A dual interaction between RSV NS1 and MED25 ACID domain reshapes antiviral responses

A dual interaction between RSV NS1 and MED25 ACID domain reshapes antiviral responses | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results A dual interaction between RSV NS1 and MED25 ACID domain reshapes antiviral responses Célia Ait-Mouhoub , Jiawei Dong , Magali Noiray , Jenna Fix , Stepanka Nedvedova , Alexis Verger , Jean-Francois Eleouet , Delphyne Descamps , Monika Bajorek , View ORCID Profile Christina Sizun doi: https://doi.org/10.1101/2025.01.23.634448 Célia Ait-Mouhoub 1 Virologie et Immunologie Moléculaire, INRAE, UVSQ, Université Paris-Saclay , Jouy-en-Josas, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jiawei Dong 2 Institut de Chimie des Substances Naturelles, CNRS, Université Paris-Saclay , Gif-sur-Yvette, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Magali Noiray 3 Institute for Integrative Biology of the Cell, CNRS, CEA, Université Paris-Saclay , Gif-sur-Yvette, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jenna Fix 1 Virologie et Immunologie Moléculaire, INRAE, UVSQ, Université Paris-Saclay , Jouy-en-Josas, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Stepanka Nedvedova 2 Institut de Chimie des Substances Naturelles, CNRS, Université Paris-Saclay , Gif-sur-Yvette, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Alexis Verger 4 EMR 9002 Integrative Structural Biology, CNRS, INSERM, Université de Lille, Institut Pasteur de Lille , Lille, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jean-Francois Eleouet 1 Virologie et Immunologie Moléculaire, INRAE, UVSQ, Université Paris-Saclay , Jouy-en-Josas, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Delphyne Descamps 1 Virologie et Immunologie Moléculaire, INRAE, UVSQ, Université Paris-Saclay , Jouy-en-Josas, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Monika Bajorek 1 Virologie et Immunologie Moléculaire, INRAE, UVSQ, Université Paris-Saclay , Jouy-en-Josas, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: christina.sizun{at}cnrs.fr monika.bajorek{at}inrae.fr Christina Sizun 2 Institut de Chimie des Substances Naturelles, CNRS, Université Paris-Saclay , Gif-sur-Yvette, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Christina Sizun For correspondence: christina.sizun{at}cnrs.fr monika.bajorek{at}inrae.fr Abstract Full Text Info/History Metrics Preview PDF Abstract Respiratory syncytial virus (RSV), the most common cause of bronchiolitis and pneumonia in infants, elicits a remarkably weak innate immune response. This is partly due to the type I interferon (IFN-I) antagonism of the non-structural RSV NS1 protein. It was recently suggested that NS1 could modulate host transcription via an interaction with the MED25 subunit of the Mediator complex. Previous work emphasized the role of the NS1 C-terminal helix α3 for recruitment of the MED25 ACID domain, a target of transcription factors (TFs). Here we show that the NS1 α/β core domain binds to MED25 ACID, and acts cooperatively with NS1 α3 to achieve nanomolar affinity. This strong interaction is rationalized by the dual NS1 binding site on MED25 ACID predicted by AlphaFold3, which overlaps with the two canonical binding interfaces of TF transactivation domains (TADs), H1 and H2. By NMR, we confirmed that the NS1 α/β core domain targets the H2 interface. Several single amino acid NS1 α/β core domain mutations displayed reduced affinity for MED25 ACID, both in vitro and in cellula, at a comparable extent to the deletion of NS1 α3. These mutations resulted in attenuated replication of recombinant RSV (rRSV) and increased expression of several antiviral interferon-stimulated genes (ISG) in interferon-competent cells. In MED25 knockdown cells, rRSV-mCherry replication was further attenuated, in line with the upregulation of IFT1 and ISG15 ISGs. The difference between WT and NS1 mutant rRSV-mCherry was partially lost, suggesting that RSV uses MED25 to control antiviral responses, by a mechanism involving the NS1−MED25 ACID complex. The strong interaction and the extended binding surface of NS1 on MED25 ACID provide evidence for a mechanism, where NS1 blocks access of transcription factors to MED25 ACID, and thereby MED25 mediated transcription activation. Author Summary Respiratory syncytial virus (RSV) is a major pathogen for acute lower respiratory infections in infants and in the elderly. RSV elicits a remarkably weak immune response. It has developed a unique strategy to counteract the immune system, by encoding two small multifunctional proteins, RSV NS1 and NS2. NS1 is involved in interferon antagonism in the cytosol. Recently NS1 was shown to modulate host transcription in the nucleus. However, the mechanisms underpinning this function are not fully clear. Here we focus on the interplay between NS1 and the cellular MED25 coactivator protein, which can contribute to the antiviral response by activating several innate immune response genes. The MED25 C-terminal ACtivator Interacting Domain (ACID), a target of cellular transcription factors (TF), is a key feature for this function. To investigate the impact of MED25 hijacking by NS1, we combined in vitro biophysical experiments and cellular assays to probe the relationship between the stability of the NS1−MED25 ACID complex and RSV replication as well as antiviral responses. Our results suggest that this interaction is correlated with antiviral response antagonism, probably by hindering TFs to interact with MED25-ACID. This knowledge might pave the way for antiviral strategies aimed at stimulating appropriate immune responses. Introduction Human respiratory syncytial virus (hRSV) is the most common cause of acute lower respiratory tract infections in infants and elderly ( 1 ). In 2019, an estimated 33 million cases of RSV occurred in infants worldwide, requiring 3.6 million hospitalizations and resulting in ∼100,000 deaths among children under the age of five ( 2 ). While vaccines for older adults and pregnant women, as well as prophylactic antibodies for infants, were marketed recently, there is still no affordable effective specific treatment for RSV ( 3 , 4 ). RSV elicits a remarkably weak innate immune response, and RSV-infected infants produce very low type-I interferon (IFN-I) levels ( 5 ). To find new directions for antiviral therapies, a better understanding of RSV pathogenesis, in particular of RSV immune response evasion, is needed. RSV is an enveloped, negative-strand RNA virus of the Pneumoviridae family, Mononegavirales order ( 6 ). Its genome is composed of 10 genes encoding 11 proteins, including two non-structural proteins, NS1 and NS2. RSV NS1 and NS2 have no homologs outside the Orthopneumovirus genus. They constitute a unique strategy of RSV to evade the host immune system. NS1 and NS2 interfere with several IFN induction mechanisms and act individually or together as antagonists of antiviral pathways ( 7 – 11 ). The RSV NS1 gene is the first transcribed, suggesting a critical role at the beginning of infection. NS1 is a small protein of 139 amino acids that interferes with type-I IFN induction and signaling ( 10 , 11 ). Several cytoplasmic targets of NS1 have been identified. NS1 interacts with E3-ubiquitin ligase TRIM25 and inhibits the ubiquitination of innate immune receptor RIG-I, thereby preventing RIG-I mediated IFN production ( 12 ). NS1 acts as a scaffold protein for a multi-subunit E3 ligase complex, leading to degradation of TNF receptor associated factor 3 (TRAF3), thereby lowering induction of interferon stimulated genes (ISGs) ( 13 ) ( 14 , 15 ). NS1 also prevents premature apoptosis ( 16 ). Furthermore, NS1 was suggested to contribute to host-range restriction ( 10 , 17 ). A fraction of RSV NS1 is present in the nucleus of infected epithelial cells, where it associates with host nuclear proteins ( 14 , 18 , 19 ). It was recently shown that RSV NS1 modulates host cell gene transcription via interactions with chromatin and with the Mediator complex ( 20 ). The multi-subunit Mediator complex is a transcriptional co-regulator that is essential for the regulation of RNA polymerase II transcription in eukaryotes ( 21 – 23 ). Its main function is to transduce regulatory information from sequence specific transcription factors (TFs) bound to enhancer regions to the promoter-bound basal RNA pol II machinery. The Mediator is hijacked by a number of viruses, in particular DNA viruses and retroviruses, e.g. herpes simplex virus, human papilloma virus and dengue virus, to control viral and host gene expression ( 24 ). The Mediator subunit MED25 was first found to be an interactor of NS1 by quantitative proteomics ( 18 ). This interaction was independently confirmed by affinity purification-mass spectrometry ( 20 ), a yeast two-hybrid screen and luciferase complementation ( 25 ), and a BioID proximity screen complemented by two other binary protein-protein interaction screens ( 26 ). Finally, RSV replication was shown to be enhanced in interferon-competent epithelial A549 lung cells, where MED25 was knocked out ( 26 ), establishing a link between NS1 interferon antagonism and MED25 regulated transcription. MED25 contains two folded domains connected by a long disordered loop and a disordered Q-rich C-terminal region. The N-terminal von Willebrand (VWA) domain anchors MED25 to the Mediator. The C-terminal ACtivator Interacting Domain (ACID) of MED25 is recruited by acidic transactivation domains (TADs) of DNA-binding TFs ( 27 ). Its structure was solved by NMR, and contains a β-barrel domain flanked by three α-helices and dynamic loops ( 28 – 31 ). Mammalian MED25 ACID displays two distinct TAD binding interfaces, termed H1 and H2, which are located on two opposite faces of the β-barrel. ETV/PEA3 family TADs target the H1 interface ( 32 , 33 ), whereas ATF6α targets the H2 interface ( 34 ) ( 35 ). Tandem TADs of p53 ( 36 ) and Herpes simplex VP16 each bind to one of these interfaces ( 27 ). We previously identified MED25 ACID as the binding domain of NS1 ( 25 ). RSV NS1 contains a compact α/β core domain, composed of a 7-stranded β-sandwich domain and α-helix (α1), and a C-terminal α-helix (α3) ( 37 ). NS1 α3 was reported to be involved in the modulation of host response and gene expression ( 20 , 37 ). We showed that the NS1 α3 deletion strongly impaired MED25 ACID binding, indicating that α3 is a main determinant for MED25 ACID binding ( 25 ). NMR experiments indicated that NS1 α3, as an isolated peptide, bound to the MED25 ACID H2 interface, similarly to specific TADs ( 25 ). Moreover, NS1 was able to compete for binding with the TAD of ATF6α, a master regulator of the endoplasmic reticulum stress response, which activates the unfolded protein response (UPR) ( 38 ). ATF6α TAD binds to the MED25 ACID H2 interface ( 35 ). Unlike DNA-specific TFs that recruit MED25, NS1 lacks a DNA binding domain, and hence cannot transduce information to a promoter. We thus hypothesized that NS1 may impair host gene transcription activation by occluding the H2 TAD binding site of MED25 ACID and preventing its recruitment by cellular TFs. However, many aspects of the NS1−MED25 ACID interaction remained puzzling. In particular, the NS1 α3 peptide displayed only 10 µM affinity, as compared to 20 nM for full-length NS1 ( 25 ). We therefore reasoned that the NS1 α/β core domain also binds to MED25 ACID, and found out that NS1 α3 and the α/β core domain cooperatively bind to MED25 ACID. Ab initio prediction of the MED25 ACID-NS1 complex structure suggested that NS1 binds to both H1 and H2 interfaces via its α3 and α/β core subdomains, respectively. Several NS1 α/β core domain alanine substitutions located in the interface reduced the NS1−MED25 ACID interaction as potently as α3 deletion. These mutations attenuated RSV replication, and induced higher transcription levels for four antiviral ISGs. In cells depleted of MED25, rRSV-mCherry replication was attenuated for WT as well as NS1 mutant rRSV, and the advantage of NS1 WT over NS1 mutants was lost. Based on these results, we hypothesize that RSV uses MED25 to evade cellular antiviral responses by precluding activation via MED25-specific