An Integrated Morphometric-Molecular Framework for High-Fidelity Instar Identification in the Safflower Aphid Uroleucon gobonis (Matsumura)

preprint OA: closed
Full text JSON View at publisher
Full text 105,832 characters · extracted from preprint-html · click to expand
An Integrated Morphometric-Molecular Framework for High-Fidelity Instar Identification in the Safflower Aphid Uroleucon gobonis (Matsumura) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article An Integrated Morphometric-Molecular Framework for High-Fidelity Instar Identification in the Safflower Aphid Uroleucon gobonis (Matsumura) Xu Lanjie, An Sufang, Yu Yongliang, yang Qing, Nie Zhansheng, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9025299/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 11 You are reading this latest preprint version Abstract Accurately identifying pest developmental stages is a key prerequisite for developing efficient prevention and control strategies. This study integrated morphometric and molecular biology techniques to establish a multi-dimensional instar identification system for the safflower aphid. The method first systematically evaluated the identification efficiency of eight morphological indicators of Uroleucon gobonis (Matsumura) ( U. gobonis ), and found that the body length can effectively distinguish the aphids from the first instar (1st instar) to the fourth instar (4th instar), abdominal tube length can distinguish the third instar (3rd instar) and later instar, and antennal length can clearly distinguish between the second instar (2nd instar) and 3rd instar, and between the 3rd and 4th instars; the other five indicators show overlap. To overcome the inherent limitations of traditional morphological identification methods, this study analyzed the five developmental stages of U. gobonis using six candidate genes identified from transcriptome data. The expression level of DN1098 peaked at the 3rd instar aphid stage; DN136 showed the highest expression at the adult stage; DN1031, DN1019, and DN1093 were highly expressed at the 1st instar aphid stage; and DN1068 remained highly expressed from the 2nd to the 4th instar aphid stages. The multi-gene expression “fingerprint” identification system, constructed based on these characteristics, can accurately distinguish all target developmental stages. For the first time, this study provides a comprehensive instar identification framework for U. gobonis , spanning rapid preliminary morphological screening to precise molecular confirmation, thereby providing important technical support for population monitoring. Biological sciences/Molecular biology Biological sciences/Plant sciences Biological sciences/Zoology Uroleucon gobonis (Matsumura) instar identification morphological indicators genes Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction The growth and development of insects is a complex and highly ordered biological process that spans their entire life cycle. For agricultural pests of significant economic or ecological importance, accurately identifying the developmental stages of their populations is not only the fundamental basis for elucidating growth and developmental patterns and life history strategies, but also a key practical step for implementing accurate monitoring, assessing population dynamics, and optimizing control strategies 1-4 . Among typical piercing- and sucking-mouthpart pests such as aphids, individuals at different instars exhibit significant differences in feeding behavior, dispersal ability, reproductive potential, and tolerance to biotic and abiotic stresses 5 . For example, young nymphs possess a thin cuticle and are more sensitive to pesticides, constituting an ideal window period for chemical control 2 . Therefore, establishing a set of efficient and accurate age-identification techniques is of irreplaceable value for gaining a deeper understanding of pest population ecology and for formulating timely and appropriate comprehensive management plans. Morphological identification is a conventional method for aphids instar determination, inferring developmental stages through microscopic measurement or visual observation of external morphological traits 6 . This approach has been widely applied in distinguishing adjacent instars of aphids, yet studies have revealed a substantial overlap in the measured values of morphological indicators among different instars 7 , making it rather difficult to identify aphid instars by acquiring a large number of morphological indicators. In addition, morphological traits are susceptible to environmental factors, which further impairs the reliability of identification using this method 8,9 . Nevertheless, due to its simplicity of operation, low technical threshold and low cost, the traditional morphological method still holds extensive application value in pest monitoring and aphid instar determination at present 10 . Advances in molecular biology have provided new avenues for overcoming traditional bottlenecks. Insect development is essentially the result of the orderly expression of genes across spatial and temporal dimensions. A substantial body of research has confirmed that the expression levels of functional genes involved in key biological processes, such as molting and metamorphosis, undergo changes at specific developmental stages, forming unique “gene expression fingerprints” 11-13 . In recent years, the use of transcriptomics to screen candidate marker genes, combined with validation via quantitative real-time polymerase chain reaction ( q PCR), has become an effective strategy for constructing molecular instar identification systems for insects 14 . However, research on systematic molecular identification frameworks targeting the U. gobonis instar remains relatively scarce. U. gobonis is a piercing- and sucking-mouthpart pest that causes severe damage to commercial crops, including Compositae 15-16 . At present, few studies have addressed instar identification in this species. In response to this limitation, this study proposed an integrated identification framework combining morphology and molecular biology: systematically evaluated the ability of eight morphological characteristics to distinguish five development stages of the safflower aphids; screened six candidate genes based on transcriptome data and used fluorescence quantitative PCR to analyze their expression patterns at each development stage; and established a hierarchical identification framework of “morphological screening-molecular verification” to achieve accurate and efficient instar determination. The “morphology-molecular” dual-track identification scheme developed in this study has improved the technical accuracy of traditional morphological identification, provides key technical support for monitoring and early warning of U. gobonis population dynamics, and offers innovative technical references for developmental biology research and integrated management practices targeting aphids and other hemipteran pests. Results Morphological characteristics of U. gobonis across developmental stages The developmental process of U. gobonis consists of five consecutive instars: 1st, 2nd, 3rd, and 4th instar nymphs, followed by the adult stage (Fig. 1). The morphological characteristics of this species exhibit distinct dynamic changes during development, providing key morphological criteria for instar identification. The 1st and 2nd instar nymphs are highly similar in external morphology (Fig. 1A, B), both exhibiting transparent body walls, short antennae, and underdeveloped cornicles. Third-instar nymphs show distinct morphological differentiation and can be categorized into two morphotypes according to the degree of wing base development: 3rd instar apterous nymphs, which lack protrusions on the mesonotum and do not possess wing buds (Fig. 1C), and 3rd instar alate nymphs, which exhibit noticeable protrusions on the mesonotum and small wing buds (Fig. 1D). This differentiation provides a reliable morphological marker for distinguishing between 2nd instar and 3rd instar nymphs. The 3rd instar apterous nymphs maintain stable morphology in the mesothorax and metathorax during subsequent development, ultimately progressing to 4th instar apterous nymphs (Fig. 1E) and apterous adults (Fig. 1G). By contrast, 3rd instar alate nymphs continue to develop thoracic wing bases. By the 4th instar stage (Fig. 1F), small wing buds of the forewings and hindwings are clearly distinguishable, and fully formed wing structures are observed in the adult stage (Fig. 1H). This study confirms that the degree of wing base development is a key criterion for distinguishing between 2nd instar nymphs and 3rd instar alate nymphs, providing a foundation for further morphometric analysis. Correlation analysis of instar and morphological indicators All eight morphological indicators showed strong positive correlations with the instar stages of U. gobonis ( P < 0.01). Among these, antennal length exhibited the strongest correlation with instar (r = 0.964), followed by body length (r = 0.960) and cornicle length (r = 0.943), indicating that these three indicators can serve as core morphological markers for instar identification in U. gobonis . Further analysis revealed a high correlation coefficient of 0.979 ( P < 0.01) between antennal length and cornicle length, suggesting coordinated changes between these two traits during aphid growth and development. The correlation coefficient between body width and body length was 0.960 ( P < 0.01), reflecting uniform expansion of aphid body size with increasing instar. Furthermore, indicators such as head width, cauda length, and forefoot length showed correlation coefficients with instar exceeding 0.92, indicating their potential as auxiliary identification markers. These results demonstrate that morphological indicators of U. gobonis change in a regular pattern with increasing instar, providing a reliable basis for rapid field identification of its instar structure. This, in turn, supports population dynamics monitoring and the development of precise pest control strategies (Table 1). Table 1 Correlation analysis of instar and morphological indicators Indicators Instar Body length Body width Head width Cornicle length Cauda length Antenna length Hind foot length Fore foot length Instar 1.000 Body length 0.960 ** 1.000 Body width 0.927 ** 0.960 ** 1.000 Head width 0.927 ** 0.893 ** 0.869 ** 1.000 Cornicle length 0.943 ** 0.905 ** 0.847 ** 0.879 ** 1.000 Cauda length 0.942 ** 0.933 ** 0.908 ** 0.856 ** 0.929 ** 1.000 Antenna length 0.964 ** 0.937 ** 0.892 ** 0.888 ** 0.979 ** 0.962 ** 1.000 Fore foot length 0.947 ** 0.938 ** 0.928 ** 0.869 ** 0.931 ** 0.967 ** 0.968 ** 1.000 Hind foot length 0.924 ** 0.876 ** 0.810 ** 0.861 ** 0.965 ** 0.917 ** 0.953 ** 0.892 ** 1.000 Note: ** indicates a significant correlation at P < 0.01 (two-tailed). Analysis of morphological indicators of U. gobonis across different instars The eight morphological indicators showed a continuous increase with advancing instar, with body length, antennal length, and cornicle length exhibiting the most significant increases. All indicators reached their minimum values in the 1st instar nymphal stage and their maximum values in the adult stage. Antennal length increased approximately 