Exogenous Oxytocin Alleviates Prodromal and Clinical Parkinson's Disease Phenotypes via the Inhibition of Enteric Glial Cell-triggered Neuroinflammation

preprint OA: closed
Full text JSON View at publisher
Full text 137,564 characters · extracted from preprint-html · click to expand
Exogenous Oxytocin Alleviates Prodromal and Clinical Parkinson's Disease Phenotypes via the Inhibition of Enteric Glial Cell-triggered Neuroinflammation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Exogenous Oxytocin Alleviates Prodromal and Clinical Parkinson's Disease Phenotypes via the Inhibition of Enteric Glial Cell-triggered Neuroinflammation Hong Chen, Yuanyuan Han, Zhuoting Li, Qin Zhang, Xintao Huang, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8516406/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background/Aims: This study aims to elucidate how hyperactivated enteric glial cells (EGCs) trigger Parkinson's disease (PD) pathogenesis and whether the exogenous gut–brain regulatory hormone oxytocin canalleviate the phenotypes of PD. Methods: Prodromal and clinical PD mouse models were established via the intragastric administration of rotenone (ROT). The intestinal and motor functions of the mice were assessed. The expression of glial fibrillary acidic protein (GFAP), oxytocin receptor (OXTR) and tyrosine hydroxylase (TH) in the colon and midbrain was detected by immunofluorescence staining. The levels of α-synuclein (α-syn), oxytocin (OXT), and inflammatory factors in the serum and colon were measured by ELISA, western blotting and qPCR. Exogenous OXT and the EGC inhibitor fluorocitrate (FC) were administered, and the rescue effect on PD mice was assessed via neurobehavioral assays. Results: ROT administration induced constipation and motor PD symptoms in mice. The expression of GFAP and α-syn in the colon of PD mice wasincreased, whereasthe OXT and OXTR levels were decreased. Exogenous OXT or FC administration inhibited EGChyperactivation, reduced inflammatory factorlevels and α-syn accumulation, and ultimately alleviated the prodromal and clinical PD phenotypes. Conclusions: EGC hyperactivation plays a crucial role in PD pathogenesis, and exogenous OXT or FC could ameliorate the prodromal and clinical PD phenotypes. Parkinson’s disease Prodromal stage α-Synuclein Oxytocin Enteric glial cell Neuroinflammation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Parkinson's disease (PD) is one of the most common neurodegenerative diseases. With the aging of the global population, the number of PD patients is estimated to reach 10 million by 2030. 1 , 2 The pathological hallmark of PD is the progressive loss of dopaminergic (DA) neurons in the substantia nigra pars compacta (SNpc), along with the presence of Lewy bodies—structures formed by misfolded α-synuclein (α-syn) aggregates within residual DA neurons. 3 , 4 Although some advances have been achieved in the clinic, unfortunately, PD remains incurable. PD patients exhibit typical motor symptoms, such as resting tremor, rigidity, and postural instability, and nonmotor symptoms (NMSs), such as constipation, dysphagia and nausea, which precede motor symptoms. 5 , 6 Among the NMS, constipation is acknowledged as one of the earliest and most prevalent symptoms, especially in the prodromal stage of PD. 7 Interestingly, Braak et al. proposed that α-syn first accumulates in the enteric nervous system (ENS) and spreads in a "prion-like" manner through the vagus nerve to the brain, which leads to neurological and motor deficits in PD. 8 However, the mechanism underlying the early aggregation of α-syn in the ENS and the associated intestinal motility disorders remain unclear. Recent studies have reported that enteric glial cells (EGCs), as "sentinel" cells, are hyperactivated in the prodromal stage of PD and play pivotal roles in PD pathogenesis. 9 – 11 EGCs are the most abundant cell type and participate in the maintenance of intestinal homeostasis. 12 , 13 However, hyperactivated EGCs, characterized by increased expression of glial fibrillary acidic protein (GFAP), induce PD occurrence by promoting the release of proinflammatory cytokines, growth factors and other immunomodulatory molecules and disrupting intestinal function. 14 As such, targeting EGC-triggered neuroinflammation and intestinal dysfunction has emerged as a promising therapeutic strategy for the treatment of PD. Oxytocin (OXT) is a hypothalamus-derived small peptide of 9 amino acids that is well known for its ability to regulate uterine contraction and prosocial behaviors. 15 , 16 Recently, studies have reported that OXT levels are significantly decreased in both PD animal models and PD patients, indicating its neuroprotective role. 17 , 18 In the present study, we found that rotenone (ROT) administration induced prodromal and clinical PD phenotypes in mice. Mechanistically, EGCs are hyperactivated, which triggers increases in the expression of GFAP and α-syn in the colon and the release of inflammatory factors such as IL-6, IL-1β, and TNF-α. More importantly, supplementation with exogenous OXT or the EGC inhibitor fluorocitrate (FC) successfully ameliorated the prodromal and clinical PD phenotypes of mice via the inhibition of EGC activation. The findings of the present study not only shed light on the mechanism of PD pathogenesis but also provide novel clues for PD treatment. Materials and methods Animals Male C57BL/6J mice aged 8 weeks were purchased from the Animal Center of Shanxi Medical University. The mice were acclimatized to a standard environment with a temperature of 23 ± 2°C, humidity of 40–60%, a 12 h light/dark cycle, and ad libitum access to food and water for 14 days. Establishment of the PD mouse model The experimental circuit diagram of the ROT (MCE, Monmouth Junction, NJ, USA, Cat# HY-B1756)-induced prodromal and clinical PD mouse model is shown in Fig. 1 A. The mice were randomly divided into 2 groups: the control group (n = 30) and the ROT group (n = 60). ROT powder was dissolved in 20% Tween-80 (Solarbio, Beijing, China, Cat# T8360) and 40% PEG-300 (Solarbio, Beijing, China, Cat# IP9020) with 40% PBS. The mice received ROT (20 mg/kg) or vehicle daily intragastrically. Behavioral and intestinal motility tests were performed at the 2nd, 3rd, and 7th weeks. The mice were sacrificed at the 3rd and 7th weeks for further analysis. Drug administration The flow chart of the effects of OXT (MCE, Monmouth Junction, NJ, USA, Cat# HY-17571A) or the EGC inhibitor fluorocitrate (FC, MCE, Monmouth Junction, NJ, USA, Cat# F9634) on ROT-induced mice is shown in Fig. 3 A. The mice were randomly assigned to 4 groups: the control, ROT, ROT + OXT and ROT + FC groups (n = 20/group). OXT or FC powder was dissolved in PBS at a dosage of 0.1 mg/kg via gavage or 20 µmol/kg via intraperitoneal injection, respectively, combined with ROT administration. Mouse perfusion and sample collection The mice were deeply anesthetized with 2.5% isoflurane (RWD Life Science Co., Xingtai, China, Cat# R510-22-10) and transcardially perfused with potassium-free PBS. The brain and colon were isolated immediately, with one hemisphere postfixation and the colonic segment in 4% paraformaldehyde for 24 h for histology; the other hemisphere was subdissected, and the remaining colonic segment was subjected to biochemical analysis. Postfixed samples were subjected to 15% and 30% sucrose dehydration (each for 24 h) at 4°C, and after being embedded in optimal cutting temperature (OCT) compound (Sakura, Finetek, Japan, Cat# 4583), they were immediately frozen in liquid nitrogen. Slide-mounted 16 µm brain sections and 6 µm colonic sections were cut using a cryostat (Leica Microsystems, Nussloch, Germany, Cat# CM1860). Hypothalamus, midbrain and colon tissues were collected for further experiments. Behavioral assessment Prior to the initiation of the behavioral test, the mice underwent a two-day adaptive training regimen, and the test was repeated 3 times for each mouse. Acceleration of the rotarod test The mice were placed on a rotarod apparatus, and then the rod revolved from 5 to 20 rpm over 5 min. The latency of the mice to fall off the accelerating rotarod within 5 min was recorded 3 times at 1 h intervals. Pole test The climbing pole was positioned at an angle of 45°, and the mouse was placed face up near the top of a pole with a rough surface (50 cm in height and 1 cm in diameter). The time to reach the bottom of the pole was recorded for each mouse in 3 trials separated by 1 h intervals. Open field test (OFT) Each mouse was placed in the center of an open area consisting of a white cube opaque chamber (40 × 40 × 40 cm) and allowed to freely move for 5 min. The total distance traveled was recorded and analyzed via Smart 3.0 software (Panlab SL, Spain) within 5 min. After each test, the chamber was cleaned with 75% alcohol and allowed to dry thoroughly to avoid affecting the next experimental mouse. Intestinal motility function assessment Fecal pellet output After 2 h of fasting and water deprivation, each mouse was individually housed in a clean cage. Fecal pellet numbers were recorded after 2 h. The collected feces were weighed to record the wet weight and then dried at 65°C for 24 h. The dry weight of the feces was subsequently measured. Measurement of carmine fecal excretion time The carmine (Solarbio, Beijing, China, Cat# C8540) powder was dissolved in PBS at a concentration of 5 mg/mL. Carmine solution (5 mg/kg) was administered to the mice via intragastric gavage, and the amount of time spent in the feces was recorded. Measurement of intestinal transmission distance Each mouse was gavaged with 300 µL of Evans blue staining solution (Sigma‒Aldrich, Steinheim, Germany, Cat# E2129) and then euthanized after 30 min. The entire intestinal segment was harvested. The distance from the stomach to the site where Evans blue disappeared was recorded. Preparation of colon whole mounts Acetone (Sigma‒Aldrich, Steinheim, Germany, Cat# 179124) was injected into the intestinal lumen, and the ends of the intestinal segment were ligated and placed in acetone for 24 h of fixation. The intestinal segment was incised along the mesenteric border under a stereomicroscope, and then the mucosal and muscular layers were sequentially removed to expose the serosal layer. Intestinal permeability assay Isothiocyanamide fluorescein-dextran (FD-4, 4000 kDa, Sigma‒Aldrich, Steinheim, Germany, Cat# FD-4) was dissolved in PBS. The mice were fasted for 4 h and then orally gavaged with FD-4 (0.5 mg/g). After 3 h, the mice were euthanized, and blood was collected from the orbital cavity. The blood sample was centrifuged at 3200 rpm for 20 min, and the serum was isolated. The FD-4 leakage fluorescence intensity was detected with a microplate fluorescence reader (SpectraMax i3, Molecular Devices, San Jose, California, USA) at an excitation wavelength of 485 nm and an emission wavelength of 530 nm. Cell culture The rat jejunum enteric glial cell line CRL-2690 was purchased from Fuheng Biology (Shanghai, China, Cat# FH1201). CRL-2690 cells were cultured in RPMI-1640 medium (Gibco, Grand Island, USA, Cat# 11875093) supplemented with 10% fetal bovine serum (FBS, Gibco, Grand Island, USA, Cat# 10099141C) and 100 U/mL penicillin‒streptomycin (Gibco, Grand Island, USA, Cat# 15140122) at 37°C in 5% CO 2 . CRL-2690 cells were treated with ROT (0.1 mM) for 24 h combined with OXT (10 nM) or FC (0.5 mM) administration. Enzyme-linked immunosorbent assay (ELISA) ELISA kits were used to measure the levels of α-syn (Cloud-Clone Corp., Wuhan, China, Cat# SEB222Mu) in the serum and OXT (Cloud-Clone Corp., Wuhan, China, Cat# CEB052Ge) in the hypothalamus, serum and colon of PD mice. The operations were conducted according to the manufacturer’s instructions. Western blotting The midbrain and colon tissues were lysed in fresh and cold RIPA buffer (Thermo Fisher Scientific, Waltham, MA, USA; Cat# P0013B) supplemented with a protease inhibitor (Sigma‒Aldrich, Steinheim, Germany; Cat# 8340). The lysates were centrifuged twice at 4°C, and the protein concentration was determined via a BCA assay (CWbio, Taizhou, Jiangsu, China; Cat# CW0014) via a spectrophotometer. A total of 20 µg of protein was subjected to SDS–PAGE and transferred to a polyvinylidene fluoride (PVDF; Millipore, Burlington, MA, USA, Cat# IPVH00010) membrane. The membranes were blocked with 5% nonfat milk in TBST (TBS containing 0.1% Tween-20) for 1 h at room temperature and then incubated with primary antibodies overnight at 4°C. After being washed with 0.1% TBST, the membranes were incubated with secondary antibodies for 1 h at room temperature. The blots were visualized by using BeyoECL Plus (Beyotime, Shanghai, China, Cat# P0018M) in a FluorChem E digital imaging system (Alpha FluorChem E) and analyzed by ImageJ software (NIH, Bethesda, MD). The primary and secondary antibodies used are listed in Table 1 . Table 1 Antibodies used in this study Antibodies Application Dilution Company & Catalog number Primary antibodies Mice anti-α-syn monoclonal IgG WB 1:800 Santa Cruz, Cat# sc-69977 Rabbit anti-oligomeric α-syn polyclonal IgG WB 1:1000 Sigma‒Aldrich, Cat# ABN2265 Rabbit anti-OXTR monoclonal IgG IF or WB 1:200 or 1:1000 Abcam, Cat# ab300443 Rabbit anti-GFAP polyclonal IgG IF or WB 1:200 or 1:1000 Abcam, Cat# ab7260 Rabbit anti-β-actin monoclonal IgG WB 1:10,000 ABclonal, Cat# AC038 Mice anti-GAPDH monoclonal IgG WB 1:10,000 Sigma‒Aldrich, Cat# MAB374 Rabbit anti-TH polyclonal IgG IF 1:200 Proteintech, Cat# 25859-1-AP Rabbit anti-ZO-1 monoclonal IgG IF 1:200 Abcam, Cat# ab276131 Rabbit anti-Claudin-3 monoclonal IgG IF 1:300 Abcam, Cat# ab214487 Rabbit anti-Claudin-5 monoclonal IgG IF 1:200 Abcam, Cat# ab131259 Secondary antibodies Mice IgG, HRP WB 1:10000 ABclonal, Cat# AS003 Rabbit IgG, HRP WB 1:10000 ABclonal, Cat# AS014 Alexa 488 donkey anti-rabbit IgG IF 1:500 Abcam, Cat# ab150073 Cy3 donkey anti-rabbit IgG IF 1:500 Jackson, Cat# 711-165-152 Immunofluorescence staining The brain and colon sections were washed in PBS for 5 min, permeabilized and blocked with 0.5% Triton X-100 in PBS for 20 min, washed 3 times in PBS for 15 min, and blocked in 10% normal donkey serum in PBS for 1 h at 37°C. Then, the cells were incubated with primary antibodies overnight at 4°C. The next day, the sections were washed with PBS 3 times. The cells were then incubated with secondary antibodies for 1 h. DAPI solution was used to stain the nuclei. The primary and secondary antibodies used are listed in Table 1 . After immunostaining, the average fluorescence intensity was analyzed via ImageJ software. The total number of tyrosine hydroxylase (TH) neurons was estimated via the Stereo Investigator system (Micro Brightfield, USA), which was combined with an Olympus microscope (Tokyo, Japan). RNA isolation and quantitative real-time-PCR (qPCR) analysis The total RNA of the colon samples was extracted with TRIzol isolation reagent (Invitrogen, Eugene Oregon, USA, Cat# 15596026CN) according to the manufacturer’s instructions. Reverse transcription of the extracted mRNA was performed via 5× All-In-One RT MasterMix (Abcam, Cambridge, UK, Cat# G492). The relative mRNA expression levels of various genes were determined via qPCR on a QuantStudio 3 Instrument (Applied Biosystems, South San Francisco, CA, USA) with the following 3-step thermal cycling protocol: 95°C for 2 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. All reactions were performed in triplicate. The relative mRNA expression was calculated via the 2-ΔΔCt method. β-actin was used as an internal control. The oligonucleotide sequences of the primers are listed in Table 2 . Table 2 Primers used in this study Gene name Forward primer Reverse Primer Mice IL-6 CCCCAATTTCCAATGCTCTCC CGCACTAGGTTTGCCGAGTA TNF-α ACCCTCACACTCACAAACCA ACCCTGAGCCATAATCCCCT IL-1β TGCCACCTTTTGACAGTGATG TTCTTGTGACCCTGAGCGAC β-actin AGGGAAATCGTGCGTGACAT TCCAGGGAGGAAGAGGATGC Statistical analyses Statistical analyses were performed with Prism 8 (GraphPad software, USA). All experimental values are expressed as the means ± S.E.M. In brief, between-group differences were evaluated via two-tailed Student's t test or one-way ANOVA followed by Bonferroni post hoc correction. A P value of 0.05 or less was considered statistically significant. Results ROT oral gavage induces prodromal and clinical phenotypes in mice Gut dyshomeostasis is thought to be the initiator of PD, especially in the prodromal stage. 