The Role and Mechanism of Periostin in the Formation of Breast Prosthesis Capsule | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The Role and Mechanism of Periostin in the Formation of Breast Prosthesis Capsule Ying Yang, Shumo Li, Li Bian, Xiaoming Dai, Jun Hu, Yun Ma, Zhiyuan Wang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4547511/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 15 Jul, 2025 Read the published version in Scientific Reports → Version 1 posted 5 You are reading this latest preprint version Abstract Capsular contraction is the most common complication after breast augmentation or reconstruction, and is the main reason underlying patient dissatisfaction and additional subsequent surgeries. Periostin is an extracellular matrix protein and a member of TGF-β superfamily. Studies have shown that periostin is closely related to fibrosis, collagen cross-linking and tissue remodeling. In this study, we observed the expression of periostin and other fibrosis-related proteins in the capsule of human breast silicon implant, assessing their relationship with the extent of capsule fibrosis. By using human breast derived fibroblasts with manipulated periostin expression level, we explored periostin’s impact on other fibrosis-related cytokines, fibroblast proliferation, differentiation, and collagen synthesis. Furthermore, we employed a murine model of prosthesis implantation to elucidate the roles of periostin and lysyl oxidase (LOX) in capsule formation. Immunohistochemical analysis of clinical capsular specimens revealed a significant correlation between periostin expression levels and the severity of capsular contracture. In vitro experiments using human breast-derived fibroblasts demonstrated that periostin promotes fibroblast proliferation and regulates the expression of key fibrosis-related proteins such as LOX, BMP-1, fibronectin, and tenascin-C at both protein and mRNA levels. Moreover, periostin was found to induce fibroblast differentiation into myofibroblasts and enhance collagen production. In the murine model of prosthesis implantation, periostin and LOX were observed to increase the thickness of the prosthesis capsule, whereas the administration of the LOX inhibitor β-aminopropionitrile (BAPN) significantly attenuated capsule formation. Our study underscores the significant role of periostin in the pathogenesis of breast prosthesis capsule formation and contracture. These findings provide novel insights into the mechanisms underlying capsular contracture and suggest periostin as a potential therapeutic target for mitigating this complication. breast Implants/adverse effects silicon implant capsular contraction periostin fibroblasts animals Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction After decades of continuous upgrading, silicone prostheses have become the most commonly used type of implant in breast augmentation surgery. Capsular contraction represents the most prevalent complication after breast augmentation, serving as the major reason underlying patient dissatisfaction and additional subsequent surgeries. Reported incidence of capsular contraction have varied, ranging from 2.8–20.4% in previous reports 1 , 2 , with isolated reports indicating rates as high as 80% 3 . Capsule is the fibrous tissue around the surgical implants or prostheses. The formation of the capsule is like the two sides of a coin: it holds the implant in place and causes the pain, sclerosis, masses and malformation at the same time. Presently, effective preventative and therapeutic strategies remain elusive, necessitating reoperation in cases of severe capsular contracture, thereby inflicting significant physical and psychological trauma upon patients 4 . The formation of fibrous envelope is the body’s protective response to exogenous implants and typically occurs within 1 to 2 weeks after operations. The main component cells of the capsule include fibroblasts, myofibroblasts and inflammatory cells such as macrophage, polymorpnonuclear leukocytes, lymphocytes, plasma cells and mastocytes 5 . Numerous factors influence the development of capsular contracture, encompassing surgical techniques, implant characteristics, infectious agents, and other variables contributing to contracture pathogenesis 6 . Despite extensive research, the precise mechanisms governing capsule formation and