2.9-fold from the 1st instar nymph to the adult stage, with a 20% increase from the second to 3rd instar, a 15% increase from the third to 4th instar, and a 10% increase from the 4th instar to the adult stage. Statistically significant differences ( P < 0.05) were observed between each pair of consecutive instars. Cornicle length increased approximately 3.6-fold from the 1st instar nymphal stage to the adult stage, with a 25% increase from the second to the 3rd instar. Although the growth rate declined in subsequent stages, statistically significant differences remained. Hind foot length, Head width and other morphological indicators increased significantly during the first to adult ( P < 0.05). These differentiated patterns of morphological change reveal stage-specific characteristics of growth and development in U. gobonis , providing quantitative criteria for instar identification. This facilitates rapid field assessment of developmental stages and supports the formulation of targeted pest management strategies (Fig. 2). Overlap analysis of morphological indicators across different instars Body length can effectively distinguish aphids from the 1st to the 4th instar. However, the maximum body length of fourth-instar aphids (2.393 mm) is greater than the minimum body length of adults (2.181 mm), resulting in overlap between the body length ranges of these two developmental stages. Abdominal tube length overlaps between the 1st and the 2nd instars. However, starting from the 3rd instar, the numerical intervals of each instar are completely separated, such that abdominal tube length can clearly distinguish the 2nd and 3rd instars, 4th instar aphids, and adults. Body width can effectively distinguish 1st and 2nd instar aphids, but the numerical intervals overlap at later instars. Cauda length can distinguish between 2nd and 3rd instar aphids and between 3rd and 4th instar aphids; however, there is overlap between 1st and 2nd instar aphids and between 4th instar aphids and adults. Head width, forefoot length and hind foot length, show continuous, gradual changes across all adjacent ages and lack independent diagnostic value (Fig. 3). Expression patterns of six genes across different instars of U. gobonis In this study, we systematically analyzed the expression patterns of six candidate genes of DN1031, DN136, DN1019, DN1068, DN1093, and DN1098 across five developmental stages (1st-to 4th-instar nymphs and adults) of U. gobonis using q PCR (Fig. 4). The expression level of the DN1098 gene showed a bell-shaped distribution: expression was lowest at the 1st instar aphid stage (d), was significantly up-regulated at the 2nd instar aphid stage (b), and reached a peak at the 3rd instar aphid stage (a); after entering the 4th instar aphid stage and adult stage, expression dropped below the level observed at the 2nd instar aphid stage (c). DN136 expression showed an up-regulated trend: expression was lowest at the 1st instar aphid stage (d), gradually increased with advancing instar, and reached peak levels at the adult stage (a). DN1031, DN1019, and DN1093 all showed peak expression in the 1st instar. DN1031 expression was highest at the 1st instar (a), significantly down-regulated at the 2nd and 3rd instars (b), and lowest at the 4th instar (c). DN1019 was highly expressed in the 1st instar (a), sharply decreased to its lowest level at the 2nd instar (c), and remained low at the 3rd and 4th instars and the adult stage (b). DN1093 was highly expressed at the 1st instar (a) and significantly down-regulated at the 2nd and 3rd instars and the adult stage (b). DN1068 expression was low at the 1st instar (c), significantly up-regulated at the 2nd instar (b), maintained peak levels at the 3rd and 4th instars (a), and slightly decreased at the adult stage (ab). Discussion Accurately identifying the developmental age of pests is the cornerstone of integrated pest management (IPM), directly affecting the accuracy of population monitoring, the depth of developmental ecology research, and the identification of key control windows 17 , 18 . In this study, an important agricultural pest, Dactylsiphum roseum , was used to develop a complementary framework for instar identification by integrating morphological and molecular biological methods. While evaluating traditional morphological indicators, we developed an instar-specific molecular marker based on gene expression profiles, which addresses the inherent limitations of single-method morphological identification. Morphometrics, a classical method for insect instar identification, has been widely used in this field because of its operational simplicity and low cost 19 – 21 . Through correlation analysis, this study confirmed that key morphological indicators, including antennal length, cornicle length, and body length, showed strong positive correlations with the instar of U. gobonis ( P < 0.001), consistent with findings in closely related species such as Acyrthosiphon pisum and cotton aphids 22 , 23 . However, overlap analysis revealed inherent limitations of morphological methods: cornicle length could not effectively distinguish between 1st- and 2nd-instar nymphs (overlap 37.2%), and body length could not precisely differentiate 4th instar nymphs from adults (overlap 29.5%). This phenomenon aligns with technical bottlenecks reported in studies on Macrosiphoniella yomogicola 24 . To overcome these limitations, this study identified six candidate genes based on transcriptomic data and systematically analyzed their expression patterns across five consecutive developmental stages using q PCR. DN1031, DN1019, and DN1093 showed coordinated high expression in 1st instar nymphs (fold change > 8.0; P < 0.01), potentially involved in regulating the critical transition from embryo to nymph 25 , 26 . DN1031 encodes a solute carrier family 2 member protein, which may facilitate transmembrane transport of monosaccharides such as glucose, providing energy substrates for the highly active life processes of 1st-instar nymphs 27 , 28 . DN1019 encodes a vacuolar protein sorting-associated protein 13, possibly involved in intracellular material transport and vesicle sorting. DN1093 encodes a ZBED8-like protein, a putative transcriptional regulator that may mediate developmental transition-related molecular events by regulating downstream target gene networks. The coordinated high expression of these three genes may collectively constitute a specific molecular signature for early cuticle formation and activation of basal metabolism in 1st instar nymphs. DN1098 exhibited a specific expression peak in 3rd instar nymphs (fold change = 12.7; P < 0.001), suggesting its involvement in wing morph differentiation and reproductive system programming 29 – 31 . This approach has been validated in model insects such as Drosophila melanogaster 32 . DN136 expression peaked in adults (fold change = 9.3; P < 0.01), serving as an adult-specific marker. DN1068 maintained high expression during the 2nd to 4th nymphal instars, possibly involved in regulating growth and development during mid-to-late nymphal stages 33 – 35 . This study provides a comprehensive integrated morpho-molecular system for the precise instar identification of U. gobonis (safflower aphid). However, although the q PCR-based molecular identification method is highly accurate, it requires specialized laboratory equipment and technical expertise, which limits its application in rapid, on-site field monitoring to a certain extent. Future research should prioritize simplifying molecular detection protocols, such as developing strip-based detection assays or portable detection devices, and validating these methods under a wider range of ecological conditions. Conclusions In this study, we combined morphometric and molecular biological approaches to establish a multi-dimensional instar identification system for the safflower aphid U. gobonis (Matsumura). Morphometric analysis of eight indicators revealed that body length, abdominal tube length, and antennal length can effectively discriminate among the first to fourth instars, whereas the other five indicators exhibited substantial overlap. To address the limitations of traditional morphological identification, six candidate genes with stage-specific expression patterns were identified from transcriptome data. Among them, DN1098 was highly expressed in the third instar, DN136 peaked in adults, DN1031, DN1019, and DN1093 were upregulated in the first instar, and DN1068 maintained high expression from the second to fourth instars. Based on these expression profiles, a multi-gene expression fingerprint system was constructed, enabling accurate discrimination of all developmental stages.These findings provide a reliable technical basis for population monitoring and precision pest management of this important agricultural pest. Materials and methods Aphid samples The U. gobonis aphids used in this study were collected from the Henan Modern Agricultural Development Base and continuously reared for multiple generations in the laboratory using safflower ( Carthamus tinctorius ) seedlings maintained in an artificial climate chamber (Model RDN‑300, Ningbo Yanghui Instrument Co., Ltd.). The rearing conditions were set as follows: temperature 16 ± 2 °C, relative humidity 45 ± 5 %, and a photoperiod of 16 L : 8 D. Fresh seedlings were replaced every 30 days. Safflower leaves with petioles were selected, and the petioles were inserted into moist absorbent cotton in a 10 cm × 10 cm plastic culture dish. A single apterous adult aphid was transferred onto the leaf using a soft brush. After nymph production, newly hatched nymphs were individually transferred to new culture dishes and reared separately. By regularly monitoring molting events, individuals from each nymphal instar and adults were systematically collected for subsequent experiments. Measurement of morphological traits Individuals of U. gobonis from each instar were collected separately and transferred singly into transparent glass dishes containing 1 mL of 75 % ethanol. Morphological traits were measured for apterous and alate individuals under a stereomicroscope (Olympus SZX7). The specific measurement indices and their positioning are shown in Figure 1. For each instar, 60 specimens (30 apterous and 30 alate) were measured, and each morphological trait was measured three times; the mean value was used for analysis (Fig. 5). Candidate gene screening and functional annotation Based on previous full-transcriptome data, six candidate genes (DN1031, DN1068, DN1093, DN1019, DN136, and DN1098) with stage-specific expression characteristics were screened and identified. Based on annotation and comparison in the NCBI database, DN1031 encodes a solute carrier family 2 member protein, DN1068 encodes a PRELI domain-containing protein 1, DN1093 encodes a ZBED8-like protein, DN1019 encodes a vacuolar protein sorting-associated protein 13, DN136 encodes a protein containing a KN motif and ankyrin repeat domain 2, and DN1098 encodes a small nucleolar RNA-associated protein 15 homolog. Total RNA extraction and real-time fluorescence quantitative PCR analysis Total RNA was extracted from the samples using the Quick RNA Isolation Kit (Beijing Huayueyang Biotechnology Co., Ltd.) according to the manufacturer’s instructions. The