The circYTHDF2-miR-146a-5p-PRSS1 Axis Mediates the JAK2-STAT3 Pathway to Promote Gastric Cancer Progression

The circYTHDF2-miR-146a-5p-PRSS1 Axis Mediates the JAK2-STAT3 Pathway to Promote Gastric Cancer Progression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The circYTHDF2-miR-146a-5p-PRSS1 Axis Mediates the JAK2-STAT3 Pathway to Promote Gastric Cancer Progression Zixin Wan, Yuyu Wang, Yuwei Li, Xuemei Zeng, Yue Qiu, Fen Tang, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8689738/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background : Gastric cancer (GC) is a malignant tumor that poses a serious threat to human life and health.PRSS1 is a differentially expressed protein in gastric cancer identified by our research group in previous studies; however, the mechanism underlying its role in the initiation and progression of gastric cancer remains unclear. Recent studies have shown that circular RNAs (circRNAs) play an important role in the progression of a variety of cancers. Methods : Immunohistochemical staining and Enzyme-Linked Immunosorbent Assay (ELISA) were used to detect the expression of PRSS1 in gastric cancer tissues, and to investigate its biological functions. Through methods including bioinformatics analysis, RNA sequencing (RNA-seq), dual-luciferase reporter gene assay, RNA immunoprecipitation (RIP), and rescue experiment, the upstream regulatory mechanism of PRSS1 was investigated. Results : Taken together, we found that PRSS1 has potential diagnostic, prognostic, and therapeutic values in cancer. Herein, we demonstrate that the PRSS1 protein is highly expressed in gastric cancer tissues and sera, and that its expression in tissues is associated with the degree of gastric cancer differentiation. Furthermore, circYTHDF2 is upregulated and was shown to positively regulate the expression of PRSS1 by sponging miR-146a-5p. Fundamentally, PRSS1 affects the proliferation, invasion, and metastasis of GC cells by activating the JAK2/STAT3 pathway. Our findings suggest that the circYTHDF2/miR-146a-5p/PRSS1 axis is involved in the proliferation, invasion, and metastasis of gastric cancer via the JAK2/STAT3 signaling pathway, and may serve as a molecular target for the early diagnosis and prognosis of gastric cancer. Conclusion : Our findings suggest that the circYTHDF2/miR-146a-5p/PRSS1 axis is involved in the malignant biological behaviors of gastric cancer via the JAK2/STAT3 signaling pathway, and may serve as a molecular target for the early diagnosis and prognosis of gastric cancer. gastric cancer circYTHDF2 miR-146a-5p PRSS1 JAK2/STAT3 signaling pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction GC is one of the most common malignant tumors globally, with over 1 million new cases diagnosed annually. Its incidence rate ranks fifth worldwide, while its mortality rate ranks fourth 1 , 2 . In some developing regions, the number of newly diagnosed cases and deaths is increasing rapidly each year. Therefore, there is an urgent need for early prevention and screening strategies for GC. Academic Terminology & Expression Specifications 3 . The PRSS1 gene is localized to the 7q34 region of chromosome, and its structure consists of four introns and five exons. The PRSS1 protein consists of 247 amino acid residues and is associated with the T cell receptor β (TCRβ) locus 4 , 5 . The PRSS1 protein is significantly upregulated in pancreatic cancer 6 、colorectal cancer 7 and cervical cancer 8 . It plays a crucial role in the initiation and progression of tumors and may be involved in the growth, proliferation, invasion, and metastasis of tumor cells 9 . Although PRSS1 is involved in the initiation and progression of various gastrointestinal diseases and cancers, its mechanism of action in the initiation and progression of gastric cancer currently remains unclear. CircRNAs are covalently closed circular RNAs generated through back-splicing of long non-coding RNAs (lncRNAs), and are regulated by specific cis-acting elements and trans-acting factors 10 . Numerous studies have reported the diverse biological functions of circRNAs, such as their ability to form complexes with RNA-binding proteins (RBPs), regulate the transcription and splicing of target genes, and function as sponges for microRNAs (miRNAs) 11 . In human cancers, circRNAs can pervasively alter tumor progression through post-transcriptional regulation. 12 . Abnormal circRNA levels have been found to be associated with a variety of cancers, including hepatocellular carcinoma, gastric cancer, oral squamous cell carcinoma, lung adenocarcinoma, and colorectal cancer, among others. 13 . The circular structure of circRNAs endows them with a longer half-life compared to linear RNAs, as well as greater resistance to RNase R. This characteristic renders them potential candidates for diagnostic biomarkers and molecular therapeutic targets 14 . Preliminary work by our research group has confirmed that miR-146a-5p targets and binds to the 3' UTR region of PRSS1, and relevant experiments have confirmed that miR-146a-5p inhibits the proliferative capacity of human gastric cancer cells. After transfection with miR-146a-5p mimics, the expression of PRSS1 is downregulated, and the activation of the JAK2/STAT3 pathway is affected 9 . On this basis, we found that PRSS1 is significantly overexpressed in gastric cancer tissues and sera, and its expression in gastric cancer tissues is positively correlated with the degree of gastric cancer differentiation. More importantly, we found that circYTHDF2 mediates the miR-146a-5p/PRSS1 axis via the Competing Endogenous RNA (ceRNA) mechanism, promoting the phosphorylation of JAK2/STAT3 proteins and thereby facilitating the proliferation of gastric cancer cells. This study will preliminarily clarify the regulatory mechanism of the circRNA-miRNA-PRSS1 axis on the proliferation, migration, and invasion of gastric cancer cells, and provide new experimental data and evidence for the identification of new gastric cancer biomarkers. Materials and Methods Clinical Samples Serum samples were collected from 60 patients who underwent gastric cancer surgery (preoperative) and 32 healthy individuals for ELISA detection. Furthermore, this study also collected 60 cases of paraffin-embedded specimens, including gastric cancer specimens and paracancerous normal specimens. Written informed consent was obtained from all subjects and/or their legal guardian(s). All specimens were pathologically confirmed by the Department of Pathology, the First Affiliated Hospital of University of South China. All specimens were subjected to immunohistochemical staining, and the use of these specimens (from GC patients) was approved by the Medical Ethics Committee. Cell Lines and Cell Culture GC cell lines (SGC7901, BGC823, MGC803) and the immortalized gastric epithelial cell line (GES-1) were provided by the Cancer Research Institute of University of South China. Cells were cultured in RPMI 1640 medium (HyClone) supplemented with 10% fetal bovine serum (FBS, HyClone) or serum-free keratinocyte medium (K-SFM, Gibco, Thermo Fisher Scientific, Waltham, MA, USA) at 37°C in a cell incubator with 5% CO₂. Western Blot Analysis Proteins were extracted in RIPA lysis buffer (P0013B, Beyotime). Proteins were separated on sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) and then transferred onto polyvinylidene fluoride (PVDF) membrane. he membrane was blocked with QuickBlock™ Blocking Buffer for Western Blot (P0252, Beyotime, Shanghai, China) for 10 min, and then incubated with primary antibodies overnight, including anti-PRSS1 monoclonal antibody (ab200996, Abcam), anti-STAT3 monoclonal antibody (ab68153, Abcam), anti-STAT3 (phospho Y705) monoclonal antibody (ab76315, Abcam), anti-JAK2 monoclonal antibody (ab108596, Abcam), anti-JAK2 (phospho Y1007 + Y1008) monoclonal antibody (ab32101, Abcam), anti-Vimentin monoclonal antibody (5741T, CST), anti-N-cadherin monoclonal antibody (13116T, CST), anti-E-cadherin monoclonal antibody (3195T, CST), anti-PCNA monoclonal antibody (60097-1-Ig, Proteintech), and anti-β-actin monoclonal antibody (7D2C10, Proteintech). Then, fluorescent secondary antibodies (1:5000, Santa Cruz Biotechnology) were added to the membrane and incubated for 2 hours. The blots were detected via chemiluminescence, and images of protein bands were acquired using a gel imaging analysis system (ODYSSEY Sa, LI-COR, USA). Quantification of individual protein bands was assessed via densitometry using ImageJ software. Quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR) Total RNA was isolated from cells using TRIzol reagent (Invitrogen, USA) according to the manufacturer's protocol. Complementary DNA (cDNA) was synthesized using the All-in-One™ First-Strand cDNA miRNA Synthesis Kit (QP013, GeneCopoeia, USA). RT-PCR was performed using the All-in-One™ miRNA qRT-PCR Kit (QP015, GeneCopoeia, Rockville, MD, USA) and BeyoFast™ SYBR Green qRT-PCR Detection Kit (Beyotime Biotechnology, Shanghai, China). Primers were purchased from Tsingke Biotechnology, Beijing, China. Immunohistochemistry (IHC) All tissue samples were fixed in neutral buffered formalin, paraffin-embedded, and then sectioned. For the routine group, sections were cut into 3-4 μm thickness. After incubation with 0.3% hydrogen peroxide in PBS for 30 minutes and blocking with 10% bovine serum albumin (BSA), the sections were incubated overnight at 4°C in a humidified chamber with primary antibodies against PRSS1 and Ki-67. Following development with HRP-conjugated secondary antibodies, sections were scored as follows: strong staining (1 point, high expression) or weak staining (0 points, low expression). For the gastric cancer tissue microarray group, sections were cut into 4 μm thickness, baked in an oven at 75°C for 2 hours, and processed according to the kit instructions (KIT9902/KIT9720). The sections were incubated overnight at 4°C with primary antibodies against PRSS1 (1:50 dilution) and Ki-67. After DAB development, the total score was calculated as the product of staining intensity (0-3 points) and percentage of positive cells (1-4 points). Samples were classified as negative (-), weakly positive (+), moderately positive (++), or strongly positive (+++). Enzyme-Linked Immunosorbent Assay (ELISA) The experiment was performed using the PRSS1 ELISA kit from Boyan Biotechnology. Serum samples were obtained from preoperative gastric cancer patients, postoperative gastric cancer patients, and healthy control subjects, with fasting blood from each cohort collected in the morning using non-anticoagulant tubes. The samples were allowed to clot at room temperature for 30 minutes, then centrifuged at 2000×g for 10 minutes at 4°C. The supernatant was aliquoted and stored at -80°C. Before the experiment, the kit was equilibrated to room temperature for more than 1 hour, and serum samples were thawed on ice. Concentrated eluent was reconstituted at 37°C and then diluted at a ratio of 1:20. Substrates A and B were mixed in equal volumes and used within 15 minutes. For the microplate, standard curve wells (PRSS1 at 3.125-100 ng/mL), blank wells, and sample wells in triplicate were set up. After adding 50 μL to each well, 100 μL of HRP-conjugated secondary antibody was added. The plate was incubated at 37°C for 1 hour, protected from light. Following five washing cycles, 100 μL of substrate was added for color development for 15 minutes. Then 50 μL of stop solution was added, and the optical density (OD) at 450 nm was measured. Protein concentrations were calculated using ELISA Calc software with a 4-parameter logistic (4-PL) model. CCK-8 Assay Cells were seeded into 96-well plates at a density of 2×10³ cells per well. The number of viable cells was measured every 24 hours according to the manufacturer's instructions (Molecular Probes, Eugene, OR, USA). This experiment was required to be independently repeated three times. Optical density (OD) values were measured at 450 nm using a microplate reader (17260, BIO-RAD, USA). Colony Formation Assay Cells were seeded into 6-well plates at a density of 1×10³ cells per well and cultured for 2 weeks. Colonies were fixed with methanol for 25 min, and then stained with 0.4% crystal violet (E607309, BBI, Shanghai, China) at room temperature for 30 min. The number of cell colonies was counted and analyzed under a microscope (TS100, Nikon, Japan). Scratch Assay Wound Healing Assay Cells were seeded into 6-well plates at a density of 5×10⁵ cells/well. When the cells grew to form a uniformly confluent monolayer covering the entire well, a single wound was created at the center of the cell monolayer using a 1000 μL pipette tip. Subsequently, phosphate-buffered saline (PBS) was used for washing to remove cell debris. After incubation in serum-free medium (SFM) for 4, 8, 24, and 48 hours, the wound closure areas were observed and imaged under an inverted microscope. This experiment should be independently repeated three times. Transwell Assay The cell density of the cell suspension was adjusted to 1×10⁶ cells/mL using serum-free RPMI-1640 medium. 