Keywords
Lymphoma, ARAP1-AS1, miR-6867-5p, proliferation, apoptosis
1. Introduction
Lymphoma is a cancer that affects human lymph nodes, which are small bean-shaped bumps under the skin. In 2008, lymphomas were classified as Hodgkin (HL), 10%, or non-Hodgkin (NHL), 90% by World Health Organization (WHO) [1]. Statistically, the estimated new cases of lymphoma are 90,390, which including 21,680 estimated deaths in the USA in 2021 [2]. Especially, in adolescents and young adults, lymphomas represent approximately one quarter of all cancers in this age group [3]. Although Lymphoma can be effectively treated in recent years, there are unwanted side effects from medicines and radiation [4]. Since lack the early clinical symptoms, lymphoma is usually diagnosed during the advance stages. Hence, useful bio-indicators in diagnose of lymphoma are needed.
lncRNA i.e., Long and non-coding RNA is defined as a part of noncoding RNAs, who are responsible for the transcription of more than 200 nucleotides in length [5]. Previous research has established that the lncRNA played a vital role in the human tumorigenesis and for development via serving as tumor oncogenes or inhibitors [6, 7], suggesting that lncRNA might function as a biomarker or potential therapeutic target in human cancers. In lymphoma, lncRNA are proved to regulate the development of lymphomas [8, 9, 10]. For instance, lncRNA, SNHG14, was stated to accelerate the cell proliferation, invasion and epithelial-to-mesenchymal in the lymphoma development [11]. Moreover, lncRNA SMAD5-AS1 was shown that downregulation of SMAD5-AS1 enhanced lymphoma cell proliferation in vitro and in vivo [12]. Long noncoding RNA ARAP1 cluster antisense RNA1 (lncRNA ARAP1-AS1), as a novel lncRNA, was published a crucial oncogene in the development of various human cancers, like colorectal cancer [13], lung cancer [14], cervical cancer [15, 16], bladder cancer [17]. Furthermore, the molecular mechanism by which ARAP1-AS1 contributes to Lymphoma progression is yet unclear.
MicroRNAs (miRNAs), a 19–25 nt single-stranded small noncoding RNAs, have been reported as a significant regulator in mediating the post-transcriptional of messenger RNA (mRNA) to regulate gene expression [18]. As a matter of fact, recent investigators have examined that lncRNA could work as sponges through inhibiting microRNAs (miRNAs) expression to facilitate proliferation and metastasis of human tumors [19, 20]. Notably, the function of miRNA regulation in diagnose and therapeutics for lymphoma has been widely disclosed (reviewed by [21, 22]). For instance, Wang et al. studied that miRNA-584 inhibited the development of lymphoma via regulating FOXO [23]. Similarly, miRNA-155 was reported that it could regulate lymphangiogenesis in lymphoma via targeting BRG [24]. For the past two years, only two studies had been focused on miR-6867, and illustrated its molecular mechanism in hepatocellular carcinogenesis [25] and human brain microvascular endothelial cells [26]. Nevertheless, no previous study has investigated the function of miR-6867 in lymphoma development.
The aim of this paper is to study and explore the regulation between ARAP1-AS1 and miR-6867-5p for the development and survival of lymphoma. Our research will provide a new perspective for lymphoma and propose a target gene which will help in the diagnosis and treatment of lymphoma.
2. Materials and methods
2.1. Patient samples
The specimens with tumors and specimens with their adjacent non-tumor which is 20 m at the edge of cancer tissue were obtained from a panel of 36 lymphoma patients at Wuhan the Sixth Hospital i.e., affiliated with Jianghan University. Following tumor excision, the samples were immediately frozen in liquid nitrogen and stored at 80C. All patients signed a consent form and provided their informed consent to participate in the study. This research was supported by the approval from the human ethical committee of the Wuhan the Sixth Hospital i.e., affiliated with the Jianghan University (China).
