cells. \u003cem\u003eClin Exp Immunol\u003c/em\u003e 1999; 118:23\u0026ndash;29. https://doi.org/10.1046/j.1365-2249.1999.01038.x\u003c/li\u003e\n\u003cli\u003eAkbar A N, Henson S M, Lanna A. Senescence of T lymphocytes: Implications for enhancing human immunity. \u003cem\u003eTrends Immunol\u003c/em\u003e 2016; 12: 866-876. https://doi.org/10.1016/j.it.2016.09.002\u003c/li\u003e\n\u003cli\u003eBachem A, Makhlouf C, Binger K J \u003cem\u003eet al\u003c/em\u003e. Microbiota-derived short-chain fatty acids promote the memory potential of antigen-activated CD8(+) T cells. \u003cem\u003eImmunity\u003c/em\u003e 2019; 51: 285\u0026ndash;297. https://doi.org/10.1016/j.immuni.2019.06.002\u003c/li\u003e\n\u003cli\u003eBaroja-Mazo A, Revilla-Nuin B, Ramirez P, Pons JA. Immunosuppressive potency of mechanistic target of rapamycin inhibitors in solid-organ transplantation. \u003cem\u003eWorld J Transplant\u003c/em\u003e. 2016; 6:183\u0026ndash;192. https://doi.org/10.5500/wjt.v6.i1.183\u003c/li\u003e\n\u003cli\u003eBarbarin A, Cayssials E, Jacomet F \u003cem\u003eet al\u003c/em\u003e. \u003cstrong\u003ePhenotype of NK-Like CD8(+) T Cells with Innate Features in Humans and Their Relevance in Cancer Diseases \u003c/strong\u003e\u003cem\u003eFrontiers in immunology.\u003c/em\u003e 2017; \u003cstrong\u003e8\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e316 https://doi.org/10.3389/fimmu.2017.00316\u003c/li\u003e\n\u003cli\u003eBektas A, Schurman S H, Gonzalez-Friere M \u003cem\u003eet al\u003c/em\u003e. Age-associated changes in human CD4\u003csup\u003e+\u003c/sup\u003e T cells point to mitochondrial dysfunction consequent to impaired autophagy. \u003cem\u003eAging\u003c/em\u003e 2019; \u003cstrong\u003e11\u003c/strong\u003e: 9234\u0026ndash;9263. https://doi.org/10.18632/aging.102438\u003c/li\u003e\n\u003cli\u003eBuford T W. (Dis) Trust your gut: the gut microbiome in age-related inflammation, health, and disease. \u003cem\u003eMicrobiome\u003c/em\u003e 2017. 5: 1-11. https://doi.org/10.1186/s40168-017-0296-0\u003c/li\u003e\n\u003cli\u003eCallender L A, Caroll A C, Beal R W J \u003cem\u003eet al. \u003c/em\u003eHuman CD8+ EMRA T cells display a senescence-associated secretory phenotype regulated by p38 MAPK. \u003cem\u003eAgeing Cell\u003c/em\u003e 2018; 12675.8 https://doi.org/10.1111/acel.12675\u003c/li\u003e\n\u003cli\u003eCallender L A, Caroll A C, Bober E A \u003cem\u003eet al\u003c/em\u003e. Mitochondrial mass governs the extent of human T cell senescence. \u003cem\u003eAging Cell 2020;\u003c/em\u003e 19: e13067 https://doi.org/10.1111/acel.13067\u003c/li\u003e\n\u003cli\u003eChambers E S, Vukmanovic-Stejic M, Shih BB \u003cem\u003eet al.\u003c/em\u003e Recruitment of inflammatory monocytes by senescent fibroblasts inhibits antigen-specific tissue immunity during human aging. Nat Aging 2021; 1: 101-113 https://doi.org/10.1038/s43587-020-00010-6\u003c/li\u003e\n\u003cli\u003eConway J and Duggal NA. Ageing of the gut microbiome: Potential influences on immune senescence and inflammageing. \u003cem\u003eAgeing Res Rev\u003c/em\u003e. 2021;68:101323. https://doi.org/10.1016/j.arr.2021.101323\u003c/li\u003e\n\u003cli\u003eCorreia- Melo C, Marques F D M, Anderson R \u003cem\u003eet al\u003c/em\u003e. Mitochondria are required for pro-ageing features of the senescent phenotype. \u003cem\u003eEMBO\u003c/em\u003e 2016; 35:724-742. https://doi.org/10.15252/embj.201592862\u003c/li\u003e\n\u003cli\u003eCovre