19 ROT, a mitochondrial respiratory chain complex I inhibitor, has been widely adopted to induce chronic PD models. 20 To reveal how intestinal dysfunction underlies the pathogenesis of PD, we first established a PD mouse model via oral gavage administration of ROT. As schematically illustrated in Fig. 1 A, the mice were subjected to ROT (20 mg/kg) daily for 7 successive weeks, followed by behavioral and intestinal motility assays. The mice exhibited significant motor dysfunction at the 7th week after ROT administration, as evidenced by a shorter latency to fall from the rotarod, prolonged pole-climbing time, and reduced total distance traveled in the target zone ( Fig. 1 B-D ) . Notably, symptoms of constipation emerged at the 3rd week and persisted until the 7th week, as indicated by a reduced fecal water content, a decreased number of fecal pellets, prolonged carmine appearance time in feces, and a shortened Evans blue transit distance ( Fig. 1 E-I ) . These results demonstrated that ROT treatment induced intestinal motility dysfunction (prodromal symptoms) and motor deficits (clinical symptoms) in the mice. The established PD model lays the foundation for exploring the mechanism by which gut dysfunction triggers PD pathogenesis. α-syn expression in the colon, midbrain, and serum of PD model mice at the prodromal stage It has been well documented that α-syn first aggregates in the ENS and then spreads to the brain via the vagus nerve or blood in both PD patients and mouse models. 21 – 23 To assess α-syn alterations in the ROT-induced prodromal stage in PD mice, we used western blotting (WB) and ELISA to measure the levels of α-syn in the colon, midbrain and serum of PD mice, as schematically illustrated in Fig. 2 A. The results revealed that the levels of α-syn monomers and oligomers were significantly increased in the colons of prodromal PD mice ( Fig. 2 B-C ) . In contrast, in this stage, no significant alteration in α-syn was observed in the midbrain ( Fig. 2 D-E ) . Furthermore, serum α-syn levels were markedly elevated in prodromal PD mice ( Fig. 2 F ) . The above results suggest that, in the prodromal stage of PD, the expression of α-syn is elevated, whereas that in the midbrain is not significantly altered. Compromised the OXT/OXTR signaling pathway and hyperactivated EGCs in the prodromal stage in PD mice OXT is a key gut–brain regulatory hormone that is produced mainly in the hypothalamus and is released by the hypothalamic‒pituitary axis (HPA). 15 The serum OXT level was significantly reduced in neurotoxin-induced PD mice. 18 , 24 – 26 Interestingly, one study has shown that OXT can alleviate visceral hypersensitivity by inhibiting the activation of EGCs, which occurs even before the onset of PD. 27 To determine whether the OXT/OXTR signaling pathway was compromised and whether EGCs were hyperactivated in prodromal PD mice, we performed ELISA, WB and IF staining to measure the levels of OXT, its receptor (OXTR), and GFAP. As shown in Fig. 3 A, Hypothalamic and serum OXT levels were significantly decreased in prodromal PD mice, although no detectable changes were detected in the colon. This observation could be attributed to the hypothalamic derivation of OXT. Moreover, both the WB and IF staining results demonstrated that OXTRs were significantly decreased in the colons of prodromal PD mice ( Fig. 3 B-D ) . Additionally, the expression of GFAP, an EGC biomarker, was markedly increased in both colonic sections and muscularis whole mounts ( Fig. 3 E-F ) . Collectively, these data indicate that the OXT/OXTR signaling pathway was compromised in the colon of prodromal PD mice, whereas EGCs were hyperactivated, which might underscore the pathogenesis of PD. Inhibition of EGC hyperactivation mitigates intestinal neuroinflammation in prodromal PD mice After observing hyperactivation of EGCs and downregulation of OXT, we aimed to determine whether inhibition of EGC activity with a specific inhibitor (FC) or supplementation with exogenous OXT could mitigate neuroinflammation in the colon of prodromal PD mice ( Fig. 4 A ) . As shown in Fig. 4 B, supplementation with OXT by oral gavage reversed the decrease in serum OXT. Then, we performed qPCR to assess the impact of EGC inhibition on the expression levels of inflammatory factors in the colon of prodromal PD mice. The administration of OXT or FC successfully reversed the ROT-induced increase in the levels of IL-6, TNF-α, and IL-1β ( Fig. 4 C ) . Additionally, IF staining revealed that the intensity of GFAP was reduced in colon muscularis whole mounts after OXT or FC administration ( Fig. 4 D-E ) . To further confirm the above observations, we treated the rat jejunal EGC line (CRL-2690) with OXT or FC. WB analysis revealed that OXT or FC treatment significantly inhibited GFAP overexpression induced by ROT ( Fig. 4 F-G ). The IF staining and quantification results aligned well with those of the WB analysis ( Fig. 4 H-I ) . These data suggest that the inhibition of EGC activation mitigates neuroinflammation in the colon of prodromal PD mice, which holds potential for the treatment of PD. OXT or FC administration reduces α-syn expression and rescues DA neuron loss in the SNpc of PD mice After observing the anti-neuroinflammatory effect of EGC inhibition by OXT or FC, we wanted to determine the effects on α-syn expression and DA neuron survival in PD mice. As shown in Fig. 5 A-B, Administration of OXT or FC markedly reduced α-syn in the colon of prodromal PD mice. Concurrently, the serum α-syn level was also decreased, as assessed by ELISA ( Fig. 5 C ) . Additionally, DA neurons in the SNpc were quantified after labeling with TH IF. As shown in Figure. 5D-E , compared with those in control PD mice, the number of DA neurons significantly decreased in clinical PD mice, although there was no detectable change in prodromal PD mice. OXT or FC administration significantly rescued DA neuron loss in clinical PD model mice. Taken together, these results illustrate that OXT or FC treatment significantly reduced α-syn in the colon and serum and rescued DA neuron loss in the SNpc of PD mice. OXT treatment restores the intestinal integrity of prodromal PD and clinical PD mice Intestinal integrity is essential for maintaining gut homeostasis, the impairment of which is implicated in the pathogenesis of PD. 28–30 To determine whether OXT administration could impact intestinal integrity and barrier function in PD mice, we conducted IF staining for ZO-1 and Claudin-3/5, which are known proteins reflecting the tight junctions of the colon. As shown in Fig. 6 A-C, the fluorescence signals of ZO-1, Claudin-3, and Claudin-5 were significantly reduced with diffusion in the prodromal and clinical stages of PD, which was markedly reversed by OXT administration. Fluorescence intensity quantification further confirmed the above observations ( Fig. 6 D-F ) . To examine gut permeability, FD-4, a fluorescence dye, was administered via oral gavage. As shown in Fig. 6 G, the FD-4 signal in the serum of prodromal and clinical PD mice was elevated, which was markedly decreased by OXT administration. These data suggest that exogenous OXT treatment repaired the impairment of intestinal integrity and barrier function in PD mice. Exogenous OXT or FC alleviates constipation and motor disorders in PD mice Given the observed neuroprotective role of OXT in restoring the intestinal function and neuropathological features of ROT-induced PD mice, we further evaluated its impact on motor ability and intestinal motility. As shown in Fig. 7 A-C, the administration of OXT or FC significantly reversed the motor deficits of clinical PD model mice, as evidenced by the Rota-Rod, climbing pole, and open field assays. Additionally, intestinal motility was also examined. The administration of OXT or FC restored intestinal motility, as shown by increased fecal water content, shortened the appearance time of carmine in feces, and extended the Evans blue transit distance ( Fig. 7 D-F ) . Collectively, these results indicate that exogenous OXT or FC has a protective effect on the motor ability and intestinal motility of ROT-induced PD mice. Discussion Affective treatment of PD remains a major challenge. 31 NMSs, particularly constipation, reportedly emerge decades prior to the onset of motor symptoms in PD patients. 5 Here, we established prodromal and clinical PD mouse models via oral gavage administration of ROT and further evaluated the rescue effect and mechanism of EGC inhibition in PD mice. Model organisms are crucial for disease mechanism investigations and drug development. 32 To date, different types of PD models have been established by gene manipulation or pharmacological intervention. 33 ROT is a widely used pesticide that has also been adopted to create cellular or animal PD models. 20 In the present study, we demonstrated that chronic ROT exposure induced intestinal dysfunctions in mice prior to the manifestation of PD-related motor deficits. Mice subjected to ROT exposure exhibited significant intestinal motility function impairments at the 3rd week and motor deficits at the 7th week. Another study reported that intestinal motility dysfunction occurred at the 2nd week after ROT treatment, 34 which could be attributed to the higher dosage of ROT. Moreover, in ROT-induced PD mice, α-syn accumulation, a compromised OXT/OXTR signaling pathway, and EGC hyperactivation were observed, which was consistent with the findings of previous studies, indicating the successful establishment of the PD model. 17,18,35,36 Currently, for the treatment of PD, dopamine replacement is mainstream, but its long-term administration is associated with various adverse effects. 37 , 38 A growing number of studies have shown that brain-gut peptides such as GLP-1, nesfatin-1, and ghrelin exert neuroprotective effects both in vivo and in vitro, indicating their promising potential for PD treatment. 39 , 40 OXT, one of the main hypothalamus-derived peptides, is increasingly recognized as a key regulator of the brain‒gut axis. 41 OXTR, a G protein-coupled receptor (GPCR), is the specific receptor for OXT and is widely expressed in both the brain and peripheral tissues. 42 , 43 Downregulation of OXT/OXTR was found in PD and colitis patients. 35 , 44 In the present study, we also observed that, in ROT-induced PD mice, OXT was decreased in the serum and hypothalamus, accompanied by a reduction in OXTRs in the colon. A recent study reported that in PD patients, hypothalamic OXT was decreased. 17 Our results, as well as those of others, indicate that dysregulation of hypothalamic synthetic or secretory function is one pathological feature in the early stage of PD, which provides novel targets for PD intervention, especially at the prodromal stage. More importantly, we found that exogenous OXT administration abrogated neurobehavioral deficits and intestinal dysfunction, which aligned well with the findings of other studies. Ye et al. demonstrated that supplementation with OXT inhibited microglial activation, thereby exerting a neuroprotective effect in the early stage of Alzheimer’s disease (AD) in mice. 45 Almansoub et al. reported that OXT alleviated the phenotypes of PD mice, including motor disorders, cognitive impairments and depressive-like behaviors. 18 These findings indicate that exogenous OXT may represent a promising therapeutic strategy for alleviating PD progression. OXT has multiple regulatory effects on the intestine, including motility, barrier integrity, and inflammatory responses. 46 , 47 Wang et al. demonstrated that OXT alleviated colitis by restoring intestinal integrity. 44 Dou et al. demonstrated that OXT regulated immune tolerance to mitigate colitis in mice. 48 A number of studies have reported intestinal barrier integrity disruption in both PD patients and mouse models. 49 , 50 Consistent with these previous findings, we also observed increased intestinal permeability, compromised motility, and reduced expression of tight junction proteins in PD mice. Furthermore, exogenous OXT administration significantly mitigated intestinal epithelial barrier damage in PD mice and concurrently alleviated neurological deficits. These findings suggest that OXT plays a crucial role in maintaining gut homeostasis and impacts the gut‒brain axis. EGCs are the most abundant cell type within the ENS and are hyperactivated in the early stage of PD. 10,12 EGCs not only provide a nutritional supply and protective functions for enteric neurons but also participate in regulating intestinal motility, barrier function, and immunity. 