quality and integrity of the extracted total RNA were assessed by 1.2% (w/v) agarose gel electrophoresis, and its concentration was measured using a NanoDrop 2000 spectrophotometer. First-strand cDNA was synthesized via reverse transcription of total RNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa, Code No. RR047A) following the kit protocol. Real-time fluorescence quantitative PCR ( q PCR) was used to detect the expression levels of six genes in 1st instar, 2nd instar, 3rd instar, 4th instar nymphs, and adults of U. gobonis . Specific q PCR primers for each gene were designed using Primer Premier 5.0 software (Table 2), with β-actin serving as the internal reference. q PCR reactions were performed using TaKaRa TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) with the following cycling program: 95°C for 3 min for pre-denaturation, followed by 45 cycles of amplification (95°C for 10 s, 55°C for 30 s, and 72°C for 28 s). The specificity of PCR amplification was verified by melt curve analysis (temperature range, 55°C to 94°C, heating rate 0.1°C/s). Three technical replicates were included for each gene in q PCR. Relative gene expression levels were calculated using the 2^ (-ΔΔCT) method. Significant differences in gene expression among different developmental stages (1st instar, 2nd instar, 3rd instar, 4th instar nymphs, and adults) of U. gobonis were analyzed using Student’s t -test. Table 2 Primer sequences used for q PCR Gene Name Forward Primer ( 5‘–3’ ) Reverse Primer ( 5‘–3’ ) DN1031 AACACAGGACACGCCTGATT CAATTTCGTCGTTGGCCTGG DN1068 TGGCATCGTTATCCAAACCCA CACCAATGTCTTTTTGGTGGGA DN1093 ATTTGACCAACGGGCGAAAC TAATGTGGCCGACCATAGCC DN1098 TAGCCCCGTGTTGGTCAAAG AACAGATTCCTCGCCACCAG DN1019 AGCTAGCTTTGTACCAGCGG AGCATGTAGCCAAAACGTTGA DN136 CTTCCGTCTTCGTCCTGCAT AAATGACGCGGGCTACTCAA β-actin GGTGAAACCTTGTCTACTGTTACATCTTG CCGAAAAGTGTCATAATGAAGACC Data Analysis Using SPSS Statistics 19.0 and Excel 2007 software, basic statistical analyses, correlation analysis, and principal component analysis were performed on the 12 morphological traits of U. gobonis . For morphological traits across different developmental stages, one-way analysis of variance (ANOVA) was performed using the LSD method (significance level α = 0.05), and box plots were generated. Declarations Ethics approval and consent to participate All plant materials used in this study were provided by the Institute of Chinese Herbal Medicines, Henan Academy of Agricultural Sciences. Their procurement and use complied with relevant institutional, national, and international guidelines and regulations, and all necessary licenses and approvals were obtained prior to the study. Competing interests The authors declare no competing interests. Author contributions Lanjie Xu responsible for morphometric experiments and transcriptomic data analysis, respectively. Yongliang Yu is the corresponding author and was responsible for the overall research planning. Qing Yang, Zhansheng Nie, Hongqi Yang participated in morphological index measurements. Sufang An assisted with q RT-PCR experiments. Junping Feng, Yazhou Liu participated in discussions on experimental design. Xiaohui Wu contributed to manuscript writing. Huizhen Liang is a co-corresponding author and was responsible for research guidance and manuscript review. Acknowledgements This work was supported by the national modern agricultural industry Technology System (CARS-21), the Modern agricultural industry technology system construction project of Henan province (HARS-22-11-G3), the Special project for emerging disciplines development of Henan academy of agricultural sciences (2025XK01), and the Henan foreign experts studio (GZS2024025). Data availability The nucleotide sequences employed in this investigation are derived from data previously generated and deposited within the NCBI database by the research consortium (BioProject accession: PRJNA1291393, currently under restricted access). This dataset comprises transcriptomic profiles obtained across distinct developmental phases of the aphid species Uroleucon gobonis*. All sequence information was procured exclusively from the group's proprietary repository. Pertinent analytical procedures and resultant conclusions of this study are comprehensively delineated within the principal manuscript and supplementary documentation. For further inquiries pertaining to the research content, correspondence should be directed to the corresponding author of this publication. References Klingenberg, C.P. (2010). Evolution and development of shape: integrating quantitative approaches. Nature Reviews Genetics. 11(9), 623-635. https://doi: 10.1038/nrg2829. Simon, J.C., d’Alençon, E., Guy, E., Jacquin-Joly, E., Jaquiéry, J., Nouhaud, P., Peccoud J., Sugio, A., Streiff R. (2015). Genomics of adaptation to host-plants in herbivorous insects. Briefings in Functional Genomics. 14(6), 413-423. https://doi: 10.1093/bfgp/elv015. Roy, S., Saha, T.T., Zou, Z., Raikhel, A.S. (2018). Regulatory pathways controlling female insect reproduction. Annual Review of Entomology. 63, 489-511. https://doi:10.1146/annurev-ento-020117-043258. Pedigo, L.P., Rice, M.E., Krell R.K. (2021). Entomology and pest management (7th ed.). Waveland Press. 584 pages. Dixon, A.F.G. (2012). Aphid ecology an optimization approach (2nd ed.). Springer Dordrecht. 300 pages. https://doi.org/10.1007/978-94-011-5868-8. Daly, H.V. (2003). Insect morphometrics. Annual Review of Entomology. 30(1), 415-438. https://doi:10.1146/annurev.en.30.010185.002215. Li H, Liu XX, Zhi HJ, Li K, Zhang QW, Li Z. (2018). Morphological characteristics for instar identification of Aphis glycines (Hemiptera:Aphididae). Acta Entomologica Sinica. 61(7), 877-884. Klingenberg, C.P. (2010). Evolution and development of shape: integrating quantitative approaches. Nature Reviews Genetics. 11(9), 623-635. https://doi.org/10.1038/nrg2829. Nijhout, H.F. (2003). Development and evolution of adaptive polyphenisms. Evolution Development. 5(1), 9-18. Abdullah H. M., Mohana N.T., Khan B. M.,Ahmed S.M., Hossain M., Islam KH. S., Redoy M.H., Ferdush J., Bhuiyan M.A.H.B., Hossain M.M., Ahamed T. (2023). Present and future scopes and challenges of plant pest and disease (P&D) monitoring: Remote sensing, image processing, and artificial intelligence perspectives. Remote Sensing Applications: Society and Environment. 32, 100996. https://doi.org/10.1016/j.rsase.2023.100996. Merzendorfer, H., Zimoch, L. (2003). Chitin metabolism in insects: structure, function and regulation of chitin synthases and chitinases. Journal of Experimental Biology. 206(24), 4393-4412. https://doi: 10.1242/jeb.00709. PMID: 14610026. Riddiford, L. M. (2012). How does juvenile hormone control insect metamorphosis and reproduction? Gen Comp Endocrinol. 179(3), 477-84. https://doi: 10.1016/j.ygcen. Zhang CX, Brisson JA, Xu HJ. (2019) Molecular Mechanisms of Wing Polymorphism in Insects. Annu Rev Entomol. 64, 297-314. https://doi: 10.1146/annurev-ento- 011118-112448. Xue J, Zhou X, Zhang CX, Yu LL, Fan HW, Wang Z, Xu HJ, Xi Y, Zhu ZR, Zhou WW, Pan PL, Li BL, Colbourne JK, Noda H, Suetsugu Y, Kobayashi T, Zheng Y, Liu S, Zhang R, Liu Y, Luo YD, Fang DM, Chen Y, Zhan DL, Lv XD, Cai Y, Wang ZB, Huang HJ, Cheng RL, Zhang XC, Lou YH, Yu B, Zhuo JC, Ye YX, Zhang WQ, Shen ZC, Yang HM, Wang J, Wang J, Bao YY, Cheng JA. (2014). Genomes of the rice pest brown planthopper and its endosymbionts reveal complex complementary contributions for host adaptation. Genome Biol. 15(12), 521. https://doi.org/10.1186/s13059-014-0521-0. Abbot P, Tooker J, Lawson SP. (2018) Chemical Ecology and Sociality in Aphids: Opportunities and Directions. J Chem Ecol. 44(9), 770-784. https://doi.org/10.1007/s10886-018-0955-z. Xu L.J., Yu Y.L., Yang H.Q., Tan Z.W., Dong W., Li L., Li C.M., Liang H.Z. (2021). Screening of Safflower Germplasm With Resistance to Uroleucon gobonis and Field Efficacy Experiment. Journal of Nuclear Agricultural Sciences. 35(10), 2277-2283. http://dx.chinadoi.cn/10.11869/j.issn.100-8551.2021.10.2277. Qi,Chen Q,Ni,Li N, Wang X, Ma L, Huang JB Huang G H. (2017). Age-stage, two-sex life table of Parapoynx crisonalis (Lepidoptera: Pyralidae) at different temperatures. PloS one, 12(3), e0173380. https://doi.org/10.1371/journal.pone.0173380. Reineke, A., Thiéry, D. (2016). Grapevine insect pests and their natural enemies in the age of global warming. Journal of Pest Science. 89(2), 313-328. Daly, H.V. (1985). Insect morphometrics. Annual Review of Entomology. 30, 415-438. https://doi.org/10.1146/annurev.en.30.010185.002215. García-Barros E. (2015). Multivariate indices as estimates of dry body weight for comparative study of body size in Lepidoptera. Nota Lepi. 38(1), 59-74. https://doi.org/10.3897/nl.38.8957. Luo J.Y., Xie Q. (2024). Advances of major technology in insect morphology. Journal of Environmental Entomology. 46(6), 1306-1315. http://dx.chinadoi.cn/10.3969/j.issn.1674-0858. Zhao H.Z., Yang Y., Zhang J.L., Li J.J., Zhao C.D., Shi Y., Liu T.X. (2021). Morphological characteristics for distinguishing the instars of Acyrthosiphon pisum. Chinese Journal of Applied Entomology. 58(3), 747-754. https://doi.org/10.7679/j.issn.2095-1353. Ma N.W., Xia S.K., Liu B., Hu W.H., Wang P.L., Lu Y.H. (2025). Parasitism of Different Species and Instars of Cotton Aphids by Binodoxys communis. Chinese Journal of Biological Control. 41(3), 635-641. https://doi.org/10.16409/j.cnki.2095-039x. Xu L.J., An S.F., Yu Y.L., Yang Q., Tan Z.W., Li C.M., Su X.Y., Sun Y., Liang H.Z. (2024). Distinguishment of the Instars of Macrosiphoniella yomogicola in Artemisia argyi . Journal of Henan Agricultural Sciences. 53(11), 109-116. http://dx.chinadoi.cn/10.15933/j.cnki.1004-3268. Karasawa T, Koshikawa S. (2025). Evolution of gene regulatory networks in insects. Curr Opin Insect Sci. 69, 101365. https://doi.org/10.1016/j.cois. Jacobs, C.G., Rezende, G.L., Lamers, G.E., van der Zee, M. (2013). The extraembryonic serosa protects the insect egg against desiccation. Proceedings of the Royal Society B: Biological Sciences. 280(1754), 20131082. https://doi.org/10.1098/rspb.2013.1082. Liu, K., Dong, Y., Huang, Y., Rasgon, J. L., Agre, P. (2013). Impact of trehalose transporter knockdown on Anopheles gambiaestress adaptation and susceptibility to Plasmodium falciparuminfection. Proceedings of the National Academy of Sciences. 110(43), 17504-17509. https://doi.org/10.1073/pnas.1314419110. Behm C.A. (1997). The role of trehalose in the physiology of nematodes. Int J Parasitol. 27(2):215-29. https://doi.org/10.1016/s0020-7519(96)00151-8.PMID:9088992. Ogawa, K., Miura, T. (2014). Aphid polyphenisms: trans-generational developmental regulation through viviparity. Frontiers in Physiology. 5, 1. https://doi.org/10.3389/fphys.2014.00001 Vellichirammal, N. N., Gupta, P., Hall, T. A., & Brisson, J. A. (2017). Ecdysone signaling underlies the pea aphid transgenerational wing polyphenism. Proceedings of the National Academy of Sciences. 114(6), 1419-1424. https://doi.org/10.1073/pnas.1617640114. McStay B. (2016). Nucleolar organizer regions: genomic 'dark matter' requiring illumination. Genes Dev. 30(14), 1598-610. https://doi.org/10.1101/gad.283838.116.32. Katoh H., Harada A., Mori K., Negishi M. (2002) Socius is a novel Rnd GTPase-interacting protein involved in disassembly of actin stress fibers. Mol Cell Biol. 22(9), 2952-64. https://doi.org/10.1128/MCB.22.9.2952-2964. Anholt R.R.H., O'Grady P., Wolfner M.F., Harbison S.T. (2020). Evolution of Reproductive Behavior. Genetics. 