2.2. Cell culture
Normal human lymphocyte cells and lymphoma human cell lines (Raji, CA46, Ramos) taken from American Type Culture Collection (ATCC) from Maryland (USA). All cell lines were recultured in PRMI 1640 medium i.e., supplemented with 10% (v/v) of fetal bovine serum (FBS; PAN-Biotech, Aidenbach, Germany) and 100 U/ml streptomycin/penicillin (Invitrogen, Carlsbad, USA) in humidified atmosphere containing 5% of CO at 37C. After, medium was changed every second day. Logarithmic phase cells were selected for follow-up study.
2.3. Cell transfection
GenePharma Corporation (China) developed ARAP1-AS1-targeting siRNA (si-lnc) as well as a negative control siRNA (si-NC). The lentiviral vector of sh-ARAP1-AS1 (sh-lnc) and negative control (sh-NC) were purchased from TsingKe (Wuhan, China). MiR-6867-5p mimic and mimic control (miR-NC), miR-6867-5p as inhibitors and its corresponding negative control (inhibitor-NC) were also obtained by GenePharma Corporation (Shanghai, China). Cell transfection was carried out using Lipofectamine 2000 according to the manufacturer’s recommendations, with cell convergence exceeding 70%. After 48 hours, the rate of the transfection was observed by RT-qPCR.
2.4. Xenograft tumor formation
For in vivo experiments, BALB/c nu/nu thymus-deficient mice (nude) were obtained from Guangdong medical laboratory of animal center, China. All mice were allowed to grow in SPF animal experiment centers. After the end of adaptive feeding, the mice (nude) were categorized in two groups, first group was injected with Raji cells that were transfected with sh-ARAP1-AS1 and second group with sh-NC, respectively. The density of cells was 1 10 cells per mouse. These mice were reared for 5 weeks, and the tumor formation in mice, their feeding and drinking habits, and their activity status were observed daily. After, at the end of the experiment, the mice were euthanized by inhalation of diethyl ether, and the tumor was stripped and then fixed. Then these tumors were weighed and size were measured according to previous study [11]. The procedure was carried out in compliance with laboratory animal care protocols. The Animal Care Committee at The Sixth Hospital of Wuhan, Affiliated Hospital of Jianghan University, authorized all animals used in this research.
2.5. Reverse transcription-quantitative PCR (RT-qPCR)
To extract RNA from all cells and tissues, Trizol reagent (Invitrogen) was utilized. The isolated RNAs were then transcribed into cDNA using a Reverse Transcription Kit (Vazyme, China). Gene expression was measured using the SYBR Green PCR Kit (Japan). The ABI 7500 Fast Real-Time PCR instrument was used in this experiment (Applied Biosystems, USA). Expression of lncRNA/mRNA was normalized upto GAPDH, while miRNA expression levels were normalized upto U6. On basis of the sample threshold cycle (Ct) values of trplicates replications, data were analysed. Tsingke (Wuhan China) developed all of the primers for the qRT-PCR experiment. All sequences of primers were provided in Table 1.
Table 1.
| Gene name | Forward primers (5’-3’) | Reverse primers |
|---|---|---|
| ARAP1-AS1 | GAAGGAAGGCTGAAGTCCCT | GAAGGAAGGCTGAAGTCCCT |
| miR-6867-5p | CGGTGTGTGTGTAGAGGAAGAA | GAGGGAGAGGCAGTCAGGTT |
| GAPDH | ACAGTCCATGCCATCACTGC | CACCACTGACACGTTGGCA |
| U6 | CTCGCTTCGGCAGCACA | AACGCTTCACGAATTTGCGT |
2.6. MTT Reduction assay/3-(4,5-Dimethylthiazol- 2-yl)-2,5-diphenyltetrazolium bromide Reduction assay
In elisa plates of 96-wells 3 10 cells were put in each well, after cell transfection. Then 10 ul of MTT reagent (Sigma-Aldrich, USA) was added in each well and incubated for 4 h. After that, discarded the MTT solution and 100 ul of dimethyl sulfoxide (DMSO) was added in each well to dissolved the remaining formazan for 5 min. The absorbance at 570 nm was measured using a microplate spectrophotometer (Thermo Scientific, USA) [27].