100 μL of the cell suspension was aspirated into the upper chamber. The lower chamber of the Transwell was filled with 500 μL of DMEM containing 20% FBS, which served as a chemoattractant. After 18 hours of incubation, the cells on the surface of the upper chamber were scraped off using cotton swabs. After the chamber was washed three times in PBS buffer, it was inverted and placed on filter paper to air-dry slightly. Subsequently, the chamber was fixed in 4% paraformaldehyde (PFA) for 30 minutes, stained with 0.1% crystal violet, imaged, and quantification was performed by counting the cells in five random fields. This experiment should be independently repeated three times. Agarose Gel Electrophoresis Assay Agarose gels were prepared using 1× TAE electrophoresis buffer, with an appropriate concentration selected as needed (e.g., 1%). After heating until the agarose was completely dissolved, the solution was poured into the electrophoresis tank and allowed to stand for solidification. On a laminar flow hood, samples were taken, loading buffer was added, and the mixture was mixed thoroughly, after which it was carefully loaded into the loading wells. After electrophoresis, the gel was immersed in a staining solution for staining. Following rinsing, the gel was observed for results on a UV transilluminator. Dactinomycin Assay Cells were exposed to Actinomycin D (Sigma) at a concentration of 2 mg/mL for transcriptional inhibition. qRT-PCR was used to analyze the expression levels of circRNAs and their parental genes. The 2–ΔCT method was used to calculate the relative expression levels of gene abundance, with the group untreated with Actinomycin D (0 h) serving as the internal control. Dual-Luciferase Reporter Gene Assay The psiCHECK-2-circ0011164-WT and psiCHECK-2-circ0011164-MUT vectors, which contain the wild-type (WT) and mutant (MUT) sequences of circYTHDF2, respectively, were purchased from Changsha ABW Biology. HEK 293T cells were seeded into 24-well plates, and the aforementioned vectors were co-transfected with miR-146a-5p mimics or negative control (NC) using Lipofectamine™ 2000. Forty-eight hours after transfection, the activity was detected using the Dual-Luciferase Reporter Gene System, and the results were expressed as relative fold normalized to Renilla luciferase. RNA Immunoprecipitation Assay (RIP) 2×10⁷ cells were collected. After washing with PBS and centrifugation, 1.7 mL of polysome lysis buffer was added to the pellet, along with 17 μL of protease inhibitors and RNase inhibitors. The mixture was incubated on ice for 20 minutes and vortexed to mix thoroughly. Then, 8.5 μL of DNase salt solution and 20 μL of DNase (20 U) were added, followed by treatment at 37°C for 10 minutes to digest DNA. Subsequently, 9 μL of 0.5 M EDTA, 3.6 μL of 0.5 M EGTA, and 17 μL of DTT were added, and the mixture was centrifuged at 16,100 × g for 10 minutes at 4°C. The supernatant was divided equally into three aliquots: 0.8 mL for the IP group, 0.8 mL for the IgG group, and 0.1 mL for the Input group. The Input group was stored frozen at -80°C. The IP group and IgG group were added with AGO2 antibody and IgG antibody, respectively, and incubated with vertical mixing at 4°C overnight. Meanwhile, 40 μL of protein A/G magnetic beads were washed and equilibrated with 0.5 mL of lysis buffer. After that, 20 μL of the equilibrated bead mixture was added to each of the IP group and the IgG group, followed by continuous incubation at 4°C overnight. Once the magnetic beads were collected, they were washed three times with Wash Buffer 1 and Wash Buffer 2 (both containing DTT), respectively. Finally, 1 mL of Trizol was added to each of the three groups of samples for lysis. RNA was extracted via chloroform extraction and ethanol precipitation, then dissolved in 30 μL of nuclease-free water, followed by reverse transcription and qRT-PCR analysis. Data availability statements The data that support the findings of this study are available from the corresponding author upon reasonable request. Results Clinical Significance of PRSS1 Expression in Gastric Cancer Tissues and Serum Previously, our research group identified that PRSS1 might be a potential marker for early diagnosis and prognosis of GC through the following procedures: first, tissues were purified using laser capture microdissection (LCM) technology, and then isotope-labeled quantitative proteomics technology was applied 9 . To investigate the correlation between PRSS1 and GC, we performed IHC, ELISA, Western blot, and qPCR. Next, we detected the expression of PRSS1 protein in 72 cases of gastric cancer tissues via immunohistochemical staining. The results showed that PRSS1 protein was expressed in the cytoplasm after staining. Compared with paired adjacent non-cancerous mucosa, PRSS1 protein was highly expressed in gastric adenocarcinoma tissues (Fig. 1A-D). Furthermore, the expression intensity decreased as the degree of tumor differentiation decreased (Table 1). ELISA detection combined with clinicopathological analysis showed that the concentration of PRSS1 in peripheral blood of the preoperative gastric cancer group was statistically significantly higher than that of the healthy control group. There was no significant difference in PRSS1 between the postoperative gastric cancer group and the healthy control group (Fig. 1E). In addition, the serum PRSS1 expression level was correlated with multiple clinical indicators: it was significantly correlated with patient age (higher in patients aged ≥60 years), TNM staging (higher in stages Ⅲ-Ⅳ than in stages Ⅰ-Ⅱ), and tumor size (higher in tumors with a size of ≥5 cm) (P<0.01). However, it showed no significant correlation with gender, histological grade, or lymph node metastasis (Table 2). Then, we found that PRSS1 was expressed at a higher level in GC (gastric cancer) cell lines (MGC803, BGC823, and SGC7901) than in immortalized gastric mucosal epithelial cells (GES-1 cells, Fig. 1F-G). Table 1 Statistical Analysis of PRSS1 Protein Expression in Gastric Cancer Tissues Tissue Type Number of cases (n) Immunohistochemistry(IHC) Results (n) PRSS1 Positive Rate （%） χ 2 P-value Negative （－） Weakly Positive （+） Moderately Positive （++） Strongly Positive （+++） Peritumoral Gastric Mucosa Tissues 72 65 7 - - 9.72% Well-differentiated Adenocarcinoma Tissues 4 2 1 1 - 50.00% 3.821 0.051 Moderately-differentiated Adenocarcinoma Tissues 21 6 13 2 - 71.43% *** 30.946 0.000 Poorly-differentiated Adenocarcinoma Tissues 47 5 35 7 - 89.36% *** 74.463 0.000 Compared with peritumoral gastric mucosa tissues, *** P ＜0.001. Table 2 Analysis of the Relationship Between Serum PRSS1 Protein Expression and Clinicopathological Parameters Item Groups Serum PRSS1 Concentration （ng/mL） t -value P -value Sex Male 42.95±17.69 -0.370 0.713 Female 45.31±26.46 Age ≥60 years 49.61±25.79 2.927 0.005 ** ＜60 years 34.54±11.92 TNM Staging Ⅰ-Ⅱ 34.59±9.25 -3.036 0.004 ** Ⅲ-Ⅳ 49.58±26.38 Tumor Size ≥5 57.39±30.18 2.901 0.005 ** <5 38.79±16.77 Histological Grade Well-Moderately-differentiated 38.98±13.77 1.369 0.177 Poorly-differentiated 47.69±26.92 Lymph Node Metastasis Positive 47.23±25.93 1.338 0.187 Negative 37.72±8.79 The Effect of PRSS1 on the Biological Behaviors of Gastric Cancer Cells To clarify which functions of GC cells are mediated by PRSS1, we selected the MGC803 and BGC823 cell lines with relatively high PRSS1 expression levels for PRSS1 knockdown, and verified the knockdown efficiency by WB (Western Blot) (Figure 2A). To verify the effect of PRSS1 on cell proliferation, we performed CCK8 (Cell Counting Kit-8), colony formation, and WB assays to detect the expression of proliferation-related factors. CCK8 assays showed that the proliferation rate of cells with low PRSS1 expression was significantly lower than that of the Control group and the negative control group (Figure 2B); Colony formation assays confirmed that the colony formation rate in the low PRSS1 expression group was significantly decreased (Figure 2C); Western blot assays revealed that the expression level of the proliferation-related protein PCNA was significantly downregulated in the low PRSS1 expression group, suggesting that PRSS1 may affect cell proliferation (Figure 2D). To verify the effect of PRSS1 on the invasion, migration, and EMT (Epithelial-Mesenchymal Transition) processes of gastric cancer cells. The following experiments were performed. Wound healing assays showed that the migration distance of the siPRSS1 group was significantly shorter than that of the Control group (Fig. 2E); Transwell assays confirmed that the number of migrating and invading cells in the low PRSS1 expression group was significantly reduced (Fig. 2F). Furthermore, low PRSS1 expression could also affect the expression of epithelial-mesenchymal transition (EMT)-related proteins, leading to decreased expression of mesenchymal markers N-cadherin and Vimentin, and increased expression of epithelial marker E-cadherin (Fig. 2G). These results indicate that the ability of MGC803 and BGC823 cells to undergo EMT is impaired after low PRSS1 expression. These results indicate that PRSS1 promotes the progression of GC by enhancing cancer cell proliferation, migration, and invasion. Mechanism of Action by Which PRSS1 Promotes Gastric Cancer Cell Migration and Invasion Western blot was used to detect the effect of PRSS1 downregulation on the JAK2/STAT3 pathway. The results showed that in MGC803 and BGC823 cells, JAK2 and STAT3 exhibited no significant changes following PRSS1 downregulation. Whereas the protein levels of p-JAK2 and p-STAT3 were decreased (Fig. 3). The results suggest that PRSS1 may induce the migration and invasion of MGC803 and BGC823 cells directly or indirectly by regulating the JAK2/STAT3 pathway. Western blot analysis of JAK2/STAT3 pathway components (p-JAK2, JAK2, p-STAT3, STAT3) in MGC803 and BGC823 gastric cancer cells following PRSS1 knockdown. GAPDH/β-actin served as loading control. Densitometric quantification (right panels) shows significant reduction in phosphorylated protein levels upon PRSS1 depletion (n = 3 independent experiments). Expression Regulation of PRSS1 in Gastric Cancer and Its Mechanism (1).Identification of CircYTHDF2 that Regulates the Expression of PRSS1 Based on the previous finding that miR-146a-5p targets PRSS1 to inhibit the growth of gastric cancer cells,， 9 in this study, through prediction using StarBase combined with circRNAs (Table 3), and further combined with circRNA microarray data (Fig. 4.1A) followed by Venn diagram analysis, circYTHDF2 that may bind to miR-146a-5p was screened out (Fig. 4.1B) Sanger sequencing results showed that circYTHDF2 is derived from the back-splicing of exons 5-6 of the YTHDF2 gene, forming a closed circular structure, and its junction sequence is "CCTGTTGAGCATCACTTTCCA" (Fig. 4.1C). Divergent primer PCR and agarose gel electrophoresis confirmed that specific bands of circYTHDF2 could be amplified in cDNA, whereas no amplification was observed in genomic DNA (gDNA), thus validating its circular structure (Fig. 4.1D). qPCR showed that the expression of circYTHDF2 in MGC803 and BGC823 cells was significantly higher than that in GES-1 cells (Fig. 4.1F). Actinomycin D assay confirmed that the half-life of circYTHDF2 (>24 h) was significantly longer than that of its linear parental gene YTHDF2 (<8 h), suggesting that it has high stability (Fig. 4.1F). Table 3 Differentially Expressed circRNAs in circRNA Microarray circRNA P-value FC (abs) RegμLation chrom GeneSymbol hsa_circRNA_060539 0.007553 1.588604 up chr20 SDC4 hsa_circRNA_101996 0.019948 1.696884 up chr 17 SPECC1 hsa_circRNA_407172 0.016356 1.526703 up chr9 RP11-182N22.7 hsa_circRNA_100018 0.012323 1.619288 up chr1 GNB1 hsa_circRNA_100491 0.01481 1.550904 up chr1 PCNXL2 hsa_circRNA_101695 0.007567 1.570053 up chr16 NAGPA hsa_circRNA_053294 0.034851 1.548787 up chr2 ZNF512 … … … … … … hsa_circRNA_011164 0.031566 1.791049 up chr1 YTHDF2 hsa_circRNA_001586 0.031858 1.77983 up chr6 HISTIH3D (2).Targeted Binding of CircYTHDF2 to miR-146a-5p To clarify the interaction between circYTHDF2 and miR-146a-5p, we performed dual-luciferase reporter assay and RNA immunoprecipitation (RIP) assay. The dual-luciferase reporter gene assay showed that after co-transfection of the circYTHDF2 wild-type vector with miR-146a-5p mimics, luciferase activity was significantly decreased, while the mutant vector exhibited no significant changes, confirming that circYTHDF2 can directly bind to miR-146a-5p (Fig. 4.2A). RIP assay further demonstrated that circYTHDF2 could be significantly enriched by the AGO2 antibody (Fig. 4.2B). Next, to clarify the interaction between circYTHDF2 and PRSS1, we performed knockdown and overexpression of circYTHDF2 in MGC803 and BGC823 cell lines, and verified the knockdown efficiency by qPCR (Fig. 4.2C-D). Western blot analysis showed that after knockdown of circYTHDF2, the protein expression of PRSS1 decreased, while its overexpression led to an increase in PRSS1 protein expression (Fig. 4.2E-F); rescue experiments demonstrated that miR-146a-5p inhibitor could reverse the downregulation of PRSS1 induced by circYTHDF2 knockdown (Fig. 4.2G). Taken together, these results suggest that circYTHDF2 may act as a ceRNA for miR-146a-5p, and regulate the expression of PRSS1 by binding to miR-146a-5p. Effect of the CircYTHDF2-miR-146a-5p-PRSS1 Axis on the Biological Behaviors of Gastric Cancer Cells To investigate the functional role of CircYTHDF2 in GC (gastric cancer) cells, we performed gain-of-function and loss-of-function experiments. CCK-8 and colony formation assays showed that knockdown of circYTHDF2 could significantly inhibit cell proliferation (Fig. 5A-B), while its overexpression promoted cell proliferation (Fig. 5C-D); rescue experiments confirmed that co-transfection of si-circYTHDF2 and miR-146a-5p inhibitor could partially reverse the proliferation-inhibiting effect (Fig. 5E-F). Regarding cell migration and invasion, wound healing and Transwell assays showed that knockdown of circYTHDF2 could significantly reduce the migration distance and the number of migrating and invading cells (Fig. 5G-H), while its overexpression exerted the opposite effect (Fig. 5I-J), and this effect could be reversed by the miR-146a-5p inhibitor (Fig. 5K-L). Collectively, these results reveal a novel mechanism by which circYTHDF2 directly binds to miR-146a-5p and promotes gastric cancer cell proliferation, invasion, and metastasis by upregulating the expression of PRSS1. With the development of high-throughput sequencing technology, an increasing number of circRNAs have been identifie 15 . As a novel gene regulatory factor, circRNA exerts its functions at the transcriptional or post-transcriptional level, regulating downstream factors 16 . CircRNAs are abundant in eukaryotes and play a key role in regulating genes 17 , miRNAs, and modulating the processes involved in pathological conditions. Emerging research has identified dysregulated circRNAs in gastric, colorectal, and liver cancers that play active roles in tumor initiation and progression 18,19 . C ircRNAs are a class of non-coding RNAs (ncRNAs) formed through back-splicing of linear RNAs and covalent circularization. 