TFs, due to efficient competitive binding of the entire NS1 to both TAD binding sites of MED25 ACID. Results Ab initio structural model of the NS1−MED25 ACID complex We previously observed by NMR that the isolated NS1 α3 peptide bound to the MED25 ACID H2 interface, with a Kd of 10 µM ( 25 ). NS1 α3 induced NMR signal perturbations similar to those of H2-binding TADs ( 28 , 31 ). We also observed secondary binding to the H1 interface by NMR, but with much lower affinity (Kd 500 µM). Structure prediction of the MED25 ACID−NS1 α3 complex with machine-learning algorithms suggested that NS1 α3 binds to the canonical TAD-binding interfaces of MED25 ACID, but could not discriminate between H1 and H2 interfaces ( 27 ). Moreover, we had previously noticed that deletion of α3 not fully impaired MED25 ACID binding ( 25 ). Therefore, we generated ab initio structural complex models by deep learning methods using full-length NS1. High accuracy models were obtained with AlphaFold2 ( 39 ) and AlphaFold3 ( 40 ). The two algorithms provided similar results ( Fig 1 ). Download figure Open in new tab Fig 1. AlphaFold3 structural prediction of the complex between human MED25 ACID and RSV NS1. (A) Proteins are in cartoon representation. MED25 ACID is displayed with the α3 helix and the H1 interface in front view. The position of α-helices and the NS1 α/β core are indicated. Individual protein models were colored either in gray or according to the predicted local-distance difference test (pLDDT) confidence score, using the ChimeraX AlphaFold color palette ( 41 ). (B) Predicted aligned error (PAE) matrix for the complex with residues 1-155 (MED25 ACID) and residues 156-294 (NS1). The individual protein structures were rather well predicted, with predicted template modeling (pTM) scores of 0.75 and 0.79, for MED25 ACID and NS1 respectively. The two MED25 ACID helices α1 and α3 were predicted with lower predicted local-distance difference test (pLDDT) scores ( Fig 1 ). The large loops of MED25 ACID were also less well defined. This is consistent with previous reports that described the latter as highly dynamic ( 35 , 42 ). A high confidence was found for the complex interface with an AF3 interface pTM (ipTM) score of 0.72, as illustrated by the predicted aligned error (PAE) matrix ( Fig 1 ). In all complex models, NS1 was clamped onto the MED25 ACID β-barrel on each side of the α1/α3 helix pair. Surprisingly, the C-terminal NS1 α3 helix is predicted to bind to the H1 interface, while the NS1 α/β core makes extensive contacts with the H2 interface. Notably, α3 is no longer associated to the domain, unlike in the dimeric NS1 crystal structure ( 37 ), where α3 contributes to intra-and inter-protomer contacts. This suggests that potential dimers are disrupted upon complex formation. This hypothesis is supported by the same NS1 β-sheet being involved in the NS1 dimer and in the MED25 ACID interface. Of note, NS1 residue D102, which is mutated in the construct used here and derived from RSV strain Long, is outside the interaction region. In summary, AlphaFold3 predicts that full-length NS1 uses a dual binding site on MED25 ACID, comprising both TAD-binding interfaces. It also suggests that conformational changes occur upon complex formation both in NS1 and MED25 ACID, presumably in the less defined protein regions. Binding of NS1 with α3 deletion to MED25 ACID To assess the contribution of the NS1 α/β core domain to MED25 ACID binding, we measured real time association/dissociation kinetics using bio-layer interferometry (BLI). We used recombinant His-tagged MED25 ACID as a ligand, and full-length NS1 or the C-terminally truncated NS1Δα3 (NS1 aa 1-116) proteins as analytes. Measurements were done in Tris pH 8, NaCl buffer at a temperature of 25°C. Under these conditions, NS1 does not self-assemble ( 43 ). His-tagged MED25 ACID was successfully loaded onto Ni-NTA biosensors, which were subsequently incubated with NS1 or NS1Δα3 ( Supplementary Fig S1 ). The NS1 BLI data were well fitted with a 1:1 binding model ( Table 1 ). A K d of 16 nM was determined, in line with previous ITC data (15 nM). Association of NS1 was rather slow with a rate ka of 0.12 µM -1 .s -1 , as compared to the values reported for the TADs of VP16, ERM or ATF6α (300-1,100 µM -1 .s -1 ) ( 35 ). Dissociation was also slow, with a rate kdis of 2 10 -3 s -1 versus 100-400 s -1 for TADs. View this table: View inline View popup Download powerpoint Table 1 Bio-layer interferometry (BLI) binding equilibrium and kinetic parameters for the NS1 and NS1Δα3 complexes with MED25 ACID. Kd dissociation constant (nM), ka association rate (µM -1 .s -1 ), kd dissociation rate ((s -1 ) x10 3 ). The sum of squared deviations Χ 2 and the coefficient of determination R 2 are given as indicators for the quality of curve fits. BLI data at pH 8 and 298 K were fitted with a 1:1 binding model for NS1, and with a 2:1 heterogeneous binding model for NS1Δα3. Contrary to NS1, a single binding site model failed to reproduce BLI data obtained with NS1Δα3. However, the data were well fitted with a 2:1 heterogeneous binding model ( Supplementary Fig S1, Table 1 ). This model applies in the case, where two different populations of NS1−MED25 ACID complex are formed, both with 1:1 stoichiometry. The two binding modes of NS1Δα3 afforded close K d values (615 and 850 nM). These values are 1-2 orders of magnitude higher than the Kd of the NS1 α3 peptide alone (10 µM, measured by NMR and by ITC ( 25 )), confirming that the NS1 α/β core domain binds to MED25 ACID on its own. While the two binding modes of NS1Δα3 cannot be distinguished in terms of affinity, they differ in terms of kinetics. Mode 1 (75% populated) displayed both faster association and faster dissociation than mode 2 (25% populated) ( Table 1 ). Overall, the association rates for NS1Δα3 were lower than for full-length NS1, which points to the contribution of NS1 α3. In binding mode 1, the association kinetics of NS1Δα3 and NS1 were comparable, but NS1Δα3 dissociated faster, resulting in lower affinity, and suggesting the formation of an encounter complex. Conversely, in mode 2, the dissociation kinetics were similar, but NS1Δα3 associated more slowly, resulting again in lower affinity, and suggesting that a tighter complex is formed in mode 2. This tighter complex may result from slow rearrangements taking place after formation of the mode 1 complex following an induced fit mechanism, or from conformational selection of either NS1 Δα3 or MED25 ACID, assuming conformational equilibria for these proteins. The affinity of NS1Δα3 is 1-2 orders of magnitude lower than that of full-length NS1, and the affinity of the NS1 α3 peptide is 3 orders of magnitude lower. The substantial affinity gain of full-length NS1 versus its isolated α3 and α/β core subdomains thus strongly indicates cooperative binding. This can only be rationalized by a dual binding mode, as proposed in the AlphaFold3 model of the NS1−MED25 ACID complex. To rule out a bias due to an altered protein structure, we measured thermal protein unfolding using dynamic scanning fluorimetry (DSF). NS1 and NS1Δα3 displayed similar sample brightness and 350 nm/330 nm fluorescence ratios. Both proteins showed cooperative unfolding, with transition temperatures of 69.5°C and 65.8°C, respectively ( Supplementary figure S2 ). This indicates that although the Δα3 mutation slightly destabilizes NS1, NS1Δα3 is folded similarly to the α/β core domain in NS1. To get structural insight, we generated AlphaFold3 models of the NS1Δα3−MED25 ACID complex. The interface confidence was lower than with NS1 (ipTM 0.6). Nevertheless, the models indicate that NS1Δα3 targets the H2 interface of MED25 ACID. In the absence of α3, NS1Δα3 binds to MED25 ACID similarly to the α/β domain of NS1, with only small rearrangements ( Supplementary Fig S3A ). The NS1 α/β core domain is slightly rotated on the H2 interface, and the two MED25 ACID α1 and α3 helices are slightly displaced with respect to the MED25 ACID β-barrel ( Supplementary Fig S3B ). This suggests that conformational changes may occur in MED25 ACID α1 and α3 helices, and that these helices may couple the two H1 and H2 interfaces. To obtain experimental evidence for binding of NS1 α/β core domain to the H2 interface of MED25 ACID, we used NMR. We measured 2D 1 H- 15 N HSQC spectra of 15 N-labeled MED25 ACID mixed with unlabeled NS1Δα3 or NS1. Samples were prepared in a buffer at pH 6.5 to ensure that amide signals are not broadened by solvent exchange. At a 1:1 molar ratio, most MED25 ACID amide NMR signals became nearly undetectable due to severely line broadening. This is indicative of the formation of a protein complex, as a size increase leads to more efficient transverse 15 N relaxation. To detect differential line broadening induced by chemical exchange at the interface of the complex, we measured intensities at a lower NS1Δα3 or NS1 molar ratio ( Fig 2A, B ). At a 0.5 ratio, NS1Δα3 and NS1 induced similar perturbation patterns. Global line broadening was observed, and residual intensities I/I0 were ∼0.5. Only sharp signals clustered at the center of the HSQC spectrum, which also displayed higher intensities in free MED25-ACID, displayed higher I/I0 values (areas shaded in grey in Fig 2C,D ). They were assigned to the disordered N-terminus (A373-M388) and a long flexible loop (E410-L423), which remain flexible in the complex. Line broadening for the ordered regions of MED25 ACID was not uniform. This was more marked for NS1Δα3 compared to NS1, and may be explained by the faster binding kinetics. In particular, MED25 ACID residues 450-470 (helix α1 and strand β4) and residues 510-542 (strands β6 and β7), encompassing the H2 interface of MED25 ACID, displayed lower intensities, and delineated a large perturbation area, when mapped onto the 3D structure of MED25 ACID ( Fig 2E,F ). Perturbations observed for the C-terminal α3 helix of MED25 ACID, which is not part of the H2 interface, but antiparallel to the α1 helix, suggest that α3 might sense conformational changes in α1 as a result of NS1Δα3/NS1 binding. Taken together, NMR data indicate that the NS1 α/β core domain targets the H2 interface of MED25 ACID, in agreement with the AlphaFold3 models, and in apparent contradiction with previous NMR data, where NS1 α3 targeted the same interface. Download figure Open in new tab Fig 2. NMR analysis of NS1 and NS1Δα3 binding to MED25 ACID . (A,B) Superimposition of 2D 1 H- 15 N HSQC spectra of 15 N-MED25 ACID (100 µM) alone (black) and mixed with 0.5 molar equivalent of NS1Δα3 (green, A ) or full-length NS1 (red, B ). Samples were prepared in 20 mM Na phosphate pH 6.5, 100 mM NaCl, 5 mM TCEP buffer. Experiments were carried out at 800 MHz 1 H resonance frequency and at a temperature of 293 K. (C,D) Residual intensities of MED25 ACID were calculated as the ratio of intensities in the presence and absence of NS1Δα3 or NS1 for each amide signal (I/I0, filled dots). The mean and mean - SD values were drawn with broken lines. Mean values and standard deviations (SD) were calculated from residues in folded regions. The amide signal intensities of MED25 ACID alone were plotted on the same diagram with arbitrary units (white dots). Disordered regions at the N-terminus of MED25 ACID and in the E410-L423 loop were highlighted in grey. Regions with I/I0 < mean − SD were highlighted in yellow. (E,F) Residues with marked intensity attenuation were mapped onto the 3D structure of MED25 ACID represented in cartoon. The H2 TAD-binding interface is in front view. Residues with mean − SD < I/I0 < mean are in light color and I/I0 < mean − SD in bright color. Identification of NS1 α/β core domain residues critical for MED25 ACID binding in vitro Based on the MED25 ACID−NS1 AlphaFold3 prediction, we mutated five NS1 interface residues into alanine. Four amino acid substitutions are located on the B1 β-sheet of NS1, with I54 and F56 on strand β4, and E110 and K112 on strand β7 ( Fig 3A ). I54, F56, and E110 were chosen close to the MED25 ACID M523 residue ( Fig 3A ), as the M523E mutation disrupted the interaction with NS1 ( 25 ). M122 is at the N-terminus of helix α3. An