2.7. RNA immunoprecipitation (RIP) assay
MagnaRIP, RNA-Binding, Protein Immunoprecipitation Kit (Bedford, USA) was used to perform the RIP experiment [11]. RIPA cell lysis buffer was used to incubate and extract Raji and CA46 cells. The lysates are then processed in RIP buffer with magnetic beads coated with AGO2 antibodies or IgG as a control. The protein was digested with Proteinase K, and the immunoprecipitated RNA was extracted. Then RT-qPCR was performed to analyze ARAP1-AS1 and miR-6867-5p expression levels.
2.8. Luciferase reporter protocols
ARAP1-AS1 (full length) and its mutant (lacking the miR-6867-5p binding sites) were produced, and they were then ligated into pGL3 vectors (Promega, USA). ARAP1-AS1-WT and ARAP1-AS1-Mut are the two variants. Using Lipofectamine 2000 (USA: Invitrogen), these recombinant plasmids were transfected with miR-6867-5p and miR-NC into Raji cells or the CA46 cell line. Dual-Luciferase Reporter Assay System (Promega, USA) was used to determine the luciferase activities after 48 hours transfection [11].
2.9. Flow Cytometry (FC)
The apoptosis was determined using the Annexin V-FITC Apoptosis Detection Kit (Beyotime, China). Manufacturers’ instructions were followed as the previous study [28]. In brief, Raji and CA46 cells lines were collected 48 h after transfection and trypsin was used to remove cells, then centrifugation was done and washing two times with cold PBS. Cells were then suspended in binding buffer at a concentration of 1 10 cells/mL. After that, the cells were stained with 5 L of Annexin V-FITC solution and 10 L of PI solution. The samples were then incubated for 15 minutes at room temperature in the dark. Finally, the apoptosis rate was examined by flow cytometry (San Jose, USA).
2.10. Subcellular fractionation analysis
According to previous study [29], we use NE-PER cytoplasmic and nuclear extraction reagents (Thermo Fisher, USA), for the removal of the cytoplasmic and nuclear fractions of Raji and CA46 cell lines. RT-qPCR was used to evaluate the RNAs. The cytoplasmic and nuclear controls were GAPDH and U6, respectively.
2.11. Statistical analysis
Quantitative data was presented as a mean standard deviation, and tests were carried out in triplicate. For comparison, the student’s t-test was employed. One-way analysis of variance (ANOVA) was also performed between two or more groups. Pearson test was used to analyze the correlation between ARAP1-AS1 and miR-6867-5p in lymphoma samples.
3. Results
3.1. ARAP1-AS1 is upregulated in lymphoma cells and tissues, while ARAP1-AS1 knockdown inhibits lymphoma cell proliferation and accelerates cell apoptosis
RT-qPCR was used to evaluate ARAP1-AS1 expression in several lymphoma cell lines. This finding showed that in comparison with normal lymphocyte cell in these three lymphoma cell lines (Raji, CA46 and Ramos), ARAP1-AS1 was overexpressed (Fig. 1A). According to an RT-qPCR analysis of its expression pattern in 36 pairs of lymphoma and neighboring tissues, the expression level of ARAP1-AS1 in tumor tissues was substantially greater than in surrounding tissues (Fig. 1B). By survival analysis, ARAP1-AS1 with high expression showed the poor survival (Fig. 1C). Furthermore, a sub-cellular fractionation investigation verified the higher concentration of ARAP1-AS1 in Raji and CA46 cells’ cytoplasm (Fig. 1D). According to the results, ARAP1-AS1 may operate as a competitive endogenous RNA (ceRNA) in the development of lymphoma. To explore the further role of ARAP1-AS1 in lymphoma cells, we performed loss of function assays in the Raji and CA46 cells. The results of RT-qPCR demonstrated that ARAP1-AS1 expression was knocked down after transfection with si-ARAP1-AS1 plasmid (Fig. 1E). As a consequence, MTT assay showed that low expression of ARAP1-AS1 assisted to the obviously reduced of Raji and CA46 cell viability (Fig. 1F). Furthermore, knocking down ARAP1-AS1 meaningly improved the apoptosis rate of Raji and CA46 cells (Fig. 1G). ARAP1-AS1 jointly had a critical function in lymphoma cell proliferation and survival.