51 The hyperactivation of EGCs has been strongly implicated in the pathogenesis of various types of diseases, including PD. 52–54 Clairembault et al. reported that the expression of GFAP, the characteristic protein of EGCs, was obviously upregulated in the colonic biopsies of early-stage PD patients, which was synchronous with the elevated expression of α-syn. 55 In the present study, we found that EGCs were strongly activated, accompanied by elevated mRNA expression of proinflammatory cytokines (including IL-6, TNFα, and IL-1β), in prodromal PD mice, which was consistent with observations in 6-OHDA-induced PD mice. 9 Additionally, a recent study demonstrated that inhibiting EGC activation by regulating gut microbial metabolites alleviates the pathological manifestations of PD in mice, 56 which aligns well with our findings that OXT administration abrogates EGC activation and is correlated with neuroinflammation. Given the critical role of EGC activation in gut‒brain axis-related disorders, a pharmacological inhibitor of EGCs, FC, was developed. 57 Ziegler et al. demonstrated that FC restores epithelial barrier function in colitis mice by blocking EGC function. 58 Gao et al. reported that FC reversed intestinal motility dysfunction by inhibiting EGC activation. 59 Consistent with those reports, we found that FC administration significantly inhibited EGC hyperactivation, which was accompanied by decreased α-syn expression, reduced proinflammatory cytokine levels in the colon, rescued DA neuron loss in the SNpc, and improved motor deficits, analogous to those of OXT in PD mice. Collectively, these findings suggest that the inhibition of EGCs may serve as a potential strategy for PD treatment. Conclusion In summary, in the present study, we successfully established ROT-induced prodromal and clinical PD mice, which exhibited both intestinal dysfunction, such as disrupted integrity and motility; EGC hyperactivation-induced neuroinflammation; and neurobehavioral deficits, including DA neuron loss in the SNpc and motor disability. More importantly, we found that exogenous supplementation with OXT or administration of the EGC inhibitor FC significantly reversed the manifestations of PD in mice by mitigating EGC-triggered neuroinflammation. Notably, several gaps need to be filled in the future. First, to elucidate the rescue mechanism of OXT and FC, a mouse model in which the OXTR is knocked out in EGCs is desired. Second, the potential signaling pathway mediated by OXT/OXTR needs to be clarified via multiomics assays. Third, the findings of the present study need to be confirmed in other PD animal models, especially with intestinal tissue samples from PD patients. Overall, our work sheds light on the mechanism underlying PD pathogenesis and provides clues for PD therapeutics. Declarations Author Contributions This study was designed and conceived by CWZ and LL. In vivo experiments were conducted by ZTL, YYH and HC. In vitro experiments were performed by HC. QZ, XTH, LY, CWZ, and LL supervised the project. HC drafted the manuscript. ZWZ and LL contributed to critical review and revision of the manuscript. All the authors read and approved the final manuscript. Funding This work was supported by the National Natural Science Foundation of China [82301759]; the Natural Science Foundation of Shanxi Province [202303021212129]; the National Clinical Key Speciality Construction Project [24090520, 231618]; the Ministry of Education of China "Chunhui Plan" Cooperative Research Project Foundation [HZKY20220505]; and the Shanxi Province Postdoctoral Research Foundation [2022071]. Data availability No datasets were generated or analyzed during the current study. Ethics approval All animal experiments complied with the regulations and guidelines of the ARRIVE Guidelines 2.0. (PLoS Bio 8(6), e1000412,2010). The protocols were approved by the Animal Research Ethics Committee at Shanxi Medical University (SYDL2023024). Consent for Publication Not applicable. Competing Interests The authors have no relevant financial or nonfinancial interests to disclose. References Kurth T, Brinks R. Projecting Parkinson's disease burden. BMJ 2025;388:r350. Su D, Cui Y, He C, et al. Projections for prevalence of Parkinson's disease and its driving factors in 195 countries and territories to 2050: modeling study of Global Burden of Disease Study 2021. BMJ 2025;388:e080952. Ye H, Robak LA, Yu M, Cykowski M, Shulman JM. Genetics and Pathogenesis of Parkinson's Syndrome. Annu Rev Pathol 2023;18:95-121. Koeglsperger T, Rumpf S, Schliesser P, et al. Neuropathology of incidental Lewy body & prodromal Parkinson's disease. Mol Neurodegener 2023;18(1):32. Leite Silva ABR, Goncalves De ORW, Diogenes GP, et al. Premotor, nonmotor and motor symptoms of Parkinson's Disease: A new clinical state of the art. Aging Res Rev 2023;84:101834. Chen Z, Li G, Liu J. Autonomic dysfunction in Parkinson's disease: Implications for pathophysiology, diagnosis, and treatment. Neurobiol Dis 2020;134:104700. Yuan X, Chen Y, Liu Z. Relationship among Parkinson's disease, constipation, microbes, and microbiological therapy. World J Gastroenterol 2024;30(3):225-237. Braak H, Del Tredici K, Rub U, de Vos RAI, Jansen Steur ENH, Braak E. Staging of brain pathology related to sporadic Parkinson's disease. Neurobiol Aging 2003;24(2):197-211. Thomasi BBDM, Valdetaro L, Ricciardi MCG, et al. Enteric glial cell reactivity in colonic layers and mucosal modulation in a mouse model of Parkinson's disease induced by 6-hydroxydopamine. Brain Res Bull 2022;187:111-121. Emmi A, Sandre M, Russo FP, et al. Duodenal alpha-Synuclein Pathology and Enteric Gliosis in Advanced Parkinson's Disease. Mov Disord 2023;38(5):885-894. Benvenuti L, D'Antongiovanni V, Pellegrini C, et al. Enteric Glia at the Crossroads between Intestinal Immune System and Epithelial Barrier: Implications for Parkinson Disease. Int J Mol Sci 2020;21(23):9199. Sharkey KA, Mawe GM. The enteric nervous system. Physiol Rev 2023;103(2):1487-1564. Progatzky F, Shapiro M, Chng SH, et al. Regulation of intestinal immunity and tissue repair by enteric glia. Nature 2021;599(7883):125-130. D'Antongiovanni V, Pellegrini C, Antonioli L, et al. Enteric Glia and Brain Astroglia: Complex Communication in Health and Disease along the Gut-Brain Axis. Neuroscientist 2024;30(4):493-510. Winokur SB, Caslin AY, Davis FM, Froemke RC. Oxytocin. Curr Biol 2025;35(20):R985-R992. Han X, Ma Y. Oxytocin in Human Social Network Cooperation. Neuroscientist 2025;31(4):409-424. Wang Y, Xu H, Chen S, et al. Oxytocin Protects Nigrostriatal Dopamine Signal via Activating GABAergic Circuit in the MPTP-Induced Parkinson's Disease Model. Adv Sci (Weinh) 2024;11(36):e2310244. Almansoub HAMM, Tang H, Wu Y, et al. Oxytocin Alleviates MPTP-Induced Neurotoxicity in Mice by Targeting MicroRNA-26a/Death-Associated Protein Kinase 1 Pathway. J Alzheimers Dis 2020;74(3):883-901. Christopher CJ, Morgan KH, Tolleson CM, et al. Specific Bacterial Taxa and Their Metabolite, DHPS, May Be Linked to Gut Dyshomeostasis in Patients with Alzheimer's Disease, Parkinson's Disease, and Amyotrophic Lateral Sclerosis. Nutrients 2025;17(9):1597. Ibarra-Gutierrez MT, Serrano-Garcia N, Orozco-Ibarra M. Rotenone-Induced Model of Parkinson's Disease: Beyond Mitochondrial Complex I Inhibition. Mol Neurobiol 2023;60(4):1929-1948. Manfredsson FP, Luk KC, Benskey MJ, et al. Induction of alpha-synuclein pathology in the enteric nervous system of the rat and nonhuman primate results in gastrointestinal dysmotility and transient CNS pathology. Neurobiol Dis 2018;112:106-118. Barrenschee M, Zorenkov D, Bottner M, et al. Distinct pattern of enteric phospho-alpha-synuclein aggregates and gene expression profiles in patients with Parkinson's disease. Acta Neuropathol Commun 2017;5(1):1. Espinosa-Oliva AM, Ruiz R, Soto MS, et al. Inflammatory bowel disease induces pathological alpha-synuclein aggregation in the human gut and brain. Neuropathol Appl Neurobiol 2024;50(1):e12962. Zhang S, Mi P, Luan J, Sun M, Zhao X, Feng X. Fluorene-9-bisphenol acts on the gut-brain axis by regulating oxytocin signaling to disturb social behaviors in zebrafish. Environ Res 2024;255:119169. Gruber T, Lechner F, Murat C, et al. High-calorie diets uncouple hypothalamic oxytocin neurons from a gut-to-brain satiation pathway via kappa-opioid signaling. Cell Rep 2023;42(10):113305. Nowacka A, Sniegocki M, Ziolkowska EA. Vagal Oxytocin Receptors as Molecular Targets in Gut-Brain Signaling: Implications for Appetite, Satiety, Obesity, and Esophageal Motility-A Narrative Review. Int J Mol Sci 2025;26(16):7812. Xu S, Qin B, Shi A, Zhao J, Guo X, Dong L. Oxytocin inhibited stress induced visceral hypersensitivity, enteric glial cells activation, and release of proinflammatory cytokines in maternal separated rats. Eur J Pharmacol 2018;818:578-584. Aho VTE, Houser MC, Pereira PAB, et al. Relationships of gut microbiota, short-chain fatty acids, inflammation, and the gut barrier in Parkinson's disease. Mol Neurodegener 2021;16(1):6. van IJzendoorn SCD, Derkinderen P. The Intestinal Barrier in Parkinson's Disease: Current State of Knowledge. J Parkinsons Dis 2019;9(s2):S323-S329. Pellegrini C, D'Antongiovanni V, Miraglia F, et al. Enteric alpha-synuclein impairs intestinal epithelial barrier through caspase-1-inflammasome signaling in Parkinson's disease before brain pathology. NPJ Parkinsons Dis 2022;8(1):9. Dong-Chen X, Yong C, Yang X, Chen-Yu S, Li-Hua P. Signaling pathways in Parkinson's disease: molecular mechanisms and therapeutic interventions. Signal Transduct Target Ther 2023;8(1):73. Robinson NB, Krieger K, Khan FM, et al. The current state of animal models in research: A review. Int J Surg 2019;72:9-13. Lal R, Singh A, Watts S, Chopra K. Experimental models of Parkinson's disease: Challenges and Opportunities. Eur J Pharmacol 2024;980:176819. Liu L, Zhao Y, Yang W, et al. Rotenone Induces Parkinsonism with Constipation Symptoms in Mice by Disrupting the Gut Microecosystem, Inhibiting the PI3K-AKT Signaling Pathway and Gastrointestinal Motility. Int J Mol Sci 2025;26(5):2079. Purba JS, Hofman MA, Swaab DF. Decreased number of oxytocin-immunoreactive neurons in the paraventricular nucleus of the hypothalamus in Parkinson's disease. Neurology 1994;44(1):84-89. Usami N, Maegawa H, Hayashi M, Kudo C, Niwa H. Changes in the analgesic mechanism of oxytocin can contribute to hyperalgesia in Parkinson's disease model rats. PLoS One 2024;19(8):e0300081. Foltynie T, Bruno V, Fox S, Kuhn AA, Lindop F, Lees AJ. Medical, surgical, and physical treatments for Parkinson's disease. Lancet 2024;403(10423):305-324. Murakami H, Shiraishi T, Umehara T, Omoto S, Iguchi Y. Recent Advances in Drug Therapy for Parkinson's Disease. Intern Med 2023;62(1):33-42. Dong D, Xie J, Wang J. Neuroprotective Effects of Brain-Gut Peptides: A Potential Therapy for Parkinson's Disease. Neurosci Bull 2019;35(6):1085-1096. Kalinderi K, Papaliagkas V, Fidani L. GLP-1 Receptor Agonists: A New Treatment in Parkinson's Disease. Int J Mol Sci 2024;25(7):3812. Carter CS, Kenkel WM, MacLean EL, et al. Is Oxytocin "Nature's Medicine"?. Pharmacol Rev 2020;72(4):829-861. Jurek B, Neumann ID. The Oxytocin Receptor: From Intracellular Signaling to Behavior. Physiol Rev 2018;98(3):1805-1908. Pierzynowska K, Gaffke L, Zabinska M, et al. Roles of the Oxytocin Receptor (OXTR) in Human Diseases. Int J Mol Sci 2023;24(4):3887. Wang X, Chen D, Guo M, et al. Oxytocin Alleviates Colitis and Colitis-Associated Colorectal Tumorigenesis via Noncanonical Fucosylation. Research (Wash D C) 2024;7:407. Ye C, Cheng M, Ma L, et al. Oxytocin Nanogels Inhibit Innate Inflammatory Response for Early Intervention in Alzheimer's Disease. ACS Appl Mater Interfaces 2022;14(19):21822-21835. Welch MG, Margolis KG, Li Z, Gershon MD. Oxytocin regulates gastrointestinal motility, inflammation, macromolecular permeability, and mucosal maintenance in mice. Am J Physiol Gastrointest Liver Physiol 2014;307(8):G848-G862. Ishioh M, Nozu T, Okumura T. Brain Neuropeptides, Neuroinflammation, and Irritable Bowel Syndrome. Digestion 2024;105(1):34-39. Dou D, Liang J, Zhai X, et al. Oxytocin signaling in dendritic cells regulates immune tolerance in the intestine and alleviates DSS-induced colitis. Clin Sci (Lond) 2021;135(4):597-611. Bellini G, Benvenuti L, Ippolito C, et al. Intestinal histomorphological and molecular alterations in patients with Parkinson's disease. Eur J Neurol 2023;30(11):3440-3450. Rajkovaca Latic I, Popovic Z, Mijatovic K, et al. Association of intestinal inflammation and permeability markers with clinical manifestations of Parkinson's disease. Parkinsonism Relat Disord 2024;123:106948. Rao M, Gulbransen BD. Enteric Glia. Cold Spring Harb Perspect Biol 2025;17(4):a041368. Lv X, Lv S, Wang G, et al. Glia-derived adenosine in the ventral hippocampus drives pain-related anxiodepression in a mouse model resembling trigeminal neuralgia. Brain Behav Immun 2024;117:224-241. Seguella L, Gulbransen BD. Enteric glial biology, intercellular signaling and roles in gastrointestinal disease. Nat Rev Gastroenterol Hepatol 2021;18(8):571-587. van Baarle L, De Simone V, Schneider L, et al. IL-1R signaling drives enteric glia-macrophage interactions in colorectal cancer. Nat Commun 2024;15(1):6079. Clairembault T, Kamphuis W, Leclair-Visonneau L, et al. Enteric GFAP expression and phosphorylation in Parkinson's disease. J Neurochem 2014;130(6):805-815. Shang M, Ning J, Zang C, et al. Microbial metabolite 3-indolepropionic acid alleviated PD pathologies by decreasing enteric glia cell gliosis via suppressing IL-13Ralpha1 related signaling pathways. Acta Pharm Sin B 2025;15(4):2024-2038. Nasser Y, Fernandez E, Keenan CM, et al. Role of enteric glia in intestinal physiology: effects of the gliotoxin fluorocitrate on motor and secretory function. Am J Physiol Gastrointest Liver Physiol 2006;291(5):G912-G927. Ziegler AL, Caldwell ML, Craig SE, et al. Enteric glial cell network function is required for epithelial barrier restitution following intestinal ischemic injury in the early postnatal period. Am J Physiol Gastrointest Liver Physiol 2024;326(3):G228-G246. Gao H, Zhang Y, Li Y, et al. mu-Opioid Receptor-Mediated Enteric Glial Activation Is Involved in Morphine-Induced Constipation. Mol Neurobiol 2021;58(7):3061-3070. Additional Declarations The authors declare no competing interests. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8516406","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":569197768,"identity":"123170f2-7373-44bd-87ad-2502df337cb4","order_by":0,"name":"Hong Chen","email":"","orcid":"","institution":"Shanxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Hong","middleName":"","lastName":"Chen","suffix":""},{"id":569197769,"identity":"27c1a9fc-fd8a-4d15-b1b2-b9d5908f5c8f","order_by":1,"name":"Yuanyuan Han","email":"","orcid":"","institution":"Shanxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yuanyuan","middleName":"","lastName":"Han","suffix":""},{"id":569197770,"identity":"42f36553-4c20-428e-b926-1cd077383b8d","order_by":2,"name":"Zhuoting Li","email":"","orcid":"","institution":"Shanxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhuoting","middleName":"","lastName":"Li","suffix":""},{"id":569197771,"identity":"157f80bb-5721-4ea4-b32b-af336bba360e","order_by":3,"name":"Qin Zhang","email":"","orcid":"","institution":"Yuncheng Central Hospital of Shanxi Province","correspondingAuthor":false,"prefix":"","firstName":"Qin","middleName":"","lastName":"Zhang","suffix":""},{"id":569197772,"identity":"4bbecad4-e622-4817-be33-0fdfdac4f7c2","order_by":4,"name":"Xintao Huang","email":"","orcid":"","institution":"First Hospital of Shanxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xintao","middleName":"","lastName":"Huang","suffix":""},{"id":569197773,"identity":"06cfc687-af92-4430-9bad-8fdb5c5479c3","order_by":5,"name":"Liu Yang","email":"","orcid":"","institution":"First Hospital of Shanxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Liu","middleName":"","lastName":"Yang","suffix":""},{"id":569197774,"identity":"721c100b-a072-468a-82c6-de12e80bcd1a","order_by":6,"name":"Chengwu Zhang","email":"","orcid":"","institution":"Shanxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Chengwu","middleName":"","lastName":"Zhang","suffix":""},{"id":569197775,"identity":"33f975d5-c919-4b6c-9e4e-79178bedbe60","order_by":7,"name":"Li Lu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAApUlEQVRIiWNgGAWjYBACPgbmhgMfoBwJorSwMTA2HJxBshZmHtK0SCQ2Hrb5czja4ADzwds8DHZ5xGhpOJzblpa74QBbsjUPQ3IxkVoabIBaeMykeRgOJDYQpcXijwRQC/83ErQwsIFtYSNSC8/DhoO9QL/MPMxmbDnHIJmwFn725MMffvw5nNt3vPnhjTcVdoS1IAAziDAgXv0oGAWjYBSMAjwAAIpoOrKd7kagAAAAAElFTkSuQmCC","orcid":"","institution":"Shanxi Medical University","correspondingAuthor":true,"prefix":"","firstName":"Li","middleName":"","lastName":"Lu","suffix":""}],"badges":[],"createdAt":"2026-01-05 03:12:32","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":true,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":true},"doi":"10.21203/rs.3.rs-8516406/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8516406/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":99671981,"identity":"cdaf9c5c-91e6-4068-8b70-7d6e7998a0a1","added_by":"auto","created_at":"2026-01-07 07:13:29","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5539922,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/a169f351179de3306690d5ae.docx"},{"id":99795355,"identity":"d9527de4-882e-4dec-b5ba-bf6840017cc8","added_by":"auto","created_at":"2026-01-08 13:37:48","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":342,"visible":true,"origin":"","legend":"","description":"","filename":"rs8516406.json","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/fc973dfe8f5b371dfb28c50d.json"},{"id":99795034,"identity":"e9e5cf97-1251-4fef-8ed1-4e031426e99b","added_by":"auto","created_at":"2026-01-08 13:36:51","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":135291,"visible":true,"origin":"","legend":"","description":"","filename":"rs85164060enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/e5c3b43c318ab601c471ea34.xml"},{"id":99794426,"identity":"7f72e5b2-f863-49d1-9dc7-c72dc80f2907","added_by":"auto","created_at":"2026-01-08 13:34:59","extension":"jpeg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":400824,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/d368f334c73ab5997fa7f026.jpeg"},{"id":99794702,"identity":"57aecb13-46e7-46ac-9714-529fb219f036","added_by":"auto","created_at":"2026-01-08 13:35:59","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":307192,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/2963bf4312b1ae8c12bed0ba.jpeg"},{"id":99794519,"identity":"966083e1-871a-4940-bc97-93db47ce4e29","added_by":"auto","created_at":"2026-01-08 13:35:11","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1080120,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/58022f78528919e8f7d47e25.jpeg"},{"id":99671983,"identity":"70f2d078-99d6-4206-9fc0-83f3b906558b","added_by":"auto","created_at":"2026-01-07 07:13:29","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":958576,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/5fa98e7dff12dd97a81093c0.jpeg"},{"id":99795890,"identity":"e9364012-be45-4974-96ad-4cc42b4591c2","added_by":"auto","created_at":"2026-01-08 13:40:00","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":912180,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/c467b1506e5d5e8cc820dcee.jpeg"},{"id":99671991,"identity":"cff13807-52c1-44b7-8f91-ef70ae777036","added_by":"auto","created_at":"2026-01-07 07:13:29","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1405860,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/7bedf8d777485b177359d88b.jpeg"},{"id":99671992,"identity":"4740ba0c-4cad-44a9-94f2-f848267ffd0e","added_by":"auto","created_at":"2026-01-07 07:13:29","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":264798,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/8ed3e7208728850999cbbde1.jpeg"},{"id":99795386,"identity":"ddc359bc-024b-4524-ba01-332a1068af69","added_by":"auto","created_at":"2026-01-08 13:37:51","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":65061,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/28042a97d009b52f91c6052f.png"},{"id":99796750,"identity":"6fe712bc-954b-434f-b60b-c8a2f75ef94f","added_by":"auto","created_at":"2026-01-08 13:43:22","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":42670,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/6d9cd2ee063ad579dbbac11f.png"},{"id":99671987,"identity":"b15bae50-c339-4ffe-a9d6-ad1b02cac3ae","added_by":"auto","created_at":"2026-01-07 07:13:29","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":127627,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/c70b75243dad941ff7cdf6f0.png"},{"id":99671979,"identity":"412841a3-d983-49aa-bcbf-fadeee2c4d72","added_by":"auto","created_at":"2026-01-07 07:13:29","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":115223,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/e0f261a5ce032583019a58c7.png"},{"id":99671990,"identity":"b8bdec09-49ec-4c49-b3cf-1c91e7e1bbeb","added_by":"auto","created_at":"2026-01-07 07:13:29","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":106341,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/fd00962da396a06547abbf07.png"},{"id":99671988,"identity":"63cdf801-991b-4fe5-88ab-423ff4ebaf30","added_by":"auto","created_at":"2026-01-07 07:13:29","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":199404,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/bcee61e5d452fb7515f63f56.png"},{"id":99671985,"identity":"ac8ffd89-34a7-4c88-99f6-22c720b15019","added_by":"auto","created_at":"2026-01-07 07:13:29","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":53245,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/fd540d177df8c50e3256a325.png"},{"id":99671993,"identity":"1e543b5c-a7d1-42bb-805b-ab705b1dfda7","added_by":"auto","created_at":"2026-01-07 07:13:29","extension":"xml","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":132786,"visible":true,"origin":"","legend":"","description":"","filename":"rs85164060structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/ab8bf6de4dbf184f727d2e62.xml"},{"id":99671994,"identity":"a7825512-3da7-42e7-8036-6234c8ae4be2","added_by":"auto","created_at":"2026-01-07 07:13:29","extension":"html","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":147345,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/9e41f5714ae7ce7e69d0ae49.html"},{"id":99671968,"identity":"ba527fde-3056-46c3-bda9-3bf85c09609a","added_by":"auto","created_at":"2026-01-07 07:13:29","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":278830,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMotor and constipation symptoms occur at the 7\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003eth\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e and 3\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003erd\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e weeks, respectively, in ROT-induced PD mice.\u003c/strong\u003e (\u003cstrong\u003eA)\u003c/strong\u003e Experimental circuit diagram of the ROT-induced prodromal and clinical PD mouse models. (\u003cstrong\u003eB)\u003c/strong\u003e Rota‒rod test. (\u003cstrong\u003eC) \u003c/strong\u003eClimbing pole test. (\u003cstrong\u003eD) \u003c/strong\u003eOpen field test.\u003cstrong\u003e (E) \u003c/strong\u003eWater content of the fecal pellets. (\u003cstrong\u003eF)\u003c/strong\u003e Numbers of fecal pellet outputs. (\u003cstrong\u003eG) \u003c/strong\u003eCarmine appearance time in the fecal pellets. (\u003cstrong\u003eH-I) \u003c/strong\u003eEvans blue transit distance. CON, control; ROT, rotenone. n = 8 mice/group. The data are presented as the means ± SEMs. * \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 and *** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 by two-tailed Student’s t test.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/1e73e36c33c630380dbbabda.png"},{"id":99671972,"identity":"bf4b5b9b-f198-4fba-8ffd-9921ae724930","added_by":"auto","created_at":"2026-01-07 07:13:29","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":161871,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIncreased α-syn expression in the colon and serum during the prodromal stage in PD mice. (A) \u003c/strong\u003eFlowchart of sample collection and processing. (\u003cstrong\u003eB-C) \u003c/strong\u003eRepresentative western blot images and density analysis results of α-syn and α-syn oligomers in the colon. (\u003cstrong\u003eD-E)\u003c/strong\u003e Representative western blot images and the density analysis results of α-syn in the midbrain containing the SNpc. (\u003cstrong\u003eF)\u003c/strong\u003e The concentrations of α-syn in the serum.CON, control; ROT, rotenone; α-syn, α-synuclein. n = 3–5mice/group. The data are presented as the means ± SEMs. ns, notsignificant. * \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05 by two-tailed Student’s t test.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/2bd66122544e49d97fe55f3c.png"},{"id":99795470,"identity":"97a426f8-b958-4d25-92ff-408dcbb0544c","added_by":"auto","created_at":"2026-01-08 13:38:13","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":483295,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCompromised OXT/OXTR signaling and hyperactivation of EGCs in the colon of ROT-induced prodromal PD mice. (A)\u003c/strong\u003e OXT levels in the hypothalamus, serum, and colon tissue. (\u003cstrong\u003eB-C)\u003c/strong\u003e Representative western blot images and density analysis results of OXTRsin the colon. (\u003cstrong\u003eD)\u003c/strong\u003e Representative images of OXTRs in the colonic muscularis whole mounts. (\u003cstrong\u003eE-F)\u003c/strong\u003e Representative images of GFAP in colonic sections and muscularis whole mounts. (\u003cstrong\u003eG-H)\u003c/strong\u003e Quantitative analysis of the optical density of OXTR and GFAP IF staining in the colon. CON, control; ROT, rotenone; OXT, oxytocin; OXTR, oxytocin receptor; GFAP, glial fibrillary acidic protein. n = 3–5 mice/group. The data are presented as the means ± SEMs. * \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 and *** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 by one-way ANOVA followed by Bonferroni post hoc correction and two-tailed Student’s t test.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/7935cad9df7d808bc119ab65.png"},{"id":99671971,"identity":"15d3f915-93f8-4e09-9872-d811721af435","added_by":"auto","created_at":"2026-01-07 07:13:29","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":429882,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOXT or FC inhibits the hyperactivation of EGCs and reduces inflammatory factorlevels in the colon of the ROT-induced prodromal PD mousemodel and the EGC line.\u003c/strong\u003e (\u003cstrong\u003eA)\u003c/strong\u003e Flow chart of the animal treatments with OXT and FC. (\u003cstrong\u003eB)\u003c/strong\u003e The levels of OXT in the serum of prodromal PD mice. (\u003cstrong\u003eC) \u003c/strong\u003eThe mRNA expression of IL-6, TNFα and IL-1β in the colon. (\u003cstrong\u003eD)\u003c/strong\u003eRepresentative imagesof GFAP in colonic muscularis whole mounts. (\u003cstrong\u003eE)\u003c/strong\u003e Quantitative analysis of the optical density of GFAP IF staining in the colon.\u003cstrong\u003e (F-G) \u003c/strong\u003eRepresentative western blot imagesand density analysis results of GFAP in CRL-2690 cells. (\u003cstrong\u003eH-I)\u003c/strong\u003eRepresentative imagesand quantitative analysis of the optical density of GFAP in CRL-2690 cells. CON, control; ROT, rotenone; OXT, oxytocin; FC, fluorocitrate; GFAP, glial fibrillary acidic protein. n = 3–5 mice/group. The data are presented as the means ± SEMs. * \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 and *** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 0.001 by one-way ANOVA followed by Bonferroni post hoc correction and two-tailed Student’s t test.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/4dd19311b2fc71c3b066db4d.png"},{"id":99671974,"identity":"c4d8b4b9-bce9-40d2-9a9e-6a4b73dd600b","added_by":"auto","created_at":"2026-01-07 07:13:29","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":535319,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOXT or FC decreases α-syn expression and rescues the loss of DA neurons in the ROT-induced PD mouse model.\u003c/strong\u003e(\u003cstrong\u003eA-B)\u003c/strong\u003e Representative western blot images and the density analysis results of α-syn in the colons of prodromal PD mice. (\u003cstrong\u003eC) \u003c/strong\u003eThe levels of α-syn in the serum of prodromal PD mice. (\u003cstrong\u003eD) \u003c/strong\u003eRepresentative images of TH-positive neurons in the SNpc of prodromal PD and clinical PD mice. (\u003cstrong\u003eE)\u003c/strong\u003eQuantification of TH-positive cells in the SNpc. CON, control; ROT, rotenone; OXT, oxytocin; FC, fluorocitrate; α-syn, α-synuclein; TH, tyrosine hydroxylase. n = 3–6 mice/group. The data are presented as the means ± SEMs. * \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 and *** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 by one-way ANOVA followed by Bonferroni post hoc correction.