NCBI Virus blast query showed that these five positions are highly conserved within a set of 471 human RSV NS1 sequences: 16 mismatches were detected for I54, 9 for F56, 2 for E110, 2 for K112, and 1 mismatch for M122. Download figure Open in new tab Fig 3. Mutational analysis of NS1 binding to MED25 ACID in vitro. (A) Residues selected for mutational analysis, located at the interface between NS1 and MED25 ACID, based on the AlphaFold3 MED25 ACID−NS1 complex structure. Proteins are in cartoon representation. MED25 ACID is in gray, and NS1 in blue and cyan. The NS1 β-sheet B1 is in dark blue, β-sheet B2 and helix α3 in cyan. NS1 residues that were mutated into alanine (I54, F56, E110, K112, and M122) are in orange sticks. MED25 ACID M523, which was previously shown to be involved in the MED25 ACID−NS1 interaction, is in red sticks. (B) Dissociation constants (Kd) of the MED25 ACID−NS1 complex measured by BLI for WT and mutated NS1. A 2:1 heterogeneous binding model was used for mutated NS1. The relative population (%) of the first binding mode is indicated on top of the bars. (C) Association (ka) and dissociation (kdis) rates measured by BLI. (D) Enthalpy (ΔH) and entropic contributions to free energy (-TΔS) measured by Isothermal Titration Calorimetry (ITC) for MED25 ACID binding to WT and mutated NS1. (E) Dissociation constants (Kd) measured by ITC. We produced recombinant mutated NS1 protein, and measured the interaction with MED25 ACID by BLI ( supplementary figure S1 ). All NS1 variants made specific interactions with MED25 ACID. Similarly to NS1Δα3, data could not be accurately fitted with a single site binding model. We thus used extracted thermodynamic and kinetic parameters with a 2:1 heterogeneous binding model ( Table 2 , Fig 3B ). The affinities spanned a range over two orders of magnitude with Kd values between 7.5 nM and 1.6 µM. NS1 single amino acid mutations E110A (K d1 1.3 µM, K d2 1.6 µM) and F56A (K d1 330 nM; 80% populated) were the most efficient to disrupt the complex, and the loss of affinity was comparable to that of the NS1 Δα3 deletion. View this table: View inline View popup Download powerpoint Table 2. Bio-layer interferometry (BLI) binding equilibrium and kinetic parameters for the complex of NS1 with single amino acid substitutions with MED25 ACID. Kd dissociation constant (nM), ka association rate (µM -1 .s -1 ), kd dissociation rate ((s -1 ) x10 3 ). The sum of squared deviations Χ 2 and the coefficient of determination R 2 are given as indicators for the quality of curve fits. Data were measured at pH 8 and 298 K and fitted with a 2:1 heterogeneous binding model. All mutated NS1 proteins displayed a binding mode with fast association (mode 1). The association rates (k a1 0.12-0.21 µM -1 .s -1 ) were close to that of NS1 (0.12 µM -1 .s -1 ), and slightly higher than that of NS1Δα3 (0.08 µM -1 .s -1 ) ( Table 2 , Fig 3C ). Mode 1 was the lower affinity mode, and the strength of the interaction inversely correlated with the dissociation rate (k dis1 9-190 10 -3 s -1 ). Mode 1 was higher populated for NS1 with single amino substitutions that were most impaired for MED25 ACID binding (F56A, E110A). The higher affinity binding mode (mode 2) generally displayed slower association. It also displayed slower dissociation, with dissociation rates (k dis2 1.1-3.4 10 -3 s -1 ) in the same range as that of WT NS1 (2 10 -3 s -1 ). Mode 2 was significantly populated for the mutations that were less efficient to disrupt disrupted MED25 ACID binding, with 75% population for K112A mutation. To validate the binding parameters with a second method, we made measurements by isothermal titration calorimetry (ITC), by titrating MED25 ACID into WT or mutated NS1. The experimental conditions were optimized to avoid aggregation of NS1. Surprisingly, no heat was measured for NS1Δα3. This might point to conformational rearrangements concomitant to NS1Δα3-MED25 ACID complex formation. However, the five NS1 proteins with alanine substitutions were amenable to ITC ( Supplementary figure S4 ). The ITC data could be fitted with a single binding site model, resulting in a global thermal signature at equilibrium. Binding was mainly enthalpy driven ( Table 3 , Fig 3D ). The Kd values ( Table 3 , Fig 3E ) were of the same order of magnitude as the Kds measured by BLI, except for M122A. These data thus confirm the role of residues F56 and E110 for MED25 ACID binding. To rule out a possible bias due to structural integrity, we verified the stability of mutated NS1 by thermal denaturation. The DSF curves and F350/F330 ratios were similar to that of WT NS1. Inflection temperatures varied between 65.6°C and 69.3°C, confirming that these proteins were all folded ( Supplementary figure S2 ). Thus, no correlation was observed between the stability of mutated NS1 and its binding strength. As a control, we measured ITC data for two single amino acid NS1 α3 mutations: Y125A and L133A. The Y125A mutation did not significantly impair MED25 ACID binding. In contrast, the L133A mutation efficiently disrupted the complex with a Kd of ∼2 µM ( Table 3 , Fig 3E ). This is in line with previous findings, where the double L132A/L133A substitution in NS1 disrupted MED25 ACID binding in cells ( 25 ). Taken together, our results indicate the NS1 α/β core domain plays a critical role for MED25 ACID binding, and that single amino acid mutations in both NS1 core and α3 domains can destabilize the complex with a loss of affinity by up to nearly two orders of magnitude, strengthening confidence in the AlphaFold3 model. View this table: View inline View popup Download powerpoint Table 3. Thermodynamic parameters for binding of wild-type NS1 and NS1 with single amino acid substitutions to MED25 ACID measured by ITC. Number of sites (N), dissociation constant (Kd), association enthalpy (ΔH), and entropic contribution to free energy (-TΔS). Measurements were carried out at pH 8 and at 298 K, and the ITC data fitted with a one set of sites model. Validation of NS1 α/β core domain binding to MED25 ACID in cellula To validate the NS1 mutations in cells, we used a split-luciferase complementation assay, based on the NanoLuc enzyme ( 44 ). The 114 NanoLuc subunit was fused to the C-terminus of WT or mutated NS1 (NS1-114), and the 11S subunit to the N-terminus of MED25 ACID (11S-MED25 ACID). The constructs were co-transfected into HEK 293T cells. Controls were made by co-transfecting each fusion construct with its complementary non-fused NanoLuc construct. Cells were lysed 24 h post-transfection, and luciferase substrate was added. The interaction was measured using the luminescence signal. When NS1-114 was co-expressed with 11S-MED25 ACID, the luminescence was high ( Fig 4A ), indicating that the MED25 ACID−NS1 complex was formed. MED25 ACID/NS1 Δα3 was used as a positive control. The α3 deletion drastically reduced the interaction with MED25 ACID, in line with the significant loss of affinity observed with NS1Δα3 in vitro. We then measured interactions using the same single amino acid mutations of the NS1 α/β core domain as in the above in vitro experiments ( Fig 4A ). All mutations resulted in a weaker interaction with MED25 ACID, as compared to WT NS1. The trend of affinity loss was similar to that observed by BLI. The most significant loss of affinity was observed for the F56A and E110A substitutions, and the least with K112A. Download figure Open in new tab Fig 4. Interaction in cells between MED25 ACID and WT or mutated NS1 proteins . (A) Interactions were measured in HEK 293T cells using the NanoLuc assay. NS1 was fused to the NanoLuc 114 subunit (NS1-114) and MED25 ACID to NanoLuc 11S (11S-MED25 ACID). HEK 293T cells were transfected with pairs of constructs, combined as shown on the bar diagram. The normalized luminescence ratio (NLR) is the ratio between actual read and negative controls (each fusion protein with the complementary NanoLuc subunit). Bars represent the mean value of 4 independent biological experiments done in triplicate. Error bars represent the standard deviation. *p < 0.05, **p < 0.01, ***p < 0.001 (unpaired two-tailed t-test). (B) Interaction between the TRIM25 protein and NS1, WT or mutated, measured with the NanoLuc assay, using NS1-114 and 11S-TRIM25 constructs. (C) HEK 293T cells were transfected with pCI-neo plasmids encoding WT or mutated NS1 constructs fused to 114 NanoLuc. Cell lysates were subjected to Western Blot analysis using an anti-NS1 antibody. (D) BEAS-2B cells were transfected with plasmids encoding WT or mutated NS1 constructs fused to 114 NanoLuc. Cells were fixed, immunostained with anti-NS1 antibody followed by Alexa Fluor secondary antibody, and analyzed by confocal fluorescence microscopy. Scale bar = 10 µm. As a control, we carried out the NanoLuc assay with the same NS1-114 constructs and 11S NanoLuc fused to the TRIM25 protein (TRIM25-11S). NS1 was shown to bind to the E3-ubiquitin ligase TRIM25 SPRY domain, thereby suppressing RIG-I ubiquitination in the cytoplasm, and preventing RIG-I mediated IFN production ( 12 ). We first tested WT NS1 with TRIM25 and confirmed that TRIM25 interacts with NS1 in cells ( Fig 4B ). The Δα3, I54A, F56A, E110A, and M122A NS1 mutations resulted in luminescence comparable to that of WT NS1. Only the NS1 K112A mutation resulted in lower luminescence. These data suggest that neither the NS1 α3 region nor NS1 α/β core domain residues critical for MED25 ACID binding are critical for TRIM25 binding. Neither Alphafold2 nor Alphafold3 generated high-confidence structural models of the TRIM25 SPRY-complex. Since mutated NS1 was still competent for TRIM25 binding, we inferred that the mutations did not inactivate NS1. Analysis of the lysates by Western blotting using anti-NS1 antibody confirmed comparable protein expression levels for WT and mutated NS1 ( Fig 4C ). As a last control, we analyzed the cellular localization of NS1 transfected with pCI-neo-NS1 constructs by confocal microscopy, using a bronchial epithelial cell line (BEAS-2B) ( Fig 4D ). BEAS-2B cells were transfected to express WT or mutated NS1 proteins. NS1 localization was determined by confocal imaging after staining with anti-NS1 antibody. All NS1 variants showed cytoplasmic as well as nuclear localization, indicating that none of the mutations affected its nuclear translocation. Taken together, our data show that the NS1 α/β core domain is necessary for tight binding of NS1 to MED25 ACID in cells, and that the affinity can be significantly reduced by single amino mutations in this domain, to the same extent as full deletion of α3. This strongly supports the hypothesis of a dual binding site on MED25 ACID. Viral replication of recombinant rRSV-mCherry with NS1 mutations NS1 mutations in the α3 domain, α3 domain deletion as well as the Y125A or L132A/L133A substitutions were reported to reduce the replication rate of rRSV in IFN competent lung A549 epithelial cells ( 37 ). We previously showed that the same mutations reduced the interaction with MED25 ACID ( 25 ). We thus wondered if NS1 α/β core domain mutations that disrupt MED25 ACID binding could also attenuate replication. We generated recombinant rRSV-mCherry encoding either WT NS1 or NS1 with single amino acid substitutions. We also produced NS1Δα3 rRSV-mCherry as a control. Each rRSV-mCherry was recovered in BSR-T7 cells and amplified in Vero cells, which are two IFN-incompetent cell lines. For viral replication experiments, bronchial epithelial BEAS-2B cells were infected with rRSV-mCherry with a multiplicity of infection (MOI) of 0.1. BEAS cells were reported to produce an antiviral response associated with IFN-I and IFN-III expression upon RSV infection ( 45 ). Viral replication was visualized with a fluorescence microscope at 6 h, 24 h, 32 h, 48 h, and 56 h post-infection (pi) ( Fig 5A ). At 32 h pi, mCherry fluorescence was lower for all mutated NS1 as compared to WT rRSV, except for I54A, indicating that viral replication was attenuated with respect to WT ( Fig 5A ). The most attenuated proteins were NS1 Δα3 and E110A rRSV-mCherry. At 56 h pi, all mutated NS1 proteins displayed lower replication. The viral replication