3.2. Knockdown of ARAP1-AS1 inhibits the lymphoma cell growth in vivo
To corroborate the participation of ARAP1-AS1 in development of lymphoma cells in vivo, xenograft tumor formation experiments were carried out. According to the findings, Raji cells transfected with sh-ARAP1-AS1 developed tumors that were much shorter than Raji cells transfected with sh-NC (Fig. 2A). In proportion, both volume and weight of tumors derived from Raji cells with low expression of ARAP1-AS1 were getting smaller with time than negative control (Fig. 2B–C). These results illuminated that ARAP1-AS1 was positively correlated with lymphoma progression.
3.3. MiR-6867-5p is a target gene of ARAP1-AS1
To corroborate the further molecular mechanism of the ARAP1-AS1 in lymphoma, the bioinformatics analysis was executed to seek potential target gene of ARAP1-AS1. As a result, we found that ARAP1-AS1 confined a promising binding site for miR-6867-5p (Fig. 3A). Furthermore, luciferase reporter experiments exposed that only miR-6867-5p mimics, rather than miR-NC, were able to inhibit the luciferase activity of the wide-type ARAP1-AS1 sequence in Raji and CA46 cells, while having no effect on the mutant ARAP1-AS1 sequence in both cell lines (Fig. 3B). RIP experiments consistently revealed that Ago2 antibody increased ARAP1-AS1 and miR-6867-5p in lymphoma cells when compared to IgG, showing a link between ARAP1-AS1 and miR-6867-5p in lymphoma cells (Fig. 3C). Next, miR-6867-5p expression at mRNA level was examined in lymphoma cells and normal lymphocyte cell by RT-qPCR. The results indicated that compared with normal lymphocyte cell, miR-6867-5p was generally declined in lymphoma cells (Fig. 3D). In cancer tissues, miR-6867-5p mRNA expression was suppressed, as expected (Fig. 3E). In lymphoma cells, ARAP1-AS1 and miR-6867-5p have a negative association, according to Pearson’s correlation analysis (Fig. 3F). Moreover, survival analysis displayed that the lymphoma patients with miR-6867-5p low expression had less survival time (Fig. 3G). ARAP1-AS1 inhibited the expression of miR-6867-5p in lymphoma cells, according to all of these studies.
3.4. ARAP1-AS1 accelerates the proliferation and impairs apoptosis by regulating miR-6867-5p
We first validated the influence of ARAP1-AS1 on miR-6867-5p in lymphoma cells to further delineate the contribution of ARAP1-AS1 to lymphoma development was regulated by a miR-6867-5p-dependent mechanism. As expected, the mRNA expression of miR-6867-5p were promoted when transfected si- ARAP1-AS1 in both Raji and CA46 cells and the inhibitory impact of miR-6867-5p expression was alleviated after co-transfecting si- ARAP1-AS1 and miR-6867-5p inhibitor (Fig. 4A). Meanwhile, MMT assays suggested that the inhibitor miR-6867-5p reduced the repressive impact of si-ARAP1-AS1 on cell viability (Fig. 4B). Inhibition of miR-6867-5p also reduced the apoptosis rate that was promoted in ARAP1-AS1-depleted cells (Fig. 4C). In other words, through down-regulating miR-6867-5p, the lncRNA ARAP1-AS1 boosted lymphoma cell growth and reduced apoptosis.