contracture remain incompletely understood. Overall, exogenous implants incite inflammation, prompting fibroblast-mediated collagen deposition, and myofibroblast-induced tissue contraction. When the physiological wound healing process stagnates, pathological changes ensue, culminating in capsular contracture 7 . A large number of studies, including implant types, surface characteristics, surgical methodologies, and bacterial infections, have endeavored to elucidate the intricate mechanisms of capsule formation and contracture, in order to seek effective therapeutic and preventative methods 8 – 10 . Periostin, a 90kDa secreted glycoprotein encoded by the Postn gene, is a member of the transforming growth factor-beta (TGF-β) protein-induced superfamily with very low expression in normal adult tissues but strongly mediated secretion into the extracellular interstitium after acute injury 11 . Extensive literature has studied the important role of periostin in a variety of areas, including bone regeneration, bone marrow fibrosis, myocardial infarction recovery, airway inflammation, idiopathic pulmonary fibrosis, muscle atrophy and fibrosis, kidney disease, skin inflammation, joint stiffness, and tumor progression, invasion, metastasis, and fibrosis 12 , 13 14 . Previous studies have highlighted periostin's ability to augment active lysyl oxidase (LOX) levels, thereby facilitating collagen cross-linking and enhancing connective tissue mechanical properties 15 . Given its central involvement in fibrotic processes, we hypothesize that periostin may play a crucial regulatory role in capsule formation and contractures, although no prior reports have explored its specific contribution to these processes following breast prosthesis implantation. Consequently, our study observed the expression of periostin and its correlation with the degree of capsule contracture within the capsule of human breast silicone implants. By using human breast derived fibroblasts with manipulated periostin expression, we investigated its impact on other fibrosis-related cytokines, fibroblast proliferation, differentiation, and collagen synthesis. Additionally, we employed a murine model of prosthesis implantation to validate the roles of periostin and LOX in capsule formation. 2. Materials and Methods Clinical cases collection- We collected a cohort of cases involving the removal of breast silicone implants or capsule removal surgeries spanning from 2009 to 2019, excluding specimens not of breast origin and those related to other types of prostheses. Clinicopathological eveluation- Formalin-fixed, paraffin-embedded tissue sections stained with hematoxylin and eosin (HE) were examined under a microscope. Microscopic assessments encompassed various features, including capsule thickness, fibroblast density, inflammation type and severity, collagen fibril orientation, and morphological characteristics of breast glands within the specimens. Additionally, clinical and radiological data associated with these cases were systematically compiled. The Baker grading system 5 was employed to classify the degree of capsule contracture as follows: Grade I denoting normal breast appearance and touch; Grade II indicating mild contracture perceptible to the surgeon but lacking symptoms; Grade III indicative of moderate contracture, characterized by palpable firmness; and Grade IV representing severe contracture, visually apparent with symptomatic manifestations. Antibodies - Rabbit polyclonal anti-periostin antibodies (Abcam, ab14041), mouse monoclonal anti-alpha smooth muscle actin (SMA) antibodies (Abcam, ab7817), rabbit polyclonal anti-Fibronectin antibodies (Proteintech, 15613-AP), rabbit polyclonal anti-LOX antibodies (Proteintech, 17958-1-AP), rabbit polyclonal anti-bone morphogenetic protein 1 (BMP1) antibodies (Affinity, DF9280), rabbit recombinant anti-beta-Actin antibodies (Proteintech, 81115-1-RR) and rabbit monoclonal anti-Tenascin-C antibodies (CST, 12221) were purchased from the sources indicated. Immunohistochemistry - Capsule tissues surrounding breast implants were sectioned, dewaxed, subjected to antigen retrieval, and then cooled. Endogenous peroxidases were neutralized using 3% hydrogen peroxide (H 2 O 2 ). Subsequently, sections were incubated with primary antibodies for 1 hour at room temperature, followed by incubation with secondary