attenuation of NS1 I54A, F56A, and E110A rRSV-mCherry was comparable to that of NS1 Δα3 rRSV. NS1 K112A and M122A rRSV-mCherry were less attenuated. Download figure Open in new tab Fig 5. Viral replication of recombinant rRSV-mCherry coding for NS1 mutated at the MED25 ACID binding interface. (A) BEAS-2B or (B) Vero cells were infected with rRSV-mCherry containing WT or mutated NS1 with a multiplicity of infection (MOI) of 0.1 and visualized by fluorescence microscopy from 6 h to 56 h post-infection (pi). Growth curves were obtained by measuring the fluorescence intensity at the indicated time points pi. (C) BEAS-2B cells were infected with rRSV-mCherry WT or mutated NS1 at a MOI of 0.1. Viruses were collected at 6 h, 24 h, 48 h, and 72 h post-infection, and the viral load was titrated in Vero cells using a plaque assay. Viral spots were revealed with an anti-RSV antibody followed by a secondary antibody coupled with HPR and HPR substrate reagent. One spot represents one virus at 72 h pi. Representation of 1 experiment from 3 independent biological experiments done in duplicate. As a control, we measured viral replication in Vero cells, which are not IFN competent. We used WT and the most attenuated rRSV-mCherry mutants in BEAS-2B cells, i.e. NS1 I54A, E110A, and Δα3 rRSV. Like WT rRSV, the three NS1 rRSV mutants induced syncytia formation in Vero cells at 56 h pi ( Fig 5B ). This is a known cytopathic feature in RSV infected cell lines ( 46 ). Replication of mutant rRSV-mCherry was slightly attenuated compared to WT in Vero cells, in particular a later pi times ( Fig 5B ). This was in agreement with previous reports for NS1 Δα3 rRSV-mCherry ( 37 ). The attenuation was less significant than in BEAS-2B cells, suggesting that the NS1 rRSV mutants replicate at a comparable level to WT rRSV in cells that do not produce an antiviral response. This points to a correlation between rRSV replication and IFN response for these mutants. However, the partial attenuation in Vero cells of rRSV with the NS1 I54A mutation, which does only mildly reduce the affinity of NS1 for MED25 ACID ( Fig 4A ), indicates that alternative antiviral responses likely come into play. To confirm viral replication data obtained from mCherry fluorescence measurements, we used a viral plaque assay as a complementary method to quantify the virus titer. We infected BEAS-2B cells with either WT or NS1-mutated rRSV-mCherry at a MOI of 0.1. Cell-associated virus samples were collected at 6 h, 24 h, 48 h, and 72 h pi, and viral titers were determined using a plaque assay on Vero cells. Detectable replication of rRSV-mCherry began at 24 h pi, and only minimal differences were observed between NS1 mutant and WT rRSV. At 48 h pi the difference in replication became more pronounced. Consistently with the results obtained by mCherry fluorescence measurements, all NS1 mutants exhibited attenuation compared to WT rRSV-mCherry ( Fig 5C ). At 72 h pi, the replication rate of the rRSV NS1 mutants was lower by approximately 1.5 orders of magnitude in BEAS-2B cells as compared to WT ( Fig 5C ). The NS1 Δα3, I54A, and E110A mutants were the most attenuated. Taken together, our data suggest that similarly to the rRSV-mCherry NS1 Δα3 mutant, rRSV-mCherry NS1 α/β core mutants result in attenuated replication in BEAS-2B cells, and that the NS1 mutations that most effectively disrupt the interaction with MED25 result in lower replication rates. NS1 mutations disrupting the MED25 ACID interaction impact IFN signaling It was previously reported that NS1 α3 mutations induced differential gene expression in A549 cells ( 37 ). To examine the potential role of the NS1 core domain versus NS1 α3 in IFN response signaling pathways, we measured expression levels of IFN-stimulated genes (ISGs) in BEAS-2B cells. We selected four ISGs involved in the cellular response against RSV infection, IFIT1, IFITM3, ISG15, and OAS1A, which were shown to be upregulated upon RSV infection in BEAS-2B cells ( 45 ). BEAS-2B cells were infected at a MOI of 3 with WT or NS1-mutated rRSV. Expression of ISGs was determined by RT-qPCR at 10 h pi. WT rRSV-mCherry induced upregulation of the four ISGs compared to mock infection ( Fig 6 ). The NS1 F56A, K112A, and M122A mutations triggered a comparable response to that of WT rRSV-mCherry. Deletion of the NS1 α3 helix significantly increased the mRNAs levels of the three ISGs IFITM3, ISG15, and OAS1A, compared to WT rRSV ( Fig 6 ). The two most attenuated rRSV-mCherry viruses with NS1 α/β core domain I54A and E1110A substitutions ( Fig 5A,C ) were less efficient in controlling antiviral ISG responses. The NS1 E110A mutation, which strongly impaired MED25 ACID binding, resulted in increased expression of IFITM3 and ISG15 mRNAs in infected cells. The I54A mutation, which less efficiently disrupted the interaction with MED25 ACID, led to upregulation of all four tested ISGs versus WT rRSV. Altogether, these data suggest that both NS1 α3 and the NS1 core domain act in concert in host response modulation. Download figure Open in new tab Fig 6. Expression levels of interferon-stimulated genes (ISGs) in BEAS-2B cells infected with rRSV-mCherry coding for NS1 variants and mock infected. Expression levels of ISG mRNA were determined by RT-qPCR 10 h pi in BEAS-2B cells infected with rRSV-mCherry, coding for WT or mutant NS1, with a MOI of 3. The fold change was calculated with the ΔCt method. Data are from 4 independent experiments. Mean ± standard error of the mean are represented. *p < 0.05, **p < 0.01 (Mann-Whitney test). Comparison of WT and mutant NS1 rRSV properties in MED25-depleted cells To specifically examine the role of MED25 during RSV infection for NS1 mediated antiviral responses, we measured rRSV replication in MED25-knocked down A549 cells. This cell line has been used previously to study the effect of MED25 knockout on WT RSV replication ( 26 ). A549 cells produce innate antiviral responses upon RSV infection ( 45 ). Transfection efficiency is higher in A549 cells than in BEAS-2B cells. We therefore transfected A549 cells with siRNA against MED25, and subsequently infected the transfected cells with WT or NS1 mutant rRSV-mCherry with a MOI of 0.5. A negative control siRNA was used for comparison. mCherry fluorescence was measured at 48 h pi to assess rRSV-mCherry replication. Fig 7A shows Western blot analysis of MED25 expression in cells transfected with siRNA against MED25 versus control siRNA, which confirmed the efficient depletion of MED25. In negative control A549 cells, in which MED25 was present, viral replication was significantly attenuated for the NS1Δα3 mutant compared to WT rRSV ( Fig 7B ). This is consistent with previously reported data ( 37 ). The rRSV-mCherry mutants with I54A and E110A NS1 substitutions were also significantly attenuated. This mirrors the decrease of viral fitness for the three mutants compared to WT rRSV observed in BEAS2B cells ( Fig 5A ). In MED25 knockdown A549 cells, rRSV replication was decreased for WT, as compared to the negative control sample. This was surprising, since Van Royen et al. had observed the opposite, i.e. increased RSV replication in MED25 knockout A549 cells ( 26 ). The three NS1 mutants were also more attenuated, compared to the negative control cells. However, in contrast to the control experiment, the replication difference between WT and mutant rRSV was less significant, in particular for the I54A and E110A mutants. Overall, these results confirm that MED25 plays a positive role for the viral replication of rRSV, mediated by NS1. Download figure Open in new tab Fig 7. Impact of MED25 knockdown on rRSV replication and ISG expression in A549 cells. A549 cells were transfected with 10 nM of control siRNA or siRNA against MED25, followed by infection 24 h later with WT or NS1 mutant rRSV-mCherry viruses at a MOI of 0.5. (A) Western blot analysis of MED25 depletion was performed 48 h pi in A549 cells transfected with control versus MED25 siRNA. (B) RSV replication was quantified at 48 h pi by measurement of mCherry fluorescence intensity. Data show means and standard errors of 4 independent experiments, p<0.05 *, p<0.005 **, p<0.0005 ***. (C) Cellular viability was quantified at 48h pi in A549 control cells compared to A549 MED25 depleted cells with a bioluminescence assay. The figure represents 3 independent experiments. (D) Expression levels of ISG mRNA, determined by RT-qPCR 48 h pi, in MED25-knockdown A549 cells infected with WT or NS1 mutant rRSV-mCherry at a MOI 2. The fold change was calculated using the ΔCT method. Data are from 4 independent experiments. Mean ± standard error of the mean are represented. *p < 0.05, **p < 0.01. *p < 0.05, **p < 0.01 (Mann-Whitney test). The statistical test was used to compare the control siRNA condition with the MED25 siRNA condition for each rRSV. No significant toxicity or mortality, as measured by quantifying ATP, was detected, when comparing control and MED25 depleted cells ( Fig 7C ). To rationalize the decrease in RSV titer in MED25-knockdown cells, we measured the expression levels of the four antiviral ISGs. A549 cells were transfected with MED25 or control siRNA, and infected at a MOI of 2 with WT or NS1 mutant rRSV-mCherry. Expression of ISGs was determined by RT-qPCR at 48 h pi. For IFITM3 and OAS1A, only minimal differences of expression levels were observed in A549 cells infected with WT or rRSV-mCherry mutants, when MED25 was knocked down as compared to the control experiment ( Fig 7D ). For two other ISGs, IFIT1 and ISG15, a drastic increase of mRNA was observed in MED25 knockdown cells compared to negative control, for WT rRSV and the three NS1 mutant rRSVs. This increased antiviral response could at least partly explain the lower replication of WT and mutant rRSV in MED25 knockdown cells ( Fig 7B ). Under our experimental conditions, MED25 therefore appears to be hijacked by rRSV to downregulate several ISGs. We did not observe significant changes in ISG expression levels with NS1 mutants compared to WT rRSV-mCherry at 48 h pi. Nevertheless, the lower viral replication of NS1 rRSV mutants compared to WT rRSV in the presence of MED25 points to an implication of the NS1-MED25 interaction for the restriction of antiviral responses in A549 cells. Discussion RSV NS1 protein achieves tight binding to MED25 ACID via a dual binding site Mammalian MED25 was shown to be targeted by the cellular transcription activators ERM ( 32 , 47 ), ATF6α ( 48 ), p53 ( 36 ), and ETV4 ( 33 ), as well as Herpes simplex virus (HSV) VP16 ( 28 – 31 ), Varicella-zoster Virus (VZV) IE62 ( 49 ), and Kaposi’s sarcoma-associated herpesvirus (KSHV) lana-1 viral proteins ( 50 ). NMR was used to map the binding regions for the corresponding TADs to the H1 or H2 interfaces of MED25 ACID. When transcription activators possess two TADs, like p53 and VP16, each TAD binds specifically to one these interfaces. In the case of VP16, the two TADs activate transcription independently and bind cooperatively to the H1 and H2 faces of MED25 ACID ( 28 , 29 ). MED25-specific TADs are very variable in composition, but they all possess short motifs that are unstructured in isolation and are assumed to adopt an α-helical conformation in complex with MED25 ACID. To date there is no experimental high-resolution structure of a MED25 ACID-TAD complex. Even structure prediction with deep learning methods remains challenging. Binding of the NS1 α3 peptide, which reminds of a TAD, could not be resolved by AlphaFold2, which proposed models with NS1 α3 binding either to MED25 ACID H1 or to H2 ( 27 ). It was therefore surprising to obtain high confidence structure models for the MED25 ACID−NS1 complex by AlphaFold3. In the context of full-length NS1, NS1 α3 therefore acts like an H1-binding TAD despite its preference for the H2 interface as a peptide. The NS1 α/β core domain, which shares no structural similarity with a TAD, also binds to MED25 ACID. Experimental evidence by NMR supports the hypothesis that it binds to the MED25 ACID H2 interface. Both subdomains contribute to an extensive interaction surface. The difference between the affinities of single NS1 subdomains versus