4. Discussion
There is a mounting body of literature that recognizes the vital role of long-coding RNAs in human cancers by regulating genes expression at various levels, such as epigenetic, transcription and post-transcription [6, 30, 31]. In present, the lncRNA ARAP1-AS1, as a new oncogene, has been demonstrated in a number of malignant tumors. For instance, Li et al. [32] discovered that the lncRNA ARAP1-AS1 targeted the miR-4735-3p/PLAGL2 pathway to produce malignant phenotypes in ovarian cancer cells. ARAP1-AS1 detected cell migration and proliferation in breast cancer through the miR-2110/HDAC2/PLIN1 axis, according to Lu et al. [33]. Furthermore, Zhou et al. [34] discovered that ARAP1-AS1 aided cervical cancer growth by partly controlling POU2F2 expression through miR-149-3p.
ARAP1-AS1 was shown to be elevated in tumor tissues and lymphoma cell lines in this study, which was verified using the RT-qPCR technique. Corresponding with other studies [35, 36, 37], ARAP1-AS1 was also shown to be preferentially localized in the cytoplasm, suggesting that it might be a competitive endogenous RNA (ceRNA) in lymphoma cells. In addition, loss-of-function assays confirmed that ARAP1-AS1 played an important role in survival of the lymphoma cells, by showing that knockdown of ARAP1-AS1 reduced the Raji and CA46 cell viability, while increased the apoptosis of the Raji and CA46 cells. Consistently, the Raji with low expression of ARAP1-AS1 led to remarkable smaller tumor volume in nude mice than the negative control. In conclusion, the lncRNA ARAP1-AS1 might serve as an important biomarker of lymphoma cells.
To further investigate the molecular mechanisms of lncRNA ARAP1-AS1 in enhancing the development of lymphoma cells, we carried out bioinformatics analysis using miRDB database and established that miR-6867-5p had the putative binding site for ARAP1-AS1. MicroRNA (miRNA) is a kind of endogenous and small noncoding RNA, which can regulate cell proliferation, differentiation, apoptosis, cell cycle and tissue development [38]. In addition, prior studies that have noted the importance of microRNA therapeutics in cancer [39, 40]. MiR-6867-5p, as a novel miRNA, has been found that lncRNA MACC1-AS1 functions via sponging miR-6867-5p in human brain microvascular endothelial cells [26]. Moreover, miR-6867-5p was also reported to serve as a target miRNA of Quercetin (3, 3, 4, 5, 7-pentahydroxyflavone) that could inhibit the development of endometriosis [41]. In this study, RIP experiment confirmed the close interaction between ARAP1-AS1 and miR-6867-5pA, and knockdown of ARAP1-AS1 significantly increased the expression of the miR-6867-5p in the lymphoma cell lines. Following that, researchers discovered that ARAP1-AS1 sponging miR-6867-5p promoted lymphoma cell growth and inhibited apoptosis.
In this study, we mainly focus on the effect of the interaction between ARAP1-AS1 and miR-6867-5p on lymphoma growth. Further work needs to be carried out to validate the more complicated mechanisms of ARAP1-AS1 in promoting the development and proliferation of human lymphoma, such as more experiments in vivo and clinical trials.
In a word, our results it was recommended that the lncRNA ARAP1-AS1 played a substantial role in enhancing the multiplication and development of the lymphoma cells through functioning as a miR-6867-5p sponge. This discovery will lead to a new gene target for human lymphoma diagnosis and therapy.
Funding
Funding information is not available.
Ethics approval
The present study was approved by the Ethics Committee of the Sixth Hospital of Wuhan, Affiliated Hospital of Jianghan University (Wuhan, China). The processing of clinical tissue samples is in strict compliance with the ethical standards of the Declaration of Helsinki. All patients signed written informed consent.
This animal experiment was conducted in accordance with the ARRIVE guidelines and was authorized by the Animal Care Committee at the Sixth Hospital of Wuhan, Affiliated Hospital of Jianghan University.
Consent to participate
All patients signed written informed consent.
Consent for publication
Consent for publication was obtained from the participants.
Availability of data and material
All data generated or analyzed during this study are included in this article.
Authors’ contributions
Conception: BP.