antibodies for 40 minutes at room temperature. Visualization was achieved through DAB staining, complemented by hematoxylin nuclear staining. Following dehydration, clearing, and mounting, image analysis was conducted utilizing Image-proplus software (Media Cybernetics, USA), with the intensity of staining quantified as the product of positive grey value and positive area (IOD). Cell culture - Human breast-derived fibroblasts (HMF7630) obtained from CELLBIO, Shanghai, and the 293T cell line sourced from the Kunming Institute of Zoology were utilized in this study. The cells were cultured in RPMI-1640 medium (Gibco, Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (Gibco) at 37°C in a humidified atmosphere with 5% CO2. Medium was refreshed every 24 hours, and cells were harvested during the logarithmic growth phase for subsequent experiments. Plasmid and cell transfection - Periostin expression and interference vectors were synthesized by GeneCopoeia (Guangzhou, China, see Fig. 1 ). The sequences of short hairpin RNA (shRNA) are detailed in Table 1 . Following identification and screening, periostin expression, interference, and negative control plasmids were packaged with lentivirus in human embryonic kidney 293T cells using the Lenti-Pac™ HIV Expression Packaging Kit (GeneCopoeia, Guangzhou, China). HMF7630 cells were transfected with recombinant lentivirus at a multiplicity of infection (MOI) of 5, at a growth density of 75%. Stably transfected cells were selected in the presence of 2 µg/ml puromycin until the infection positivity rate exceeded 80%. Table 1 Sequences of shRNA Name Sense (5’-3’) shPeriostin-a GCTGCTTATTGTTAACCCTAT shPeriostin-b GCACTTGTAAGAACTGGTATA shPeriostin-c GCAACGTGAATGTTGAATTAC shPeriostin-d GGTGACAGTATAACAGTAAAT RNA isolation and quantitative real-time polymerase chain reaction (qRT-PCR) - Total RNA was extracted from cells using Trizol reagent (MRC, Germany) as per the manufacturer's protocol, followed by reverse transcription to synthesize first-strand cDNA using the All-in-OneTM First-Strand-cDNA Synthesis Kit (GeneCopoeia, USA). Specific primer sets for periostin, LOX, BMP-1, Fibronectin, Tenascin C, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were designed (Table 2 ). Quantitative real-time polymerase chain reaction (qRT-PCR) was conducted using the All-in-OneTM qPCR Mix (GeneCopoeia, USA) on a Real-Time PCR Detection System (2720 Thermo, USA). All experiments were independently replicated three times, with relative mRNA levels normalized to endogenous GAPDH mRNA using the relative quantification comparative Ct method. Table 2 Sequences of primers used for qRT-PCR Gene (Homo) Sequence (5′–3′) POSTN Forward CCAAATGTCTGTGCCCTTC Reverse CCCTTTCCCTCGATCTCCT LOX Forward TAGCCACTATGACCTGCTTGAT Reverse CTGGGGTTTACACTGACCTTTA BMP-1 Forward TGCGGGGGTGATGTGAAAA Reverse CTGGGTAGTTGGGCGATTG Fibronectin Forward TTCCCATTATGCCGTTGGAG Reverse GAAATGACCACTTCCAAAGCCTA Tenascin-C Forward ACATCGCATCAACATCCCC Reverse TCCTCCAGTCTGCTCAGCA GAPDH Forward CGCTGAGTACGTCGTGGAGTC Reverse GCTGATGATCTTGAGGCTGTTGTC Western blot analysis - Transfected cells were washed with phosphate-buffered saline (PBS) and lysed in radioimmunoprecipitation assay (RIPA) buffer containing protease inhibitor. The resulting supernatant was collected and stored at -80°C. Protein samples were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to polyvinylidene fluoride (PVDF) membranes, and blocked with 5% skim milk for 1 hour. Membranes were then incubated with specific primary antibodies at room temperature for 2 hours. Following incubation with secondary horseradish peroxidase (HRP)-conjugated antibodies (dilution 1:4000) for 1.5 hours at room temperature, membranes were washed thrice with Tris-buffered saline with Tween (TBST), incubated with Immobilon Western Chemiluminescent horseradish peroxidase substrate (Millipore), and exposed to medical x-ray film (Carestream). CCK8 assay - Cells in logarithmic growth phase were digested and centrifuged. The cell number was determined in a cell counting plate, and the digested cells were adjusted to 5x10 4 cells/ml. Subsequently, cells were inoculated into a 96-well cell culture plate at a rate of 5x10 3 cells/well (100µl per well), with three wells allocated for each cell group simultaneously. At 0h, 24h, 48h, and 72h post-inoculation, 10µl of CCK-8 solution was added to each