full-length NS1 shows that binding is cooperative, as observed previously with VP16 TAD1 and TAD2 ( 28 , 29 ). Strikingly, NMR perturbations of 15 N-ME25 ACID were observed in the two antiparallel α1 and α3 helices of MED25 ACID ( Fig 2 ). These are ideally positioned to mediate coupling between H2 and H1, likely via an allosteric communication, as proposed earlier ( 35 ). Interestingly, binding kinetic measurements by BLI show that the complex between MED25 ACID and NS1Δα3, i.e. the isolated NS1 α/β core domain, does not adopt a single binding mode. This was also observed for the single amino acid mutants of full-length NS1. A first binding mode (mode 1) displayed faster association and faster dissociation, concomitantly with lower affinity ( Table 2 ). This would be in line with an encounter complex, with suboptimal binding geometry. The first binding mode was the most populated for the NS1 mutants that most efficiently disrupted the complex. A second binding mode (mode 2) displayed slower association, but also slower dissociation, and higher affinity. The encounter complex might undergo structural rearrangements, or association occurs via conformational selection. The absence of correlation between the population of mode 1 and thermal stability of NS1 mutants rather supports the first hypothesis. Since the mode 1 affinity was higher only for the NS1 Δα3 mutant, it can be assumed that the α3 subdomain is key to proceed to binding mode 2. Overall, our results suggest that mutations that disrupt the MED25 ACID−NS1 complex kinetically trap the encounter complex. Kds for MED25 ACID complexes with single TAD were reported in the µM range (0.5 µM for ATF6α TAD, 0.5 µM for ERM, 1.6 µM for VP16 TAD1, 8.1 µM for p53 TAD2), while Kds for tandem TAD1-TAD2 TADs were in the 50-1000 nM range (50 nM for VP16 TAD, 0.8 µM for p53 TAD) ( 28 , 29 , 35 , 36 , 47 ). NS1 binds to MED25 ACID in the high affinity range for TADs (Kd 16 nM by BLI, and 44 nM by ITC), and, according to the AlphaFold3 structure prediction, fully occludes the TAD-binding sites. This strongly suggests that NS1 can efficiently compete with cellular TADs for binding. Impact of RSV NS1 α3 and α/β subdomains on rRSV replication Based on the AlphaFold3 3D complex model, we designed five alanine substitutions on NS1 to disrupt the interaction with MED25 ACID. NS1 E110A and F56A substitutions were the most efficient to disrupt the interaction in vitro ( Table 2 , Table 3 ). In the complex models, NS1 E110 is close to MED25 ACID K518, and the mutation could disrupt an electrostatic interaction. Conversely, F56 is close to MED25 ACID M523, and the M523E mutation was shown previously to disrupt the complex in vitro ( 25 ). In contrast to in vitro experiments with recombinant proteins, all NS1 mutants displayed significantly lower affinity in cellula ( Fig 4A ). In cell interaction experiments confirmed the potency of the single amino acid mutations in the NS1 α/β domain, E110A and F56A, to disrupt the interaction to the same extent as the deletion of the α3 helix. In cellula, the three NS1 mutants with the lowest MED25 ACID affinity, NS1 Δα3 and the NS1 α/β core domain mutants F56A and E110A, still bound to another NS1 protein partner, TRIM25 ( Fig 4B ). This confirms that these mutations specifically affected the interaction with MED25, and that the cytosolic function of NS1 remained intact for the rRSV mutants. Moreover, in Vero cells, recombinant rRSV with NS1 Δα3 and E110A mutations displayed similar syncytia formation and replication rates comparable to the WT virus in these IFN-deficient cells ( Fig 5B ). This indicates that these NS1 mutations did not affect any structural aspects of the virus or the capacity for viral replication in the absence of an innate immune response. In contrast, in BEAS-2B cells, which produce an antiviral response associated with the expression of IFN-I and IFN-III ( 45 ), all mutant rRSV viruses showed less syncytia formation. They also displayed an approximately 1-2 orders of magnitude decrease in replication compared to WT rRSV in plaque assay at time points later than 32-48 h pi ( Fig 5A,C ). All six NS1 mutants showed intact nuclear localization, similarly to WT NS1, ( Fig 4 ) indicating that the defects were not due to impaired NS1 cellular localization. A rough correlation can be drawn between the loss of MED25 ACID binding affinity and the loss of viral fitness, since the NS1 K112A and M122A mutations, which retained the highest affinities, also led to the least attenuated rRSVs, while NS1 Δα3 and E110A rRSV remained more attenuated ( Fig 5A,C ). However, since NS1 is a small multifunctional and multipartner protein ( 10 , 11 , 18 ), it cannot be excluded that some amino acid changes in the MED25 ACID binding interface of NS1 affect interactions with other partners, relieving inhibition of alternative pathways of the innate immune response. In particular, rRSV with the NS1 I54A mutation, which is less critical for the interaction with MED25 ACID, is attenuated, and its infection dynamics differ from that of the other mutants at 48-56 h pi ( Fig 5A,C ). This would also be in line with the NS1 I54A rRSV mutant being more attenuated in IFN incompetent Vero cells, compared to Δα3 and E110A ( Fig 5B ). Impact of the RSV NS1-MED25 interaction on the innate immune response To investigate the origin of the loss of viral replication of NS1 mutants, we measured expression levels of ISGs. We focused on ISGs previously shown to be upregulated in RSV-infected IFN-competent BEAS-2B cells ( 45 ). IFIT1 acts as a sensor of viral RNA, thereby inhibiting viral replication ( 51 , 52 ). IFITM3 restricts cellular entry for several viruses ( 53 ). IFIT1 and IFITM3 proteins were shown to be targets of RSV NS1, with significantly reduced levels in HEK293 cells in the presence of NS1 ( 54 ). ISG15 is a ubiquitin-like protein that leads to ISGylation of several target proteins involved in the activation of innate immune response ( 55 ). OAS1A is an oligoadenylate synthetase that inhibits viral replication via activation of RNase L ( 56 ). OAS1 and IFITM3 were shown to be upregulated in RSV- infected A549 cells ( 37 , 57 ). Our results confirm that gene expression for these four ISGs is upregulated upon infection with rRSV-mCherry ( Fig 6 ). ISG expression was further upregulated by NS1 Δα3 NS1 as well as NS1 α/β core mutants, except M122A, as compared to cells infected with WT NS1 rRSV. The elevated levels of selected ISG genes appeared to be correlated to the restriction of viral replication, as measured by viral titer and syncytia formation. MED25 is a sub stoichiometric subunit of the Mediator. Our results indicate that RSV replicates less in MED25 knockdown A549 cells, suggesting that MED25 gives an advantage for RSV replication. This stands in contrast to previously published data that showed that RSV replication was enhanced in MED25 knockout cells, suggesting that MED25 had an antiviral effect ( 26 ). In our hands, the depletion of MED25 had no toxic effect on cells. siRNA was used previously to knockdown MED25 in other cell lines like U2OS cells ( 47 , 48 ), based on the observation that MED25 is a labile Mediator component. We therefore concluded that the decrease in viral replication was not due to a negative effect on cell function. The difference between the two studies may be due to the amount of MED25 depletion. We used siRNA, which resulted in incomplete MED25 depletion, whereas Van Royen et al. used CRISPR- Cas9 to knock out MED25, thereby possibly affecting the Mediator complex function ( 26 ). When MED25 expression was intact, viral replication was significantly attenuated for the three mutant rRSVs NS1 Δα3, I54A, and E110A, compared to WT rRSV, in BEAS-2B cells ( Fig 5 ) as well as in A549 cells ( Fig 7 ). In contrast, in MED25 knockdown A549 cells, the replication difference between WT and NS1 Δα3, I54A, and E110A rRSV viruses was less significant, with almost no difference detected for E110A ( Fig 7 ). This suggests that in the absence of MED25, the antiviral response of the cell does no longer discriminates between WT and NS1 mutants. Since NS1 Δα3 and E110A mutations disrupted the interaction with MED25, these results provide first evidence for RSV hijacking MED25 to reduce the cellular immune response upon RSV infection. Hypotheses for a competition mechanism between RSV NS1 and cellular TADs in targeting MED25 Hijacking of the MED25 Mediator subunit has been reported for other viruses, with very different mechanisms. HSV VP16 ( 58 , 59 ) and VZV IE62 ( 49 , 60 ) are genuine immediate-early transcription activators, containing DNA-binding domains and TADs that bind to MED25. KSHV Lana-1 was shown to act differently. It induces the serum response element by acting as an adaptor protein connecting the serum response factor and the Mediator via MED25 in a ternary complex ( 50 ). Owing to its small size, RSV NS1 is expected to use a different mechanism. We previously showed that NS1 competes in vitro with the TAD of human activating transcription factor 6 (ATF6α) for MED25 binding ( 25 ). ATF6α is a sensor of misfolded protein. In response to endoplasmic reticulum (ER) stress, it is transported into the nucleus to activate transcription of ER stress response genes via a direct interaction with the MED25 subunit ( 34 , 48 ). The rationale for using this specific transcription factor was that RSV was shown to induce a non-canonical ER stress response via activation of AFT6 pathways in A549 cells ( 61 ). Moreover, the H2 interface of MED25 ACID was reported to be the interaction site of the ATF6α TAD ( 35 ). Recently, competition for MED25 ACID binding was demonstrated between ATF6α and an ad hoc lipidated H2-binding peptide with TAD-like amino acid composition ( 62 ). This peptide, with an estimated Kd of 4 µM, was able to partially inhibit MED25-dependent gene transcription ( 62 ). Hence, tight binding of NS1 to MED25 ACID in the 20-50 nM range as well as occlusion of the H2 interface by the NS1 α/β core domain rationalize NS1 competition with ATF6α binding and signaling. The high affinity of NS1 for MED25 ACID and the dual binding domain on MED25 ACID suggest that NS1 would efficiently compete with cellular H1-binding TADs as well as with H2-binding TADs. Transcription inhibition due to competitive binding has also been demonstrated for p53-dependent transcription, with a stapled peptide mimicking the p53 tandem TAD, which was able to block p53- Mediator binding and to suppress the p53 response ( 63 ). More generally, the high affinity of the NS1-MED25 ACID emphasizes the relevance of MED25 as a cellular target of NS1 for host transcription regulation by RSV. The downstream effect of the sequestration of MED25 by NS1 is still unclear. Several cellular transcription factors were reported to target MED25: RAR, HNF4α, ERM, SOX9, and ATF6α ( 21 ). Since RSV NS1 acts on multiple pathways that more directly act on IFN-I and IFN-III production and signaling, the interaction with MED25 is not strictly necessary to regulate antiviral protein levels. For example, HNF4α controls multiple metabolic pathways, in particular lipid homeostasis ( 64 ). The interaction with MED25 may therefore participate in modeling a general antiviral and inflammatory state of the cell upon RSV infection. Additional studies are required to identify the specific downstream pathways affected by the NS1-MED25 interaction. Materials and Methods Plasmids The MED25 ACID (NCBI Gene ID 81857, MED25 aa 389–543) construct was obtained by introducing start and stop codons at the appropriate site in Addgene #64771 plasmid, as described previously ( 25 ). The sequence of NS1 is a variant from RSV subgroup A Long strain (GenBank AY911262 ) containing the N102D mutation. For NanoLuc plasmids, custom synthesized pCI-neo NanoLuc 114 and 11S vectors (Promega) were used to clone the codon-optimized RSV NS1, MED25, and TRIM25 (GeneCust) constructs using standard PCR, digestion, and ligation techniques. pCI-neo-NS1 single-site mutations in the full-length construct were obtained by using the QuickChange site-directed mutagenesis kit (Stratagene). NS1 Δα3 (aa 1-118) was