Interpretation or analysis of data: BP, YFG, and JW.
Preparation of the manuscript: SFQ.
Revision for important intellectual content: BP, YFG, and JW.
Supervision: BP and YFG.
All authors read and approved the manuscript.
Acknowledgments
None.
Conflict of interest
The authors declare that they have no conflict of interests.
References
- [1]. Polyatskin I.L., Artemyeva A.S. and Krivolapov Y.A., [Revised WHO classification of tumors of hematopoietic and lymphoid tissues, 2017 (4th edition): lymphoid tumors], Arkh Patol 81 (2019), 59–65. [DOI] [PubMed] [Google Scholar]
- [2]. Siegel R.L., Miller K.D., Fuchs H.E. and Jemal A., Cancer Statistics, CA Cancer J Clin 71 (2021), 7–33. [DOI] [PubMed] [Google Scholar]
- [3]. Hochberg J. and Cairo M.S., Lymphoma in Adolescents and Young Adults: Current Perspectives, Cancer J 24 (2018), 285–300. [DOI] [PubMed] [Google Scholar]
- [4]. Ansell S.M., Hodgkin Lymphoma: Diagnosis and Treatment, Mayo Clin Proc 90 (2015), 1574–83. [DOI] [PubMed] [Google Scholar]
- [5]. St Laurent G., Wahlestedt C. and Kapranov P., The Landscape of long noncoding RNA classification, Trends Genet 31 (2015), 239–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [6]. Peng W.X., Koirala P. and Mo Y.Y., LncRNA-mediated regulation of cell signaling in cancer, Oncogene 36 (2017), 5661–5667. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [7]. Wang J., Su Z., Lu S., Fu W., Liu Z., Jiang X. and Tai S., LncRNA HOXA-AS2 and its molecular mechanisms in human cancer, Clin Chim Acta 485 (2018), 229–233. [DOI] [PubMed] [Google Scholar]
- [8]. Gholami A., Farhadi K., Sayyadipour F., Soleimani M. and Saba F., Long noncoding RNAs (lncRNAs) in human lymphomas, Genes Dis 9 (2022), 900–914. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [9]. Karstensen K.T., Schein A., Petri A., Bøgsted M., Dybkær K., Uchida S. and Kauppinen S., Long Non-Coding RNAs in Diffuse Large B-Cell Lymphoma, Noncoding RNA 7 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- [10]. Ghafouri-Fard S., Khoshbakht T., Hussen B.M., Taheri M. and Jamali E., The emerging role non-coding RNAs in B cell-related disorders, Cancer Cell Int 22 (2022), 91. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [11]. Zhao L., Liu Y., Zhang J., Liu Y. and Qi Q., LncRNA SNHG14/miR-5590-3p/ZEB1 positive feedback loop promoted diffuse large B cell lymphoma progression and immune evasion through regulating PD-1/PD-L1 checkpoint, Cell Death Dis 10 (2019), 731. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [12]. Zhao C.C., Jiao Y., Zhang Y.Y., Ning J., Zhang Y.R., Xu J., Wei W. and Kang-Sheng G., Lnc SMAD5-AS1 as ceRNA inhibit proliferation of diffuse large B cell lymphoma via Wnt/β-catenin pathway by sponging miR-135b-5p to elevate expression of APC, Cell Death Dis 10 (2019), 252. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [13]. Ye Y., Gu B., Wang Y., Shen S. and Huang W., YY1-Induced Upregulation of Long Noncoding RNA ARAP1-AS1 Promotes Cell Migration and Invasion in Colorectal Cancer Through the Wnt/β-Catenin Signaling Pathway, Cancer Biother Radiopharm 34 (2019), 519–528. [DOI] [PubMed] [Google Scholar]