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/c0f95056c240cae7aa60b022.png"},{"id":99671976,"identity":"fe4b946a-9a65-4032-bf9f-5927db552099","added_by":"auto","created_at":"2026-01-07 07:13:29","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":810658,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOXT reverses intestinal barrier dysfunction in ROT-induced PD mice. (A-C) \u003c/strong\u003eRepresentative images of ZO-1, Claudin-3 and Claudin-5 in the colonsof prodromal PD and clinical PD mice.\u003cstrong\u003e (D-F) \u003c/strong\u003eQuantitative analysis of the optical density of ZO-1, Claudin-3 and Claudin-5 immunohistostaining in the colon. (\u003cstrong\u003eG) \u003c/strong\u003eFD-4 leakage in serum. CON, control; ROT, rotenone; OXT, oxytocin; FD-4, fluorescein-dextran. n = 5–6 mice/group. The data are presented as the means ± SEMs. * \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 and *** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 by one-way ANOVA followed by Bonferroni post hoc correction.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/30db705a6c0efebeae01d61e.png"},{"id":99794700,"identity":"03370ae4-4882-404e-afa7-0c637774b281","added_by":"auto","created_at":"2026-01-08 13:35:59","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":173718,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOXT or FC alleviates motor symptoms and intestinal motility dysfunctions inROT-induced PD mice. (A-C)\u003c/strong\u003e Rota‒rod, climbing pole and open field tests in clinical PD model mice. (\u003cstrong\u003eD-F)\u003c/strong\u003e Water content of the fecal pellets, carmine appearance time in the fecal pelletsand the Evans blue transit distance in prodromal PD mice. CON, control; ROT, rotenone; OXT, oxytocin; FC, fluorocitrate. n = 6 mice/group. The data are presented as the means ± SEMs. * \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 and *** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 by two-tailed Student’s t test.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/ad56af32325c21df2533d50e.png"},{"id":99805156,"identity":"eeaddecc-16c6-44e7-9269-e5fd90930480","added_by":"auto","created_at":"2026-01-08 14:15:56","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4061386,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8516406/v1/cb7b7b0a-5679-4822-8ed1-1dfff89a5a85.pdf"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eExogenous Oxytocin Alleviates Prodromal and Clinical Parkinson's Disease Phenotypes via the Inhibition of Enteric Glial Cell-triggered Neuroinflammation\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eParkinson's disease (PD) is one of the most common neurodegenerative diseases. With the aging of the global population, the number of PD patients is estimated to reach 10\u0026nbsp;million by 2030.\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e The pathological hallmark of PD is the progressive loss of dopaminergic (DA) neurons in the substantia nigra pars compacta (SNpc), along with the presence of Lewy bodies\u0026mdash;structures formed by misfolded α-synuclein (α-syn) aggregates within residual DA neurons.\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e Although some advances have been achieved in the clinic, unfortunately, PD remains incurable.\u003c/p\u003e \u003cp\u003ePD patients exhibit typical motor symptoms, such as resting tremor, rigidity, and postural instability, and nonmotor symptoms (NMSs), such as constipation, dysphagia and nausea, which precede motor symptoms.\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e Among the NMS, constipation is acknowledged as one of the earliest and most prevalent symptoms, especially in the prodromal stage of PD.\u003csup\u003e7\u003c/sup\u003e Interestingly, Braak et al. proposed that α-syn first accumulates in the enteric nervous system (ENS) and spreads in a \"prion-like\" manner through the vagus nerve to the brain, which leads to neurological and motor deficits in PD.\u003csup\u003e8\u003c/sup\u003e However, the mechanism underlying the early aggregation of α-syn in the ENS and the associated intestinal motility disorders remain unclear.\u003c/p\u003e \u003cp\u003eRecent studies have reported that enteric glial cells (EGCs), as \"sentinel\" cells, are hyperactivated in the prodromal stage of PD and play pivotal roles in PD pathogenesis.\u003csup\u003e\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e EGCs are the most abundant cell type and participate in the maintenance of intestinal homeostasis.\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e,\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e However, hyperactivated EGCs, characterized by increased expression of glial fibrillary acidic protein (GFAP), induce PD occurrence by promoting the release of proinflammatory cytokines, growth factors and other immunomodulatory molecules and disrupting intestinal function.\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e As such, targeting EGC-triggered neuroinflammation and intestinal dysfunction has emerged as a promising therapeutic strategy for the treatment of PD.\u003c/p\u003e \u003cp\u003eOxytocin (OXT) is a hypothalamus-derived small peptide of 9 amino acids that is well known for its ability to regulate uterine contraction and prosocial behaviors.\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e Recently, studies have reported that OXT levels are significantly decreased in both PD animal models and PD patients, indicating its neuroprotective role.\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eIn the present study, we found that rotenone (ROT) administration induced prodromal and clinical PD phenotypes in mice. Mechanistically, EGCs are hyperactivated, which triggers increases in the expression of GFAP and α-syn in the colon and the release of inflammatory factors such as IL-6, IL-1β, and TNF-α. More importantly, supplementation with exogenous OXT or the EGC inhibitor fluorocitrate (FC) successfully ameliorated the prodromal and clinical PD phenotypes of mice via the inhibition of EGC activation. The findings of the present study not only shed light on the mechanism of PD pathogenesis but also provide novel clues for PD treatment.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eMale C57BL/6J mice aged 8 weeks were purchased from the Animal Center of Shanxi Medical University. The mice were acclimatized to a standard environment with a temperature of 23\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C, humidity of 40\u0026ndash;60%, a 12 h light/dark cycle, and ad libitum access to food and water for 14 days.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eEstablishment of the PD mouse model\u003c/h3\u003e\n\u003cp\u003eThe experimental circuit diagram of the ROT (MCE, Monmouth Junction, NJ, USA, Cat# HY-B1756)-induced prodromal and clinical PD mouse model is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA. The mice were randomly divided into 2 groups: the control group (n\u0026thinsp;=\u0026thinsp;30) and the ROT group (n\u0026thinsp;=\u0026thinsp;60). ROT powder was dissolved in 20% Tween-80 (Solarbio, Beijing, China, Cat# T8360) and 40% PEG-300 (Solarbio, Beijing, China, Cat# IP9020) with 40% PBS. The mice received ROT (20 mg/kg) or vehicle daily intragastrically. Behavioral and intestinal motility tests were performed at the 2nd, 3rd, and 7th weeks. The mice were sacrificed at the 3rd and 7th weeks for further analysis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eDrug administration\u003c/h3\u003e\n\u003cp\u003eThe flow chart of the effects of OXT (MCE, Monmouth Junction, NJ, USA, Cat# HY-17571A) or the EGC inhibitor fluorocitrate (FC, MCE, Monmouth Junction, NJ, USA, Cat# F9634) on ROT-induced mice is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eA. The mice were randomly assigned to 4 groups: the control, ROT, ROT\u0026thinsp;+\u0026thinsp;OXT and ROT\u0026thinsp;+\u0026thinsp;FC groups (n\u0026thinsp;=\u0026thinsp;20/group). OXT or FC powder was dissolved in PBS at a dosage of 0.1 mg/kg via gavage or 20 \u0026micro;mol/kg via intraperitoneal injection, respectively, combined with ROT administration.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eMouse perfusion and sample collection\u003c/h3\u003e\n\u003cp\u003eThe mice were deeply anesthetized with 2.5% isoflurane (RWD Life Science Co., Xingtai, China, Cat# R510-22-10) and transcardially perfused with potassium-free PBS. The brain and colon were isolated immediately, with one hemisphere postfixation and the colonic segment in 4% paraformaldehyde for 24 h for histology; the other hemisphere was subdissected, and the remaining colonic segment was subjected to biochemical analysis. Postfixed samples were subjected to 15% and 30% sucrose dehydration (each for 24 h) at 4\u0026deg;C, and after being embedded in optimal cutting temperature (OCT) compound (Sakura, Finetek, Japan, Cat# 4583), they were immediately frozen in liquid nitrogen. Slide-mounted 16 \u0026micro;m brain sections and 6 \u0026micro;m colonic sections were cut using a cryostat (Leica Microsystems, Nussloch, Germany, Cat# CM1860). Hypothalamus, midbrain and colon tissues were collected for further experiments.\u003c/p\u003e\n\u003ch3\u003eBehavioral assessment\u003c/h3\u003e\n\u003cp\u003ePrior to the initiation of the behavioral test, the mice underwent a two-day adaptive training regimen, and the test was repeated 3 times for each mouse.\u003c/p\u003e \u003cp\u003eAcceleration of the rotarod test\u003c/p\u003e \u003cp\u003eThe mice were placed on a rotarod apparatus, and then the rod revolved from 5 to 20 rpm over 5 min. The latency of the mice to fall off the accelerating rotarod within 5 min was recorded 3 times at 1 h intervals.\u003c/p\u003e \u003cp\u003ePole test\u003c/p\u003e \u003cp\u003eThe climbing pole was positioned at an angle of 45\u0026deg;, and the mouse was placed face up near the top of a pole with a rough surface (50 cm in height and 1 cm in diameter). The time to reach the bottom of the pole was recorded for each mouse in 3 trials separated by 1 h intervals.\u003c/p\u003e \u003cp\u003eOpen field test (OFT)\u003c/p\u003e \u003cp\u003eEach mouse was placed in the center of an open area consisting of a white cube opaque chamber (40 \u0026times; 40 \u0026times; 40 cm) and allowed to freely move for 5 min. The total distance traveled was recorded and analyzed via Smart 3.0 software (Panlab SL, Spain) within 5 min. After each test, the chamber was cleaned with 75% alcohol and allowed to dry thoroughly to avoid affecting the next experimental mouse.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eIntestinal motility function assessment\u003c/h2\u003e \u003cp\u003eFecal pellet output\u003c/p\u003e \u003cp\u003eAfter 2 h of fasting and water deprivation, each mouse was individually housed in a clean cage. Fecal pellet numbers were recorded after 2 h. The collected feces were weighed to record the wet weight and then dried at 65\u0026deg;C for 24 h. The dry weight of the feces was subsequently measured.\u003c/p\u003e \u003cp\u003eMeasurement of carmine fecal excretion time\u003c/p\u003e \u003cp\u003eThe carmine (Solarbio, Beijing, China, Cat# C8540) powder was dissolved in PBS at a concentration of 5 mg/mL. Carmine solution (5 mg/kg) was administered to the mice via intragastric gavage, and the amount of time spent in the feces was recorded.\u003c/p\u003e \u003cp\u003eMeasurement of intestinal transmission distance\u003c/p\u003e \u003cp\u003eEach mouse was gavaged with 300 \u0026micro;L of Evans blue staining solution (Sigma‒Aldrich, Steinheim, Germany, Cat# E2129) and then euthanized after 30 min. The entire intestinal segment was harvested. The distance from the stomach to the site where Evans blue disappeared was recorded.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePreparation of colon whole mounts\u003c/h3\u003e\n\u003cp\u003eAcetone (Sigma‒Aldrich, Steinheim, Germany, Cat# 179124) was injected into the intestinal lumen, and the ends of the intestinal segment were ligated and placed in acetone for 24 h of fixation. The intestinal segment was incised along the mesenteric border under a stereomicroscope, and then the mucosal and muscular layers were sequentially removed to expose the serosal layer.\u003c/p\u003e\n\u003ch3\u003eIntestinal permeability assay\u003c/h3\u003e\n\u003cp\u003eIsothiocyanamide fluorescein-dextran (FD-4, 4000 kDa, Sigma‒Aldrich, Steinheim, Germany, Cat# FD-4) was dissolved in PBS. The mice were fasted for 4 h and then orally gavaged with FD-4 (0.5 mg/g). After 3 h, the mice were euthanized, and blood was collected from the orbital cavity. The blood sample was centrifuged at 3200 rpm for 20 min, and the serum was isolated. The FD-4 leakage fluorescence intensity was detected with a microplate fluorescence reader (SpectraMax i3, Molecular Devices, San Jose, California, USA) at an excitation wavelength of 485 nm and an emission wavelength of 530 nm.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eThe rat jejunum enteric glial cell line CRL-2690 was purchased from Fuheng Biology (Shanghai, China, Cat# FH1201). CRL-2690 cells were cultured in RPMI-1640 medium (Gibco, Grand Island, USA, Cat# 11875093) supplemented with 10% fetal bovine serum (FBS, Gibco, Grand Island, USA, Cat# 10099141C) and 100 U/mL penicillin‒streptomycin (Gibco, Grand Island, USA, Cat# 15140122) at 37\u0026deg;C in 5% CO\u003csub\u003e2\u003c/sub\u003e. CRL-2690 cells were treated with ROT (0.1 mM) for 24 h combined with OXT (10 nM) or FC (0.5 mM) administration.