generated by introducing start and stop codons at the appropriate site in the coding sequence using standard PCR, digestion, and ligation techniques. A pET28 plasmid was used to express recombinant His-tagged MED25 ACID (aa 389-543) protein. pGEX-4T3 plasmids were used to express recombinant WT and mutated GST-tagged NS1 proteins. Mutations were introduced by site-directed mutagenesis using the QuikChange kit (Stratagene). NS1Δα3 (aa 1-116), used for NMR, ITC and BLI measurements, was constructed by introducing a stop codon at amino acid position 117. Primers are listed in Supplementary Table 1 . Cells Vero cells (ATCC number CCL-81), HEK 293T cells (ATCC number CRL-3216), and BSRT7/5 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM), whereas BEAS-2B cells (ATCC number CRL-3588) were maintained in RPMI 1640 medium (Eurobio Scientific), supplemented with 10% fetal bovine serum (FBS-12A, Capricorn Scientific), 1% L-glutamine (200mM) (Eurobio Scientific), and 1% penicillin-streptomycin (100U/ml and 100ug/ml, respectively). The cells were grown at 37°C in 5% CO 2 . Virus strains and recombinant viruses Human RSV Long strain, subgroup A (GenBank AY911262 ), was used for infection assays. Recombinant rRSV-mCherry viruses were rescued by reverse genetics, as previously described ( 65 ) and amplified in Vero cells. NS1 core mutations were introduced into a pACNR1180 vector ( 66 ) coding for the whole rRSV-mCherry antigenome using the QuickChange II Site-Directed Mutagenesis kit (Stratagene). The NS1 α3 deletion was generated and subcloned into the pACNR1180-rRSVmCherry vector using the In-Fusion HD Cloning Kit (Takara). Specific primers containing AfeI and KpnI restriction enzyme sites were used for In-Fusion PCR. All primers are listed in Supplementary Table 2 . Virus fluorescence quantification BEAS-2B cells or Vero cells were seeded at 1 x 10 5 cells per well in 24-well plates the day before infection. Cells were infected with WT or mutated NS1 rRSV-mCherry at a multiplicity of infection (MOI) of 0.1 in RPMI or DMEM SVF-free medium. At 6 h, 24 h, 32 h, 48 h, and 56 h post-infection, the cells were observed with a ZOE Fluorescent Cell Imager, and the fluorescence was measured using an Infinite M200 PRO microplate reader (TECAN) with excitation and emission wavelengths of 580 and 620 nm, respectively. The fluorescence intensity of the infected cells was normalized with the fluorescence of uninfected BEAS-2B or Vero cells (Mock). Virus plaque assay All rRSV-mCherry viruses were titrated on Vero cells by standard plaque assay: cells were infected with serial 10-fold dilutions of viral suspension in DMEM SVF-free medium. The overlay consisted of cellulose Avicel RC581 (FMC Biopolymer) at a final concentration of 1.2% in 2X MEM. After 7 days of infection at 37°C, 5% CO 2 , cells were fixed and incubated with a monoclonal mouse RSV A/B antibody (Chemicon, MAB858-4) (1:2000) and horseradish peroxidase (HRP)-conjugated goat anti-mouse antibody (Sera Care) (1:2000). Plaques were revealed using the KPL TrueBlue Substrate (Sera Care), and the number of plaque-forming units (p.f.u.) per well was counted visually. The mock control consisted of Vero cell culture supernatant. Analysis of RSV NS1 protein sequence NCBI Virus blast was used to scan sequence conservation in RSV NS1 using the Protein Search mode. The server ( https://www.ncbi.nlm.nih.gov/labs/virus/vssi/#/ ) was accessed on September 19, 2024. Structure predictions The AlphaFold3 server ( https://golgi.sandbox.google.com/ ) was accessed on May 29, 2023. The protein query sequences were MED25 ACID (Uniprot Q71SY5, aa 389-543), full-length NS1 (aa 1-139), and C-terminally truncated NS1 (aa 1-116). Visualization of the PAE for predicted complex structures was done with the webserver PAE Viewer ( 67 ) and figures were prepared with ChimeraX ( 41 ). Expression and purification of recombinant proteins MED25 ACID, containing an N-terminal double 6xHis-T7 tag, was expressed from E. coli BL21(DE3) bacteria transformed with the pET28-MED25 ACID plasmid. Bacteria were grown from a 20 mL starter culture in 1 L 2YT medium at 37°C to an optical density of 0.6 at 600 nm. Induction was made with 0.1 mM isopropyl-β-D-thiogalactoside (IPTG) for 24 h at 20°C. 15 N-labeled MED25 ACID was produced in minimal M9 medium supplemented with 1 g·L -1 15 NH 4 Cl (Eurisotop, France) instead of 2YT. Bacteria were lysed by sonication in 50 mM Na phosphate (NaP), 300 mM NaCl, 10 mM imidazole, pH 8 buffer containing protease inhibitors (complete, Roche), and 1 mg.mL -1 lysozyme (Thermo Fisher). Lysates were clarified by ultracentrifugation. His-tagged MED25 ACID was captured with 2 ml of Ni-NTA resin (Thermo Fisher). The protein was then stepwise eluted with NaP/NaCl buffer containing increasing amounts of imidazole (25, 50, 500 mM). The protein was then exchanged into 20 mM Tris pH 8.0, 150 mM NaCl buffer, using a Hiprep Desalting 26/10 column (GE Healthcare). 1 mM dithiothreitol (DTT), 2.5 mM CaCl 2 , and 5 units/mL thrombin (Sigma) were added, and the mixture was incubated at 4°C overnight. Purification of His-tagged MED25 ACID was carried out by loading the clarified lysate on HisTrap FF 1 mL or 5 mL columns, and eluting His-tagged MED25 ACID with an imidazole gradient in 50 mM NaP, 25 mM imidazole, 500 mM NaCl pH 8.0 buffer on an Akta System. Samples were further purified by gel filtration on a Superdex S75 Hiload column (Cityva) equilibrated with 20 mM NaP pH 6.5, 100 mM NaCl buffer. 5 mM DTT or TCEP was then added, and the protein was concentrated to 200-500 µM using centrifugal filter units with a 10 kDa cut-off (Amicon Ultra, Millipore). The MED25 ACID concentration was determined by measuring the absorption at 280 nm and using the theoretical molar extinction coefficient calculated on the ProtParam server ( https://web.expasy.org/protparam/ ). WT and mutated NS1 were expressed from E. coli BL21(DE3) transformed with pGEX-NS1-derived plasmids. Cultures were grown from 20 mL starter cultures in 1L LB or 2YT medium at 37°C to an optical density of 0.6-0.8 at 600 nm, and induced with 0.3 mM IPTG for 24 h at 20°C. After harvesting, cells were first incubated in 20 mM Tris pH 8, 300 mM NaCl, 5% glycerol buffer, supplemented with protease inhibitors (complete, Roche), 1 mg.mL -1 lysozyme (Thermo Fisher), 0.2 % Triton X100, 10 mM MgSO 4 , and 2500 U benzonase (Sigma-Aldrich). 1 mM DTT and up to 1.5 M NaCl were added, and the bacteria were sonicated. Lysates were clarified by ultracentrifugation. GST- NS1 was captured with 2 ml Glutathione Sepharose beads (GE Healthcare). The beads were extensively washed with 20 mM Tris pH 8, 300 mM NaCl, 5% glycerol. They were incubated overnight with 20U thrombin (Sigma-Aldrich) at 4°C in 20 mM Tris, 150 mM NaCl, 2.5 mM CaCl 2 , and 5 mM 2- mercaptoethanol. NS1 was eluted and further purified by gel filtration on a Superdex S75 Hiload 16/600 column (Cityva) equilibrated with 20 mM Tris pH 8, 200 mM NaCl, 1 mM DTT buffer. 5 mM TCEP was added to the fractions containing NS1, and the protein was concentrated to 200-500 µM using centrifugal filter units with a 10 kDa cut-off (Amicon Ultra, Millipore). The NS1 concentration was determined from absorption at 280 nm. SDS-PAGE and Western blot analysis Protein samples were separated by electrophoresis on 15% polyacrylamide gels in Tris-glycine buffer. All samples were boiled for 3 min prior to electrophoresis. Proteins were then transferred to a nitrocellulose membrane (Roche Diagnostics). The blots were blocked with 5% non-fat milk in Tris-buffered saline (pH 7.4), and incubated with a monoclonal rabbit NS1 antibody (GeneTex, GTX638591) (1:1000) and horseradish peroxidase (HRP)-conjugated goat anti-rabbit antibody (1mg/ml, 5450-0010 Seracare) (1:10,000). Western blots were developed using freshly prepared chemiluminescent substrate (100 mM Tris-HCl, pH 8.8, 1.25 mM luminol, 0.2 mM p-coumaric acid, 0.05% H 2 O 2 ) and exposed on a ChemiDocTM Touch Imaging System (Bio-Rad). Dynamic scanning fluorimetry (DSF) DSF was performed on a Tycho instrument (Nanotemper Technologies) at a scanning rate of 30°C/min in the 35-95°C temperature range. Intrinsic fluorescence of tryptophan was recorded at 350 and 330 nm. Protein concentration was 100 µM. Bio-Layer Interferometry (BLI) All proteins were dialyzed into 20 mM Tris pH 8.0, 200 mM NaCl, and 1 mM TCEP buffer. 0.05 % Tween was added for BLI experiments. His-tagged MED25 ACID (1 µM) was captured on Octet Ni-NTA biosensors (Sartorius) for 180 s at a level of 2.0 mm. Kinetic experiments were performed on an Octet RED96e system (FortéBio) at 25°C and under 1000 rpm shaking, using black 96-well plates. His-MED25 ACID-loaded biosensors were first equilibrated in buffer for 60 s (baseline), then incubated for 300 s in a concentration series of WT or mutated NS1 solutions, obtained by 2-fold dilutions (association), and finally incubated for 600 s in buffer (dissociation). Real-time binding kinetics were analyzed with the Octet Analysis Studio software (v.12.2.2.6). The raw signal was processed by subtracting two reference signals, the first measured from a biosensor without His-MED25 ACID and second measured in the absence of NS1. A global fitting of both association and dissociation signals was done either with a 1:1 model or with a heterogeneous 2:1 binding model. Isothermal Titration Calorimetry (ITC) ITC measurements were carried out on a MicroCal PEAQ-ITC calorimeter (Malvern Panalytical) at a temperature of 298 K. Protein samples (WT or mutated NS1, and MED25 ACID) were dialyzed against the same batch of 20 mM Tris pH 8.0, 200 mM NaCl, 1 mM TCEP buffer. NS1 (20 µM) was placed into the calorimeter sample cell (V = 200 µL). Aliquots of 2 µL of MED25 ACID at a concentration of 200 µM (for titration of WT NS1 and NS1Δα3) or 250 µM (for titration of NS1 with single amino acid substitutions) placed in the 40 µL syringe were injected into the NS1 protein solution under stirring at 500 rpm every 180 s during 4 s. Data were processed and analyzed with MicroCal PEAQ-ITC Analysis Software (v1.41) according to the one set of sites binding model. Nuclear Magnetic Resonance (NMR) 2D 1 H- 15 N HSQC spectra of 15 N-labeled MED25 ACID were measured on a Bruker 800 MHz NMR spectrometer equipped with a TCI cryoprobe, at a temperature of 293 K. Samples contained 100 µM 15 N-MED25 ACID, with or without 0.5-1.0 molar equivalent of WT or mutated NS1 in 20 mM Na phosphate pH 6.5, 100 mM NaCl, 5 mM TCEP buffer. 7.5 % D 2 O was added to lock the spectrometer frequency. Spectra were processed with TopSpin 4.0 software (Bruker BioSpin) and analyzed with AnalysisAssign V3.1.1 ( 68 ) software. NanoLuc interaction assay Constructs expressing the NanoLuc subunits 114 and 11S were used ( 44 ). HEK 293T cells were seeded at a concentration of 6 x 10 4 cells per well in a 48-well plate. After 24 h, cells were co-transfected in triplicate with 0.4 µg of total DNA (0.2 µg of each plasmid) using Lipofectamine 2000 (Invitrogen). 24 h post-transfection, cells were washed with PBS 1X and lysed for 1h at room temperature using 50 µL NanoLuc lysis buffer (Promega). NanoLuc enzymatic activity was measured using the Nano-Glo Substrate (Promega). For each pair of plasmids, normalized luminescence ratios (NLRs) were calculated as follows: the luminescence activity measured in cells transfected with the two plasmids (each viral protein fused to a different NanoLuc subunit) was divided by the sum of luminescence activities measured in two control samples obtained by co-transfecting one NanoLuc fused viral protein plasmid with a plasmid expressing only the other NanoLuc subunit. Data represent the mean ± standard deviation (SD) of 4 independent experiments, each done in triplicate. Luminescence was measured with an Infinite 200 Pro (Tecan, Männedorf, Switzerland). Immunofluorescence microscopy Overnight cultures of BEAS-2B cells seeded at 5 x 10 5 cells per well in 6-well plates (on an 18-mm micro cover glass for immunostaining) were transfected with 2 µg of pCI-neo plasmids expressing WT or modified NS1 using Lipofectamine 2000 (Invitrogen). At 24 h post-infection, cells were fixed with 4% paraformaldehyde for 10 min, blocked with 3% BSA and 0.2% Triton X100–PBS for 10 min, and stained with a monoclonal rabbit NS1 antibody (GeneTex, GTX638591) (1:200), followed by species-specific secondary antibody conjugated to Alexa Fluor 488 (A11008, Invitrogen) (1:1000). Images were acquired using the white light laser SP8 (Leica Microsystems, Wetzlar, Germany) confocal microscope at a nominal magnification of 63 and the Leica Application Suite X (LAS X) software. RT-qPCR Overnight cultures of BEAS-2B cells seeded at 2 x 10 5 in a 24-well plate were infected with recombinant WT or mutated NS1 rRSV-mCherry, at a MOI of 3. At 10 h post-infection, the supernatant of the infected cells was removed, and the cells were washed with PBS and frozen at-80°C until the RNA extraction. The RNA extraction was performed using the TRI Reagent (Molecular Research Center) according to the manufacturer’s protocol. Total cDNA was synthesized from 69 ng of RNA using the iScript Advanced cDNA Synthesis Kit for RT-qPCR (Bio-Rad). 