- [14]. Tao X., Zhang Y., Li J., Ni Z., Tao Z., You Q., He Z., Huang D. and Zheng S., Low expression of long non-coding RNA ARAP1-AS1 can inhibit lung cancer proliferation by inducing G0/G1 cell cycle organization, J Thorac Dis 12 (2020), 7326–7336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [15]. Zhang Y., Wu D. and Wang D., Long non-coding RNA ARAP1-AS1 promotes tumorigenesis and metastasis through facilitating proto-oncogene c-Myc translation via dissociating PSF/PTB dimer in cervical cancer, Cancer Med 9 (2020), 1855–1866. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- [16]. Min H. and He W., Long non-coding RNA ARAP1-AS1 promotes the proliferation and migration in cervical cancer through epigenetic regulation of DUSP5, Cancer Biol Ther 21 (2020), 907–914. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [17]. Teng J., Ai X., Jia Z., Wang K., Guan Y. and Guo Y., Long non-coding RNA ARAP1-AS1 promotes the progression of bladder cancer by regulating miR-4735-3p/NOTCH2 axis, Cancer Biol Ther 20 (2019), 552–561. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [18]. Ali Syeda Z., Langden S.S.S., Munkhzul C., Lee M. and Song S.J., Regulatory Mechanism of MicroRNA Expression in Cancer, Int J Mol Sci 21 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- [19]. Cao H.L., Liu Z.J., Huang P.L., Yue Y.L. and Xi J.N., lncRNA-RMRP promotes proliferation, migration and invasion of bladder cancer via miR-206, Eur Rev Med Pharmacol Sci 23 (2019), 1012–1021. [DOI] [PubMed] [Google Scholar]
- [20]. Kong X., Duan Y., Sang Y., Li Y., Zhang H., Liang Y., Liu Y., Zhang N. and Yang Q., LncRNA-CDC6 promotes breast cancer progression and function as ceRNA to target CDC6 by sponging microRNA-215, J Cell Physiol 234 (2019), 9105–9117. [DOI] [PubMed] [Google Scholar]
- [21]. Qadir M.I. and Faheem A., miRNA: A Diagnostic and Therapeutic Tool for Pancreatic Cancer, Crit Rev Eukaryot Gene Expr 27 (2017), 197–204. [DOI] [PubMed] [Google Scholar]
- [22]. Wu M., Wang G., Tian W., Deng Y. and Xu Y., MiRNA-based Therapeutics for Lung Cancer, Curr Pharm Des 23 (2018), 5989–5996. [DOI] [PubMed] [Google Scholar]
- [23]. Wang C.C., Han L., Hou Y.H. and Ying X.Y., MiRNA-584 suppresses the progression of NK/T-cell lymphoma by targeting FOXO1, Eur Rev Med Pharmacol Sci 24 (2020), 4404–4411. [DOI] [PubMed] [Google Scholar]
- [24]. Chang Y., Cui M., Fu X., Zhang L., Li X., Li L., Wu J., Sun Z., Zhang X., Li Z., Nan F., Yan J. and Zhang M., MiRNA-155 regulates lymphangiogenesis in natural killer/T-cell lymphoma by targeting BRG1, Cancer Biol Ther 20 (2019), 31–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [25]. Dang S., Zhou J., Chen Y., Chen P., Ji M., Shi B., Yang Q. and Hou P., Dynamic expression of ZNF382 and its tumor-suppressor role in hepatitis B virus-related hepatocellular carcinogenesis, Oncogene 38 (2019), 4804–4819. [DOI] [PubMed] [Google Scholar]
- [26]. Yan G., Zhao H. and Hong X., LncRNA MACC1-AS1 attenuates microvascular endothelial cell injury and promotes angiogenesis under hypoxic conditions via modulating miR-6867-5p/TWIST1 in human brain microvascular endothelial cells, Ann Transl Med 8 (2020), 876. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [27]. Cao X., Fu M., Bi R., Zheng X., Fu B., Tian S., Liu C., Li Q. and Liu J., Cadmium induced BEAS-2B cells apoptosis and mitochondria damage via MAPK signaling pathway, Chemosphere 263 (2021), 128346. [DOI] [PubMed] [Google Scholar]