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eEnzyme-linked immunosorbent assay (ELISA)\u003c/h2\u003e \u003cp\u003eELISA kits were used to measure the levels of α-syn (Cloud-Clone Corp., Wuhan, China, Cat# SEB222Mu) in the serum and OXT (Cloud-Clone Corp., Wuhan, China, Cat# CEB052Ge) in the hypothalamus, serum and colon of PD mice. The operations were conducted according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eThe midbrain and colon tissues were lysed in fresh and cold RIPA buffer (Thermo Fisher Scientific, Waltham, MA, USA; Cat# P0013B) supplemented with a protease inhibitor (Sigma‒Aldrich, Steinheim, Germany; Cat# 8340). The lysates were centrifuged twice at 4\u0026deg;C, and the protein concentration was determined via a BCA assay (CWbio, Taizhou, Jiangsu, China; Cat# CW0014) via a spectrophotometer. A total of 20 \u0026micro;g of protein was subjected to SDS\u0026ndash;PAGE and transferred to a polyvinylidene fluoride (PVDF; Millipore, Burlington, MA, USA, Cat# IPVH00010) membrane. The membranes were blocked with 5% nonfat milk in TBST (TBS containing 0.1% Tween-20) for 1 h at room temperature and then incubated with primary antibodies overnight at 4\u0026deg;C. After being washed with 0.1% TBST, the membranes were incubated with secondary antibodies for 1 h at room temperature. The blots were visualized by using BeyoECL Plus (Beyotime, Shanghai, China, Cat# P0018M) in a FluorChem E digital imaging system (Alpha FluorChem E) and analyzed by ImageJ software (NIH, Bethesda, MD). The primary and secondary antibodies used are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAntibodies used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntibodies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eApplication\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDilution\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCompany \u0026amp; Catalog number\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimary antibodies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMice anti-α-syn monoclonal IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:800\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSanta Cruz, Cat# sc-69977\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit anti-oligomeric α-syn polyclonal IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSigma‒Aldrich, Cat# ABN2265\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit anti-OXTR monoclonal IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIF or WB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:200 or 1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAbcam, Cat# ab300443\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit anti-GFAP polyclonal IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIF or WB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:200 or 1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAbcam, Cat# ab7260\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit anti-β-actin monoclonal IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:10,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eABclonal, Cat# AC038\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMice anti-GAPDH monoclonal IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:10,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSigma‒Aldrich, Cat# MAB374\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit anti-TH polyclonal IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eProteintech, Cat# 25859-1-AP\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit anti-ZO-1 monoclonal IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAbcam, Cat# ab276131\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit anti-Claudin-3 monoclonal IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:300\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAbcam, Cat# ab214487\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit anti-Claudin-5 monoclonal IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAbcam, Cat# ab131259\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSecondary antibodies\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMice IgG, HRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:10000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eABclonal, Cat# AS003\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit IgG, HRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:10000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eABclonal, Cat# AS014\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAlexa 488 donkey anti-rabbit IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAbcam, Cat# ab150073\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCy3 donkey anti-rabbit IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eJackson, Cat# 711-165-152\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence staining\u003c/h2\u003e \u003cp\u003eThe brain and colon sections were washed in PBS for 5 min, permeabilized and blocked with 0.5% Triton X-100 in PBS for 20 min, washed 3 times in PBS for 15 min, and blocked in 10% normal donkey serum in PBS for 1 h at 37\u0026deg;C. Then, the cells were incubated with primary antibodies overnight at 4\u0026deg;C. The next day, the sections were washed with PBS 3 times. The cells were then incubated with secondary antibodies for 1 h. DAPI solution was used to stain the nuclei. The primary and secondary antibodies used are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. After immunostaining, the average fluorescence intensity was analyzed via ImageJ software. The total number of tyrosine hydroxylase (TH) neurons was estimated via the Stereo Investigator system (Micro Brightfield, USA), which was combined with an Olympus microscope (Tokyo, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eRNA isolation and quantitative real-time-PCR (qPCR) analysis\u003c/h2\u003e \u003cp\u003eThe total RNA of the colon samples was extracted with TRIzol isolation reagent (Invitrogen, Eugene Oregon, USA, Cat# 15596026CN) according to the manufacturer\u0026rsquo;s instructions. Reverse transcription of the extracted mRNA was performed via 5\u0026times; All-In-One RT MasterMix (Abcam, Cambridge, UK, Cat# G492). The relative mRNA expression levels of various genes were determined via qPCR on a QuantStudio 3 Instrument (Applied Biosystems, South San Francisco, CA, USA) with the following 3-step thermal cycling protocol: 95\u0026deg;C for 2 min, followed by 40 cycles of 95\u0026deg;C for 15 s and 60\u0026deg;C for 1 min. All reactions were performed in triplicate. The relative mRNA expression was calculated via the 2-ΔΔCt method. β-actin was used as an internal control. The oligonucleotide sequences of the primers are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMice\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIL-6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCCAATTTCCAATGCTCTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCACTAGGTTTGCCGAGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTNF-α\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCCTCACACTCACAAACCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCCTGAGCCATAATCCCCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIL-1β\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCCACCTTTTGACAGTGATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTTGTGACCCTGAGCGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eβ-actin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGGAAATCGTGCGTGACAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCAGGGAGGAAGAGGATGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analyses\u003c/h2\u003e \u003cp\u003eStatistical analyses were performed with Prism 8 (GraphPad software, USA). All experimental values are expressed as the means\u0026thinsp;\u0026plusmn;\u0026thinsp;S.E.M. In brief, between-group differences were evaluated via two-tailed Student's t test or one-way ANOVA followed by Bonferroni post hoc correction. A \u003cem\u003eP\u003c/em\u003e value of 0.05 or less was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eROT oral gavage induces prodromal and clinical phenotypes in mice\u003c/h2\u003e \u003cp\u003eGut dyshomeostasis is thought to be the initiator of PD, especially in the prodromal stage.\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e ROT, a mitochondrial respiratory chain complex I inhibitor, has been widely adopted to induce chronic PD models.\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e To reveal how intestinal dysfunction underlies the pathogenesis of PD, we first established a PD mouse model via oral gavage administration of ROT. As schematically illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, the mice were subjected to ROT (20 mg/kg) daily for 7 successive weeks, followed by behavioral and intestinal motility assays. The mice exhibited significant motor dysfunction at the 7th week after ROT administration, as evidenced by a shorter latency to fall from the rotarod, prolonged pole-climbing time, and reduced total distance traveled in the target zone \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-D\u003cb\u003e)\u003c/b\u003e. Notably, symptoms of constipation emerged at the 3rd week and persisted until the 7th week, as indicated by a reduced fecal water content, a decreased number of fecal pellets, prolonged carmine appearance time in feces, and a shortened Evans blue transit distance \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE-I\u003cb\u003e)\u003c/b\u003e. These results demonstrated that ROT treatment induced intestinal motility dysfunction (prodromal symptoms) and motor deficits (clinical symptoms) in the mice. The established PD model lays the foundation for exploring the mechanism by which gut dysfunction triggers PD pathogenesis.\u003c/p\u003e \u003cp\u003e \u003cb\u003eα-syn expression in the colon, midbrain, and serum of PD model mice at the prodromal stage\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIt has been well documented that α-syn first aggregates in the ENS and then spreads to the brain via the vagus nerve or blood in both PD patients and mouse models.\u003csup\u003e\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e To assess α-syn alterations in the ROT-induced prodromal stage in PD mice, we used western blotting (WB) and ELISA to measure the levels of α-syn in the colon, midbrain and serum of PD mice, as schematically illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA. The results revealed that the levels of α-syn monomers and oligomers were significantly increased in the colons of prodromal PD mice \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eB-C\u003cb\u003e)\u003c/b\u003e. In contrast, in this stage, no significant alteration in α-syn was observed in the midbrain \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eD-E\u003cb\u003e)\u003c/b\u003e. Furthermore, serum α-syn levels were markedly elevated in prodromal PD mice \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eF\u003cb\u003e)\u003c/b\u003e. The above results suggest that, in the prodromal stage of PD, the expression of α-syn is elevated, whereas that in the midbrain is not significantly altered.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eCompromised the OXT/OXTR signaling pathway and hyperactivated EGCs in the prodromal stage in PD mice\u003c/h2\u003e \u003cp\u003eOXT is a key gut\u0026ndash;brain regulatory hormone that is produced mainly in the hypothalamus and is released by the hypothalamic‒pituitary axis (HPA).\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e The serum OXT level was significantly reduced in neurotoxin-induced PD mice.\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e Interestingly, one study has shown that OXT can alleviate visceral hypersensitivity by inhibiting the activation of EGCs, which occurs even before the onset of PD.\u003csup\u003e27\u003c/sup\u003e To determine whether the OXT/OXTR signaling pathway was compromised and whether EGCs were hyperactivated in prodromal PD mice, we performed ELISA, WB and IF staining to measure the levels of OXT, its receptor (OXTR), and GFAP. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, Hypothalamic and serum OXT levels were significantly decreased in prodromal PD mice, although no detectable changes were detected in the colon. This observation could be attributed to the hypothalamic derivation of OXT. Moreover, both the WB and IF staining results demonstrated that OXTRs were significantly decreased in the colons of prodromal PD mice \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eB-D\u003cb\u003e)\u003c/b\u003e. Additionally, the expression of GFAP, an EGC biomarker, was markedly increased in both colonic sections and muscularis whole mounts \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eE-F\u003cb\u003e)\u003c/b\u003e. Collectively, these data indicate that the OXT/OXTR signaling pathway was compromised in the colon of prodromal PD mice, whereas EGCs were hyperactivated, which might underscore the pathogenesis of PD.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eInhibition of EGC hyperactivation mitigates intestinal neuroinflammation in prodromal PD mice\u003c/h2\u003e \u003cp\u003eAfter observing hyperactivation of EGCs and downregulation of OXT, we aimed to determine whether inhibition of EGC activity with a specific inhibitor (FC) or supplementation with exogenous OXT could mitigate neuroinflammation in the colon of prodromal PD mice \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, supplementation with OXT by oral gavage reversed the decrease in serum OXT. Then, we performed qPCR to assess the impact of EGC inhibition on the expression levels of inflammatory factors in the colon of prodromal PD mice. The administration of OXT or FC successfully reversed the ROT-induced increase in the levels of IL-6, TNF-α, and IL-1β \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e. Additionally, IF staining revealed that the intensity of GFAP was reduced in colon muscularis whole mounts after OXT or FC administration \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD-E\u003cb\u003e)\u003c/b\u003e. To further confirm the above observations, we treated the rat jejunal EGC line (CRL-2690) with OXT or FC. WB analysis revealed that OXT or FC treatment significantly inhibited GFAP overexpression induced by ROT \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF-G\u003cb\u003e).\u003c/b\u003e The IF staining and quantification results aligned well with those of the WB analysis \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH-I\u003cb\u003e)\u003c/b\u003e. These data suggest that the inhibition of EGC activation mitigates neuroinflammation in the colon of prodromal PD mice, which holds potential for the treatment of PD.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eOXT or FC administration reduces α-syn expression and rescues DA neuron loss in the SNpc of PD mice\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAfter observing the anti-neuroinflammatory effect of EGC inhibition by OXT or FC, we wanted to determine the effects on α-syn expression and DA neuron survival in PD mice. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-B, Administration of OXT or FC markedly reduced α-syn in the colon of prodromal PD mice. Concurrently, the serum α-syn level was also decreased, as assessed by ELISA \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e. Additionally, DA neurons in the SNpc were quantified after labeling with TH IF. As shown in \u003cb\u003eFigure. 5D-E\u003c/b\u003e, compared with those in control PD mice, the number of DA neurons significantly decreased in clinical PD mice, although there was no detectable change in prodromal PD mice. OXT or FC administration significantly rescued DA neuron loss in clinical PD model mice. Taken together, these results illustrate that OXT or FC treatment significantly reduced α-syn in the colon and serum and rescued DA neuron loss in the SNpc of PD mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eOXT treatment restores the intestinal integrity of prodromal PD and clinical PD mice\u003c/h2\u003e \u003cp\u003eIntestinal integrity is essential for maintaining gut homeostasis, the impairment of which is implicated in the pathogenesis of PD.\u003csup\u003e28\u0026ndash;30\u003c/sup\u003e To determine whether OXT administration could impact intestinal integrity and barrier function in PD mice, we conducted IF staining for ZO-1 and Claudin-3/5, which are known proteins reflecting the tight junctions of the colon. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-C, the fluorescence signals of ZO-1, Claudin-3, and Claudin-5 were significantly reduced with diffusion in the prodromal and clinical stages of PD, which was markedly reversed by OXT administration. Fluorescence intensity quantification further confirmed the above observations \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD-F\u003cb\u003e)\u003c/b\u003e. To examine gut permeability, FD-4, a fluorescence dye, was administered via oral gavage. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG, the FD-4 signal in the serum of prodromal and clinical PD mice was elevated, which was markedly decreased by OXT administration. These data suggest that exogenous OXT treatment repaired the impairment of intestinal integrity and barrier function in PD mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eExogenous OXT or FC alleviates constipation and motor disorders in PD mice\u003c/h2\u003e \u003cp\u003eGiven the observed neuroprotective role of OXT in restoring the intestinal function and neuropathological features of ROT-induced PD mice, we further evaluated its impact on motor ability and intestinal motility. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA-C, the administration of OXT or FC significantly reversed the motor deficits of clinical PD model mice, as evidenced by the Rota-Rod, climbing pole, and open field assays. Additionally, intestinal motility was also examined. The administration of OXT or FC restored intestinal motility, as shown by increased fecal water content, shortened the appearance time of carmine in feces, and extended the Evans blue transit distance \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD-F\u003cb\u003e)\u003c/b\u003e. Collectively, these results indicate that exogenous OXT or FC has a protective effect on the motor ability and intestinal motility of ROT-induced PD mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eAffective treatment of PD remains a major challenge.\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e NMSs, particularly constipation, reportedly emerge decades prior to the onset of motor symptoms in PD patients.\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e Here, we established prodromal and clinical PD mouse models via oral gavage administration of ROT and further evaluated the rescue effect and mechanism of EGC inhibition in PD mice.\u003c/p\u003e \u003cp\u003eModel organisms are crucial for disease mechanism investigations and drug development.\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e To date, different types of PD models have been established by gene manipulation or pharmacological intervention.\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e ROT is a widely used pesticide that has also been adopted to create cellular or animal PD models.\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e In the present study, we demonstrated that chronic ROT exposure induced intestinal dysfunctions in mice prior to the manifestation of PD-related motor deficits. Mice subjected to ROT exposure exhibited significant intestinal motility function impairments at the 3rd week and motor deficits at the 7th week. Another study reported that intestinal motility dysfunction occurred at the 2nd week after ROT treatment,\u003csup\u003e34\u003c/sup\u003e which could be attributed to the higher dosage of ROT. Moreover, in ROT-induced PD mice, α-syn accumulation, a compromised OXT/OXTR signaling pathway, and EGC hyperactivation were observed, which was consistent with the findings of previous studies, indicating the successful establishment of the PD model. \u003csup\u003e17,18,35,36\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eCurrently, for the treatment of PD, dopamine replacement is mainstream, but its long-term administration is associated with various adverse effects.\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e,\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e A growing number of studies have shown that brain-gut peptides such as GLP-1, nesfatin-1, and ghrelin exert neuroprotective effects both in vivo and in vitro, indicating their promising potential for PD treatment.\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e,\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e OXT, one of the main hypothalamus-derived peptides, is increasingly recognized as a key regulator of the brain‒gut axis.\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e OXTR, a G protein-coupled receptor (GPCR), is the specific receptor for OXT and is widely expressed in both the brain and peripheral tissues.\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e,\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e Downregulation of OXT/OXTR was found in PD and colitis patients.\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e,\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e In the present study, we also observed that, in ROT-induced PD mice, OXT was decreased in the serum and hypothalamus, accompanied by a reduction in OXTRs in the colon. A recent study reported that in PD patients, hypothalamic OXT was decreased.\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e Our results, as well as those of others, indicate that dysregulation of hypothalamic synthetic or secretory function is one pathological feature in the early stage of PD, which provides novel targets for PD intervention, especially at the prodromal stage. More importantly, we found that exogenous OXT administration abrogated neurobehavioral deficits and intestinal dysfunction, which aligned well with the findings of other studies. Ye et al. demonstrated that supplementation with OXT inhibited microglial activation, thereby exerting a neuroprotective effect in the early stage of Alzheimer\u0026rsquo;s disease (AD) in mice.\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e Almansoub et al. reported that OXT alleviated the phenotypes of PD mice, including motor disorders, cognitive impairments and depressive-like behaviors.\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e These findings indicate that exogenous OXT may represent a promising therapeutic strategy for alleviating PD progression.\u003c/p\u003e \u003cp\u003eOXT has multiple regulatory effects on the intestine, including motility, barrier integrity, and inflammatory responses.\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e,\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e Wang et al. demonstrated that OXT alleviated colitis by restoring intestinal integrity.\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e Dou et al. demonstrated that OXT regulated immune tolerance to mitigate colitis in mice.\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e A number of studies have reported intestinal barrier integrity disruption in both PD patients and mouse models.\u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e,\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e Consistent with these previous findings, we also observed increased intestinal permeability, compromised motility, and reduced expression of tight junction proteins in PD mice. Furthermore, exogenous OXT administration significantly mitigated intestinal epithelial barrier damage in PD mice and concurrently alleviated neurological deficits. These findings suggest that OXT plays a crucial role in maintaining gut homeostasis and impacts the gut‒brain axis.\u003c/p\u003e \u003cp\u003eEGCs are the most abundant cell type within the ENS and are hyperactivated in the early stage of PD.\u003csup\u003e10,12\u003c/sup\u003e EGCs not only provide a nutritional supply and protective functions for enteric neurons but also participate in regulating intestinal motility, barrier function, and immunity.\u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e The hyperactivation of EGCs has been strongly implicated in the pathogenesis of various types of diseases, including PD.\u003csup\u003e52\u0026ndash;54\u003c/sup\u003e Clairembault et al. reported that the expression of GFAP, the characteristic protein of EGCs, was obviously upregulated in the colonic biopsies of early-stage PD patients, which was synchronous with the elevated expression of α-syn.\u003csup\u003e\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u003c/sup\u003e In the present study, we found that EGCs were strongly activated, accompanied by elevated mRNA expression of proinflammatory cytokines (including IL-6, TNFα, and IL-1β), in prodromal PD mice, which was consistent with observations in 6-OHDA-induced PD mice.\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e Additionally, a recent study demonstrated that inhibiting EGC activation by regulating gut microbial metabolites alleviates the pathological manifestations of PD in mice,\u003csup\u003e56\u003c/sup\u003e which aligns well with our findings that OXT administration abrogates EGC activation and is correlated with neuroinflammation. Given the critical role of EGC activation in gut‒brain axis-related disorders, a pharmacological inhibitor of EGCs, FC, was developed.\u003csup\u003e\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e Ziegler et al. demonstrated that FC restores epithelial barrier function in colitis mice by blocking EGC function.\u003csup\u003e\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u003c/sup\u003e Gao et al. reported that FC reversed intestinal motility dysfunction by inhibiting EGC activation.\u003csup\u003e\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e\u003c/sup\u003e Consistent with those reports, we found that FC administration significantly inhibited EGC hyperactivation, which was accompanied by decreased α-syn expression, reduced proinflammatory cytokine levels in the colon, rescued DA neuron loss in the SNpc, and improved motor deficits, analogous to those of OXT in PD mice. Collectively, these findings suggest that the inhibition of EGCs may serve as a potential strategy for PD treatment.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, in the present study, we successfully established ROT-induced prodromal and clinical PD mice, which exhibited both intestinal dysfunction, such as disrupted integrity and motility; EGC hyperactivation-induced neuroinflammation; and neurobehavioral deficits, including DA neuron loss in the SNpc and motor disability. More importantly, we found that exogenous supplementation with OXT or administration of the EGC inhibitor FC significantly reversed the manifestations of PD in mice by mitigating EGC-triggered neuroinflammation. Notably, several gaps need to be filled in the future. First, to elucidate the rescue mechanism of OXT and FC, a mouse model in which the OXTR is knocked out in EGCs is desired. Second, the potential signaling pathway mediated by OXT/OXTR needs to be clarified via multiomics assays. Third, the findings of the present study need to be confirmed in other PD animal models, especially with intestinal tissue samples from PD patients. Overall, our work sheds light on the mechanism underlying PD pathogenesis and provides clues for PD therapeutics.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was designed and conceived by CWZ and LL. In vivo experiments were conducted by ZTL, YYH and HC. In vitro experiments were performed by HC. QZ, XTH, LY, CWZ, and LL supervised the project. HC drafted the manuscript. ZWZ and LL contributed to critical review and revision of the manuscript. All the authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China [82301759]; the Natural Science Foundation of Shanxi Province [202303021212129]; the National Clinical Key Speciality Construction Project [24090520, 231618]; the Ministry of Education of China \"Chunhui Plan\" Cooperative Research Project Foundation [HZKY20220505]; and the Shanxi Province Postdoctoral Research Foundation [2022071].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eavailability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo datasets were generated or analyzed during the current study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments complied with the regulations and guidelines of the ARRIVE Guidelines 2.0. (PLoS Bio 8(6), e1000412,2010). The protocols were approved by the Animal Research Ethics Committee at Shanxi Medical University (SYDL2023024).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for Publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or nonfinancial interests to disclose.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKurth T, Brinks R. Projecting Parkinson\u0026apos;s disease burden. BMJ 2025;388:r350.\u003c/li\u003e\n\u003cli\u003eSu D, Cui Y, He C, et al. Projections for prevalence of Parkinson\u0026apos;s disease and its driving factors in 195 countries and territories to 2050: modeling study of Global Burden of Disease Study 2021. BMJ 2025;388:e080952. \u003c/li\u003e\n\u003cli\u003eYe H, Robak LA, Yu M, Cykowski M, Shulman JM. Genetics and Pathogenesis of Parkinson\u0026apos;s Syndrome. Annu Rev Pathol 2023;18:95-121.