L P, De Maeyer R P H, Gomes D C O and Akbar A N. The role of senescent T cells in Immunopathology. \u003cem\u003eAgeing Cell\u003c/em\u003e 2020; 12:e13272. https://doi.org/10.1111/acel.13272\u003c/li\u003e\n\u003cli\u003eDesd\u0026iacute;n-Mic\u0026oacute; G, Soto-Heredero G, Aranda J F \u003cem\u003eet al\u003c/em\u003e. T cells with dysfunctional mitochondria induce multimorbidity and premature senescence. \u003cem\u003eScience\u003c/em\u003e 2020; 368:1371\u0026ndash;1376 https://doi.org/10.1126/science.aax0860\u003c/li\u003e\n\u003cli\u003eDugan B, Conway J, Duggal. Inflammaging as a target for healthy ageing. \u003cem\u003eAge Ageing \u003c/em\u003e2023; 52:afac328 https://doi.org/10.1093/ageing/afac328\u003c/li\u003e\n\u003cli\u003eDuggal N A. Reversing the immune ageing clock: lifestyle modifications and pharmacological interventions. \u003cem\u003eBiogerontology\u003c/em\u003e 2018; 19:481-496. https://doi.org/10.1007/s10522-018-9771-7\u003c/li\u003e\n\u003cli\u003eFurusawa Y, Obata Y, Fukuda S \u003cem\u003eet al\u003c/em\u003e. Commensal microbe-derived butyrate induces the differentiation of colonic regulatory T cells. \u003cem\u003eNature\u003c/em\u003e 2013; 504: 446\u0026ndash;450. https://doi.org/10.1038/nature12721\u003c/li\u003e\n\u003cli\u003eFreund A, Patil C K , Campisi J. p38 MAPK is a novel DNA damage response-independent regulator of the senescence-associated secretory phenotype. \u003cem\u003eEMBO\u003c/em\u003e 2011;30:1536-48. https://doi.org/10.1038/emboj.2011.69\u003c/li\u003e\n\u003cli\u003eGate D, Saligrama N, Leventhal O, Yang A C \u003cem\u003eet al\u003c/em\u003e. Clonally Expanded CD8 T Cells Patrol the Cerebrospinal Fluid in Alzheimer\u0026rsquo;s Disease. Nature 2020; 577: 399\u0026ndash;404. https://doi.org/10.1038/s41586-019-1895-7\u003c/li\u003e\n\u003cli\u003eHan Y M, Bedarida T, Ding Y \u003cem\u003eet al\u003c/em\u003e. \u0026beta;-Hydroxybutyrate prevents vascular senescence through hnRNP A1-mediated upregulation of Oct 4. \u003cem\u003eMol Cell \u003c/em\u003e71:1064-1078. https://doi.org/10.1016/j.molcel.2018.07.036\u003c/li\u003e\n\u003cli\u003eKim M, Qie Y, Park J, Kim CH. Gut Microbial Metabolites Fuel Host Antibody Responses. \u003cem\u003eCell Host Microbe \u003c/em\u003e2016;20:202-14. https://doi.org/10.1016/j.chom.2016.07.001\u003c/li\u003e\n\u003cli\u003eLevy M, Blacher E, Elinav E. Microbiome, metabolites and host immunity. \u003cem\u003eCurr Opin Microbio \u003c/em\u003e2017;25: 8-15 https://doi.org/10.1016/j.mib.2016.10.003\u003c/li\u003e\n\u003cli\u003eMonaghan TM, Duggal NA, Rosati E, \u003cem\u003eet al\u003c/em\u003e. A Multi-Factorial Observational Study on Sequential Fecal Microbiota Transplant in Patients with Medically Refractory Clostridioides difficile Infection. \u003cem\u003eCells\u003c/em\u003e. 2021;10 :3234 https://doi.org/10.3390/cells10113234\u003c/li\u003e\n\u003cli\u003eParish S T , Wu J E , Effros R B . Sustained CD28 expression delays multiple features of replicative senescence in human CD8 T lymphocytes. \u003cem\u003eJ Clin Immunol\u003c/em\u003e 2010; 30:798-805. https://doi.org/10.1007/s10875-010-9449-7\u003c/li\u003e\n\u003cli\u003ePollizzi K N, Patel C H, Sun H I \u003cem\u003eet al\u003c/em\u003e. m TORC1 and m TORC2 selectively regulate CD8 T cell differentiation. \u003cem\u003eJ Clin Invest\u003c/em\u003e 2015; 125: 2090- 