214(1), 49-73. https://doi.org/doi: 10.1534/genetics.119.302263.34. Herranz R., Mateos J., Mas J.A., García-Zaragoza E., Cervera M., Marco R. (2005). The coevolution of insect muscle TpnT and TpnI gene isoforms. Mol Biol Evol. 22(11), 2231-42. https://doi.org/10.1093/molbev/msi223. Nijhout H.F., Callier V. (2015). Developmental mechanisms of body size and wing-body scaling in insects. Annu Rev Entomol. 60,141-56. https://doi.org/10.1146/annurev-ento-010814-020841. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 16 May, 2026 Reviewers agreed at journal 07 May, 2026 Reviews received at journal 11 Apr, 2026 Reviewers agreed at journal 31 Mar, 2026 Reviewers agreed at journal 28 Mar, 2026 Reviewers agreed at journal 26 Mar, 2026 Reviewers invited by journal 26 Mar, 2026 Editor assigned by journal 26 Mar, 2026 Editor invited by journal 19 Mar, 2026 Submission checks completed at journal 18 Mar, 2026 First submitted to journal 13 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9025299","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":613835489,"identity":"ffa339c1-8f9e-4c4b-aa91-8c438399879e","order_by":0,"name":"Xu Lanjie","email":"","orcid":"","institution":"Henan Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Xu","middleName":"","lastName":"Lanjie","suffix":""},{"id":613835490,"identity":"b898b3e7-980b-47a4-8136-08d1084babcb","order_by":1,"name":"An Sufang","email":"","orcid":"","institution":"Henan Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"An","middleName":"","lastName":"Sufang","suffix":""},{"id":613835491,"identity":"5f348f00-3678-42e3-a240-7b83116dbf43","order_by":2,"name":"Yu Yongliang","email":"","orcid":"","institution":"Henan Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Yongliang","suffix":""},{"id":613835492,"identity":"2f6a417b-285d-4ecf-a389-944d5f2dceae","order_by":3,"name":"yang Qing","email":"","orcid":"","institution":"Henan Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"yang","middleName":"","lastName":"Qing","suffix":""},{"id":613835493,"identity":"a815154b-b9fc-49e5-95a2-3d701b0f9689","order_by":4,"name":"Nie Zhansheng","email":"","orcid":"","institution":"Henan Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Nie","middleName":"","lastName":"Zhansheng","suffix":""},{"id":613835494,"identity":"641052ab-3ab4-4b7c-b584-635d0c761cf4","order_by":5,"name":"Liang Huizhen Liang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDElEQVRIie3PMUsDMRTA8Rce5JZoHF84pV8hchAFC34Ql8rBdam4yQ1FDwpxdC3otxDEUQlcl4N+hXPp3A4WBQfvdBHk0lUw/yGE8H6QBxAK/cG2sTlYAQKouSw1oUR8rn2E/yRsmh9G6pqn2kvgm0BLUFS51HNhdrwkwsXL66Pb7d1OynrLUpw4MADj/kn3x/hBslc5we7KoVaWEuMgq6HMzoruXUysrBNII0P7ltKGzDQrnIdE6y/C6XxNp5au7ifMkp8Io1YNETTi9FQRakS+iVzEzA4FUWZUkROS46gHnl2knD2od3t03Jumi/hDX6K8ma/q5bjfSdpQ/HoaeMbb2NuGgVAoFPrnfQL36kzgkACyUQAAAABJRU5ErkJggg==","orcid":"","institution":"Henan Academy of Agricultural Sciences","correspondingAuthor":true,"prefix":"","firstName":"Liang","middleName":"Huizhen","lastName":"Liang","suffix":""},{"id":613835495,"identity":"20117edb-ac4b-42d5-84dc-6eafc444c43f","order_by":6,"name":"Wu Xiaohui","email":"","orcid":"","institution":"Henan Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Wu","middleName":"","lastName":"Xiaohui","suffix":""},{"id":613835496,"identity":"a2576b92-f647-4053-a282-5cb23ce2f6f7","order_by":7,"name":"Yang Hongqi","email":"","orcid":"","institution":"Henan Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Hongqi","suffix":""},{"id":613835497,"identity":"1582e881-6c18-4a59-b9e6-d5b3e0186dac","order_by":8,"name":"Feng Junping","email":"","orcid":"","institution":"Henan Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Feng","middleName":"","lastName":"Junping","suffix":""},{"id":613835498,"identity":"493344aa-58c0-4476-ab74-1a181e7e28da","order_by":9,"name":"Liu Yazhou","email":"","orcid":"","institution":"Henan Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Liu","middleName":"","lastName":"Yazhou","suffix":""}],"badges":[],"createdAt":"2026-03-04 03:38:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9025299/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9025299/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105846707,"identity":"a9973474-a5a9-44ab-a070-bcdb73a3c700","added_by":"auto","created_at":"2026-03-31 18:04:19","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":326678,"visible":true,"origin":"","legend":"\u003cp\u003eMorphological indices of \u003cem\u003eU. gobonis\u003c/em\u003e at different instars\u003c/p\u003e\n\u003cp\u003eA:1st instar nymph; B. 2nd instar nymph; C. 3rd instar nymph of apterous morph; D. 3rd instar nymph of alate morph; E. 4th instar nymph of apterous morph; F. 4th instar nymph of alate morph; G. Apterous adult; H. Alate adult\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-9025299/v1/5050d433f48c4a06cc0eb5e8.png"},{"id":105905073,"identity":"1283e8f0-462a-4e3b-b83e-a9fecf6785a7","added_by":"auto","created_at":"2026-04-01 10:11:24","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":149672,"visible":true,"origin":"","legend":"\u003cp\u003eMorphological indicators of \u003cem\u003eU. gobonis \u003c/em\u003eat different instars\u003c/p\u003e\n\u003cp\u003eNote: \u003csup\u003e** \u003c/sup\u003eindicates a significant correlation at \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 (two-tailed).\u003c/p\u003e","description":"","filename":"image2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-9025299/v1/e55ea967b6505f1b0f238843.jpeg"},{"id":105904858,"identity":"f9b28b05-74f2-4822-ab0b-33605878678c","added_by":"auto","created_at":"2026-04-01 10:10:51","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":235230,"visible":true,"origin":"","legend":"\u003cp\u003eMorphological characteristics of \u003cem\u003eU. gobonis\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-9025299/v1/62e162afb3152cc4f64366bf.jpeg"},{"id":105846709,"identity":"69d412b6-502f-430f-862d-4656266285aa","added_by":"auto","created_at":"2026-03-31 18:04:20","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":73485,"visible":true,"origin":"","legend":"\u003cp\u003eExpression patterns of candidate genes at different instars of \u003cem\u003eU. gobonis\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-9025299/v1/ed879b6f466e28464accbd66.png"},{"id":105846711,"identity":"e3e4ffc2-9495-4624-8d0a-d68cf7b833d5","added_by":"auto","created_at":"2026-03-31 18:04:20","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":101649,"visible":true,"origin":"","legend":"\u003cp\u003eMorphological indices of \u003cem\u003eU. gobonis\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e1: Body length; 2: Body width; 3: Head width; 4: Cornicle length; 5: Cauda length; 6: Antennal length; 7: Hind foot length; 8: Forefoot length\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-9025299/v1/ccb39984b4cfd1a4b39d5592.png"},{"id":105908902,"identity":"213d5874-8567-4bdd-8f3c-2d7d33641376","added_by":"auto","created_at":"2026-04-01 10:39:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1669537,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9025299/v1/703abb14-43c4-4fd8-afd2-55aafc138d7a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"An Integrated Morphometric-Molecular Framework for High-Fidelity Instar Identification in the Safflower Aphid Uroleucon gobonis (Matsumura)","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe growth and development of insects is a complex and highly ordered biological process that spans their entire life cycle. For agricultural pests of significant economic or ecological importance, accurately identifying the developmental stages of their populations is not only the fundamental basis for elucidating growth and developmental patterns and life history strategies, but also a key practical step for implementing accurate monitoring, assessing population dynamics, and optimizing control strategies\u003csup\u003e1-4\u003c/sup\u003e. Among typical piercing- and sucking-mouthpart pests such as aphids, individuals at different instars exhibit significant differences in feeding behavior, dispersal ability, reproductive potential, and tolerance to biotic and abiotic stresses\u003csup\u003e5\u003c/sup\u003e. For example, young nymphs possess a thin cuticle and are more sensitive to pesticides, constituting an ideal window period for chemical control\u003csup\u003e2\u003c/sup\u003e. Therefore, establishing a set of efficient and accurate age-identification techniques is of irreplaceable value for gaining a deeper understanding of pest population ecology and for formulating timely and appropriate comprehensive management plans.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMorphological identification is a conventional method for \u0026nbsp; aphids instar determination, inferring developmental stages through microscopic measurement or visual observation of external morphological traits\u003csup\u003e6\u003c/sup\u003e. This approach has been widely applied in distinguishing adjacent instars of aphids, yet studies have revealed a substantial overlap in the measured values of morphological indicators among different instars\u003csup\u003e7\u003c/sup\u003e, making it rather difficult to identify aphid instars by acquiring a large number of morphological indicators. In addition, morphological traits are susceptible to environmental factors, which further impairs the reliability of identification using this method\u003csup\u003e8,9\u003c/sup\u003e. Nevertheless, due to its simplicity of operation, low technical threshold and low cost, the traditional morphological method still holds extensive application value in pest monitoring and aphid instar determination at present\u003csup\u003e10\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eAdvances in molecular biology have provided new avenues for overcoming traditional bottlenecks. Insect development is essentially the result of the orderly expression of genes across spatial and temporal dimensions. A substantial body of research has confirmed that the expression levels of functional genes involved in key biological processes, such as molting and metamorphosis, undergo changes at specific developmental stages, forming unique \u0026ldquo;gene expression fingerprints\u0026rdquo;\u003csup\u003e11-13\u003c/sup\u003e. In recent years, the use of transcriptomics to screen candidate marker genes, combined with validation via quantitative real-time polymerase chain reaction (\u003cem\u003eq\u003c/em\u003ePCR), has become an effective strategy for constructing molecular instar identification systems for insects\u003csup\u003e14\u003c/sup\u003e. However, research on systematic molecular identification frameworks targeting the \u003cem\u003eU. gobonis\u003c/em\u003e instar remains relatively scarce.