\u003c/li\u003e\n\u003cli\u003eKoeglsperger T, Rumpf S, Schliesser P, et al. Neuropathology of incidental Lewy body \u0026amp; prodromal Parkinson\u0026apos;s disease. Mol Neurodegener 2023;18(1):32.\u003c/li\u003e\n\u003cli\u003eLeite Silva ABR, Goncalves De ORW, Diogenes GP, et al. Premotor, nonmotor and motor symptoms of Parkinson\u0026apos;s Disease: A new clinical state of the art. Aging Res Rev 2023;84:101834. \u003c/li\u003e\n\u003cli\u003eChen Z, Li G, Liu J. Autonomic dysfunction in Parkinson\u0026apos;s disease: Implications for pathophysiology, diagnosis, and treatment. Neurobiol Dis 2020;134:104700. \u003c/li\u003e\n\u003cli\u003eYuan X, Chen Y, Liu Z. Relationship among Parkinson\u0026apos;s disease, constipation, microbes, and microbiological therapy. World J Gastroenterol 2024;30(3):225-237.\u003c/li\u003e\n\u003cli\u003eBraak H, Del Tredici K, Rub U, de Vos RAI, Jansen Steur ENH, Braak E. Staging of brain pathology related to sporadic Parkinson\u0026apos;s disease. Neurobiol Aging 2003;24(2):197-211.\u003c/li\u003e\n\u003cli\u003eThomasi BBDM, Valdetaro L, Ricciardi MCG, et al. Enteric glial cell reactivity in colonic layers and mucosal modulation in a mouse model of Parkinson\u0026apos;s disease induced by 6-hydroxydopamine. Brain Res Bull 2022;187:111-121. \u003c/li\u003e\n\u003cli\u003eEmmi A, Sandre M, Russo FP, et al. Duodenal alpha-Synuclein Pathology and Enteric Gliosis in Advanced Parkinson\u0026apos;s Disease. Mov Disord 2023;38(5):885-894.\u003c/li\u003e\n\u003cli\u003eBenvenuti L, D\u0026apos;Antongiovanni V, Pellegrini C, et al. Enteric Glia at the Crossroads between Intestinal Immune System and Epithelial Barrier: Implications for Parkinson Disease. Int J Mol Sci 2020;21(23):9199. \u003c/li\u003e\n\u003cli\u003eSharkey KA, Mawe GM. The enteric nervous system. Physiol Rev 2023;103(2):1487-1564.\u003c/li\u003e\n\u003cli\u003eProgatzky F, Shapiro M, Chng SH, et al. Regulation of intestinal immunity and tissue repair by enteric glia. Nature 2021;599(7883):125-130. \u003c/li\u003e\n\u003cli\u003eD\u0026apos;Antongiovanni V, Pellegrini C, Antonioli L, et al. Enteric Glia and Brain Astroglia: Complex Communication in Health and Disease along the Gut-Brain Axis. Neuroscientist 2024;30(4):493-510. \u003c/li\u003e\n\u003cli\u003eWinokur SB, Caslin AY, Davis FM, Froemke RC. Oxytocin. Curr Biol 2025;35(20):R985-R992. \u003c/li\u003e\n\u003cli\u003eHan X, Ma Y. Oxytocin in Human Social Network Cooperation. Neuroscientist 2025;31(4):409-424. \u003c/li\u003e\n\u003cli\u003eWang Y, Xu H, Chen S, et al. Oxytocin Protects Nigrostriatal Dopamine Signal via Activating GABAergic Circuit in the MPTP-Induced Parkinson\u0026apos;s Disease Model. Adv Sci (Weinh) 2024;11(36):e2310244.\u003c/li\u003e\n\u003cli\u003eAlmansoub HAMM, Tang H, Wu Y, et al. Oxytocin Alleviates MPTP-Induced Neurotoxicity in Mice by Targeting MicroRNA-26a/Death-Associated Protein Kinase 1 Pathway. J Alzheimers Dis 2020;74(3):883-901.\u003c/li\u003e\n\u003cli\u003eChristopher CJ, Morgan KH, Tolleson CM, et al. Specific Bacterial Taxa and Their Metabolite, DHPS, May Be Linked to Gut Dyshomeostasis in Patients with Alzheimer\u0026apos;s Disease, Parkinson\u0026apos;s Disease, and Amyotrophic Lateral Sclerosis. Nutrients 2025;17(9):1597. \u003c/li\u003e\n\u003cli\u003eIbarra-Gutierrez MT, Serrano-Garcia N, Orozco-Ibarra M. Rotenone-Induced Model of Parkinson\u0026apos;s Disease: Beyond Mitochondrial Complex I Inhibition. Mol Neurobiol 2023;60(4):1929-1948. \u003c/li\u003e\n\u003cli\u003eManfredsson FP, Luk KC, Benskey MJ, et al. Induction of alpha-synuclein pathology in the enteric nervous system of the rat and nonhuman primate results in gastrointestinal dysmotility and transient CNS pathology. Neurobiol Dis 2018;112:106-118. \u003c/li\u003e\n\u003cli\u003eBarrenschee M, Zorenkov D, Bottner M, et al. Distinct pattern of enteric phospho-alpha-synuclein aggregates and gene expression profiles in patients with Parkinson\u0026apos;s disease. Acta Neuropathol Commun 2017;5(1):1. \u003c/li\u003e\n\u003cli\u003eEspinosa-Oliva AM, Ruiz R, Soto MS, et al. Inflammatory bowel disease induces pathological alpha-synuclein aggregation in the human gut and brain. Neuropathol Appl Neurobiol 2024;50(1):e12962. \u003c/li\u003e\n\u003cli\u003eZhang S, Mi P, Luan J, Sun M, Zhao X, Feng X. Fluorene-9-bisphenol acts on the gut-brain axis by regulating oxytocin signaling to disturb social behaviors in zebrafish. Environ Res 2024;255:119169. \u003c/li\u003e\n\u003cli\u003eGruber T, Lechner F, Murat C, et al. High-calorie diets uncouple hypothalamic oxytocin neurons from a gut-to-brain satiation pathway via kappa-opioid signaling. Cell Rep 2023;42(10):113305. \u003c/li\u003e\n\u003cli\u003eNowacka A, Sniegocki M, Ziolkowska EA. Vagal Oxytocin Receptors as Molecular Targets in Gut-Brain Signaling: Implications for Appetite, Satiety, Obesity, and Esophageal Motility-A Narrative Review. Int J Mol Sci 2025;26(16):7812. \u003c/li\u003e\n\u003cli\u003eXu S, Qin B, Shi A, Zhao J, Guo X, Dong L. Oxytocin inhibited stress induced visceral hypersensitivity, enteric glial cells activation, and release of proinflammatory cytokines in maternal separated rats. Eur J Pharmacol 2018;818:578-584. \u003c/li\u003e\n\u003cli\u003eAho VTE, Houser MC, Pereira PAB, et al. Relationships of gut microbiota, short-chain fatty acids, inflammation, and the gut barrier in Parkinson\u0026apos;s disease. Mol Neurodegener 2021;16(1):6. \u003c/li\u003e\n\u003cli\u003evan IJzendoorn SCD, Derkinderen P. The Intestinal Barrier in Parkinson\u0026apos;s Disease: Current State of Knowledge. J Parkinsons Dis 2019;9(s2):S323-S329. \u003c/li\u003e\n\u003cli\u003ePellegrini C, D\u0026apos;Antongiovanni V, Miraglia F, et al. Enteric alpha-synuclein impairs intestinal epithelial barrier through caspase-1-inflammasome signaling in Parkinson\u0026apos;s disease before brain pathology. NPJ Parkinsons Dis 2022;8(1):9. \u003c/li\u003e\n\u003cli\u003eDong-Chen X, Yong C, Yang X, Chen-Yu S, Li-Hua P. Signaling pathways in Parkinson\u0026apos;s disease: molecular mechanisms and therapeutic interventions. Signal Transduct Target Ther 2023;8(1):73. \u003c/li\u003e\n\u003cli\u003eRobinson NB, Krieger K, Khan FM, et al. The current state of animal models in research: A review. Int J Surg 2019;72:9-13. \u003c/li\u003e\n\u003cli\u003eLal R, Singh A, Watts S, Chopra K. Experimental models of Parkinson\u0026apos;s disease: Challenges and Opportunities. Eur J Pharmacol 2024;980:176819. \u003c/li\u003e\n\u003cli\u003eLiu L, Zhao Y, Yang W, et al. Rotenone Induces Parkinsonism with Constipation Symptoms in Mice by Disrupting the Gut Microecosystem, Inhibiting the PI3K-AKT Signaling Pathway and Gastrointestinal Motility. Int J Mol Sci 2025;26(5):2079. \u003c/li\u003e\n\u003cli\u003ePurba JS, Hofman MA, Swaab DF. Decreased number of oxytocin-immunoreactive neurons in the paraventricular nucleus of the hypothalamus in Parkinson\u0026apos;s disease. Neurology 1994;44(1):84-89. \u003c/li\u003e\n\u003cli\u003eUsami N, Maegawa H, Hayashi M, Kudo C, Niwa H. Changes in the analgesic mechanism of oxytocin can contribute to hyperalgesia in Parkinson\u0026apos;s disease model rats. PLoS One 2024;19(8):e0300081. \u003c/li\u003e\n\u003cli\u003eFoltynie T, Bruno V, Fox S, Kuhn AA, Lindop F, Lees AJ. Medical, surgical, and physical treatments for Parkinson\u0026apos;s disease. Lancet 2024;403(10423):305-324. \u003c/li\u003e\n\u003cli\u003eMurakami H, Shiraishi T, Umehara T, Omoto S, Iguchi Y. Recent Advances in Drug Therapy for Parkinson\u0026apos;s Disease. Intern Med 2023;62(1):33-42.\u003c/li\u003e\n\u003cli\u003eDong D, Xie J, Wang J. Neuroprotective Effects of Brain-Gut Peptides: A Potential Therapy for Parkinson\u0026apos;s Disease. Neurosci Bull 2019;35(6):1085-1096. \u003c/li\u003e\n\u003cli\u003eKalinderi K, Papaliagkas V, Fidani L. GLP-1 Receptor Agonists: A New Treatment in Parkinson\u0026apos;s Disease. Int J Mol Sci 2024;25(7):3812. \u003c/li\u003e\n\u003cli\u003eCarter CS, Kenkel WM, MacLean EL, et al. Is Oxytocin \u0026quot;Nature\u0026apos;s Medicine\u0026quot;?. Pharmacol Rev 2020;72(4):829-861. \u003c/li\u003e\n\u003cli\u003eJurek B, Neumann ID. The Oxytocin Receptor: From Intracellular Signaling to Behavior. Physiol Rev 2018;98(3):1805-1908. \u003c/li\u003e\n\u003cli\u003ePierzynowska K, Gaffke L, Zabinska M, et al. Roles of the Oxytocin Receptor (OXTR) in Human Diseases. Int J Mol Sci 2023;24(4):3887. \u003c/li\u003e\n\u003cli\u003eWang X, Chen D, Guo M, et al. Oxytocin Alleviates Colitis and Colitis-Associated Colorectal Tumorigenesis via Noncanonical Fucosylation. Research (Wash D C) 2024;7:407.\u003c/li\u003e\n\u003cli\u003eYe C, Cheng M, Ma L, et al. Oxytocin Nanogels Inhibit Innate Inflammatory Response for Early Intervention in Alzheimer\u0026apos;s Disease. ACS Appl Mater Interfaces 2022;14(19):21822-21835. \u003c/li\u003e\n\u003cli\u003eWelch MG, Margolis KG, Li Z, Gershon MD. Oxytocin regulates gastrointestinal motility, inflammation, macromolecular permeability, and mucosal maintenance in mice. Am J Physiol Gastrointest Liver Physiol 2014;307(8):G848-G862. \u003c/li\u003e\n\u003cli\u003eIshioh M, Nozu T, Okumura T. Brain Neuropeptides, Neuroinflammation, and Irritable Bowel Syndrome. Digestion 2024;105(1):34-39. \u003c/li\u003e\n\u003cli\u003eDou D, Liang J, Zhai X, et al. Oxytocin signaling in dendritic cells regulates immune tolerance in the intestine and alleviates DSS-induced colitis. Clin Sci (Lond) 2021;135(4):597-611. \u003c/li\u003e\n\u003cli\u003eBellini G, Benvenuti L, Ippolito C, et al. Intestinal histomorphological and molecular alterations in patients with Parkinson\u0026apos;s disease. Eur J Neurol 2023;30(11):3440-3450. \u003c/li\u003e\n\u003cli\u003eRajkovaca Latic I, Popovic Z, Mijatovic K, et al. Association of intestinal inflammation and permeability markers with clinical manifestations of Parkinson\u0026apos;s disease. Parkinsonism Relat Disord 2024;123:106948. \u003c/li\u003e\n\u003cli\u003eRao M, Gulbransen BD. Enteric Glia. Cold Spring Harb Perspect Biol 2025;17(4):a041368. \u003c/li\u003e\n\u003cli\u003eLv X, Lv S, Wang G, et al. Glia-derived adenosine in the ventral hippocampus drives pain-related anxiodepression in a mouse model resembling trigeminal neuralgia. Brain Behav Immun 2024;117:224-241. \u003c/li\u003e\n\u003cli\u003eSeguella L, Gulbransen BD. Enteric glial biology, intercellular signaling and roles in gastrointestinal disease. Nat Rev Gastroenterol Hepatol 2021;18(8):571-587. \u003c/li\u003e\n\u003cli\u003evan Baarle L, De Simone V, Schneider L, et al. IL-1R signaling drives enteric glia-macrophage interactions in colorectal cancer. Nat Commun 2024;15(1):6079. \u003c/li\u003e\n\u003cli\u003eClairembault T, Kamphuis W, Leclair-Visonneau L, et al. Enteric GFAP expression and phosphorylation in Parkinson\u0026apos;s disease. J Neurochem 2014;130(6):805-815. \u003c/li\u003e\n\u003cli\u003eShang M, Ning J, Zang C, et al. Microbial metabolite 3-indolepropionic acid alleviated PD pathologies by decreasing enteric glia cell gliosis via suppressing IL-13Ralpha1 related signaling pathways. Acta Pharm Sin B 2025;15(4):2024-2038.\u003c/li\u003e\n\u003cli\u003eNasser Y, Fernandez E, Keenan CM, et al. Role of enteric glia in intestinal physiology: effects of the gliotoxin fluorocitrate on motor and secretory function. Am J Physiol Gastrointest Liver Physiol 2006;291(5):G912-G927. \u003c/li\u003e\n\u003cli\u003eZiegler AL, Caldwell ML, Craig SE, et al. Enteric glial cell network function is required for epithelial barrier restitution following intestinal ischemic injury in the early postnatal period. Am J Physiol Gastrointest Liver Physiol 2024;326(3):G228-G246.\u003c/li\u003e\n\u003cli\u003eGao H, Zhang Y, Li Y, et al. mu-Opioid Receptor-Mediated Enteric Glial Activation Is Involved in Morphine-Induced Constipation. Mol Neurobiol 2021;58(7):3061-3070. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"Shanxi Medical University","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Parkinson’s disease, Prodromal stage, α-Synuclein, Oxytocin, Enteric glial cell, Neuroinflammation","lastPublishedDoi":"10.21203/rs.3.rs-8516406/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8516406/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground/Aims: \u003c/strong\u003eThis study aims to elucidate how hyperactivated enteric glial cells (EGCs) trigger Parkinson's disease (PD) pathogenesis and whether the exogenous gut–brain regulatory hormone oxytocin canalleviate the phenotypes of PD.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eProdromal and clinical PD mouse models were established via the intragastric administration of rotenone (ROT). The intestinal and motor functions of the mice were assessed. The expression of glial fibrillary acidic protein (GFAP), oxytocin receptor (OXTR) and tyrosine hydroxylase (TH) in the colon and midbrain was detected by immunofluorescence staining. The levels of α-synuclein (α-syn), oxytocin (OXT), and inflammatory factors in the serum and colon were measured by ELISA, western blotting and qPCR. Exogenous OXT and the EGC inhibitor fluorocitrate (FC) were administered, and the rescue effect on PD mice was assessed via neurobehavioral assays.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eROT administration induced constipation and motor PD symptoms in mice. The expression of GFAP and α-syn in the colon of PD mice wasincreased, whereasthe OXT and OXTR levels were decreased. Exogenous OXT or FC administration inhibited EGChyperactivation, reduced inflammatory factorlevels and α-syn accumulation, and ultimately alleviated the prodromal and clinical PD phenotypes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e EGC hyperactivation plays a crucial role in PD pathogenesis, and exogenous OXT or FC could ameliorate the prodromal and clinical PD phenotypes.\u003c/p\u003e","manuscriptTitle":"Exogenous Oxytocin Alleviates Prodromal and Clinical Parkinson's Disease Phenotypes via the Inhibition of Enteric Glial Cell-triggered Neuroinflammation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-07 07:13:24","doi":"10.21203/rs.3.rs-8516406/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"090c3fec-33b4-42aa-85df-7d22753f3e1e","owner":[],"postedDate":"January 7th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-01-07T07:13:24+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-07 07:13:24","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8516406","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8516406","identity":"rs-8516406","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00