2108. https://doi.org/10.1172/JCI77746\u003c/li\u003e\n\u003cli\u003eRazaK, Sharma-OatesA, PadyukovL \u003cem\u003eet al \u003c/em\u003eSpecific features of immune ageing are detected in the earliest stages in rheumatoid arthritis development. [Under review in eBioMedicine] \u003c/li\u003e\n\u003cli\u003eRivi\u0026egrave;re A, Selak M, Lantin D, Leroy F, De Vuyst L. Bifidobacteria and butyrate-producing colon bacteria: importance and strategies for their stimulation in the human gut. Front Microbiol. (2016) 7:979. doi: 10.3389/fmicb.2016.00979\u003c/li\u003e\n\u003cli\u003eRosser E C, Piper C J M, Matei D E \u003cem\u003eet al\u003c/em\u003e. Microbiota-derived metabolites supress arthritis by amplifying aryl-hydrocarbon receptor activation in regulatory B cells. \u003cem\u003eCell Metabolism\u003c/em\u003e 2020; 31: 837-851. https://doi.org/10.1016/j.cmet.2020.03.003 \u003c/li\u003e\n\u003cli\u003eSalazar, N., Arboleya S, Navarro T \u003cem\u003eet al.\u003c/em\u003e Age-associated changes in gut microbiota and dietary components related with the immune system in adulthood and old age: a cross sectional study. Nutrients, 2019. 11:17 https://doi.org/10.3390/nu11081765\u003c/li\u003e\n\u003cli\u003eSaul D, Kosinsky R L, Atkinson E J \u003cem\u003eet al\u003c/em\u003e. A new gene set identifies senescent cells and predicts senescence-associated pathways across tissues. \u003cem\u003eNat Comms\u003c/em\u003e 2022; 13:4827.https://doi.org/10.1038/s41467-022-32552-1\u003c/li\u003e\n\u003cli\u003eSayegh S, Fantecelle C H, Laphanuwat P \u003cem\u003eet al\u003c/em\u003e. Vitamin D3 inhibits p38 MAPK and senescence-associated inflammatory mediator secretion by senescent fibroblasts that impacts immune responses during ageing. \u003cem\u003eAging Cell\u003c/em\u003e 2024; 23:e14093. https://doi.org/10.1111/acel.14093\u003c/li\u003e\n\u003cli\u003eSun Q, Chen X, Ma J \u003cem\u003eet al.\u003c/em\u003e Mammalian target of rapamycin up-regulation of pyruvate kinase isoenzyme type M2 is critical for aerobic glycolysis and tumorgrowth. \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e USA 2011; 108, 4129\u0026ndash;4134 https://doi.org/10.1073/pnas.1014769108\u003c/li\u003e\n\u003cli\u003eTchkonia T, Zhu Y, van Deursen J, Campisi J \u0026amp; Kirkland J L. Cellular senescence and the senescent secretory phenotype: therapeutic opportunities. \u003cem\u003eJ. Clin. Invest 2013; \u003c/em\u003e123: 966\u0026ndash;972. https://doi.org/10.1172/jci64098\u003c/li\u003e\n\u003cli\u003eThevaranjan N, Puchta A, Schulz C, \u003cem\u003eet al\u003c/em\u003e. Age-Associated Microbial Dysbiosis Promotes Intestinal Permeability, Systemic Inflammation, and Macrophage Dysfunction. \u003cem\u003eCell Host Microbe.\u003c/em\u003e 2017;21:455-66 e4. https://doi.org/10.1016/j.chom.2017.03.002\u003c/li\u003e\n\u003cli\u003eUsami M, Kishimoto K, Ohata A \u003cem\u003eet al\u003c/em\u003e. Butyrate and trichostatin A attenuate nuclear factor kappaB activation and tumor necrosis factor alpha secretion and increase prostaglandin E2 secretion in human peripheral blood mononuclear cells. \u003cem\u003eNutr Res\u003c/em\u003e 2008; 28, 321\u0026ndash;328. https://doi.org/10.1016/j.nutres.2008.02.012\u003c/li\u003e\n\u003cli\u003eWiley C D and Campisi J. The metabolic roots of senescence: mechanisms and opportunities for intervention. \u003cem\u003eNat Metab\u003c/em\u003e 2021; 10: 