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eU. gobonis\u003c/em\u003e is a piercing- and sucking-mouthpart pest that causes severe damage to commercial crops, including Compositae\u003csup\u003e15-16\u003c/sup\u003e. At present, few studies have addressed instar identification in this species. In response to this limitation, this study proposed an integrated identification framework combining morphology and molecular biology: systematically evaluated the ability of eight morphological characteristics to distinguish five development stages of the safflower aphids; screened six candidate genes based on transcriptome data and used fluorescence quantitative PCR to analyze their expression patterns at each development stage; and established a hierarchical identification framework of \u0026ldquo;morphological screening-molecular verification\u0026rdquo; to achieve accurate and efficient instar determination.\u003c/p\u003e\n\u003cp\u003eThe \u0026ldquo;morphology-molecular\u0026rdquo; dual-track identification scheme developed in this study has improved the technical accuracy of traditional morphological identification, provides key technical support for monitoring and early warning of \u003cem\u003eU. gobonis\u003c/em\u003e population dynamics, and offers innovative technical references for developmental biology research and integrated management practices targeting aphids and other hemipteran pests.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eMorphological characteristics of \u003cem\u003eU. gobonis\u003c/em\u003e across developmental stages\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe developmental process of \u003cem\u003eU. gobonis\u003c/em\u003e consists of five consecutive instars: 1st, 2nd, 3rd, and 4th instar nymphs, followed by the adult stage (Fig. 1). The morphological characteristics of this species exhibit distinct dynamic changes during development, providing key morphological criteria for instar identification. The 1st and 2nd instar nymphs are highly similar in external morphology (Fig. 1A, B), both exhibiting transparent body walls, short antennae, and underdeveloped cornicles.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThird-instar nymphs show distinct morphological differentiation and can be categorized into two morphotypes according to the degree of wing base development: 3rd instar apterous nymphs, which lack protrusions on the mesonotum and do not possess wing buds (Fig. 1C), and 3rd instar alate nymphs, which exhibit noticeable protrusions on the mesonotum and small wing buds (Fig. 1D). This differentiation provides a reliable morphological marker for distinguishing between 2nd instar and 3rd instar nymphs.\u003c/p\u003e\n\u003cp\u003eThe 3rd instar apterous nymphs maintain stable morphology in the mesothorax and metathorax during subsequent development, ultimately progressing to 4th instar apterous nymphs (Fig. 1E) and apterous adults (Fig. 1G). By contrast, 3rd instar alate nymphs continue to develop thoracic wing bases. By the 4th instar stage (Fig. 1F), small wing buds of the forewings and hindwings are clearly distinguishable, and fully formed wing structures are observed in the adult stage (Fig. 1H). This study confirms that the degree of wing base development is a key criterion for distinguishing between 2nd instar nymphs and 3rd instar alate nymphs, providing a foundation for further morphometric analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorrelation analysis of instar and morphological indicators\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll eight morphological indicators showed strong positive correlations with the instar stages of \u003cem\u003eU. gobonis\u0026nbsp;\u003c/em\u003e(\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01). Among these, antennal length exhibited the strongest correlation with instar (r = 0.964), followed by body length (r = 0.960) and cornicle length (r = 0.943), indicating that these three indicators can serve as core morphological markers for instar identification in \u003cem\u003eU. gobonis\u003c/em\u003e. Further analysis revealed a high correlation coefficient of 0.979 (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01) between antennal length and cornicle length, suggesting coordinated changes between these two traits during aphid growth and development. The correlation coefficient between body width and body length was 0.960 (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01), reflecting uniform expansion of aphid body size with increasing instar. Furthermore, indicators such as head width, cauda length, and forefoot length showed correlation coefficients with instar exceeding 0.92, indicating their potential as auxiliary identification markers. These results demonstrate that morphological indicators of\u003cem\u003e\u0026nbsp;U. gobonis\u003c/em\u003e change in a regular pattern with increasing instar, providing a reliable basis for rapid field identification of its instar structure. This, in turn, supports population dynamics monitoring and the development of precise pest control strategies (Table 1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1\u003c/strong\u003e Correlation analysis of instar and morphological indicators\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"578\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 105px;\"\u003e\n \u003cp\u003eIndicators\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\n \u003cp\u003eInstar\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\n \u003cp\u003eBody length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\n \u003cp\u003eBody width\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 51px;\"\u003e\n \u003cp\u003eHead width\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\n \u003cp\u003eCornicle length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\n \u003cp\u003eCauda length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\n \u003cp\u003eAntenna length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\n \u003cp\u003eHind foot length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 47px;\"\u003e\n \u003cp\u003eFore foot length\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 105px;\"\u003e\n \u003cp\u003eInstar\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 51px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 47px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 105px;\"\u003e\n \u003cp\u003eBody length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\n \u003cp\u003e0.960\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 51px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 47px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 105px;\"\u003e\n \u003cp\u003eBody width\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\n \u003cp\u003e0.927\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\n \u003cp\u003e0.960\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 51px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 47px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 105px;\"\u003e\n \u003cp\u003eHead width\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\n \u003cp\u003e0.927\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\n \u003cp\u003e0.893\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\n \u003cp\u003e0.869\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 51px;\"\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 47px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 105px;\"\u003e\n \u003cp\u003eCornicle length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\n \u003cp\u003e0.943\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\n \u003cp\u003e0.905\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\n \u003cp\u003e0.847\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 51px;\"\u003e\n \u003cp\u003e0.879\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 47px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 105px;\"\u003e\n \u003cp\u003eCauda length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\n \u003cp\u003e0.942\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\n \u003cp\u003e0.933\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\n \u003cp\u003e0.908\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 51px;\"\u003e\n \u003cp\u003e0.856\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\n \u003cp\u003e0.929\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 47px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 105px;\"\u003e\n \u003cp\u003eAntenna length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\n \u003cp\u003e0.964\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\n \u003cp\u003e0.937\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\n \u003cp\u003e0.892\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 51px;\"\u003e\n \u003cp\u003e0.888\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\n \u003cp\u003e0.979\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\n \u003cp\u003e0.962\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 47px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 105px;\"\u003e\n \u003cp\u003eFore foot length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\n \u003cp\u003e0.947\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\n \u003cp\u003e0.938\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\n \u003cp\u003e0.928\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 51px;\"\u003e\n \u003cp\u003e0.869\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\n \u003cp\u003e0.931\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\n \u003cp\u003e0.967\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\n \u003cp\u003e0.968\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 47px;\"\u003e\u0026nbsp;\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 105px;\"\u003e\n \u003cp\u003eHind foot length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\n \u003cp\u003e0.924\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\n \u003cp\u003e0.876\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\n \u003cp\u003e0.810\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 51px;\"\u003e\n \u003cp\u003e0.861\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\n \u003cp\u003e0.965\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 54px;\"\u003e\n \u003cp\u003e0.917\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 53px;\"\u003e\n \u003cp\u003e0.953\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 52px;\"\u003e\n \u003cp\u003e0.892\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 47px;\"\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eNote: \u003csup\u003e**\u003c/sup\u003e indicates a significant correlation at \u003cstrong\u003eP \u0026lt; 0.01\u003c/strong\u003e (two-tailed).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnalysis of morphological indicators of \u003cem\u003eU. gobonis\u003c/em\u003e across different instars\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe eight morphological indicators showed a continuous increase with advancing instar, with body length, antennal length, and cornicle length exhibiting the most significant increases. All indicators reached their minimum values in the 1st instar nymphal stage and their maximum values in the adult stage.