20,21 .Due to their covalently closed circular structure, circRNAs are more stable than their linear counterparts, and thus are abundant in plasma, cell-free saliva, and even circulating exosomes, which may predict the onset of cancer and other diseases 22 . CircRNAs function as molecular sponges through their multiple miRNA binding sites, regulating target gene expression via the circRNA-miRNA-mRNA network to play critical roles in tumorigenesis and malignant progression 17 . PRSS1 plays an important role in the hydrolysis of the extracellular matrix (ECM), the metabolism of water-soluble vitamins and coenzymes, and the collagen synthesis process. Meanwhile, it is also involved in the activation of metalloproteins, exhibits functions similar to the interaction between neuroactive ligands and receptors, and can be secreted into body fluids and excreta 23 . However, the mechanism(s) through which the PRSS1 protein is involved in GC progression remains unclear to date. However, we employed IHC and ELISA techniques to detect the expression levels of PRSS1 in GC tissues and serum samples. The results showed that PRSS1 exhibited high expression in both GC tissues and serum. It was significantly correlated with the age of GC patients, TNM stage, and tumor size. In tumor tissues, it was also found that the expression level of PRSS1 was positively correlated with the degree of tumor differentiation. It was found that the overexpression of PRSS1 promoted cell proliferation, migration, and invasion, while the opposite results were obtained when the expression of PRSS1 was knocked down. Therefore, PRSS1 may play an oncogenic role in GC and be involved in the progression of GC. However, the potential mechanisms by which PRSS1 affects GC remain poorly understood. It has been reported that since their discovery, miRNAs are involved in a variety of biological functions and pathological processes, including cancer 24 . It has been found that miR-146a-5p functions as a tumor-suppressive miRNA in certain cancers, 25 ，while it functions as an oncogenic miRNA in other cancers 25 .It is significantly upregulated in a variety of cancer type，such as colorectal cancer 26 、breast cancer 27 among others. It has been demonstrated in experiments that miR-146a-5p can be detected in human body fluids, and its concentration typically differs in the body fluids of cancer patients compared with those of healthy individuals. These levels sometimes even depend on cancer subtypes and metastatic status, which indicates that miR-146a-5p may potentially be used as a non-invasive biomarker in the future 28 . The research group previously found that miR-146a-5p targets PRSS1 and inhibits the growth and proliferation of GC cells 9 . MiR-146a-5p serves as a crucial factor in the tumorigenesis and progression of a variety of tumors, and deserves to be a key research focus in combating cancer. To further investigate the regulatory mechanism of miR-146a-5p, we screened for the optimal circRNA molecule that binds to miR-146a-5p using high-throughput gene chips, bioinformatics screening of circRNAs, and analysis of circRNA size, binding stability, and binding specificity. The results of the dual-luciferase reporter assay confirmed that miR-146a-5p exhibits a more definite binding relationship with circYTHDF2. RNA immunoprecipitation (RIP) assay demonstrates that circYTHDF2 can regulate miR-146a-5p through an AGO2-dependent ceRNA mechanism. We further verified the targeted regulatory relationship among circYTHDF2, miR-146a-5p, and PRSS1. Results of the rescue phenotype assay showed that miR-146a-5p partially reversed the promoting effect of circYTHDF2 on the migration and invasion abilities of gastric cancer (GC) cells. During a series of cellular activities of cancer cells, ranging from growth and proliferation to apoptosis, invasion, and metastasis, the activities of signaling pathways undergo significant changes 29 . In cancer, common signaling pathways include the P53 signaling pathway 30 、NF-κB signaling pathway, JAK-STAT signaling pathway 31 、Wnt signaling pathway 32 、and mitogen-activated protein kinase (MAPK) pathway 33 . Among these, the activation of the JAK2/STAT3 signaling pathway is involved in tumorigenesis and tumor progression. It contributes to the formation of the tumor inflammatory microenvironment and is closely associated with the tumorigenesis and progression of many human tumors 34 . Signal Transducer and Activator of Transcription 3 (STAT3), serving as a convergence point for numerous oncogenic signaling pathways, plays a central role in regulating anti-tumor immune responses 35 . This study demonstrates that PRSS1 may induce the proliferation, migration, and invasion of MGC803 and BGC823 cells directly or indirectly by regulating the JAK2/STAT3 pathway. However, this study did not further investigate the regulatory relationship between PRSS1 and the JAK2/STAT3 pathway. Further verification is still required through subsequent experiments. Taken together, our study demonstrates that circYTHDF2 promotes the proliferation and migration of GC cells in vitro. Mechanistically, circYTHDF2 increases the expression of PRSS1 by acting as a miR-146a-5p sponge. This study elucidates that the CircYTHDF2-miR-146a-5p-PRSS1 expression axis mediates the regulation of malignant biological behaviors of GC cells via the JAK2/STAT3 pathway, and provides novel candidate targets for the diagnosis and treatment of gastric cancer. Similarly, our data demonstrate that PRSS1 is highly expressed in GC tissues and serum, and it can serve as a potential biomarker for GC diagnosis and combined diagnosis. Abbreviations AGO2: Argonaute 2 Abcam: Abcam (antibody supplier) BBI: BBI Life Sciences (reagent supplier) Beyotime: Beyotime Biotechnology (reagent supplier) BSA: Bovine Serum Albumin Boyan Biotechnology: Boyan Biotechnology (ELISA kit supplier) BIO-RAD: BIO-RAD Laboratories (microplate reader supplier) CST: Cell Signaling Technology cDNA: Complementary DNA ceRNA: Competing Endogenous RNA Changsha ABW Biology: Changsha ABW Biology (vector supplier) circRNA: Circular RNA CCK-8: Cell Counting Kit-8 DAB: Diaminobenzidine DNase: Deoxyribonuclease DTT: Dithiothreitol EDTA: Ethylenediaminetetraacetic Acid EGTA: Ethylene Glycol Tetraacetic Acid ECM: Extracellular Matrix ELISA: Enzyme-Linked Immunosorbent Assay FBS: Fetal Bovine Serum Gibco: Gibco (medium supplier) GC: Gastric Cancer gDNA: Genomic DNA GeneCopoeia: GeneCopoeia (reagent supplier) HRP: Horseradish Peroxidase HyClone: HyClone (medium supplier) IHC: Immunohistochemistry Invitrogen: Invitrogen (reagent supplier) JAK2: Janus Kinase 2 K-SFM: Keratinocyte Serum-Free Medium LI-COR: LI-COR Biosciences (imaging system supplier) LCM: Laser Capture Microdissection lncRNA: Long Non-Coding RNA MAPK: Mitogen-Activated Protein Kinase miR-146a-5p: MicroRNA-146a-5p MUT: Mutant NC: Negative Control NF-κB: Nuclear Factor-Kappa B Nikon: Nikon Corporation (microscope supplier) OD: Optical Density PFA: Paraformaldehyde PCNA: Proliferating Cell Nuclear Antigen PVDF: Polyvinylidene Fluoride PRSS1: Protease, Serine 1 Proteintech: Proteintech (antibody supplier) RBP: RNA-Binding Protein RIP: RNA Immunoprecipitation RNA-seq: RNA Sequencing RNase: Ribonuclease RPMI 1640: Roswell Park Memorial Institute 1640 Medium RIPA: Radio Immunoprecipitation Assay (lysis buffer) Santa Cruz Biotechnology: Santa Cruz Biotechnology (antibody supplier) SDS-PAGE: Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis Sigma: Sigma-Aldrich (reagent supplier) STAT3: Signal Transducer and Activator of Transcription 3 TCRβ: T Cell Receptor β TAE: Tris-Acetate-EDTA (electrophoresis buffer) TNM: Tumor-Node-Metastasis (staging system) Thermo Fisher Scientific: Thermo Fisher Scientific (reagent supplier) Tsingke Biotechnology: Tsingke Biotechnology (primer supplier) WT: Wild-Type 4-PL: 4-Parameter Logistic (model) EMT: Epithelial-Mesenchymal Transition qRT-PCR: Quantitative Reverse Transcription-Polymerase Chain Reaction ACC: Adrenocortical carcinoma Declarations Ethics approval and consent to participate All samples were obtained from patients with GC with approval of the medical ethics committee. We state that our study was performed in accordance with the Declaration of Helsinki. Consent for publication Not applicable Availability of data and materials The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. Competing Interests The authors declare that they have no competing interests. Funding Our work was supported by the National key research and development project (NO.2021YFE0192100),Natural Science Foundation of Hunan Province (NO.2023JJ30529),Hunan Provincial Natural Science Foundation Health Joint Fund(NO.2025JJ81061). Author contributions Co-first author 1 (Zixin Wan):Writing - original draft, Writing - review & editing, Data curation, Formal analysis: Made substantial contributions to study conception, data acquisition, and analysis/interpretation; conceived and designed the study, acquired data, and played a pivotal role in results interpretation; Co-first author 2 (Yuwei Li):Writing - review & editing, Data curation, Methodology: Participated in manuscript drafting and critical revision for important intellectual content; conceived and designed the study, acquired data, and played a pivotal role in results interpretation; Co-first author 3 (Yuyu Wang):Writing - review & editing: Participated in manuscript drafting and critical revision for important intellectual content; conceived and designed the study, acquired data, and played a pivotal role in results interpretation; Second & third authors (Xuemei Zeng, Yue Qiu):Validation, Data curation: Contributed to study conception and played an important role in results interpretation; Fourth author (Fen Tang):Data curation: Approved the final version for publication; contributed to study conception and results interpretation; Fifth author (Zhenghan He):Writing - review & editing: Participated in manuscript drafting and critical revision; Sixth author (Juan Xiao✝):Funding acquisition, Supervision: Accountable for all aspects of the work regarding research integrity; investigated and resolved accuracy-related issues; approved the final version; Corresponding author (Zhiwei Zhang✝):Funding acquisition, Project administration: Accountable for all aspects of the work regarding research integrity; investigated and resolved accuracy-related issues; approved the final version. Précis: The circYTHDF2-miR-146a-5p-PRSS1 axis promotes gastric cancer proliferation via JAK2/STAT3 signaling, representing a potential diagnostic and therapeutic target for GC. Conflict of interest statement： The authors declare no potential conflicts of interest. References Thrift, A. P. & El-Serag, H. B. Burden of Gastric Cancer. Clin Gastroenterol Hepatol 18 , 534–542 (2020). Machlowska, J., Baj, J., Sitarz, M., Maciejewski, R. & Sitarz, R. Gastric Cancer: Epidemiology, Risk Factors, Classification, Genomic Characteristics and Treatment Strategies. Int J Mol Sci 21 , 4012 (2020). Yang, W.-J. et al. Updates on global epidemiology, risk and prognostic factors of gastric cancer. World J Gastroenterol 29 , 2452–2468 (2023). Yi, Q. et al. PRSS1 mutations and the proteinase/antiproteinase imbalance in the pathogenesis of pancreatic cancer. Tumour Biol 37 , 5805–5810 (2016). Rowen, L., Koop, B. F. & Hood, L. The complete 685-kilobase DNA sequence of the human beta T cell receptor locus. Science 272 , 1755–1762 (1996). Liu, Q. et al. PRSS1 mutation: a possible pathomechanism of pancreatic carcinogenesis and pancreatic cancer. Mol Med 25 , 44 (2019). Cabot, D. et al. KRAS phosphorylation regulates cell polarization and tumorigenic properties in colorectal cancer. Oncogene 40 , 5730–5740 (2021). Song, J. Y. et al. Candidates for tumor markers of cervical cancer discovered by proteomic analysis. J Korean Med Sci 27 , 1479–1485 (2012). Ye, D. et al. Silencing PRSS1 suppresses the growth and proliferation of gastric carcinoma cells via the ERK pathway. Int J Biol Sci 17 , 957–971 (2021). Foruzandeh, Z. et al. Circular RNAs as novel biomarkers in triple-negative breast cancer: a systematic review. Mol Biol Rep 49 , 9825–9840 (2022). Zhao, J. et al. CircRNA Expression Profile in Early-Stage Lung Adenocarcinoma Patients. Cell Physiol Biochem 44 , 2138–2146 (2017). Wu, J. et al. Emerging Epigenetic Regulation of Circular RNAs in Human Cancer. Mol Ther Nucleic Acids 16 , 589–596 (2019). Fu, B. et al. Circular RNA circBCBM1 promotes breast cancer brain metastasis by modulating miR-125a/BRD4 axis. Int J Biol Sci 17 , 3104–3117 (2021). Jeck, W. R. & Sharpless, N. E. Detecting and characterizing circular RNAs. Nat Biotechnol 32 , 453–461 (2014). Caiment, F., Gaj, S., Claessen, S. & Kleinjans, J. High-throughput data integration of RNA-miRNA-circRNA reveals novel insights into mechanisms of benzo[a]pyrene-induced carcinogenicity. Nucleic Acids Res 43 , 2525–2534 (2015). Kristensen, L. S. et al. The biogenesis, biology and characterization of circular RNAs. Nat Rev Genet 20 , 675–691 (2019). CircPLK1 upregulates ETS1 to confer anthracycline resistance in triple-negative breast cancer - PubMed. https://pubmed.ncbi.nlm.nih.gov/40896288/. Rajgopal, S., Fredrick, S. J. & Parvathi, V. D. CircRNAs: Insights into Gastric Cancer. Gastrointest Tumors 8 , 159–168 (2021). Yi, J. et al. CircMYBL2 facilitates hepatocellular carcinoma progression by regulating E2F1 expression. Oncol Res 32 , 1129–1139 (2024). Chen, L. et al. The bioinformatics toolbox for circRNA discovery and analysis. Brief Bioinform 22 , 1706–1728 (2021). Zhou, Z. et al. circROBO1 promotes prostate cancer growth and enzalutamide resistance via accelerating glycolysis. J Cancer 14 , 2574–2584 (2023). Arnaiz, E. et al. CircRNAs and cancer: Biomarkers and master regulators. Semin Cancer Biol 58 , 90–99 (2019). Masson, E., Chen, J.-M., Cooper, D. N. & Férec, C. PRSS1 copy number variants and promoter polymorphisms in pancreatitis: common pathogenetic mechanism, different genetic effects. Gut 67 , 592–593 (2018). Chen, L. et al. Trends in the development of miRNA bioinformatics tools. Brief Bioinform 20 , 1836–1852 (2019). Iacona, J. R. & Lutz, C. S. miR-146a-5p: Expression, regulation, and functions in cancer. WIREs RNA 10 , e1533 (2019). Exosomal miR-146a-5p and miR-155-5p promote CXCL12/CXCR7-induced metastasis of colorectal cancer by crosstalk with cancer-associated fibroblasts - PubMed. https://pubmed.ncbi.nlm.nih.gov/35443745/. Cabello, P. et al. miR-146a-5p Promotes Angiogenesis and Confers Trastuzumab Resistance in HER2+ Breast Cancer. Cancers (Basel) 15 , 2138 (2023). Iacona, J. R. & Lutz, C. S. miR-146a-5p: Expression, regulation, and functions in cancer. Wiley Interdiscip Rev RNA 10 , e1533 (2019). Vaghari-Tabari, M. et al. Signaling, metabolism, and cancer: An important relationship for therapeutic intervention. J Cell Physiol 236 , 5512–5532 (2021). Chahat, null, Bhatia, R. & Kumar, B. p53 as a potential target for treatment of cancer: A perspective on recent advancements in small molecules with structural insights and SAR studies. Eur J Med Chem 247 , 115020 (2023). Fan, Y., Mao, R. & Yang, J. NF-κB and STAT3 signaling pathways collaboratively link inflammation to cancer. Protein Cell 4 , 176–185 (2013). Krishnamurthy, N. & Kurzrock, R. Targeting the Wnt/beta-catenin pathway in cancer: Update on effectors and inhibitors. Cancer Treat Rev 62 , 50–60 (2018). Yuan, W. et al. The role of MAPK pathway in gastric cancer: unveiling molecular crosstalk and therapeutic prospects. J Transl Med 22 , 1142 (2024). Huang, B., Lang, X. & Li, X. The role of IL-6/JAK2/STAT3 signaling pathway in cancers. Front Oncol 12 , 1023177 (2022). Zou, S. et al. Targeting STAT3 in Cancer Immunotherapy. Mol Cancer 19 , 145 (2020). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8689738","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":592581791,"identity":"504bea00-8719-4000-9d96-e29e33b3f8a1","order_by":0,"name":"Zixin Wan","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Zixin","middleName":"","lastName":"Wan","suffix":""},{"id":592581792,"identity":"baa6d8fb-f87c-4613-957b-05c089bcbd9c","order_by":1,"name":"Yuyu Wang","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Yuyu","middleName":"","lastName":"Wang","suffix":""},{"id":592581793,"identity":"8d7d360c-904b-42a9-9c7b-0dd70b7ccb54","order_by":2,"name":"Yuwei Li","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Yuwei","middleName":"","lastName":"Li","suffix":""},{"id":592581794,"identity":"754dfbb9-59ac-4bfd-9239-dfacc385e6ef","order_by":3,"name":"Xuemei Zeng","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Xuemei","middleName":"","lastName":"Zeng","suffix":""},{"id":592581795,"identity":"f00e80de-035b-457a-b4ec-bb62008e1f6a","order_by":4,"name":"Yue Qiu","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Yue","middleName":"","lastName":"Qiu","suffix":""},{"id":592581796,"identity":"76e54e0a-7170-48d2-a292-fbabac26f6da","order_by":5,"name":"Fen Tang","email":"","orcid":"","institution":"First Affiliated Hospital of University of South China","correspondingAuthor":false,"prefix":"","firstName":"Fen","middleName":"","lastName":"Tang","suffix":""},{"id":592581797,"identity":"5fa54405-e3c4-41b6-b24c-9a54047c5ebf","order_by":6,"name":"Zhenghan He","email":"","orcid":"","institution":"Southern Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhenghan","middleName":"","lastName":"He","suffix":""},{"id":592581798,"identity":"3e97810b-694c-428c-a7ce-ef9e60eca432","order_by":7,"name":"Juan Xiao","email":"","orcid":"","institution":"Second Affiliated Hospital of University of South China","correspondingAuthor":false,"prefix":"","firstName":"Juan","middleName":"","lastName":"Xiao","suffix":""},{"id":592581799,"identity":"4f027839-4df5-47a1-b6d7-6f7a8695ab49","order_by":8,"name":"Zhiwei Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAmklEQVRIiWNgGAWjYDACCQYDECVHuhZj0rUkNhCtw1y6eZvkjz+H0/uOJzB++JhDhBbLOceKDSR4DufOPPOAWXLmNiK0GNzIMXxgIHE7d8ONBDZmXiK1GBxIMLidbkCKFsMHBxJuJ5CiJa3YsOHAf8OZZx42E+uXZFCIpcnzHU8++OEjMVoQ4AAJUQPTkkCqjlEwCkbBKBgpAAAovTsQL3KFfAAAAABJRU5ErkJggg==","orcid":"","institution":"Cancer Research Institute of Hengyang Medical College, University of South China;","correspondingAuthor":true,"prefix":"","firstName":"Zhiwei","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2026-01-25 02:38:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8689738/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8689738/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":103229009,"identity":"0653b3e7-10be-43d0-822b-5846f726e1e5","added_by":"auto","created_at":"2026-02-23 11:42:11","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":306766,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePRSS1 Expression in Gastric Cancer Tissues and Cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A–D) Immunohistochemical staining of PRSS1 protein in gastric adenocarcinoma tissues:(A) Adjacent non-cancerous gastric mucosa (negative control).(B–D) Gastric adenocarcinoma tissues with varying differentiation status: well-differentiated (B), moderately differentiated (C), and poorly differentiated (D).(A1–D1) Low-magnification (10×) overview; (A2–D2) High-magnification (40×) views of boxed regions.(E) ELISA quantification of PRSS1 protein levels in serum samples from gastric cancer patients (P \u0026lt; 0.01 vs. healthy controls).(F) Western blot (top) and qPCR (bottom) analysis of PRSS1 expression in gastric cancer cell lines. β-actin served as loading controls.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8689738/v1/df70c5d414ac6e9189a48b33.jpeg"},{"id":103229008,"identity":"d1a00129-dded-486e-bddc-ed8ce1d641ef","added_by":"auto","created_at":"2026-02-23 11:42:11","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":185416,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFunctional consequences of PRSS1 knockdown in gastric cancer cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Western blot analysis demonstrating efficient PRSS1 knockdown in gastric cancer cells. GAPDH served as loading control.(B-C) PRSS1 depletion suppresses gastric cancer cell proliferation:(B) Cell proliferation curves (CCK-8/MTS assay) showing growth inhibition after PRSS1 knockdown.(C) Representative images (left) and quantification (right) of colony formation assays.(D) Western blot analysis of proliferation-related proteins following PRSS1 knockdown. β-actin served as loading control.(E-F) PRSS1 knockdown impairs migratory and invasive capacities:(E) Wound healing assay showing reduced migration at 0, 24, and 48h post-wounding(F) Transwell assays demonstrating decreased migration (upper chamber) and invasion (Matrigel-coated, lower chamber)(G) Western blot analysis of epithelial-mesenchymal transition (EMT) markers (E-cadherin, N-cadherin, Vimentin) after PRSS1 knockdown. β-actin served as loading control.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8689738/v1/48d7cbc72b41462b38248b14.jpeg"},{"id":103228939,"identity":"1497746d-81d1-46de-a645-d83027f6e17e","added_by":"auto","created_at":"2026-02-23 11:41:57","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":113995,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePRSS1 knockdown suppresses JAK2/STAT3 signaling pathway in gastric cancer cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWestern blot analysis of JAK2/STAT3 pathway components (p-JAK2, JAK2, p-STAT3, STAT3) in MGC803 and BGC823 gastric cancer cells following PRSS1 knockdown. GAPDH/β-actin served as loading control. Densitometric quantification (right panels) shows significant reduction in phosphorylated protein levels upon PRSS1 depletion (n = 3 independent experiments).\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8689738/v1/6d47d1336329c6b9b897c2a6.jpeg"},{"id":103229013,"identity":"be373487-412a-4745-85e2-b03ca891af37","added_by":"auto","created_at":"2026-02-23 11:42:16","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":199089,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure 4.1. Identification and characterization of circYTHDF2 in gastric cancer cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A)circRNAs predicted to target miR-146a-5p in Starbase database. (B) Venn diagram showing overlapping circRNAs that potentially bind miR-146a-5p from circRNA microarrays and Starbase analysis. (C) Schematic of circYTHDF2 structure, its parental gene (YTHDF2), and Sanger sequencing validation. (D) Agarose gel electrophoresis of PCR products for circYTHDF2, YTHDF2 mRNA, and GAPDH. (E) qRT-PCR analysis of circYTHDF2 expression in human gastric cancer cell lines. (F) qRT-PCR detection of circYTHDF2 and YTHDF2 mRNA levels in gastric cancer cells after Actinomycin D treatment (n = 3 independent experiments).\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8689738/v1/96d26620d635dea6f44cd285.jpeg"},{"id":103228923,"identity":"01536285-21ab-4529-9b95-92229c6620cd","added_by":"auto","created_at":"2026-02-23 11:41:56","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":79509,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure 4.2. Functional validation of circYTHDF2-miR-146a-5p-PRSS1 axis in gastric cancer cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A)Dual-luciferase reporter assay confirming the interaction between miR-146a-5p and circYTHDF. (B) RNA immunoprecipitation (RIP) assay showing significant enrichment of circYTHDF2 by AGO2 antibody. (C-D) qRT-PCR analysis of circYTHDF2 expression in MGC803 and BGC823 cells after knockdown (C) or overexpression (D). (E-F) Western blot analysis of PRSS1 protein levels upon circYTHDF2 knockdown (E) or overexpression (F); GAPDH/β-actin served as loading control. (G) Western blot showing rescued PRSS1 expression after miR-146a-5p inhibition in circYTHDF2-depleted cells (n = 3 independent experiments).\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8689738/v1/d41cfbddb5644d4c7d6bc127.jpeg"},{"id":103228977,"identity":"9bca6c4b-4ad4-442d-836c-8f62592e9b44","added_by":"auto","created_at":"2026-02-23 11:42:07","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":453691,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure 5. Functional effects of circYTHDF2 on gastric cancer cell proliferation, migration, and invasion.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) CCK-8 assay shows inhibited proliferation of GC cells after circYTHDF2 knockdown. (B) Reduced colony formation in MGC803 and BGC823 cells upon circYTHDF2 depletion. (C) CCK-8 assay demonstrates increased proliferation after circYTHDF2 overexpression. (D) Enhanced colony formation in GC cells with circYTHDF2 overexpression. (E-F) Rescue experiments: miR-146a-5p inhibition reverses the suppressive effects of circYTHDF2 knockdown on proliferation (E, CCK-8) and colony formation (F). (G) Wound healing assay reveals reduced migration in circYTHDF2-depleted GC cells. (H) Transwell assay confirms decreased migration and invasion upon circYTHDF2 knockdown. (I-J) circYTHDF2 overexpression promotes migration (I, wound healing) and invasion (J, Transwell) . (K-L) miR-146a-5p downregulation rescues the inhibitory effects of circYTHDF2 knockdown on migration (K) and invasion (L).\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8689738/v1/2f4a28273f9e97d6827c04f9.jpeg"},{"id":103658534,"identity":"5b5b3c1b-5044-4b10-97b9-91dd4801d623","added_by":"auto","created_at":"2026-02-28 15:40:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2553278,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8689738/v1/7ead8a3b-35b4-482e-bace-1ca64a8212ea.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The circYTHDF2-miR-146a-5p-PRSS1 Axis Mediates the JAK2-STAT3 Pathway to Promote Gastric Cancer Progression","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGC is one of the most common malignant tumors globally, with over 1\u0026nbsp;million new cases diagnosed annually. Its incidence rate ranks fifth worldwide, while its mortality rate ranks fourth \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. In some developing regions, the number of newly diagnosed cases and deaths is increasing rapidly each year. Therefore, there is an urgent need for early prevention and screening strategies for GC. Academic Terminology \u0026amp; Expression Specifications \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe PRSS1 gene is localized to the 7q34 region of chromosome, and its structure consists of four introns and five exons. The PRSS1 protein consists of 247 amino acid residues and is associated with the T cell receptor β (TCRβ) locus \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. The PRSS1 protein is significantly upregulated in pancreatic cancer \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e、colorectal cancer \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e and cervical cancer \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. It plays a crucial role in the initiation and progression of tumors and may be involved in the growth, proliferation, invasion, and metastasis of tumor cells \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Although PRSS1 is involved in the initiation and progression of various gastrointestinal diseases and cancers, its mechanism of action in the initiation and progression of gastric cancer currently remains unclear.\u003c/p\u003e \u003cp\u003eCircRNAs are covalently closed circular RNAs generated through back-splicing of long non-coding RNAs (lncRNAs), and are regulated by specific cis-acting elements and trans-acting factors \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Numerous studies have reported the diverse biological functions of circRNAs, such as their ability to form complexes with RNA-binding proteins (RBPs), regulate the transcription and splicing of target genes, and function as sponges for microRNAs (miRNAs) \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. In human cancers, circRNAs can pervasively alter tumor progression through post-transcriptional regulation. \u003csup\u003e12\u003c/sup\u003e. Abnormal circRNA levels have been found to be associated with a variety of cancers, including hepatocellular carcinoma, gastric cancer, oral squamous cell carcinoma, lung adenocarcinoma, and colorectal cancer, among others. \u003csup\u003e13\u003c/sup\u003e. The circular structure of circRNAs endows them with a longer half-life compared to linear RNAs, as well as greater resistance to RNase R. This characteristic renders them potential candidates for diagnostic biomarkers and molecular therapeutic targets \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePreliminary work by our research group has confirmed that miR-146a-5p targets and binds to the 3' UTR region of PRSS1, and relevant experiments have confirmed that miR-146a-5p inhibits the proliferative capacity of human gastric cancer cells. After transfection with miR-146a-5p mimics, the expression of PRSS1 is downregulated, and the activation of the JAK2/STAT3 pathway is affected \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. On this basis, we found that PRSS1 is significantly overexpressed in gastric cancer tissues and sera, and its expression in gastric cancer tissues is positively correlated with the degree of gastric cancer differentiation. More importantly, we found that circYTHDF2 mediates the miR-146a-5p/PRSS1 axis via the Competing Endogenous RNA (ceRNA) mechanism, promoting the phosphorylation of JAK2/STAT3 proteins and thereby facilitating the proliferation of gastric cancer cells. This study will preliminarily clarify the regulatory mechanism of the circRNA-miRNA-PRSS1 axis on the proliferation, migration, and invasion of gastric cancer cells, and provide new experimental data and evidence for the identification of new gastric cancer biomarkers.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eClinical Samples\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSerum samples were collected from 60 patients who underwent gastric cancer surgery (preoperative) and 32 healthy individuals for ELISA detection. Furthermore, this study also collected 60 cases of paraffin-embedded specimens, including gastric cancer specimens and paracancerous normal specimens. Written informed consent was obtained from all subjects and/or their legal guardian(s). All specimens were pathologically confirmed by the Department of Pathology, the First Affiliated Hospital of University of South China. All specimens were subjected to immunohistochemical staining, and the use of these specimens (from GC patients) was approved by the Medical Ethics Committee.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Lines and Cell Culture\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGC cell lines (SGC7901, BGC823, MGC803) and the immortalized gastric epithelial cell line (GES-1) were provided by the Cancer Research Institute of University of South China.\u0026nbsp;Cells were cultured in RPMI 1640 medium (HyClone) supplemented with 10% fetal bovine serum (FBS, HyClone) or serum-free keratinocyte medium (K-SFM, Gibco, Thermo Fisher Scientific, Waltham, MA, USA) at 37\u0026deg;C in a cell incubator with 5% CO₂.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern Blot Analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eProteins were extracted in RIPA lysis buffer (P0013B, Beyotime).\u0026nbsp;Proteins were separated on sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) and then transferred onto polyvinylidene fluoride (PVDF) membrane.\u0026nbsp;he membrane was blocked with QuickBlock\u0026trade; Blocking Buffer for Western Blot (P0252, Beyotime, Shanghai, China) for 10 min, and then incubated with primary antibodies overnight, including anti-PRSS1 monoclonal antibody (ab200996, Abcam), anti-STAT3 monoclonal antibody (ab68153, Abcam), anti-STAT3 (phospho Y705) monoclonal antibody (ab76315, Abcam), anti-JAK2 monoclonal antibody (ab108596, Abcam), anti-JAK2 (phospho Y1007 + Y1008) monoclonal antibody (ab32101, Abcam), anti-Vimentin monoclonal antibody (5741T, CST), anti-N-cadherin monoclonal antibody (13116T, CST), anti-E-cadherin monoclonal antibody (3195T, CST), anti-PCNA monoclonal antibody (60097-1-Ig, Proteintech), and anti-\u0026beta;-actin monoclonal antibody (7D2C10, Proteintech).