0.7 ng of cDNA template was added to 20 µL of reaction mixture containing 10 nM of the ISGs OAS1A, IFITM3, ISG15 and IFIT1 primers and iTaq Universal SYBR Green Supermix (Bio-Rad). Each point was performed in triplicate. The reaction was performed with the RealPleax2 thermocycler (Eppendorf). Fluorescence was monitored during the qPCR reaction. Viral RNA expression was quantified using the ΔΔCt method and normalized to the housekeeping gene GAPDH, β-actin, and 18S expression levels. Primers are listed in Supplementary Table 3 . siRNA transfection and infection MED25 siRNA (sequence GCCCTTTGTTCCGGAACTCAA) (Qiagen) and a negative control siRNA (Qiagen 1027310) were used. Freshly passaged A549 cells were transfected with siRNAs at a final concentration of 10 nM by reverse transfection in 24-well plates using Lipofectamine RNAiMAX (Thermo Fisher) according to the manufacturer’s instructions. Briefly, a mixture containing Opti-MEM (Invitrogen), Lipofectamine RNAiMAX, and siRNA was incubated for 20 min at room temperature before being deposited at the bottom of the wells. The cells were then added dropwise before incubation at 37°C with 5% CO2. 24 h post-transfection, the medium was removed, and the cells were infected with recombinant rRSV-mCherry at a MOI of 0.5 in DMEM without phenol red and without FCS for 2 h at 37°C. The medium was then replaced by DMEM supplemented with 2% SVF, and the cells were incubated for 48 h at 37°C. Quantification of replication was performed by measuring mCherry fluorescence (excitation at 580 nm and emission at 620 nm) using a Tecan Infinite M200 Pro luminometer. Noninfected A549 cells were used as standards for fluorescence background levels. Each experiment was performed in duplicate and repeated at least four times. For each experiment, cells treated under the same conditions were lysed, and MED25 expression was analyzed 72 h post-transfection by Western blotting on an immune-precipitated MED25 sample using a polyclonal rabbit MED25 antibody (Sigma-Aldrich, HPA068802) (1:5000). Toxicity assay Cell viability was measured on A549 cells transfected with the control or MED25 siRNA by using the CellTiter-Glo Assay (Promega). The CTG reagent was mixed with the supernatant of cells in a ratio of 1:1 per well and incubated for 2 min at room temperature under agitation. Luminescence quantification was performed using a Tecan Infinite M200 Pro luminometer. Control wells containing medium without cells were used as standard luminescence backgrounds. Supporting information Supplementary Table 1: Primers used for cloning and site-directed mutagenesis of RSV NS1, MED25 and TRIM25 Supplementary Table 2: Primers used for reverse genetics. Supplementary Table 3: Primers used for the ISG quantification by RT-qPCR. Supplementary Fig S1: Bio-layer interferometry real time association and dissociation curves of wild-type full-length and mutated NS1 measured using bound His-tagged MED25 ACID at pH 8.0. The fitted curves are in red lines. Supplementary Fig S2: Dynamic scanning fluorimetry data measured on wild-type and mutated NS1 at pH 8. The ratio between fluorescence at 350 and 330 nm and the first derivative are represented as a function of temperature. The inflection temperature is reported in the bar diagram. The value for WT NS1 is a mean value obtained from 2 independent measures, and the error bar represents the standard deviation. Supplementary Fig S3: (A) AlphaFold3 structural prediction of the complex between human MED25 ACID and RSV NS1Δα3. Proteins are in cartoon representation and colored according to the pLDDT (predicted local-distance difference test) confidence score, using the ChimeraX ( 41 ) AlphaFold color palette. The predicted aligned error (PAE) matrix for the complex was plotted with a color code representing the expected position error with 0 to 30 Å in dark green to white. (B) Structural alignment of MED25 ACID-NS1Δα3 (MED25 ACID in grey and NS1Δα3 in green) and MED25 ACID-NS1 (MED25 ACID in light blue and NS1 in blue) models. Supplementary Fig S4 : ITC binding isotherms for wild-type and mutated NS1 binding to MED25 ACID in 20 mM Tris pH 8.0, 200 mM NaCl, 1 mM TCEP and at a temperature of 298 K. (A) Raw binding data. (B) Integrated titration curves. The NS1 concentration in the calorimeter cell (V=200 µL) was 20 µM. MED25 ACID at a concentration of 200 µM (for experiments with WT NS1 and NS1Δα3) or 250 µM (for single amino acid NS1 mutations) was injected in 2 µL volumes, under stirring at 500 rpm. The duration of injection was 4 s, separated by a delay time of 180 s. Acknowledgments We thank Christine Lenoir for technical assistance with the production of recombinant proteins, and Marie Galloux for helpful discussions. C.A. and J.D. were supported by Université Paris Saclay doctoral grants. C.A. was partially supported by an INRAE Animal Health Department doctoral grant. The work was financially supported by a DIM One Health 2.0 grant to M.B. and C.S. The present work has benefited from the platform PIM of I2BC supported by the French Infrastructure for Integrated Structural Biology (FRISBI) ANR-10-INBS-05. References 1. ↵ Perch SG . Causes of severe pneumonia requiring hospital admission in children without HIV infection from Africa and Asia: the PERCH multi-country case-control study . Lancet . 2019 ; 394 ( 10200 ): 757 – 79 . OpenUrl CrossRef PubMed 2. ↵ Li Y , Wang X , Blau DM , Caballero MT , Feikin DR , Gill CJ , et al. Global, regional, and national disease burden estimates of acute lower respiratory infections due to respiratory syncytial virus in children younger than 5 years in 2019: a systematic analysis . The Lancet . 2022 ; 399 ( 10340 ): 2047 – 64 . OpenUrl CrossRef PubMed 3. ↵ Langedijk AC , Bont LJ . Respiratory syncytial virus infection and novel interventions . Nature Reviews Microbiology . 2023 ; 21 ( 11 ): 734 – 49 . OpenUrl CrossRef PubMed 4. ↵ Li Q , Li H , Li Z , Wang Y . Vaccine and therapeutic agents against the respiratory syncytial virus: resolved and unresolved issue . MedComm . 2024 ; 5 ( 12 ). 5. ↵ Hijano DR , Vu LD , Kauvar LM , Tripp RA , Polack FP , Cormier SA . Role of Type I Interferon (IFN) in the Respiratory Syncytial Virus (RSV) Immune Response and Disease Severity . Front Immunol . 2019 ; 10 : 566 . 6. ↵ Rima B , Collins P , Easton A , Fouchier R , Kurath G , Lamb RA , et al. ICTV Virus Taxonomy Profile: Pneumoviridae . Journal of General Virology . 2017 ; 98 ( 12 ): 2912 – 3 . OpenUrl CrossRef PubMed 7. ↵ Barik S . Respiratory syncytial virus mechanisms to interfere with type 1 interferons . Curr Top Microbiol Immunol . 2013 ; 372 : 173 – 91 . OpenUrl CrossRef PubMed 8. Van Royen T , Rossey I , Sedeyn K , Schepens B , Saelens X . How RSV Proteins Join Forces to Overcome the Host Innate Immune Response . Viruses . 2022 ; 14 ( 2 ). 9. Merritt TN , Pei J , Leung DW . Pathogenicity and virulence of human respiratory syncytial virus: Multifunctional nonstructural proteins NS1 and NS2 . Virulence . 2023 . 10. ↵ Thornhill EM , Verhoeven D . Respiratory Syncytial Virus’s Non-structural Proteins: Masters of Interference . Front Cell Infect Microbiol . 2020 ; 10 : 225 . 11. ↵ Sedeyn K , Schepens B , Saelens X . Respiratory syncytial virus nonstructural proteins 1 and 2: Exceptional disrupters of innate immune responses . PLoS Pathogens . 2019 ; 15 ( 10 ): e1007984 . OpenUrl CrossRef PubMed 12. ↵ Ban J , Lee NR , Lee NJ , Lee JK , Quan FS , Inn KS . Human Respiratory Syncytial Virus NS 1 Targets TRIM25 to Suppress RIG-I Ubiquitination and Subsequent RIG-I-Mediated Antiviral Signaling . Viruses . 2018 ; 10 ( 12 ). 13. ↵ Elliott J , Lynch OT , Suessmuth Y , Qian P , Boyd CR , Burrows JF , et al. Respiratory syncytial virus NS1 protein degrades STAT2 by using the Elongin-Cullin E3 ligase . Journal of virology . 2007 ; 81 ( 7 ): 3428 – 36 . OpenUrl Abstract / FREE Full Text 14. ↵ Swedan S , Andrews J , Majumdar T , Musiyenko A , Barik S . Multiple functional domains and complexes of the two nonstructural proteins of human respiratory syncytial virus contribute to interferon suppression and cellular location . Journal of virology . 2011 ; 85 ( 19 ): 10090 – 100 . OpenUrl Abstract / FREE Full Text 15. ↵ Swedan S , Musiyenko A , Barik S . Respiratory syncytial virus nonstructural proteins decrease levels of multiple members of the cellular interferon pathways . Journal of virology . 2009 ; 83 ( 19 ): 9682 – 93 . OpenUrl Abstract / FREE Full Text 16. ↵ Bitko V , Shulyayeva O , Mazumder B , Musiyenko A , Ramaswamy M , Look DC , et al. Nonstructural proteins of respiratory syncytial virus suppress premature apoptosis by an NF-kappaB-dependent, interferon-independent mechanism and facilitate virus growth . Journal of virology . 2007 ; 81 ( 4 ): 1786 – 95 . OpenUrl Abstract / FREE Full Text 17. ↵ Bossert B , Conzelmann KK . Respiratory syncytial virus (RSV) nonstructural (NS) proteins as host range determinants: a chimeric bovine RSV with NS genes from human RSV is attenuated in interferon-competent bovine cells . Journal of virology . 2002 ; 76 ( 9 ): 4287 – 93 . OpenUrl Abstract / FREE Full Text 18. ↵ Wu W , Tran KC , Teng MN , Heesom KJ , Matthews DA , Barr JN , et al. The interactome of the human respiratory syncytial virus NS1 protein highlights multiple effects on host cell biology . Journal of virology . 2012 ; 86 ( 15 ): 7777 – 89 . OpenUrl Abstract / FREE Full Text 19. ↵ Tan Y-r, Peng D, Chen C-m, Qin X-q . Nonstructural protein-1 of respiratory syncytial virus regulates HOX gene expression through interacting with histone . Molecular Biology Reports . 2012 ; 40 ( 1 ): 675 – 9 . OpenUrl PubMed 20. ↵ Pei J , Beri NR , Zou AJ , Hubel P , Dorando HK , Bergant V , et al. Nuclear-localized human respiratory syncytial virus NS1 protein modulates host gene transcription . Cell Rep . 2021 ; 37 ( 2 ). 21. ↵ Poss ZC , Ebmeier CC , Taatjes DJ . The Mediator complex and transcription regulation . Critical Reviews in Biochemistry and Molecular Biology . 2013 ; 48 ( 6 ): 575 – 608 . OpenUrl CrossRef PubMed Web of Science 22. Richter WF , Nayak S , Iwasa J , Taatjes DJ . The Mediator complex as a master regulator of transcription by RNA polymerase II . Nature Reviews Molecular Cell Biology . 2022 . 23. ↵ Soutourina J . Transcription regulation by the Mediator complex . Nature Reviews Molecular Cell Biology . 2017 ; 19 ( 4 ): 262 – 74 . OpenUrl CrossRef PubMed 24. ↵ Rovnak J , Quackenbush SL . Exploitation of the Mediator complex by viruses . PLOS Pathogens . 2022 ; 18 ( 4 ). 25. ↵ Dong J , Basse V , Bierre M , Peres de Oliveira A , Vidalain P-O , Sibille P , et al. Respiratory Syncytial Virus NS1 Protein Targets the Transactivator Binding Domain of MED25 . Journal of Molecular Biology . 2022 ; 434 ( 19 ). 26. ↵ Van Royen T , Sedeyn K , Moschonas GD , Toussaint W , Vuylsteke M , Van Haver D , et al. An Unexpected Encounter: Respiratory Syncytial Virus Nonstructural Protein 1 Interacts with Mediator Subunit MED25 . Journal of virology . 2022 ; 96 ( 19 ): e0129722 . OpenUrl CrossRef PubMed 27. ↵ Monté D , Lens Z , Dewitte F , Villeret V , Verger A . Assessment of machine-learning predictions for the Mediator complex subunit MED25 ACID domain interactions with transactivation domains . FEBS Letters . 