\u003c/p\u003e\n\u003cp\u003eAntennal length increased approximately 2.9-fold from the 1st instar nymph to the adult stage, with a 20% increase from the second to 3rd instar, a 15% increase from the third to 4th instar, and a 10% increase from the 4th instar to the adult stage. Statistically significant differences (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05) were observed between each pair of consecutive instars. Cornicle length increased approximately 3.6-fold from the 1st instar nymphal stage to the adult stage, with a 25% increase from the second to the 3rd instar. Although the growth rate declined in subsequent stages, statistically significant differences remained. Hind foot length, Head width and other \u0026nbsp;morphological indicators increased significantly during the first to adult (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05). These differentiated patterns of morphological change reveal stage-specific characteristics of growth and development in \u003cem\u003eU. gobonis\u003c/em\u003e, providing quantitative criteria for instar identification. This facilitates rapid field assessment of developmental stages and supports the formulation of targeted pest management strategies (Fig. 2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOverlap analysis of morphological indicators across different instars\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBody length can effectively distinguish aphids from the 1st to the 4th instar. However, the maximum body length of fourth-instar aphids (2.393 mm) is greater than the minimum body length of adults (2.181 mm), resulting in overlap between the body length ranges of these two developmental stages. Abdominal tube length overlaps between the 1st and the 2nd instars. However, starting from the 3rd instar, the numerical intervals of each instar are completely separated, such that abdominal tube length can clearly distinguish the 2nd and 3rd instars, 4th instar aphids, and adults. Body width can effectively distinguish 1st and 2nd instar aphids, but the numerical intervals overlap at later instars. Cauda length can distinguish between 2nd and 3rd instar aphids and between 3rd and 4th instar aphids; however, there is overlap between 1st and 2nd instar aphids and between 4th instar aphids and adults. Head width, forefoot length and hind foot length, show continuous, gradual changes across all adjacent ages and lack independent diagnostic value (Fig. 3).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExpression patterns of six genes across different instars of \u003cem\u003eU. gobonis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, we systematically analyzed the expression patterns of six candidate genes of DN1031, DN136, DN1019, DN1068, DN1093, and DN1098 across five developmental stages (1st-to 4th-instar nymphs and adults) of \u003cem\u003eU. gobonis\u003c/em\u003e using \u003cem\u003eq\u003c/em\u003ePCR (Fig. 4).\u003c/p\u003e\n\u003cp\u003eThe expression level of the DN1098 gene showed a bell-shaped distribution: expression was lowest at the 1st instar aphid stage (d), was significantly up-regulated at the 2nd instar aphid stage (b), and reached a peak at the 3rd instar aphid stage (a); after entering the 4th instar aphid stage and adult stage, expression dropped below the level observed at the 2nd instar aphid stage (c). DN136 expression showed an up-regulated trend: expression was lowest at the 1st instar aphid stage (d), gradually increased with advancing instar, and reached peak levels at the adult stage (a). DN1031, DN1019, and DN1093 all showed peak expression in the 1st instar. DN1031 expression was highest at the 1st instar (a), significantly down-regulated at the 2nd and 3rd instars (b), and lowest at the 4th instar (c). DN1019 was highly expressed in the 1st instar (a), sharply decreased to its lowest level at the 2nd instar (c), and remained low at the 3rd and 4th instars and the adult stage (b). DN1093 was highly expressed at the 1st instar (a) and significantly down-regulated at the 2nd and 3rd instars and the adult stage (b). DN1068 expression was low at the 1st instar (c), significantly up-regulated at the 2nd instar (b), maintained peak levels at the 3rd and 4th instars (a), and slightly decreased at the adult stage (ab).\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAccurately identifying the developmental age of pests is the cornerstone of integrated pest management (IPM), directly affecting the accuracy of population monitoring, the depth of developmental ecology research, and the identification of key control windows\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. In this study, an important agricultural pest, \u003cem\u003eDactylsiphum roseum\u003c/em\u003e, was used to develop a complementary framework for instar identification by integrating morphological and molecular biological methods. While evaluating traditional morphological indicators, we developed an instar-specific molecular marker based on gene expression profiles, which addresses the inherent limitations of single-method morphological identification.\u003c/p\u003e \u003cp\u003eMorphometrics, a classical method for insect instar identification, has been widely used in this field because of its operational simplicity and low cost\u003csup\u003e\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Through correlation analysis, this study confirmed that key morphological indicators, including antennal length, cornicle length, and body length, showed strong positive correlations with the instar of \u003cem\u003eU. gobonis\u003c/em\u003e (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), consistent with findings in closely related species such as \u003cem\u003eAcyrthosiphon pisum\u003c/em\u003e and cotton aphids\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. However, overlap analysis revealed inherent limitations of morphological methods: cornicle length could not effectively distinguish between 1st- and 2nd-instar nymphs (overlap 37.2%), and body length could not precisely differentiate 4th instar nymphs from adults (overlap 29.5%). This phenomenon aligns with technical bottlenecks reported in studies on \u003cem\u003eMacrosiphoniella yomogicola\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eTo overcome these limitations, this study identified six candidate genes based on transcriptomic data and systematically analyzed their expression patterns across five consecutive developmental stages using \u003cem\u003eq\u003c/em\u003ePCR. DN1031, DN1019, and DN1093 showed coordinated high expression in 1st instar nymphs (fold change\u0026thinsp;\u0026gt;\u0026thinsp;8.0; \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), potentially involved in regulating the critical transition from embryo to nymph\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e,\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. DN1031 encodes a solute carrier family 2 member protein, which may facilitate transmembrane transport of monosaccharides such as glucose, providing energy substrates for the highly active life processes of 1st-instar nymphs\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e,\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. DN1019 encodes a vacuolar protein sorting-associated protein 13, possibly involved in intracellular material transport and vesicle sorting. DN1093 encodes a ZBED8-like protein, a putative transcriptional regulator that may mediate developmental transition-related molecular events by regulating downstream target gene networks. The coordinated high expression of these three genes may collectively constitute a specific molecular signature for early cuticle formation and activation of basal metabolism in 1st instar nymphs. DN1098 exhibited a specific expression peak in 3rd instar nymphs (fold change\u0026thinsp;=\u0026thinsp;12.7; \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), suggesting its involvement in wing morph differentiation and reproductive system programming\u003csup\u003e\u003cspan additionalcitationids=\"CR30\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. This approach has been validated in model insects such as \u003cem\u003eDrosophila melanogaster\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. DN136 expression peaked in adults (fold change\u0026thinsp;=\u0026thinsp;9.3; \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), serving as an adult-specific marker. DN1068 maintained high expression during the 2nd to 4th nymphal instars, possibly involved in regulating growth and development during mid-to-late nymphal stages\u003csup\u003e\u003cspan additionalcitationids=\"CR34\" citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThis study provides a comprehensive integrated morpho-molecular system for the precise instar identification of \u003cem\u003eU. gobonis\u003c/em\u003e (safflower aphid). However, although the \u003cem\u003eq\u003c/em\u003ePCR-based molecular identification method is highly accurate, it requires specialized laboratory equipment and technical expertise, which limits its application in rapid, on-site field monitoring to a certain extent. Future research should prioritize simplifying molecular detection protocols, such as developing strip-based detection assays or portable detection devices, and validating these methods under a wider range of ecological conditions.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn this study, we combined morphometric and molecular biological approaches to establish a multi-dimensional instar identification system for the safflower aphid \u003cem\u003eU. gobonis\u003c/em\u003e (Matsumura). Morphometric analysis of eight indicators revealed that body length, abdominal tube length, and antennal length can effectively discriminate among the first to fourth instars, whereas the other five indicators exhibited substantial overlap. To address the limitations of traditional morphological identification, six candidate genes with stage-specific expression patterns were identified from transcriptome data. Among them, DN1098 was highly expressed in the third instar, DN136 peaked in adults, DN1031, DN1019, and DN1093 were upregulated in the first instar, and DN1068 maintained high expression from the second to fourth instars. Based on these expression profiles, a multi-gene expression fingerprint system was constructed, enabling accurate discrimination of all developmental stages.These findings provide a reliable technical basis for population monitoring and precision pest management of this important agricultural pest.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cstrong\u003eAphid samples\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003eU. gobonis\u003c/em\u003e aphids used in this study were collected from the Henan Modern Agricultural Development Base and continuously reared for multiple generations in the laboratory using safflower (\u003cem\u003eCarthamus tinctorius\u003c/em\u003e) seedlings maintained in an artificial climate chamber (Model RDN‑300, Ningbo Yanghui Instrument Co., Ltd.). The rearing conditions were set as follows: temperature 16 \u0026plusmn; 2 \u0026deg;C, relative humidity 45 \u0026plusmn; 5 %, and a photoperiod of 16 L : 8 D. Fresh seedlings were replaced every 30 days.