\u0026nbsp;Then, fluorescent secondary antibodies (1:5000, Santa Cruz Biotechnology) were added to the membrane and incubated for 2 hours. The blots were detected via chemiluminescence, and images of protein bands were acquired using a gel imaging analysis system (ODYSSEY Sa, LI-COR, USA). Quantification of individual protein bands was assessed via densitometry using ImageJ software.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR) \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was isolated from cells using TRIzol reagent (Invitrogen, USA) according to the manufacturer\u0026apos;s protocol.\u0026nbsp;Complementary DNA (cDNA) was synthesized using the All-in-One\u0026trade;\u0026nbsp;First-Strand cDNA miRNA Synthesis Kit (QP013, GeneCopoeia, USA). RT-PCR was performed using the All-in-One\u0026trade;\u0026nbsp;miRNA qRT-PCR Kit (QP015, GeneCopoeia, Rockville, MD, USA) and BeyoFast\u0026trade;\u0026nbsp;SYBR Green qRT-PCR Detection Kit (Beyotime Biotechnology, Shanghai, China). Primers were purchased from Tsingke Biotechnology, Beijing, China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunohistochemistry (IHC)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;All tissue samples were fixed in neutral buffered formalin, paraffin-embedded, and then sectioned. For the routine group, sections were cut into 3-4\u0026nbsp;\u0026mu;m thickness. After incubation with 0.3% hydrogen peroxide in PBS for 30 minutes and blocking with 10% bovine serum albumin (BSA), the sections were incubated overnight at 4\u0026deg;C in a humidified chamber with primary antibodies against PRSS1 and Ki-67. Following development with HRP-conjugated secondary antibodies, sections were scored as follows: strong staining (1 point, high expression) or weak staining (0 points, low expression). For the gastric cancer tissue microarray group, sections were cut into 4\u0026nbsp;\u0026mu;m thickness, baked in an oven at 75\u0026deg;C for 2 hours, and processed according to the kit instructions (KIT9902/KIT9720). The sections were incubated overnight at 4\u0026deg;C with primary antibodies against PRSS1 (1:50 dilution) and Ki-67. After DAB development, the total score was calculated as the product of staining intensity (0-3 points) and percentage of positive cells (1-4 points). Samples were classified as negative (-), weakly positive (+), moderately positive (++), or strongly positive (+++).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEnzyme-Linked Immunosorbent Assay (ELISA)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe experiment was performed using the PRSS1 ELISA kit from Boyan Biotechnology.\u0026nbsp;Serum samples were obtained from preoperative gastric cancer patients, postoperative gastric cancer patients, and healthy control subjects, with fasting blood from each cohort collected in the morning using non-anticoagulant tubes. The samples were allowed to clot at room temperature for 30 minutes, then centrifuged at 2000\u0026times;g for 10 minutes at 4\u0026deg;C. The supernatant was aliquoted and stored at -80\u0026deg;C.\u0026nbsp;Before the experiment, the kit was equilibrated to room temperature for more than 1 hour, and serum samples were thawed on ice. Concentrated eluent was reconstituted at 37\u0026deg;C and then diluted at a ratio of 1:20. Substrates A and B were mixed in equal volumes and used within 15 minutes.\u0026nbsp;For the microplate, standard curve wells (PRSS1 at 3.125-100 ng/mL), blank wells, and sample wells in triplicate were set up. After adding 50\u0026nbsp;\u0026mu;L to each well, 100\u0026nbsp;\u0026mu;L of HRP-conjugated secondary antibody was added. The plate was incubated at 37\u0026deg;C for 1 hour, protected from light. Following five washing cycles, 100\u0026nbsp;\u0026mu;L of substrate was added for color development for 15 minutes. Then 50\u0026nbsp;\u0026mu;L of stop solution was added, and the optical density (OD) at 450 nm was measured. Protein concentrations were calculated using ELISA Calc software with a 4-parameter logistic (4-PL) model.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCCK-8 Assay\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were seeded into 96-well plates at a density of 2\u0026times;10\u0026sup3;\u0026nbsp;cells per well.\u003c/p\u003e\n\u003cp\u003eThe number of viable cells was measured every 24 hours according to the manufacturer\u0026apos;s instructions (Molecular Probes, Eugene, OR, USA). This experiment was required to be independently repeated three times.\u0026nbsp;Optical density (OD) values were measured at 450 nm using a microplate reader (17260, BIO-RAD, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eColony Formation Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were seeded into 6-well plates at a density of 1\u0026times;10\u0026sup3;\u0026nbsp;cells per well and cultured for 2 weeks.\u0026nbsp;Colonies were fixed with methanol for 25 min, and then stained with 0.4% crystal violet (E607309, BBI, Shanghai, China) at room temperature for 30 min.\u0026nbsp;The number of cell colonies was counted and analyzed under a microscope (TS100, Nikon, Japan).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eScratch Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWound Healing Assay Cells were seeded into 6-well plates at a density of 5\u0026times;10⁵ cells/well. When the cells grew to form a uniformly confluent monolayer covering the entire well, a single wound was created at the center of the cell monolayer using a 1000 \u0026mu;L pipette tip. Subsequently, phosphate-buffered saline (PBS) was used for washing to remove cell debris.\u0026nbsp;After incubation in serum-free medium (SFM) for 4, 8, 24, and 48 hours, the wound closure areas were observed and imaged under an inverted microscope. This experiment should be independently repeated three times.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTranswell Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cell density of the cell suspension was adjusted to 1\u0026times;10⁶ cells/mL using serum-free RPMI-1640 medium.\u0026nbsp;100 \u0026mu;L of the cell suspension was aspirated into the upper chamber.\u0026nbsp;The lower chamber of the Transwell was filled with 500 \u0026mu;L of DMEM containing 20% FBS, which served as a chemoattractant.\u0026nbsp;After 18 hours of incubation, the cells on the surface of the upper chamber were scraped off using cotton swabs.\u0026nbsp;After the chamber was washed three times in PBS buffer, it was inverted and placed on filter paper to air-dry slightly. Subsequently, the chamber was fixed in 4% paraformaldehyde (PFA) for 30 minutes, stained with 0.1% crystal violet, imaged, and quantification was performed by counting the cells in five random fields. This experiment should be independently repeated three times.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAgarose Gel Electrophoresis Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAgarose gels were prepared using 1\u0026times; TAE electrophoresis buffer, with an appropriate concentration selected as needed (e.g., 1%). After heating until the agarose was completely dissolved, the solution was poured into the electrophoresis tank and allowed to stand for solidification.\u0026nbsp;On a laminar flow hood, samples were taken, loading buffer was added, and the mixture was mixed thoroughly, after which it was carefully loaded into the loading wells.\u0026nbsp;After electrophoresis, the gel was immersed in a staining solution for staining. Following rinsing, the gel was observed for results on a UV transilluminator.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDactinomycin Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were exposed to Actinomycin D (Sigma) at a concentration of 2 mg/mL for transcriptional inhibition.\u0026nbsp;qRT-PCR was used to analyze the expression levels of circRNAs and their parental genes.\u0026nbsp;The 2\u0026ndash;\u0026Delta;CT method was used to calculate the relative expression levels of gene abundance, with the group untreated with Actinomycin D (0 h) serving as the internal control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDual-Luciferase Reporter Gene Assay\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe psiCHECK-2-circ0011164-WT and psiCHECK-2-circ0011164-MUT vectors, which contain the wild-type (WT) and mutant (MUT) sequences of circYTHDF2, respectively, were purchased from Changsha ABW Biology.\u0026nbsp;HEK 293T cells were seeded into 24-well plates, and the aforementioned vectors were co-transfected with miR-146a-5p mimics or negative control (NC) using Lipofectamine\u0026trade;\u0026nbsp;2000.\u0026nbsp;Forty-eight hours after transfection, the activity was detected using the Dual-Luciferase Reporter Gene System, and the results were expressed as relative fold normalized to Renilla luciferase.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA Immunoprecipitation Assay (RIP)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;2\u0026times;10⁷ cells were collected. After washing with PBS and centrifugation, 1.7 mL of polysome lysis buffer was added to the pellet, along with 17 \u0026mu;L of protease inhibitors and RNase inhibitors. The mixture was incubated on ice for 20 minutes and vortexed to mix thoroughly. Then, 8.5\u0026nbsp;\u0026mu;L of DNase salt solution and 20\u0026nbsp;\u0026mu;L of DNase (20 U) were added, followed by treatment at 37\u0026deg;C for 10 minutes to digest DNA. Subsequently, 9\u0026nbsp;\u0026mu;L of 0.5 M EDTA, 3.6\u0026nbsp;\u0026mu;L of 0.5 M EGTA, and 17\u0026nbsp;\u0026mu;L of DTT were added, and the mixture was centrifuged at 16,100\u0026nbsp;\u0026times;\u0026nbsp;g for 10 minutes at 4\u0026deg;C.\u0026nbsp;The supernatant was divided equally into three aliquots: 0.8 mL for the IP group, 0.8 mL for the IgG group, and 0.1 mL for the Input group. The Input group was stored frozen at -80\u0026deg;C. The IP group and IgG group were added with AGO2 antibody and IgG antibody, respectively, and incubated with vertical mixing at 4\u0026deg;C overnight.\u0026nbsp;Meanwhile, 40 \u0026mu;L of protein A/G magnetic beads were washed and equilibrated with 0.5 mL of lysis buffer. After that, 20 \u0026mu;L of the equilibrated bead mixture was added to each of the IP group and the IgG group, followed by continuous incubation at 4\u0026deg;C overnight. Once the magnetic beads were collected, they were washed three times with Wash Buffer 1 and Wash Buffer 2 (both containing DTT), respectively.\u0026nbsp;Finally, 1 mL of Trizol was added to each of the three groups of samples for lysis. RNA was extracted via chloroform extraction and ethanol precipitation, then dissolved in 30 \u0026mu;L of nuclease-free water, followed by reverse transcription and qRT-PCR analysis. \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eClinical Significance of PRSS1 Expression in Gastric Cancer Tissues and Serum\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; Previously, our research group identified that PRSS1 might be a potential marker for early diagnosis and prognosis of GC through the following procedures: first, tissues were purified using laser capture microdissection (LCM) technology, and then isotope-labeled quantitative proteomics technology was applied\u003csup\u003e9\u003c/sup\u003e. To investigate the correlation between PRSS1 and GC, we performed IHC, ELISA, Western blot, and qPCR. Next, we detected the expression of PRSS1 protein in 72 cases of gastric cancer tissues via immunohistochemical staining. The results showed that PRSS1 protein was expressed in the cytoplasm after staining. Compared with paired adjacent non-cancerous mucosa, PRSS1 protein was highly expressed in gastric adenocarcinoma tissues (Fig. 1A-D). Furthermore, the expression intensity decreased as the degree of tumor differentiation decreased (Table 1). ELISA detection combined with clinicopathological analysis showed that the concentration of PRSS1 in peripheral blood of the preoperative gastric cancer group was statistically significantly higher than that of the healthy control group. There was no significant difference in PRSS1 between the postoperative gastric cancer group and the healthy control group (Fig. 1E). In addition, the serum PRSS1 expression level was correlated with multiple clinical indicators: it was significantly correlated with patient age (higher in patients aged \u0026ge;60 years), TNM staging (higher in stages Ⅲ-Ⅳ than in stages Ⅰ-Ⅱ), and tumor size (higher in tumors with a size of \u0026ge;5 cm) (P\u0026lt;0.01). However, it showed no significant correlation with gender, histological grade, or lymph node metastasis (Table 2). Then, we found that PRSS1 was expressed at a higher level in GC (gastric cancer) cell lines (MGC803, BGC823, and SGC7901) than in immortalized gastric mucosal epithelial cells (GES-1 cells, Fig. 1F-G).\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"593\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"9\" style=\"width: 593px;\"\u003e\n \u003cp\u003eTable 1 Statistical Analysis of PRSS1 Protein Expression in Gastric Cancer Tissues\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 116px;\"\u003e\n \u003cp\u003eTissue Type\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 58px;\"\u003e\n \u003cp\u003eNumber of cases\u003c/p\u003e\n \u003cp\u003e(n)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"4\" style=\"width: 238px;\"\u003e\n \u003cp\u003eImmunohistochemistry(IHC)\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eResults\u003c/p\u003e\n \u003cp\u003e(n)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003ePRSS1\u003c/p\u003e\n \u003cp\u003ePositive Rate\u003c/p\u003e\n \u003cp\u003e（%）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e\u0026chi;\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eP-value\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 116px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 58px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 41px;\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003cp\u003e（－）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 60px;\"\u003e\n \u003cp\u003eWeakly Positive\u003c/p\u003e\n \u003cp\u003e（+）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 71px;\"\u003e\n \u003cp\u003eModerately Positive\u003c/p\u003e\n \u003cp\u003e（++）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003eStrongly Positive\u003c/p\u003e\n \u003cp\u003e（+++）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 116px;\"\u003e\n \u003cp\u003ePeritumoral Gastric Mucosa Tissues\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 58px;\"\u003e\n \u003cp\u003e72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 41px;\"\u003e\n \u003cp\u003e65\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 60px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 71px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003e9.72%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 116px;\"\u003e\n \u003cp\u003eWell-differentiated Adenocarcinoma Tissues\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 58px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 41px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 60px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 71px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003e50.00%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e3.821\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e0.051\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 116px;\"\u003e\n \u003cp\u003eModerately-differentiated Adenocarcinoma Tissues\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 58px;\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 41px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 60px;\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 71px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003e71.43%\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e30.946\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e0.000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 116px;\"\u003e\n \u003cp\u003ePoorly-differentiated Adenocarcinoma Tissues\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 58px;\"\u003e\n \u003cp\u003e47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 41px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 60px;\"\u003e\n \u003cp\u003e35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 71px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003e89.36%\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e74.463\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e0.000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"9\" style=\"width: 593px;\"\u003e\n \u003cp\u003eCompared with peritumoral gastric mucosa tissues, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e＜0.001.