- [28]. Wu W., Yang J., Feng X., Wang H., Ye S., Yang P., Tan W., Wei G. and Zhou Y., MicroRNA-32 (miR-32) regulates phosphatase and tensin homologue (PTEN) expression and promotes growth, migration, and invasion in colorectal carcinoma cells, Mol Cancer 12 (2013), 30. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [29]. Zhang Z., He J. and Wang B., Circular RNA circ_HECTD1 regulates cell injury after cerebral infarction by miR-27a-3p/FSTL1 axis, Cell Cycle 20 (2021), 914–926. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [30]. Zhang X. and Ho T.T., Computational Analysis of lncRNA Function in Cancer, Methods Mol Biol 1878 (2019), 139–155. [DOI] [PubMed] [Google Scholar]
- [31]. Ma Y., Zhang J., Wen L. and Lin A., Membrane-lipid associated lncRNA: A new regulator in cancer signaling, Cancer Lett 419 (2018), 27–29. [DOI] [PubMed] [Google Scholar]
- [32]. Zhao X., Dong W., Luo G., Xie J., Liu J. and Yu F., Silencing of hsa_circ_0009035 Suppresses Cervical Cancer Progression and Enhances Radiosensitivity through MicroRNA 889-3p-Dependent Regulation of HOXB7, Mol Cell Biol 41 (2021), e0063120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [33]. Lu C., Wang X., Zhao X., Xin Y. and Liu C., Long non-coding RNA ARAP1-AS1 accelerates cell proliferation and migration in breast cancer through miR-2110/HDAC2/PLIN1 axis, Biosci Rep 40 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- [34]. Zhou L. and Xu X.L., Long Non-Coding RNA ARAP1-AS1 Facilitates the Progression of Cervical Cancer by Regulating miR-149-3p and POU2F2, Pathobiology 88 (2021), 301–312. [DOI] [PubMed] [Google Scholar]
- [35]. Zhan Y., Chen Z., Li Y., He A., He S., Gong Y., Li X. and Zhou L., Long non-coding RNA DANCR promotes malignant phenotypes of bladder cancer cells by modulating the miR-149/MSI2 axis as a ceRNA, J Exp Clin Cancer Res 37 (2018), 273. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [36]. Liu G., Ye Z., Zhao X. and Ji Z., SP1-induced up-regulation of lncRNA SNHG14 as a ceRNA promotes migration and invasion of clear cell renal cell carcinoma by regulating N-WASP, Am J Cancer Res 7 (2017), 2515–2525. [PMC free article] [PubMed] [Google Scholar]
- [37]. Zhao X., Liu Y., Li Z., Zheng S., Wang Z., Li W., Bi Z., Li L., Jiang Y., Luo Y., Lin Q., Fu Z. and Rufu C., Linc00511 acts as a competing endogenous RNA to regulate VEGFA expression through sponging hsa-miR-29b-3p in pancreatic ductal adenocarcinoma, J Cell Mol Med 22 (2018), 655–667. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [38]. Gulyaeva L.F. and Kushlinskiy N.E., Regulatory mechanisms of microRNA expression, J Transl Med 14 (2016), 143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [39]. Rupaimoole R. and Slack F.J., MicroRNA therapeutics: towards a new era for the management of cancer and other diseases, Nat Rev Drug Discov 16 (2017), 203–222. [DOI] [PubMed] [Google Scholar]
- [40]. Mazziotta C., Cervellera C.F., Lanzillotti C., Touzé A., Gaboriaud P., Tognon M., Martini F. and Rotondo J.C., MicroRNA dysregulations in Merkel cell carcinoma: Molecular mechanisms and clinical applications, J Med Virol 95 (2023), e28375. [DOI] [PubMed] [Google Scholar]
- [41]. Park S., Lim W., Bazer F.W., Whang K.Y. and Song G., Quercetin inhibits proliferation of endometriosis regulating cyclin D1 and its target microRNAs in vitro and in vivo, J Nutr Biochem 63 (2019), 87–100. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data generated or analyzed during this study are included in this article.