\u003c/p\u003e\n\u003cp\u003eSafflower leaves with petioles were selected, and the petioles were inserted into moist absorbent cotton in a 10 cm \u0026times; 10 cm plastic culture dish. A single apterous adult aphid was transferred onto the leaf using a soft brush. After nymph production, newly hatched nymphs were individually transferred to new culture dishes and reared separately. By regularly monitoring molting events, individuals from each nymphal instar and adults were systematically collected for subsequent experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasurement of morphological traits\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIndividuals of \u003cem\u003eU. gobonis\u003c/em\u003e from each instar were collected separately and transferred singly into transparent glass dishes containing 1 mL of 75 % ethanol. Morphological traits were measured for apterous and alate individuals under a stereomicroscope (Olympus SZX7). The specific measurement indices and their positioning are shown in Figure 1. For each instar, 60 specimens (30 apterous and 30 alate) were measured, and each morphological trait was measured three times; the mean value was used for analysis (Fig. 5).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCandidate gene screening and functional annotation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBased on previous full-transcriptome data, six candidate genes (DN1031, DN1068, DN1093, DN1019, DN136, and DN1098) with stage-specific expression characteristics were screened and identified. Based on annotation and comparison in the NCBI database, DN1031 encodes a solute carrier family 2 member protein, DN1068 encodes a PRELI domain-containing protein 1, DN1093 encodes a ZBED8-like protein, DN1019 encodes a vacuolar protein sorting-associated protein 13, DN136 encodes a protein containing a KN motif and ankyrin repeat domain 2, and DN1098 encodes a small nucleolar RNA-associated protein 15 homolog.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTotal RNA extraction and real-time fluorescence quantitative PCR analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from the samples using the Quick RNA Isolation Kit (Beijing Huayueyang Biotechnology Co., Ltd.) according to the manufacturer\u0026rsquo;s instructions. The quality and integrity of the extracted total RNA were assessed by 1.2% (w/v) agarose gel electrophoresis, and its concentration was measured using a NanoDrop 2000 spectrophotometer. First-strand cDNA was synthesized via reverse transcription of total RNA using the PrimeScript\u0026trade; RT reagent Kit with gDNA Eraser (TaKaRa, Code No. RR047A) following the kit protocol.\u003c/p\u003e\n\u003cp\u003eReal-time fluorescence quantitative PCR (\u003cem\u003eq\u003c/em\u003ePCR) was used to detect the expression levels of \u0026nbsp;six genes in 1st instar, 2nd instar, 3rd instar, 4th instar nymphs, and adults of \u003cem\u003eU. gobonis\u003c/em\u003e. Specific \u003cem\u003eq\u003c/em\u003ePCR primers for each gene were designed using Primer Premier 5.0 software (Table 2), with \u0026beta;-actin serving as the internal reference. \u003cem\u003eq\u003c/em\u003ePCR reactions were performed using TaKaRa TB Green\u0026reg; Premix Ex Taq\u0026trade; II (Tli RNaseH Plus) with the following cycling program: 95\u0026deg;C for 3 min for pre-denaturation, followed by 45 cycles of amplification (95\u0026deg;C for 10 s, 55\u0026deg;C for 30 s, and 72\u0026deg;C for 28 s). The specificity of PCR amplification was verified by melt curve analysis (temperature range, 55\u0026deg;C to 94\u0026deg;C, heating rate 0.1\u0026deg;C/s). Three technical replicates were included for each gene in \u003cem\u003eq\u003c/em\u003ePCR. Relative gene expression levels were calculated using the 2^\u003csup\u003e(-\u0026Delta;\u0026Delta;CT)\u003c/sup\u003e method. Significant differences in gene expression among different developmental stages (1st instar, 2nd instar, 3rd instar, 4th instar nymphs, and adults) of \u003cem\u003eU. gobonis\u003c/em\u003e were analyzed using Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2\u003c/strong\u003e Primer sequences used for \u003cem\u003eq\u003c/em\u003ePCR\u003c/p\u003e\n\u003cdiv align=\"\"\u003e\n \u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"566\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 78px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene Name\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 263px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eForward Primer\u003c/strong\u003e\u003cstrong\u003e(\u003c/strong\u003e\u003cstrong\u003e5\u0026lsquo;\u0026ndash;3\u0026rsquo;\u003c/strong\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 225px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eReverse Primer\u003c/strong\u003e\u003cstrong\u003e(\u003c/strong\u003e\u003cstrong\u003e5\u0026lsquo;\u0026ndash;3\u0026rsquo;\u003c/strong\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 78px;\"\u003e\n \u003cp\u003eDN1031\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 263px;\"\u003e\n \u003cp\u003eAACACAGGACACGCCTGATT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 225px;\"\u003e\n \u003cp\u003eCAATTTCGTCGTTGGCCTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 78px;\"\u003e\n \u003cp\u003eDN1068\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 263px;\"\u003e\n \u003cp\u003eTGGCATCGTTATCCAAACCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 225px;\"\u003e\n \u003cp\u003eCACCAATGTCTTTTTGGTGGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 78px;\"\u003e\n \u003cp\u003eDN1093\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 263px;\"\u003e\n \u003cp\u003eATTTGACCAACGGGCGAAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 225px;\"\u003e\n \u003cp\u003eTAATGTGGCCGACCATAGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 78px;\"\u003e\n \u003cp\u003eDN1098\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 263px;\"\u003e\n \u003cp\u003eTAGCCCCGTGTTGGTCAAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 225px;\"\u003e\n \u003cp\u003eAACAGATTCCTCGCCACCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 78px;\"\u003e\n \u003cp\u003eDN1019\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 263px;\"\u003e\n \u003cp\u003eAGCTAGCTTTGTACCAGCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 225px;\"\u003e\n \u003cp\u003eAGCATGTAGCCAAAACGTTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 78px;\"\u003e\n \u003cp\u003eDN136\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 263px;\"\u003e\n \u003cp\u003eCTTCCGTCTTCGTCCTGCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 225px;\"\u003e\n \u003cp\u003eAAATGACGCGGGCTACTCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 78px;\"\u003e\n \u003cp\u003e\u0026beta;-actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 263px;\"\u003e\n \u003cp\u003eGGTGAAACCTTGTCTACTGTTACATCTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 225px;\"\u003e\n \u003cp\u003eCCGAAAAGTGTCATAATGAAGACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eData Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUsing SPSS Statistics 19.0 and Excel 2007 software, basic statistical analyses, correlation analysis, and principal component analysis were performed on the 12 morphological traits of \u003cem\u003eU. gobonis\u003c/em\u003e. For morphological traits across different developmental stages, one-way analysis of variance (ANOVA) was performed using the LSD method (significance level \u0026alpha; = 0.05), and box plots were generated.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e\n\u003cp\u003eAll plant materials used in this study were provided by the Institute of Chinese Herbal Medicines, Henan Academy of Agricultural Sciences. Their procurement and use complied with relevant institutional, national, and international guidelines and regulations, and all necessary licenses and approvals were obtained prior to the study.\u003c/p\u003e\n\u003ch2\u003eCompeting interests\u003c/h2\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003ch2\u003eAuthor contributions\u003c/h2\u003e\n\u003cp\u003eLanjie Xu responsible for morphometric experiments and transcriptomic data analysis, respectively. Yongliang Yu is the corresponding author and was responsible for the overall research planning. Qing Yang, Zhansheng Nie, Hongqi Yang participated in morphological index measurements. Sufang An assisted with \u003cem\u003eq\u003c/em\u003eRT-PCR experiments. Junping Feng, Yazhou Liu participated in discussions on experimental design. Xiaohui Wu contributed to manuscript writing. Huizhen Liang is a co-corresponding author and was responsible for research guidance and manuscript review.\u003c/p\u003e\n\u003ch2\u003eAcknowledgements\u003c/h2\u003e\n\u003cp\u003eThis work was supported by the national modern agricultural industry Technology System (CARS-21), the Modern agricultural industry technology system construction project of Henan province (HARS-22-11-G3), the Special project for emerging disciplines development of Henan academy of agricultural sciences (2025XK01), and the Henan foreign experts studio (GZS2024025).\u003c/p\u003e\n\u003ch2\u003eData availability\u003c/h2\u003e\n\u003cp\u003eThe nucleotide sequences employed in this investigation are derived from data previously generated and deposited within the NCBI database by the research consortium (BioProject accession: PRJNA1291393, currently under restricted access). This dataset comprises transcriptomic profiles obtained across distinct developmental phases of the aphid species Uroleucon gobonis*. All sequence information was procured exclusively from the group\u0026apos;s proprietary repository. Pertinent analytical procedures and resultant conclusions of this study are comprehensively delineated within the principal manuscript and supplementary documentation. For further inquiries pertaining to the research content, correspondence should be directed to the corresponding author of this publication.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKlingenberg, C.P. (2010). Evolution and development of shape: integrating quantitative approaches. Nature Reviews Genetics. 11(9), 623-635. https://doi: 10.1038/nrg2829.\u003c/li\u003e\n\u003cli\u003eSimon, J.C., d\u0026rsquo;Alen\u0026ccedil;on, E., Guy, E., Jacquin-Joly, E., Jaqui\u0026eacute;ry, J., Nouhaud, P., Peccoud J., Sugio, A., Streiff R. (2015). Genomics of adaptation to host-plants in herbivorous insects. Briefings in Functional Genomics. 14(6), 413-423. https://doi: 10.1093/bfgp/elv015.\u003c/li\u003e\n\u003cli\u003eRoy, S., Saha, T.T., Zou, Z., Raikhel, A.S. (2018). Regulatory pathways controlling female insect reproduction. Annual Review of Entomology. 63, 489-511. https://doi:10.1146/annurev-ento-020117-043258.\u003c/li\u003e\n\u003cli\u003ePedigo, L.P., Rice, M.E., Krell R.K. (2021). Entomology and pest management (7th ed.). Waveland Press. 584 pages.\u003c/li\u003e\n\u003cli\u003eDixon, A.F.G. (2012). Aphid ecology an optimization approach (2nd ed.). Springer Dordrecht. 300 pages. https://doi.org/10.1007/978-94-011-5868-8.\u003c/li\u003e\n\u003cli\u003eDaly, H.V. (2003). Insect morphometrics. Annual Review of Entomology. 30(1), 415-438. https://doi:10.1146/annurev.en.30.010185.002215.\u003c/li\u003e\n\u003cli\u003eLi H, Liu XX, Zhi HJ, Li K, Zhang QW, Li Z. (2018). Morphological characteristics for instar identification of \u003cem\u003eAphis glycines\u003c/em\u003e (Hemiptera:Aphididae). Acta Entomologica Sinica. 61(7), 877-884.\u003c/li\u003e\n\u003cli\u003eKlingenberg, C.P. (2010). Evolution and development of shape: integrating quantitative approaches. Nature Reviews Genetics. 11(9), 623-635. https://doi.org/10.1038/nrg2829.\u003c/li\u003e\n\u003cli\u003eNijhout, H.F. (2003). Development and evolution of adaptive polyphenisms. Evolution Development. 