\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"106%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"5\" style=\"width: 100px;\"\u003e\n \u003cp\u003eTable 2 Analysis of the Relationship Between Serum PRSS1 Protein Expression and Clinicopathological Parameters\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 15px;\"\u003e\n \u003cp\u003eItem\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003eGroups\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003eSerum PRSS1 Concentration\u003c/p\u003e\n \u003cp\u003e（ng/mL）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003et\u003c/em\u003e-value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e-value\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 15px;\"\u003e\n \u003cp\u003eSex\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003eMale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003e42.95\u0026plusmn;17.69\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e-0.370\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e0.713\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 15px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003eFemale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003e45.31\u0026plusmn;26.46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 15px;\"\u003e\n \u003cp\u003eAge\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003e\u0026ge;60 years\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003e49.61\u0026plusmn;25.79\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e2.927\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e0.005\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 15px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003e＜60 years\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003e34.54\u0026plusmn;11.92\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 15px;\"\u003e\n \u003cp\u003eTNM Staging\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003eⅠ-Ⅱ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003e34.59\u0026plusmn;9.25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e-3.036\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e0.004\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 15px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003eⅢ-Ⅳ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003e49.58\u0026plusmn;26.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 15px;\"\u003e\n \u003cp\u003eTumor Size\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003e\u0026ge;5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003e57.39\u0026plusmn;30.18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e2.901\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e0.005\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 15px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003e\u0026lt;5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003e38.79\u0026plusmn;16.77\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 15px;\"\u003e\n \u003cp\u003eHistological Grade\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003eWell-Moderately-differentiated\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003e38.98\u0026plusmn;13.77\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e1.369\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e0.177\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 15px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003ePoorly-differentiated\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003e47.69\u0026plusmn;26.92\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 15px;\"\u003e\n \u003cp\u003eLymph Node Metastasis\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003e47.23\u0026plusmn;25.93\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e1.338\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e0.187\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 15px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003e37.72\u0026plusmn;8.79\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eThe Effect of PRSS1 on the Biological Behaviors of Gastric Cancer Cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo clarify which functions of GC cells are mediated by PRSS1, we selected the MGC803 and BGC823 cell lines with relatively high PRSS1 expression levels for PRSS1 knockdown, and verified the knockdown efficiency by WB (Western Blot) (Figure 2A).\u0026nbsp;To verify the effect of PRSS1 on cell proliferation, we performed CCK8 (Cell Counting Kit-8), colony formation, and WB assays to detect the expression of proliferation-related factors.\u0026nbsp;CCK8 assays showed that the proliferation rate of cells with low PRSS1 expression was significantly lower than that of the Control group and the negative control group (Figure 2B); Colony formation assays confirmed that the colony formation rate in the low PRSS1 expression group was significantly decreased (Figure 2C); Western blot assays revealed that the expression level of the proliferation-related protein PCNA was significantly downregulated in the low PRSS1 expression group, suggesting that PRSS1 may affect cell proliferation (Figure 2D).\u0026nbsp;To verify the effect of PRSS1 on the invasion, migration, and EMT (Epithelial-Mesenchymal Transition) processes of gastric cancer cells.\u0026nbsp;The following experiments were performed.\u0026nbsp;Wound healing assays showed that the migration distance of the siPRSS1 group was significantly shorter than that of the Control group (Fig. 2E); Transwell assays confirmed that the number of migrating and invading cells in the low PRSS1 expression group was significantly reduced (Fig. 2F).\u0026nbsp;Furthermore, low PRSS1 expression could also affect the expression of epithelial-mesenchymal transition (EMT)-related proteins, leading to decreased expression of mesenchymal markers N-cadherin and Vimentin, and increased expression of epithelial marker E-cadherin (Fig. 2G). These results indicate that the ability of MGC803 and BGC823 cells to undergo EMT is impaired after low PRSS1 expression.\u0026nbsp;These results indicate that PRSS1 promotes the progression of GC by enhancing cancer cell proliferation, migration, and invasion.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMechanism of Action by Which PRSS1 Promotes Gastric Cancer Cell Migration and Invasion\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWestern blot was used to detect the effect of PRSS1 downregulation on the JAK2/STAT3 pathway.\u0026nbsp;The results showed that in MGC803 and BGC823 cells, JAK2 and STAT3 exhibited no significant changes following PRSS1 downregulation.\u0026nbsp;Whereas the protein levels of p-JAK2 and p-STAT3 were decreased (Fig. 3).\u0026nbsp;The results suggest that PRSS1 may induce the migration and invasion of MGC803 and BGC823 cells directly or indirectly by regulating the JAK2/STAT3 pathway.\u003c/p\u003e\n\u003cp\u003eWestern blot analysis of JAK2/STAT3 pathway components (p-JAK2, JAK2, p-STAT3, STAT3) in MGC803 and \u0026nbsp;BGC823 gastric cancer cells following PRSS1 knockdown. GAPDH/\u0026beta;-actin served as loading control. Densitometric quantification (right panels) shows significant reduction in phosphorylated protein levels upon PRSS1 depletion (n = 3 independent experiments).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExpression Regulation of PRSS1 in Gastric Cancer and Its Mechanism\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(1).Identification of CircYTHDF2 that Regulates the Expression of PRSS1\u003c/p\u003e\n\u003cp\u003eBased on the previous finding that miR-146a-5p targets PRSS1 to inhibit the growth of gastric cancer cells,，\u003csup\u003e9\u003c/sup\u003e in this study, through prediction using StarBase combined with circRNAs (Table 3), and further combined with circRNA microarray data (Fig. 4.1A) followed by Venn diagram analysis, circYTHDF2 that may bind to miR-146a-5p was screened out (Fig. 4.1B) Sanger sequencing results showed that circYTHDF2 is derived from the back-splicing of exons 5-6 of the YTHDF2 gene, forming a closed circular structure, and its junction sequence is \u0026quot;CCTGTTGAGCATCACTTTCCA\u0026quot; (Fig. 4.1C). Divergent primer PCR and agarose gel electrophoresis confirmed that specific bands of circYTHDF2 could be amplified in cDNA, whereas no amplification was observed in genomic DNA (gDNA), thus validating its circular structure (Fig. 4.1D). qPCR showed that the expression of circYTHDF2 in MGC803 and BGC823 cells was significantly higher than that in GES-1 cells (Fig. 4.1F). Actinomycin D assay confirmed that the half-life of circYTHDF2 (\u0026gt;24 h) was significantly longer than that of its linear parental gene YTHDF2 (\u0026lt;8 h), suggesting that it has high stability (Fig. 4.1F).\u003c/p\u003e\n\u003cp\u003eTable 3 Differentially Expressed circRNAs in circRNA Microarray\u003c/p\u003e\n\u003cdiv align=\"\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"573\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 158px;\"\u003e\n \u003cp\u003ecircRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003eP-value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003eFC (abs)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 91px;\"\u003e\n \u003cp\u003eReg\u0026mu;Lation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003echrom\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 121px;\"\u003e\n \u003cp\u003eGeneSymbol\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 158px;\"\u003e\n \u003cp\u003ehsa_circRNA_060539\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e0.007553\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e1.588604\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 91px;\"\u003e\n \u003cp\u003eup\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003echr20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 121px;\"\u003e\n \u003cp\u003eSDC4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 158px;\"\u003e\n \u003cp\u003ehsa_circRNA_101996\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e0.019948\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e1.696884\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 91px;\"\u003e\n \u003cp\u003eup\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003echr 17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 121px;\"\u003e\n \u003cp\u003eSPECC1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 158px;\"\u003e\n \u003cp\u003ehsa_circRNA_407172\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e0.016356\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e1.526703\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 91px;\"\u003e\n \u003cp\u003eup\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003echr9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 121px;\"\u003e\n \u003cp\u003eRP11-182N22.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 158px;\"\u003e\n \u003cp\u003ehsa_circRNA_100018\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e0.012323\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e1.619288\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 91px;\"\u003e\n \u003cp\u003eup\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003echr1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 121px;\"\u003e\n \u003cp\u003eGNB1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 158px;\"\u003e\n \u003cp\u003ehsa_circRNA_100491\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e0.01481\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e1.550904\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 91px;\"\u003e\n \u003cp\u003eup\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003echr1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 121px;\"\u003e\n \u003cp\u003ePCNXL2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 158px;\"\u003e\n \u003cp\u003ehsa_circRNA_101695\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e0.007567\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e1.570053\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 91px;\"\u003e\n \u003cp\u003eup\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003echr16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 121px;\"\u003e\n \u003cp\u003eNAGPA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 158px;\"\u003e\n \u003cp\u003ehsa_circRNA_053294\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e0.034851\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e1.548787\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 91px;\"\u003e\n \u003cp\u003eup\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003echr2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 121px;\"\u003e\n \u003cp\u003eZNF512\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 158px;\"\u003e\n \u003cp\u003e\u0026hellip;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u0026hellip;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u0026hellip;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 91px;\"\u003e\n \u003cp\u003e\u0026hellip;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026hellip;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026hellip;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 158px;\"\u003e\n \u003cp\u003ehsa_circRNA_011164\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e0.031566\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e1.791049\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 91px;\"\u003e\n \u003cp\u003eup\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003echr1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 121px;\"\u003e\n \u003cp\u003eYTHDF2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 158px;\"\u003e\n \u003cp\u003ehsa_circRNA_001586\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e0.031858\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e1.77983\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 91px;\"\u003e\n \u003cp\u003eup\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003echr6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 121px;\"\u003e\n \u003cp\u003eHISTIH3D\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e(2).Targeted Binding of CircYTHDF2 to miR-146a-5p\u003c/p\u003e\n\u003cp\u003eTo clarify the interaction between circYTHDF2 and miR-146a-5p, we performed dual-luciferase reporter assay and RNA immunoprecipitation (RIP) assay. The dual-luciferase reporter gene assay showed that after co-transfection of the circYTHDF2 wild-type vector with miR-146a-5p mimics, luciferase activity was significantly decreased, while the mutant vector exhibited no significant changes, confirming that circYTHDF2 can directly bind to miR-146a-5p (Fig. 4.2A). RIP assay further demonstrated that circYTHDF2 could be significantly enriched by the AGO2 antibody (Fig. 4.2B). Next, to clarify the interaction between circYTHDF2 and PRSS1, we performed knockdown and overexpression of circYTHDF2 in MGC803 and BGC823 cell lines, and verified the knockdown efficiency by qPCR (Fig. 4.2C-D). Western blot analysis showed that after knockdown of circYTHDF2, the protein expression of PRSS1 decreased, while its overexpression led to an increase in PRSS1 protein expression (Fig. 4.2E-F); rescue experiments demonstrated that miR-146a-5p inhibitor could reverse the downregulation of PRSS1 induced by circYTHDF2 knockdown (Fig. 4.2G). Taken together, these results suggest that circYTHDF2 may act as a ceRNA for miR-146a-5p, and regulate the expression of PRSS1 by binding to miR-146a-5p.