1290-1301. https://doi.org/10.1038/s42255-021-00483-8\u003c/li\u003e\n\u003cli\u003eXiao F H, Yu Q, Deng Z L \u003cem\u003eet al\u003c/em\u003e ETS1 acts as a regulator of healthy aging via decreasing ribosomal activity. \u003cem\u003eSci Adv\u003c/em\u003e 2022; 8: eabf2017. https://doi.org/10.1126/sciadv.abf2017\u003c/li\u003e\n\u003cli\u003eYoun J, Jung M K, Yu H T, Kwon J, \u003cem\u003eet al\u003c/em\u003e. Increased Frequency of CD4+CD57+ Senescent T Cells with Newly Diagnosed Acute Heart Failure: Exploring New Pathogenic Mechanisms with Clinical Relevance\u003cem\u003e. Scientific Rep\u003c/em\u003e 2019; 9: 12887. https://doi.org/10.1038/s41598-019-49332-5\u003c/li\u003e\n\u003cli\u003eZhang J, Tianhui H, Xue L \u003cem\u003eet al\u003c/em\u003e. Senescent T cells: a potential biomarker and target for cancer therapy. \u003cem\u003eeBioMedicine \u003c/em\u003e2021; 68:103409 https://doi.org/10.1016/j.ebiom.2021.103409\u003c/li\u003e\n\u003cli\u003eZukowski E, Sannella M, Rockhold J D \u003cem\u003eet al\u003c/em\u003e STAT3 modulates CD4 + T mitochondrial dynamics and function in aging. \u003cem\u003eAgeing Cell\u003c/em\u003e 2023; 22: e13996. https://doi.org/10.1111/acel.13996\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6419928/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6419928/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAdvancing age is accompanied by an accumulation of senescent T cells that secrete pro-inflammatory senescence-associated secretory phenotype (SASP) molecules. Gut-microbiota-derived signals are increasingly recognised as immunomodulators. In the current study, we demonstrated that ageing and the accumulation of senescent T cells is accompanied by a reduction in microbial-derived short-chain fatty acids (SCFAs). Culturing aged T cells in the presence of butyrate supresses the induction of a senescence phenotype and inhibits the secretion of pro-inflammatory SASP factors, such as IL6 and IL8. Administration of faecal supernatants from young mice rich in butyrate prevented \u003cem\u003ein-vivo\u003c/em\u003e accumulation of senescent spleen cells in aged mice. The molecular pathways governing butyrate\u0026rsquo;s senomorphic potential include a reduced expression of DNA damage markers, lower mitochondrial ROS accumulation and downregulation of mTOR activation, which negatively regulates the transcription factor NFκB. Our findings establish butyrate as a potent senomorphic agent and provides the evidence base for future microbiome restitution intervention trials using butyrate supplements for combatting T cell senescence ultimately reducing inflammation and combatting age-related pathologies to extend lifelong health.\u003c/p\u003e","manuscriptTitle":"Defining microbiota-derived metabolite butyrate as a senomorphic: therapeutic potential in the age-related T cell senescence","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-11 11:49:42","doi":"10.21203/rs.3.rs-6419928/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8e4ae4a4-3231-4780-aaa0-65845319b1d3","owner":[],"postedDate":"April 11th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-04-11T11:49:42+00:00","versionOfRecord":[],"versionCreatedAt":"2025-04-11 11:49:42","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6419928","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6419928","identity":"rs-6419928","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.