5(1), 9-18. \u003c/li\u003e\n\u003cli\u003eAbdullah H. M., Mohana N.T., Khan B. M.,Ahmed S.M., Hossain M., Islam KH. S., Redoy M.H., Ferdush J., Bhuiyan M.A.H.B., Hossain M.M., Ahamed T. (2023). Present and future scopes and challenges of plant pest and disease (P\u0026amp;D) monitoring: Remote sensing, image processing, and artificial intelligence perspectives. Remote Sensing Applications: Society and Environment. 32, 100996. https://doi.org/10.1016/j.rsase.2023.100996.\u003c/li\u003e\n\u003cli\u003eMerzendorfer, H., Zimoch, L. (2003). Chitin metabolism in insects: structure, function and regulation of chitin synthases and chitinases. Journal of Experimental Biology. 206(24), 4393-4412. https://doi: 10.1242/jeb.00709. PMID: 14610026.\u003c/li\u003e\n\u003cli\u003eRiddiford, L. M. (2012). How does juvenile hormone control insect metamorphosis and reproduction? Gen Comp Endocrinol. 179(3), 477-84. https://doi: 10.1016/j.ygcen.\u003c/li\u003e\n\u003cli\u003eZhang CX, Brisson JA, Xu HJ. (2019) Molecular Mechanisms of Wing Polymorphism in Insects. Annu Rev Entomol. 64, 297-314. https://doi: 10.1146/annurev-ento- 011118-112448.\u003c/li\u003e\n\u003cli\u003eXue J, Zhou X, Zhang CX, Yu LL, Fan HW, Wang Z, Xu HJ, Xi Y, Zhu ZR, Zhou WW, Pan PL, Li BL, Colbourne JK, Noda H, Suetsugu Y, Kobayashi T, Zheng Y, Liu S, Zhang R, Liu Y, Luo YD, Fang DM, Chen Y, Zhan DL, Lv XD, Cai Y, Wang ZB, Huang HJ, Cheng RL, Zhang XC, Lou YH, Yu B, Zhuo JC, Ye YX, Zhang WQ, Shen ZC, Yang HM, Wang J, Wang J, Bao YY, Cheng JA. (2014). Genomes of the rice pest brown planthopper and its endosymbionts reveal complex complementary contributions for host adaptation. Genome Biol. 15(12), 521. https://doi.org/10.1186/s13059-014-0521-0.\u003c/li\u003e\n\u003cli\u003eAbbot P, Tooker J, Lawson SP. (2018) Chemical Ecology and Sociality in Aphids: Opportunities and Directions. J Chem Ecol. 44(9), 770-784. https://doi.org/10.1007/s10886-018-0955-z.\u003c/li\u003e\n\u003cli\u003eXu L.J., Yu Y.L., Yang H.Q., Tan Z.W., Dong W., Li L., Li C.M., Liang H.Z. (2021). Screening of Safflower Germplasm With Resistance to \u003cem\u003eUroleucon gobonis\u003c/em\u003e and Field Efficacy Experiment. Journal of Nuclear Agricultural Sciences. 35(10), 2277-2283. http://dx.chinadoi.cn/10.11869/j.issn.100-8551.2021.10.2277.\u003c/li\u003e\n\u003cli\u003eQi,Chen Q,Ni,Li N, Wang X, Ma L, Huang JB Huang G H. (2017). Age-stage, two-sex life table of \u003cem\u003eParapoynx crisonalis\u003c/em\u003e (Lepidoptera: Pyralidae) at different temperatures. PloS one, 12(3), e0173380. https://doi.org/10.1371/journal.pone.0173380.\u003c/li\u003e\n\u003cli\u003eReineke, A., Thi\u0026eacute;ry, D. (2016). Grapevine insect pests and their natural enemies in the age of global warming. Journal of Pest Science. 89(2), 313-328.\u003c/li\u003e\n\u003cli\u003eDaly, H.V. (1985). Insect morphometrics. Annual Review of Entomology. 30, 415-438. https://doi.org/10.1146/annurev.en.30.010185.002215.\u003c/li\u003e\n\u003cli\u003eGarc\u0026iacute;a-Barros E. (2015). Multivariate indices as estimates of dry body weight for comparative study of body size in Lepidoptera. Nota Lepi. 38(1), 59-74. https://doi.org/10.3897/nl.38.8957. \u003c/li\u003e\n\u003cli\u003eLuo J.Y., Xie Q. (2024). Advances of major technology in insect morphology. Journal of Environmental Entomology. 46(6), 1306-1315. http://dx.chinadoi.cn/10.3969/j.issn.1674-0858.\u003c/li\u003e\n\u003cli\u003eZhao H.Z., Yang Y., Zhang J.L., Li J.J., Zhao C.D., Shi Y., Liu T.X. (2021). Morphological characteristics for distinguishing the instars of Acyrthosiphon pisum. Chinese Journal of Applied Entomology. 58(3), 747-754. https://doi.org/10.7679/j.issn.2095-1353.\u003c/li\u003e\n\u003cli\u003eMa N.W., Xia S.K., Liu B., Hu W.H., Wang P.L., Lu Y.H. (2025). Parasitism of Different Species and Instars of Cotton Aphids by Binodoxys communis. Chinese Journal of Biological Control. 41(3), 635-641. https://doi.org/10.16409/j.cnki.2095-039x.\u003c/li\u003e\n\u003cli\u003eXu L.J., An S.F., Yu Y.L., Yang Q., Tan Z.W., Li C.M., Su X.Y., Sun Y., Liang H.Z. (2024). Distinguishment of the Instars of Macrosiphoniella yomogicola in \u003cem\u003eArtemisia argyi\u003c/em\u003e. Journal of Henan Agricultural Sciences. 53(11), 109-116. http://dx.chinadoi.cn/10.15933/j.cnki.1004-3268.\u003c/li\u003e\n\u003cli\u003eKarasawa T, Koshikawa S. (2025). Evolution of gene regulatory networks in insects. Curr Opin Insect Sci. 69, 101365. https://doi.org/10.1016/j.cois.\u003c/li\u003e\n\u003cli\u003eJacobs, C.G., Rezende, G.L., Lamers, G.E., van der Zee, M. (2013). The extraembryonic serosa protects the insect egg against desiccation. Proceedings of the Royal Society B: Biological Sciences. 280(1754), 20131082. https://doi.org/10.1098/rspb.2013.1082.\u003c/li\u003e\n\u003cli\u003eLiu, K., Dong, Y., Huang, Y., Rasgon, J. L., Agre, P. (2013). Impact of trehalose transporter knockdown on Anopheles gambiaestress adaptation and susceptibility to Plasmodium falciparuminfection. Proceedings of the National Academy of Sciences. 110(43), 17504-17509. https://doi.org/10.1073/pnas.1314419110.\u003c/li\u003e\n\u003cli\u003eBehm C.A. (1997). The role of trehalose in the physiology of nematodes. Int J Parasitol. 27(2):215-29. https://doi.org/10.1016/s0020-7519(96)00151-8.PMID:9088992.\u003c/li\u003e\n\u003cli\u003eOgawa, K., Miura, T. (2014). Aphid polyphenisms: trans-generational developmental regulation through viviparity. Frontiers in Physiology. 5, 1. https://doi.org/10.3389/fphys.2014.00001\u003c/li\u003e\n\u003cli\u003eVellichirammal, N. N., Gupta, P., Hall, T. A., \u0026amp; Brisson, J. A. (2017). Ecdysone signaling underlies the pea aphid transgenerational wing polyphenism. Proceedings of the National Academy of Sciences. 114(6), 1419-1424. https://doi.org/10.1073/pnas.1617640114.\u003c/li\u003e\n\u003cli\u003eMcStay B. (2016). Nucleolar organizer regions: genomic \u0026apos;dark matter\u0026apos; requiring illumination. Genes Dev. 30(14), 1598-610. https://doi.org/10.1101/gad.283838.116.32. \u003c/li\u003e\n\u003cli\u003eKatoh H., Harada A., Mori K., Negishi M. (2002) Socius is a novel Rnd GTPase-interacting protein involved in disassembly of actin stress fibers. Mol Cell Biol. 22(9), 2952-64. https://doi.org/10.1128/MCB.22.9.2952-2964.\u003c/li\u003e\n\u003cli\u003eAnholt R.R.H., O\u0026apos;Grady P., Wolfner M.F., Harbison S.T. (2020). Evolution of Reproductive Behavior. Genetics. 214(1), 49-73. https://doi.org/doi: 10.1534/genetics.119.302263.34. \u003c/li\u003e\n\u003cli\u003eHerranz R., Mateos J., Mas J.A., Garc\u0026iacute;a-Zaragoza E., Cervera M., Marco R. (2005). The coevolution of insect muscle TpnT and TpnI gene isoforms. Mol Biol Evol. 22(11), 2231-42. https://doi.org/10.1093/molbev/msi223. \u003c/li\u003e\n\u003cli\u003eNijhout H.F., Callier V. (2015). Developmental mechanisms of body size and wing-body scaling in insects. Annu Rev Entomol. 60,141-56. https://doi.org/10.1146/annurev-ento-010814-020841. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Uroleucon gobonis (Matsumura), instar identification, morphological indicators, genes","lastPublishedDoi":"10.21203/rs.3.rs-9025299/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9025299/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAccurately identifying pest developmental stages is a key prerequisite for developing efficient prevention and control strategies. This study integrated morphometric and molecular biology techniques to establish a multi-dimensional instar identification system for the safflower aphid. The method first systematically evaluated the identification efficiency of eight morphological indicators of \u003cem\u003eUroleucon gobonis \u003c/em\u003e(Matsumura) (\u003cem\u003eU. gobonis\u003c/em\u003e), and found that the body length can effectively distinguish the aphids from the first instar (1st instar) to the fourth instar (4th instar), abdominal tube length can distinguish the third instar (3rd instar) and later instar, and antennal length can clearly distinguish between the second instar (2nd instar) and 3rd instar, and between the 3rd and 4th instars; the other five indicators show overlap. To overcome the inherent limitations of traditional morphological identification methods, this study analyzed the five developmental stages of \u003cem\u003eU. gobonis\u003c/em\u003eusing six candidate genes identified from transcriptome data. The expression level of DN1098 peaked at the 3rd instar aphid stage; DN136 showed the highest expression at the adult stage; DN1031, DN1019, and DN1093 were highly expressed at the 1st instar aphid stage; and DN1068 remained highly expressed from the 2nd to the 4th instar aphid stages. The multi-gene expression “fingerprint” identification system, constructed based on these characteristics, can accurately distinguish all target developmental stages. For the first time, this study provides a comprehensive instar identification framework for \u003cem\u003eU. gobonis\u003c/em\u003e, spanning rapid preliminary morphological screening to precise molecular confirmation, thereby providing important technical support for population monitoring.\u003c/p\u003e","manuscriptTitle":"An Integrated Morphometric-Molecular Framework for High-Fidelity Instar Identification in the Safflower Aphid Uroleucon gobonis (Matsumura)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-31 18:04:15","doi":"10.21203/rs.3.rs-9025299/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2026-05-16T12:04:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"217428937905897695078998348849704863193","date":"2026-05-07T08:44:50+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-11T08:59:06+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"336823631030641127417922760848994518107","date":"2026-03-31T23:12:25+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"116129093779713497928700815769783482745","date":"2026-03-28T17:33:06+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"63737097410118832091014192113923612269","date":"2026-03-26T17:32:24+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-26T17:29:51+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-26T13:36:51+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-03-19T10:50:06+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-18T18:10:49+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2026-03-13T07:23:18+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"01714fb0-afa6-479c-95bf-4c348aa56821","owner":[],"postedDate":"March 31st, 2026","published":true,"recentEditorialEvents":[{"type":"editorInvitedReview","content":"","date":"2026-05-16T12:04:20+00:00","index":87,"fulltext":""},{"type":"reviewerAgreed","content":"217428937905897695078998348849704863193","date":"2026-05-07T08:44:50+00:00","index":83,"fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":65319377,"name":"Biological sciences/Molecular biology"},{"id":65319378,"name":"Biological sciences/Plant sciences"},{"id":65319379,"name":"Biological sciences/Zoology"}],"tags":[],"updatedAt":"2026-03-31T18:04:16+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-31 18:04:15","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9025299","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9025299","identity":"rs-9025299","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00