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of the CircYTHDF2-miR-146a-5p-PRSS1 Axis on the Biological Behaviors of Gastric Cancer Cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the functional role of CircYTHDF2 in GC (gastric cancer) cells, we performed gain-of-function and loss-of-function experiments. CCK-8 and colony formation assays showed that knockdown of circYTHDF2 could significantly inhibit cell proliferation (Fig. 5A-B), while its overexpression promoted cell proliferation (Fig. 5C-D); rescue experiments confirmed that co-transfection of si-circYTHDF2 and miR-146a-5p inhibitor could partially reverse the proliferation-inhibiting effect (Fig. 5E-F). Regarding cell migration and invasion, wound healing and Transwell assays showed that knockdown of circYTHDF2 could significantly reduce the migration distance and the number of migrating and invading cells (Fig. 5G-H), while its overexpression exerted the opposite effect (Fig. 5I-J), and this effect could be reversed by the miR-146a-5p inhibitor (Fig. 5K-L). Collectively, these results reveal a novel mechanism by which circYTHDF2 directly binds to miR-146a-5p and promotes gastric cancer cell proliferation, invasion, and metastasis by upregulating the expression of PRSS1.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWith the development of high-throughput sequencing technology, an increasing number of circRNAs have been identifie\u003csup\u003e15\u003c/sup\u003e.\u0026nbsp;As a novel gene regulatory factor, circRNA exerts its functions at the transcriptional or post-transcriptional level, regulating downstream factors\u003csup\u003e16\u003c/sup\u003e.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eCircRNAs are abundant in eukaryotes and play a key role in regulating genes\u003csup\u003e17\u003c/sup\u003e, miRNAs, and modulating the processes involved in pathological conditions.\u0026nbsp;Emerging research has identified dysregulated circRNAs in gastric, colorectal, and liver cancers that play active roles in tumor initiation and progression\u003csup\u003e18,19\u003c/sup\u003e. \u003cstrong\u003eC\u003c/strong\u003eircRNAs are a class of non-coding RNAs (ncRNAs) formed through back-splicing of linear RNAs and covalent circularization.\u003csup\u003e20,21\u003c/sup\u003e.Due to their covalently closed circular structure, circRNAs are more stable than their linear counterparts, and thus are abundant in plasma, cell-free saliva, and even circulating exosomes, which may predict the onset of cancer and other diseases \u003csup\u003e22\u003c/sup\u003e.\u0026nbsp;CircRNAs function as molecular sponges through their multiple miRNA binding sites, regulating target gene expression via the circRNA-miRNA-mRNA network to play critical roles in tumorigenesis and malignant progression\u003csup\u003e17\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003ePRSS1 plays an important role in the hydrolysis of the extracellular matrix (ECM), the metabolism of water-soluble vitamins and coenzymes, and the collagen synthesis process. Meanwhile, it is also involved in the activation of metalloproteins, exhibits functions similar to the interaction between neuroactive ligands and receptors, and can be secreted into body fluids and excreta\u003csup\u003e23\u003c/sup\u003e.\u0026nbsp;However, the mechanism(s) through which the PRSS1 protein is involved in GC progression remains unclear to date.\u0026nbsp;However, we employed IHC and ELISA techniques to detect the expression levels of PRSS1 in GC tissues and serum samples. The results showed that PRSS1 exhibited high expression in both GC tissues and serum.\u0026nbsp;It was significantly correlated with the age of GC patients, TNM stage, and tumor size.\u0026nbsp;In tumor tissues, it was also found that the expression level of PRSS1 was positively correlated with the degree of tumor differentiation.\u0026nbsp;It was found that the overexpression of PRSS1 promoted cell proliferation, migration, and invasion, while the opposite results were obtained when the expression of PRSS1 was knocked down.\u0026nbsp;Therefore, PRSS1 may play an oncogenic role in GC and be involved in the progression of GC.\u0026nbsp;However, the potential mechanisms by which PRSS1 affects GC remain poorly understood.\u003c/p\u003e\n\u003cp\u003eIt has been reported that since their discovery, miRNAs are involved in a variety of biological functions and pathological processes, including cancer\u003csup\u003e24\u003c/sup\u003e.\u0026nbsp;It has been found that miR-146a-5p functions as a tumor-suppressive miRNA in certain cancers,\u003csup\u003e25\u003c/sup\u003e，while it functions as an oncogenic miRNA in other cancers\u003csup\u003e25\u003c/sup\u003e .It is significantly upregulated in a variety of cancer type，such as colorectal cancer \u003csup\u003e26\u003c/sup\u003e、breast cancer \u003csup\u003e27\u003c/sup\u003e among others. It has been demonstrated in experiments that miR-146a-5p can be detected in human body fluids, and its concentration typically differs in the body fluids of cancer patients compared with those of healthy individuals. These levels sometimes even depend on cancer subtypes and metastatic status, which indicates that miR-146a-5p may potentially be used as a non-invasive biomarker in the future\u003csup\u003e28\u003c/sup\u003e. The research group previously found that miR-146a-5p targets PRSS1 and inhibits the growth and proliferation of GC cells\u003csup\u003e9\u003c/sup\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e. MiR-146a-5p serves as a crucial factor in the tumorigenesis and progression of a variety of tumors, and deserves to be a key research focus in combating cancer. To further investigate the regulatory mechanism of miR-146a-5p, we screened for the optimal circRNA molecule that binds to miR-146a-5p using high-throughput gene chips, bioinformatics screening of circRNAs, and analysis of circRNA size, binding stability, and binding specificity. The results of the dual-luciferase reporter assay confirmed that miR-146a-5p exhibits a more definite binding relationship with circYTHDF2. RNA immunoprecipitation (RIP) assay demonstrates that circYTHDF2 can regulate miR-146a-5p through an AGO2-dependent ceRNA mechanism. We further verified the targeted regulatory relationship among circYTHDF2, miR-146a-5p, and PRSS1. Results of the rescue phenotype assay showed that miR-146a-5p partially reversed the promoting effect of circYTHDF2 on the migration and invasion abilities of gastric cancer (GC) cells.\u003c/p\u003e\n\u003cp\u003eDuring a series of cellular activities of cancer cells, ranging from growth and proliferation to apoptosis, invasion, and metastasis, the activities of signaling pathways undergo significant changes\u003csup\u003e29\u003c/sup\u003e.\u0026nbsp;In cancer, common signaling pathways include the P53 signaling pathway\u003csup\u003e30\u003c/sup\u003e、NF-\u0026kappa;B signaling pathway, JAK-STAT signaling pathway\u003csup\u003e31\u003c/sup\u003e、Wnt signaling pathway\u003csup\u003e32\u003c/sup\u003e、and mitogen-activated protein kinase (MAPK) pathway\u003csup\u003e33\u003c/sup\u003e.\u0026nbsp;Among these, the activation of the JAK2/STAT3 signaling pathway is involved in tumorigenesis and tumor progression.\u0026nbsp;It contributes to the formation of the tumor inflammatory microenvironment and is closely associated with the tumorigenesis and progression of many human tumors\u003csup\u003e34\u003c/sup\u003e.\u0026nbsp;Signal Transducer and Activator of Transcription 3 (STAT3), serving as a convergence point for numerous oncogenic signaling pathways, plays a central role in regulating anti-tumor immune responses\u003csup\u003e35\u003c/sup\u003e.\u0026nbsp;This study demonstrates that PRSS1 may induce the proliferation, migration, and invasion of MGC803 and BGC823 cells directly or indirectly by regulating the JAK2/STAT3 pathway.\u0026nbsp;However, this study did not further investigate the regulatory relationship between PRSS1 and the JAK2/STAT3 pathway. Further verification is still required through subsequent experiments.\u003c/p\u003e\n\u003cp\u003eTaken together, our study demonstrates that circYTHDF2 promotes the proliferation and migration of GC cells in vitro.\u0026nbsp;Mechanistically, circYTHDF2 increases the expression of PRSS1 by acting as a miR-146a-5p sponge.\u0026nbsp;This study elucidates that the CircYTHDF2-miR-146a-5p-PRSS1 expression axis mediates the regulation of malignant biological behaviors of GC cells via the JAK2/STAT3 pathway, and provides novel candidate targets for the diagnosis and treatment of gastric cancer.\u0026nbsp;Similarly, our data demonstrate that PRSS1 is highly expressed in GC tissues and serum, and it can serve as a potential biomarker for GC diagnosis and combined diagnosis.\u003cbr\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eAGO2: Argonaute 2\u003c/p\u003e\n\u003cp\u003eAbcam: Abcam (antibody supplier)\u003c/p\u003e\n\u003cp\u003eBBI: BBI Life Sciences (reagent supplier)\u003c/p\u003e\n\u003cp\u003eBeyotime: Beyotime Biotechnology (reagent supplier)\u003c/p\u003e\n\u003cp\u003eBSA: Bovine Serum Albumin\u003c/p\u003e\n\u003cp\u003eBoyan Biotechnology: Boyan Biotechnology (ELISA kit supplier)\u003c/p\u003e\n\u003cp\u003eBIO-RAD: BIO-RAD Laboratories (microplate reader supplier)\u003c/p\u003e\n\u003cp\u003eCST: Cell Signaling Technology\u003c/p\u003e\n\u003cp\u003ecDNA: Complementary DNA\u003c/p\u003e\n\u003cp\u003eceRNA: Competing Endogenous RNA\u003c/p\u003e\n\u003cp\u003eChangsha ABW Biology: Changsha ABW Biology (vector supplier)\u003c/p\u003e\n\u003cp\u003ecircRNA: Circular RNA\u003c/p\u003e\n\u003cp\u003eCCK-8: Cell Counting Kit-8\u003c/p\u003e\n\u003cp\u003eDAB: Diaminobenzidine\u003c/p\u003e\n\u003cp\u003eDNase: Deoxyribonuclease\u003c/p\u003e\n\u003cp\u003eDTT: Dithiothreitol\u003c/p\u003e\n\u003cp\u003eEDTA: Ethylenediaminetetraacetic Acid\u003c/p\u003e\n\u003cp\u003eEGTA: Ethylene Glycol Tetraacetic Acid\u003c/p\u003e\n\u003cp\u003eECM: Extracellular Matrix\u003c/p\u003e\n\u003cp\u003eELISA: Enzyme-Linked Immunosorbent Assay\u003c/p\u003e\n\u003cp\u003eFBS: Fetal Bovine Serum\u003c/p\u003e\n\u003cp\u003eGibco: Gibco (medium supplier)\u003c/p\u003e\n\u003cp\u003eGC: Gastric Cancer\u003c/p\u003e\n\u003cp\u003egDNA: Genomic DNA\u003c/p\u003e\n\u003cp\u003eGeneCopoeia: GeneCopoeia (reagent supplier)\u003c/p\u003e\n\u003cp\u003eHRP: Horseradish Peroxidase\u003c/p\u003e\n\u003cp\u003eHyClone: HyClone (medium supplier)\u003c/p\u003e\n\u003cp\u003eIHC: Immunohistochemistry\u003c/p\u003e\n\u003cp\u003eInvitrogen: Invitrogen (reagent supplier)\u003c/p\u003e\n\u003cp\u003eJAK2: Janus Kinase 2\u003c/p\u003e\n\u003cp\u003eK-SFM: Keratinocyte Serum-Free Medium\u003c/p\u003e\n\u003cp\u003eLI-COR: LI-COR Biosciences (imaging system supplier)\u003c/p\u003e\n\u003cp\u003eLCM: Laser Capture Microdissection\u003c/p\u003e\n\u003cp\u003elncRNA: Long Non-Coding RNA\u003c/p\u003e\n\u003cp\u003eMAPK: Mitogen-Activated Protein Kinase\u003c/p\u003e\n\u003cp\u003emiR-146a-5p: MicroRNA-146a-5p\u003c/p\u003e\n\u003cp\u003eMUT: Mutant\u003c/p\u003e\n\u003cp\u003eNC: Negative Control\u003c/p\u003e\n\u003cp\u003eNF-\u0026kappa;B: Nuclear Factor-Kappa B\u003c/p\u003e\n\u003cp\u003eNikon: Nikon Corporation (microscope supplier)\u003c/p\u003e\n\u003cp\u003eOD: Optical Density\u003c/p\u003e\n\u003cp\u003ePFA: Paraformaldehyde\u003c/p\u003e\n\u003cp\u003ePCNA: Proliferating Cell Nuclear Antigen\u003c/p\u003e\n\u003cp\u003ePVDF: Polyvinylidene Fluoride\u003c/p\u003e\n\u003cp\u003ePRSS1: Protease, Serine 1\u003c/p\u003e\n\u003cp\u003eProteintech: Proteintech (antibody supplier)\u003c/p\u003e\n\u003cp\u003eRBP: RNA-Binding Protein\u003c/p\u003e\n\u003cp\u003eRIP: RNA Immunoprecipitation\u003c/p\u003e\n\u003cp\u003eRNA-seq: RNA Sequencing\u003c/p\u003e\n\u003cp\u003eRNase: Ribonuclease\u003c/p\u003e\n\u003cp\u003eRPMI 1640: Roswell Park Memorial Institute 1640 Medium\u003c/p\u003e\n\u003cp\u003eRIPA: Radio Immunoprecipitation Assay (lysis buffer)\u003c/p\u003e\n\u003cp\u003eSanta Cruz Biotechnology: Santa Cruz Biotechnology (antibody supplier)\u003c/p\u003e\n\u003cp\u003eSDS-PAGE: Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis\u003c/p\u003e\n\u003cp\u003eSigma: Sigma-Aldrich (reagent supplier)\u003c/p\u003e\n\u003cp\u003eSTAT3: Signal Transducer and Activator of Transcription 3\u003c/p\u003e\n\u003cp\u003eTCR\u0026beta;: T Cell Receptor \u0026beta;\u003c/p\u003e\n\u003cp\u003eTAE: Tris-Acetate-EDTA (electrophoresis buffer)\u003c/p\u003e\n\u003cp\u003eTNM: Tumor-Node-Metastasis (staging system)\u003c/p\u003e\n\u003cp\u003eThermo Fisher Scientific: Thermo Fisher Scientific (reagent supplier)\u003c/p\u003e\n\u003cp\u003eTsingke Biotechnology: Tsingke Biotechnology (primer supplier)\u003c/p\u003e\n\u003cp\u003eWT: Wild-Type\u003c/p\u003e\n\u003cp\u003e4-PL: 4-Parameter Logistic (model)\u003c/p\u003e\n\u003cp\u003eEMT: Epithelial-Mesenchymal Transition\u003c/p\u003e\n\u003cp\u003eqRT-PCR: Quantitative Reverse Transcription-Polymerase Chain Reaction\u003c/p\u003e\n\u003cp\u003eACC: Adrenocortical carcinoma\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll samples were obtained from patients with GC with approval of the medical ethics committee. We state that our study was performed in accordance with the Declaration of Helsinki. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur work was supported by the National key research and development project (NO.2021YFE0192100),Natural Science Foundation of Hunan Province (NO.2023JJ30529),Hunan Provincial Natural Science Foundation Health Joint Fund(NO.2025JJ81061).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCo-first author 1 (Zixin Wan):Writing - original draft, Writing - review \u0026amp; editing, Data curation, Formal analysis: Made substantial contributions to study conception, data acquisition, and analysis/interpretation; conceived and designed the study, acquired data, and played a pivotal role in results interpretation;\u003c/p\u003e\n\u003cp\u003eCo-first author 2 (Yuwei Li):Writing - review \u0026amp; editing, Data curation, Methodology: Participated in manuscript drafting and critical revision for important intellectual content; conceived and designed the study, acquired data, and played a pivotal role in results interpretation;\u003c/p\u003e\n\u003cp\u003eCo-first author 3 (Yuyu Wang):Writing - review \u0026amp; editing: Participated in manuscript drafting and critical revision for important intellectual content; conceived and designed the study, acquired data, and played a pivotal role in results interpretation;\u003c/p\u003e\n\u003cp\u003eSecond \u0026amp; third authors (Xuemei Zeng, Yue Qiu):Validation, Data curation: Contributed to study conception and played an important role in results interpretation;\u003c/p\u003e\n\u003cp\u003eFourth author (Fen Tang):Data curation: Approved the final version for publication; contributed to study conception and results interpretation;\u003c/p\u003e\n\u003cp\u003eFifth author (Zhenghan He):Writing - review \u0026amp; editing: Participated in manuscript drafting and critical revision;\u003c/p\u003e\n\u003cp\u003eSixth author (Juan Xiao✝):Funding acquisition, Supervision: Accountable for all aspects of the work regarding research integrity; investigated and resolved accuracy-related issues; approved the final version;\u003c/p\u003e\n\u003cp\u003eCorresponding author (Zhiwei Zhang✝):Funding acquisition, Project administration: Accountable for all aspects of the work regarding research integrity; investigated and resolved accuracy-related issues; approved the final version.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003ePr\u0026eacute;cis:\u003c/strong\u003e The circYTHDF2-miR-146a-5p-PRSS1 axis promotes gastric cancer proliferation via JAK2/STAT3 signaling, representing a potential diagnostic and therapeutic target for GC.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest statement：\u003c/strong\u003eThe authors declare no potential conflicts of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eThrift, A. P. \u0026amp; El-Serag, H. B. Burden of Gastric Cancer. \u003cem\u003eClin Gastroenterol Hepatol\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, 534\u0026ndash;542 (2020).\u003c/li\u003e\n\u003cli\u003eMachlowska, J., Baj, J., Sitarz, M., Maciejewski, R. \u0026amp; Sitarz, R. Gastric Cancer: Epidemiology, Risk Factors, Classification, Genomic Characteristics and Treatment Strategies. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 4012 (2020).\u003c/li\u003e\n\u003cli\u003eYang, W.-J. \u003cem\u003eet al.\u003c/em\u003e Updates on global epidemiology, risk and prognostic factors of gastric cancer. \u003cem\u003eWorld J Gastroenterol\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 2452\u0026ndash;2468 (2023).\u003c/li\u003e\n\u003cli\u003eYi, Q. \u003cem\u003eet al.\u003c/em\u003e PRSS1 mutations and the proteinase/antiproteinase imbalance in the pathogenesis of pancreatic cancer. \u003cem\u003eTumour Biol\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e, 5805\u0026ndash;5810 (2016).\u003c/li\u003e\n\u003cli\u003eRowen, L., Koop, B. F. \u0026amp; Hood, L. The complete 685-kilobase DNA sequence of the human beta T cell receptor locus. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e272\u003c/strong\u003e, 1755\u0026ndash;1762 (1996).\u003c/li\u003e\n\u003cli\u003eLiu, Q. \u003cem\u003eet al.\u003c/em\u003e PRSS1 mutation: a possible pathomechanism of pancreatic carcinogenesis and pancreatic cancer. \u003cem\u003eMol Med\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 44 (2019).\u003c/li\u003e\n\u003cli\u003eCabot, D. \u003cem\u003eet al.\u003c/em\u003e KRAS phosphorylation regulates cell polarization and tumorigenic properties in colorectal cancer. \u003cem\u003eOncogene\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e, 5730\u0026ndash;5740 (2021).\u003c/li\u003e\n\u003cli\u003eSong, J. Y. \u003cem\u003eet al.\u003c/em\u003e Candidates for tumor markers of cervical cancer discovered by proteomic analysis. \u003cem\u003eJ Korean Med Sci\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 1479\u0026ndash;1485 (2012).\u003c/li\u003e\n\u003cli\u003eYe, D. \u003cem\u003eet al.\u003c/em\u003e Silencing PRSS1 suppresses the growth and proliferation of gastric carcinoma cells via the ERK pathway. \u003cem\u003eInt J Biol Sci\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 957\u0026ndash;971 (2021).\u003c/li\u003e\n\u003cli\u003eForuzandeh, Z. \u003cem\u003eet al.\u003c/em\u003e Circular RNAs as novel biomarkers in triple-negative breast cancer: a systematic review. \u003cem\u003eMol Biol Rep\u003c/em\u003e \u003cstrong\u003e49\u003c/strong\u003e, 9825\u0026ndash;9840 (2022).\u003c/li\u003e\n\u003cli\u003eZhao, J. \u003cem\u003eet al.\u003c/em\u003e CircRNA Expression Profile in Early-Stage Lung Adenocarcinoma Patients. \u003cem\u003eCell Physiol Biochem\u003c/em\u003e \u003cstrong\u003e44\u003c/strong\u003e, 2138\u0026ndash;2146 (2017).\u003c/li\u003e\n\u003cli\u003eWu, J. \u003cem\u003eet al.\u003c/em\u003e Emerging Epigenetic Regulation of Circular RNAs in Human Cancer. \u003cem\u003eMol Ther Nucleic Acids\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 589\u0026ndash;596 (2019).\u003c/li\u003e\n\u003cli\u003eFu, B. \u003cem\u003eet al.\u003c/em\u003e Circular RNA circBCBM1 promotes breast cancer brain metastasis by modulating miR-125a/BRD4 axis. \u003cem\u003eInt J Biol Sci\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 3104\u0026ndash;3117 (2021).\u003c/li\u003e\n\u003cli\u003eJeck, W. R. \u0026amp; Sharpless, N. E. Detecting and characterizing circular RNAs. \u003cem\u003eNat Biotechnol\u003c/em\u003e \u003cstrong\u003e32\u003c/strong\u003e, 453\u0026ndash;461 (2014).\u003c/li\u003e\n\u003cli\u003eCaiment, F., Gaj, S., Claessen, S. \u0026amp; Kleinjans, J. High-throughput data integration of RNA-miRNA-circRNA reveals novel insights into mechanisms of benzo[a]pyrene-induced carcinogenicity. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e43\u003c/strong\u003e, 2525\u0026ndash;2534 (2015).\u003c/li\u003e\n\u003cli\u003eKristensen, L. S. \u003cem\u003eet al.\u003c/em\u003e The biogenesis, biology and characterization of circular RNAs. \u003cem\u003eNat Rev Genet\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 675\u0026ndash;691 (2019).\u003c/li\u003e\n\u003cli\u003eCircPLK1 upregulates ETS1 to confer anthracycline resistance in triple-negative breast cancer - PubMed. https://pubmed.ncbi.nlm.nih.gov/40896288/.\u003c/li\u003e\n\u003cli\u003eRajgopal, S., Fredrick, S. J. \u0026amp; Parvathi, V. D. CircRNAs: Insights into Gastric Cancer. \u003cem\u003eGastrointest Tumors\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 159\u0026ndash;168 (2021).\u003c/li\u003e\n\u003cli\u003eYi, J. \u003cem\u003eet al.\u003c/em\u003e CircMYBL2 facilitates hepatocellular carcinoma progression by regulating E2F1 expression. \u003cem\u003eOncol Res\u003c/em\u003e \u003cstrong\u003e32\u003c/strong\u003e, 1129\u0026ndash;1139 (2024).\u003c/li\u003e\n\u003cli\u003eChen, L. \u003cem\u003eet al.\u003c/em\u003e The bioinformatics toolbox for circRNA discovery and analysis. \u003cem\u003eBrief Bioinform\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 1706\u0026ndash;1728 (2021).\u003c/li\u003e\n\u003cli\u003eZhou, Z. \u003cem\u003eet al.\u003c/em\u003e circROBO1 promotes prostate cancer growth and enzalutamide resistance via accelerating glycolysis. \u003cem\u003eJ Cancer\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 2574\u0026ndash;2584 (2023).\u003c/li\u003e\n\u003cli\u003eArnaiz, E. \u003cem\u003eet al.\u003c/em\u003e CircRNAs and cancer: Biomarkers and master regulators. \u003cem\u003eSemin Cancer Biol\u003c/em\u003e \u003cstrong\u003e58\u003c/strong\u003e, 90\u0026ndash;99 (2019).\u003c/li\u003e\n\u003cli\u003eMasson, E., Chen, J.-M., Cooper, D. N. \u0026amp; F\u0026eacute;rec, C. PRSS1 copy number variants and promoter polymorphisms in pancreatitis: common pathogenetic mechanism, different genetic effects. \u003cem\u003eGut\u003c/em\u003e \u003cstrong\u003e67\u003c/strong\u003e, 592\u0026ndash;593 (2018).\u003c/li\u003e\n\u003cli\u003eChen, L. \u003cem\u003eet al.\u003c/em\u003e Trends in the development of miRNA bioinformatics tools. \u003cem\u003eBrief Bioinform\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 1836\u0026ndash;1852 (2019).\u003c/li\u003e\n\u003cli\u003eIacona, J. R. \u0026amp; Lutz, C. S. miR-146a-5p: Expression, regulation, and functions in cancer. \u003cem\u003eWIREs RNA\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, e1533 (2019).\u003c/li\u003e\n\u003cli\u003eExosomal miR-146a-5p and miR-155-5p promote CXCL12/CXCR7-induced metastasis of colorectal cancer by crosstalk with cancer-associated fibroblasts - PubMed. https://pubmed.ncbi.nlm.nih.gov/35443745/.\u003c/li\u003e\n\u003cli\u003eCabello, P. \u003cem\u003eet al.\u003c/em\u003e miR-146a-5p Promotes Angiogenesis and Confers Trastuzumab Resistance in HER2+ Breast Cancer. \u003cem\u003eCancers (Basel)\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 2138 (2023).\u003c/li\u003e\n\u003cli\u003eIacona, J. R. \u0026amp; Lutz, C. S. miR-146a-5p: Expression, regulation, and functions in cancer. \u003cem\u003eWiley Interdiscip Rev RNA\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, e1533 (2019).\u003c/li\u003e\n\u003cli\u003eVaghari-Tabari, M. \u003cem\u003eet al.\u003c/em\u003e Signaling, metabolism, and cancer: An important relationship for therapeutic intervention. \u003cem\u003eJ Cell Physiol\u003c/em\u003e \u003cstrong\u003e236\u003c/strong\u003e, 5512\u0026ndash;5532 (2021).\u003c/li\u003e\n\u003cli\u003eChahat, null, Bhatia, R. \u0026amp; Kumar, B. p53 as a potential target for treatment of cancer: A perspective on recent advancements in small molecules with structural insights and SAR studies. \u003cem\u003eEur J Med Chem\u003c/em\u003e \u003cstrong\u003e247\u003c/strong\u003e, 115020 (2023).\u003c/li\u003e\n\u003cli\u003eFan, Y., Mao, R. \u0026amp; Yang, J. NF-\u0026kappa;B and STAT3 signaling pathways collaboratively link inflammation to cancer. \u003cem\u003eProtein Cell\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 176\u0026ndash;185 (2013).\u003c/li\u003e\n\u003cli\u003eKrishnamurthy, N. \u0026amp; Kurzrock, R. Targeting the Wnt/beta-catenin pathway in cancer: Update on effectors and inhibitors. \u003cem\u003eCancer Treat Rev\u003c/em\u003e \u003cstrong\u003e62\u003c/strong\u003e, 50\u0026ndash;60 (2018).\u003c/li\u003e\n\u003cli\u003eYuan, W. \u003cem\u003eet al.\u003c/em\u003e The role of MAPK pathway in gastric cancer: unveiling molecular crosstalk and therapeutic prospects. \u003cem\u003eJ Transl Med\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 1142 (2024).\u003c/li\u003e\n\u003cli\u003eHuang, B., Lang, X. \u0026amp; Li, X. The role of IL-6/JAK2/STAT3 signaling pathway in cancers. \u003cem\u003eFront Oncol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 1023177 (2022).\u003c/li\u003e\n\u003cli\u003eZou, S. \u003cem\u003eet al.\u003c/em\u003e Targeting STAT3 in Cancer Immunotherapy. \u003cem\u003eMol Cancer\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 145 (2020).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"gastric cancer, circYTHDF2, miR-146a-5p, PRSS1, JAK2/STAT3 signaling pathway","lastPublishedDoi":"10.21203/rs.3.rs-8689738/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8689738/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e: Gastric cancer (GC) is a malignant tumor that poses a serious threat to human life and health.PRSS1 is a differentially expressed protein in gastric cancer identified by our research group in previous studies; however, the mechanism underlying its role in the initiation and progression of gastric cancer remains unclear. Recent studies have shown that circular RNAs (circRNAs) play an important role in the progression of a variety of cancers.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e: Immunohistochemical staining and Enzyme-Linked Immunosorbent Assay (ELISA) were used to detect the expression of PRSS1 in gastric cancer tissues, and to investigate its biological functions. Through methods including bioinformatics analysis, RNA sequencing (RNA-seq), dual-luciferase reporter gene assay, RNA immunoprecipitation (RIP), and rescue experiment, the upstream regulatory mechanism of PRSS1 was investigated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e: Taken together, we found that PRSS1 has potential diagnostic, prognostic, and therapeutic values in cancer. Herein, we demonstrate that the PRSS1 protein is highly expressed in gastric cancer tissues and sera, and that its expression in tissues is associated with the degree of gastric cancer differentiation. Furthermore, circYTHDF2 is upregulated and was shown to positively regulate the expression of PRSS1 by sponging miR-146a-5p. Fundamentally, PRSS1 affects the proliferation, invasion, and metastasis of GC cells by activating the JAK2/STAT3 pathway. Our findings suggest that the circYTHDF2/miR-146a-5p/PRSS1 axis is involved in the proliferation, invasion, and metastasis of gastric cancer via the JAK2/STAT3 signaling pathway, and may serve as a molecular target for the early diagnosis and prognosis of gastric cancer.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e: Our findings suggest that the circYTHDF2/miR-146a-5p/PRSS1 axis is involved in the malignant biological behaviors of gastric cancer via the JAK2/STAT3 signaling pathway, and may serve as a molecular target for the early diagnosis and prognosis of gastric cancer.\u003c/p\u003e","manuscriptTitle":"The circYTHDF2-miR-146a-5p-PRSS1 Axis Mediates the JAK2-STAT3 Pathway to Promote Gastric Cancer Progression","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-23 11:41:19","doi":"10.21203/rs.3.rs-8689738/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5932c155-4ae0-4136-bbe6-90e5622c1d0f","owner":[],"postedDate":"February 23rd, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-02-28T15:40:23+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-23 11:41:19","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8689738","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8689738","identity":"rs-8689738","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}