2024 . 28. ↵ Vojnic E , Mourão A , Seizl M , Simon B , Wenzeck L , Larivière L , et al. Structure and VP16 binding of the Mediator Med25 activator interaction domain . Nature Structural & Molecular Biology . 2011 ; 18 ( 4 ): 404 – 9 . OpenUrl CrossRef PubMed 29. ↵ Milbradt AG , Kulkarni M , Yi T , Takeuchi K , Sun Z-YJ , Luna RE , et al. Structure of the VP16 transactivator target in the Mediator . Nature Structural & Molecular Biology . 2011 ; 18 ( 4 ): 410 – 5 . OpenUrl CrossRef PubMed 30. Eletsky A , Ruyechan WT , Xiao R , Acton TB , Montelione GT , Szyperski T . Solution NMR structure of MED25(391–543) comprising the activator-interacting domain (ACID) of human mediator subunit 25 . Journal of Structural and Functional Genomics . 2011 ; 12 ( 3 ): 159 – 66 . OpenUrl CrossRef PubMed 31. ↵ Bontems F , Verger A , Dewitte F , Lens Z , Baert JL , Ferreira E , et al. NMR structure of the human Mediator MED25 ACID domain . Journal of structural biology . 2011 ; 174 ( 1 ): 245 – 51 . OpenUrl CrossRef PubMed 32. ↵ Landrieu I , Verger A , Baert J-L , Rucktooa P , Cantrelle F-X , Dewitte F , et al. Characterization of ERM transactivation domain binding to the ACID/PTOV domain of the Mediator subunit MED25 . Nucleic Acids Research . 2015 ; 43 ( 14 ): 7110 – 21 . OpenUrl CrossRef PubMed 33. ↵ Currie SL , Doane JJ , Evans KS , Bhachech N , Madison BJ , Lau DKW , et al. ETV4 and AP1 Transcription Factors Form Multivalent Interactions with three Sites on the MED25 Activator-Interacting Domain . Journal of Molecular Biology . 2017 ; 429 ( 20 ): 2975 – 95 . OpenUrl CrossRef PubMed 34. ↵ Sela D , Chen L , Martin-Brown S , Washburn MP , Florens L , Conaway JW , et al. Endoplasmic Reticulum Stress-responsive Transcription Factor ATF6α Directs Recruitment of the Mediator of RNA Polymerase II Transcription and Multiple Histone Acetyltransferase Complexes . Journal of Biological Chemistry . 2012 ; 287 ( 27 ): 23035 – 45 . OpenUrl Abstract / FREE Full Text 35. ↵ Henderson AR , Henley MJ , Foster NJ , Peiffer AL , Beyersdorf MS , Stanford KD , et al. Conservation of coactivator engagement mechanism enables small-molecule allosteric modulators . Proceedings of the National Academy of Sciences . 2018 ; 115 ( 36 ): 8960 – 5 . OpenUrl Abstract / FREE Full Text 36. ↵ Lee M-S , Lim K , Lee M-K , Chi S-W . Structural Basis for the Interaction between p53 Transactivation Domain and the Mediator Subunit MED25 . Molecules . 2018 ; 23 ( 10 ). 37. ↵ Chatterjee S , Luthra P , Esaulova E , Agapov E , Yen BC , Borek DM , et al. Structural basis for human respiratory syncytial virus NS1-mediated modulation of host responses . Nat Microbiol . 2017 ; 2 : 17101 . 38. ↵ Adachi Y , Yamamoto K , Okada T , Yoshida H , Harada A , Mori K . ATF6 Is a Transcription Factor Specializing in the Regulation of Quality Control Proteins in the Endoplasmic Reticulum . Cell Structure and Function . 2008 ; 33 ( 1 ): 75 – 89 . OpenUrl CrossRef PubMed Web of Science 39. ↵ Jumper J , Evans R , Pritzel A , Green T , Figurnov M , Ronneberger O , et al. Highly accurate protein structure prediction with AlphaFold . Nature . 2021 ; 596 (7873): 583 -9. OpenUrl CrossRef PubMed 40. ↵ Abramson J , Adler J , Dunger J , Evans R , Green T , Pritzel A , et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3 . Nature . 2024 ; 630 (8016): 493 -500. OpenUrl CrossRef PubMed 41. ↵ Pettersen EF , Goddard TD , Huang CC , Meng EC , Couch GS , Croll TI , et al. UCSF ChimeraX: Structure visualization for researchers, educators, and developers . Protein Science . 2020 ; 30 ( 1 ): 70 – 82 . OpenUrl PubMed 42. ↵ Henley MJ , Linhares BM , Morgan BS , Cierpicki T , Fierke CA , Mapp AK . Unexpected specificity within dynamic transcriptional protein–protein complexes . Proceedings of the National Academy of Sciences . 2020 ; 117 ( 44 ): 27346 – 53 . OpenUrl Abstract / FREE Full Text 43. ↵ Pretel E , Camporeale G , de Prat-Gay G . The Non-Structural NS1 Protein Unique to Respiratory Syncytial Virus: A Two-State Folding Monomer in Quasi-Equilibrium with a Stable Spherical Oligomer . PLoS One . 2013 ; 8 ( 9 ): e74338 . OpenUrl CrossRef PubMed 44. ↵ Dixon AS , Schwinn MK , Hall MP , Zimmerman K , Otto P , Lubben TH , et al. NanoLuc Complementation Reporter Optimized for Accurate Measurement of Protein Interactions in Cells . ACS Chem Biol . 2015 ; 11 ( 2 ): 400 – 8 . OpenUrl CrossRef PubMed 45. ↵ Hillyer P , Shepard R , Uehling M , Krenz M , Sheikh F , Thayer KR , et al. Differential Responses by Human Respiratory Epithelial Cell Lines to Respiratory Syncytial Virus Reflect Distinct Patterns of Infection Control . Journal of virology . 2018 ; 92 ( 15 ). 46. ↵ Collins PL , Fearns R , Graham BS . Respiratory Syncytial Virus: Virology , Reverse Genetics, and Pathogenesis of Disease. Challenges and Opportunities for Respiratory Syncytial Virus Vaccines. Current Topics in Microbiology and Immunology . 2013 . p. 3 – 38 . 47. ↵ Verger A , Baert J-L , Verreman K , Dewitte F , Ferreira E , Lens Z , et al. The Mediator complex subunit MED25 is targeted by the N-terminal transactivation domain of the PEA3 group members . Nucleic Acids Research . 2013 ; 41 ( 9 ): 4847 – 59 . OpenUrl CrossRef PubMed 48. ↵ Sela D , Conkright JJ , Chen L , Gilmore J , Washburn MP , Florens L , et al. Role for Human Mediator Subunit MED25 in Recruitment of Mediator to Promoters by Endoplasmic Reticulum Stress-responsive Transcription Factor ATF6α . Journal of Biological Chemistry . 2013 ; 288 ( 36 ): 26179 – 87 . OpenUrl Abstract / FREE Full Text 49. ↵ Yamamoto S , Eletsky A , Szyperski T , Hay J , Ruyechan WT . Analysis of the varicella-zoster virus IE62 N-terminal acidic transactivating domain and its interaction with the human mediator complex . Journal of virology . 2009 ; 83 ( 12 ): 6300 – 5 . OpenUrl Abstract / FREE Full Text 50. ↵ Roupelieva M , Griffiths SJ , Kremmer E , Meisterernst M , Viejo-Borbolla A , Schulz T , et al. Kaposi’s sarcoma-associated herpesvirus Lana-1 is a major activator of the serum response element and mitogen-activated protein kinase pathways via interactions with the Mediator complex . Journal of General Virology . 2010 ; 91 ( 5 ): 1138 – 49 . OpenUrl CrossRef PubMed Web of Science 51. ↵ Diamond MS . IFIT1: A dual sensor and effector molecule that detects non-2′-O methylated viral RNA and inhibits its translation . Cytokine Growth Factor Rev . 2014 ; 25 ( 5 ): 543 – 50 . OpenUrl CrossRef PubMed 52. ↵ Fensterl V , Sen GC , Goff SP . Interferon-Induced Ifit Proteins: Their Role in Viral Pathogenesis . Journal of virology . 2015 ; 89 ( 5 ): 2462 – 8 . OpenUrl Abstract / FREE Full Text 53. ↵ Bailey CC , Zhong G , Huang IC , Farzan M . IFITM-Family Proteins: The Cell’s First Line of Antiviral Defense . Annual Review of Virology . 2014 ; 1 ( 1 ): 261 – 83 . OpenUrl CrossRef PubMed 54. ↵ Ribaudo M , Barik S . The nonstructural proteins of Pneumoviruses are remarkably distinct in substrate diversity and specificity . Virol J . 2017 ; 14 ( 1 ): 215 . OpenUrl CrossRef PubMed 55. ↵ Perng Y-C , Lenschow DJ . ISG15 in antiviral immunity and beyond . Nature Reviews Microbiology . 2018 ; 16 ( 7 ): 423 – 39 . OpenUrl CrossRef PubMed 56. ↵ Pulit-Penaloza JA , Scherbik SV , Brinton MA . Type 1 IFN-independent activation of a subset of interferon stimulated genes in West Nile virus Eg101-infected mouse cells . Virology . 2012 ; 425 ( 2 ): 82 – 94 . OpenUrl CrossRef PubMed 57. ↵ Pei J , Wagner ND , Zou AJ , Chatterjee S , Borek D , Cole AR , et al. Structural basis for IFN antagonism by human respiratory syncytial virus nonstructural protein 2 . Proceedings of the National Academy of Sciences . 2021 ; 118 ( 10 ). 58. ↵ Ikeda K , Stuehler T , Meisterernst M . The H1 and H2 regions of the activation domain of herpes simplex virion protein 16 stimulate transcription through distinct molecular mechanisms . Genes to Cells . 2002 ; 7 ( 1 ): 49 – 58 . OpenUrl CrossRef PubMed Web of Science 59. ↵ Regier JL , Shen F , Triezenberg SJ . Pattern of aromatic and hydrophobic amino acids critical for one of two subdomains of the VP16 transcriptional activator . Proceedings of the National Academy of Sciences . 1993 ; 90 ( 3 ): 883 – 7 . OpenUrl Abstract / FREE Full Text 60. ↵ Khalil MI , Che X , Sung P , Sommer MH , Hay J , Arvin AM . Mutational analysis of varicella-zoster virus (VZV) immediate early protein (IE62) subdomains and their importance in viral replication . Virology . 2016 ; 492 : 82 – 91 . OpenUrl CrossRef PubMed 61. ↵ Hassan I , Gaines KS , Hottel WJ , Wishy RM , Miller SE , Powers LS , et al. Inositol-requiring Enzyme 1 Inhibits Respiratory Syncytial Virus Replication . Journal of Biological Chemistry . 2014 ; 289 ( 11 ): 7537 – 46 . OpenUrl Abstract / FREE Full Text 62. ↵ Pattelli ON , Valdivia EM , Beyersdorf MS , Regan CS , Rivas M , Hebert KA , et al. A Lipopeptidomimetic of Transcriptional Activation Domains Selectively Disrupts the Coactivator Med25 Protein–Protein Interactions . Angewandte Chemie International Edition . 2024 ; 63 ( 21 ). 63. ↵ Allen BL , Quach K , Jones T , Levandowski CB , Ebmeier CC , Rubin JD , et al. Suppression of p53 response by targeting p53-Mediator binding with a stapled peptide . Cell Rep . 2022 ; 39 ( 1 ): 110630 . OpenUrl CrossRef PubMed 64. ↵ Rana R , Surapureddi S , Kam W , Ferguson S , Goldstein JA . Med25 Is Required for RNA Polymerase II Recruitment to Specific Promoters, Thus Regulating Xenobiotic and Lipid Metabolism in Human Liver . Molecular and Cellular Biology . 2010 ; 31 ( 3 ): 466 – 81 . OpenUrl PubMed 65. ↵ Rameix-Welti MA , Le Goffic R , Herve PL , Sourimant J , Remot A , Riffault S , et al. Visualizing the replication of respiratory syncytial virus in cells and in living mice . Nat Commun . 2014 ; 5 :5104. 66. ↵ Ruggli N , Tratschin JD , Mittelholzer C , Hofmann MA . Nucleotide sequence of classical swine fever virus strain Alfort/187 and transcription of infectious RNA from stably cloned full-length cDNA . Journal of virology . 1996 ; 70 ( 6 ): 3478 – 87 . OpenUrl Abstract / FREE Full Text 67. ↵ Elfmann C , Stülke J . PAE viewer: a webserver for the interactive visualization of the predicted aligned error for multimer structure predictions and crosslinks . Nucleic Acids Research . 2023 ; 51 ( W1 ): W404 – W10 . OpenUrl CrossRef PubMed 68. ↵ Skinner SP , Fogh RH , Boucher W , Ragan TJ , Mureddu LG , Vuister GW . CcpNmr AnalysisAssign: a flexible platform for integrated NMR analysis . Journal of Biomolecular NMR . 2016 ; 66 ( 2 ): 111 – 24 . OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted January 25, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following A dual interaction between RSV NS1 and MED25 ACID domain reshapes antiviral responses Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share A dual interaction between RSV NS1 and MED25 ACID domain reshapes antiviral responses Célia Ait-Mouhoub , Jiawei Dong , Magali Noiray , Jenna Fix , Stepanka Nedvedova , Alexis Verger , Jean-Francois Eleouet , Delphyne Descamps , Monika Bajorek , Christina Sizun bioRxiv 2025.01.23.634448; doi: https://doi.org/10.1101/2025.01.23.634448 Share This Article: Copy Citation Tools A dual interaction between RSV NS1 and MED25 ACID domain reshapes antiviral responses Célia Ait-Mouhoub , Jiawei Dong , Magali Noiray , Jenna Fix , Stepanka Nedvedova , Alexis Verger , Jean-Francois Eleouet , Delphyne Descamps , Monika Bajorek , Christina Sizun bioRxiv 2025.01.23.634448; doi: https://doi.org/10.1101/2025.01.23.634448 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Pathology Subject Areas All Articles Animal Behavior and Cognition (7637) Biochemistry (17705) Bioengineering (13899) Bioinformatics (41968) Biophysics (21460) Cancer Biology (18603) Cell Biology (25526) Clinical Trials (138) Developmental Biology (13385) Ecology (19910) Epidemiology (2067) Evolutionary Biology (24328) Genetics (15614) Genomics (22513) Immunology (17741) Microbiology (40423) Molecular Biology (17193) Neuroscience (88646) Paleontology (667) Pathology (2835) Pharmacology and Toxicology (4827) Physiology (7647) Plant Biology (15160) Scientific Communication and Education (2046) Synthetic Biology (4302) Systems Biology (9825) Zoology (2271)