well. After 2 hours of incubation at 37°C and 5% CO 2 , absorbance at 450nm was measured. Immunofluorescence Microscopy- Cells from selected cell lines in logarithmic growth phase were digested and centrifuged to prepare a 10 5 cell suspension. Subsequently, 1ml of each suspension was plated onto a 24-well cell slide (three wells per cell line). After cell adherence, slides were removed from the incubator, washed three times with PBS, and fixed in 4% paraformaldehyde in PBS for 30 minutes at room temperature. Following PBS washes, cells were blocked with 5% bovine serum albumin for 30 minutes at 37°C. Primary antibody (α-SMA:1/100) was then applied and incubated overnight at 4°C in 2% bovine serum albumin. After washing, cells were incubated with fluorescence-tagged secondary antibodies (Goat Anti-Mouse IgG H&L Alexa Fluor® 647; 1:2000) for 1 hour at 37°C, followed by additional PBS washes. Nuclei were stained with DIPA (Molecular Probes, Invitrogen), and fluorescent images were captured using a fluorescence microscope (BX61; Olympus, Japan). Hydroxyproline measurement - To assess periostin's impact on collagen content, hydroxyproline levels were measured in cell lines. Hydroxyproline was extracted from 5 million stable screening cell lines according to the manufacturer's instructions provided with the hydroxyproline assay kit (Abcam). Absorbance was measured at a wavelength of 560 nm, and hydroxyproline content in the cell lines was calculated. Animal experiments - Sixty female Kunming (KM) mice aged 6–8 weeks were divided into four groups: silicone + physiological saline, silicone + periostin, silicone + LOX, and silicone + BAPN, with 15 mice per group. Each group underwent the following procedure: after anesthesia induction, incisions were made bilaterally 0.5cm from the midline of the back to expose the skin and sarcolemma, creating 1.5cm pockets. Disinfected 1ml hemispherical silicone implants were inserted, and incisions were closed. Mice received subcutaneous injections of periostin, LOX, LOX inhibitor BAPN, or control physiological saline around the prosthesis, administered once daily at a dose of 200mg/kg for 30 days. Weekly photographs were taken to monitor wound surface changes. After 30 days, silicone prostheses and surrounding tissues were excised for further analysis. Ethics approval- All methods were carried out in accordance with relevant guidelines and regulations.The study protocol involving human tissues was approved by the Ethics Committee of The First Affiliated Hospital of Kunming Medical University. The informed consent was obtained from all participants. All experiments were performed in accordance with the ethical guidelines of the 2013 Declaration of Helsinki. The material was anonymized at the time of collection. Animal care and experiments were conducted in compliance with ARRIVE guidelines, with approval obtained from the Animal Ethics Committee of Kunming Medical University (Kmmu20230546). 3. Results 3.1 Periostin expression in human breast capsules of silicon implants To assess the association between periostin expression and the extent of capsule contracture, we collected clinical capsule specimens from breast implant cases and analyzed the relationship between periostin expression and clinicopathological characteristics. Twenty-one capsule specimens from 11 breast implant cases were obtained, comprising 12 classified as Baker Grades I-II and 9 as Baker Grades III-IV based on the clinical degree of capsule contraction. All cases involved females with a mean age of 42.3 years (range: 29–42). The duration of prosthesis implantation ranged from 1 to 30 years, with an average of 12.64 years. Silicone implants were used in all 11 cases, with 10 cases yielding bilateral breast capsule specimens and 1 case yielding a unilateral specimen. Clinically, pain or discomfort was reported in 3 cases, breast lumps (including multiple lumps) in 4 cases, breast texture hardening in 2 cases, breast deformation in 4 cases, signs of infection such as swelling and fever in 1 case, and breast softening with mass formation following a car accident in 1 case. Capsule formation was observed in 20 specimens under microscopic examination. The relationship between clinicopathological characteristics and the extent of capsular contraction is summarized in Table 3 . Baker Grades III-IV were defined as instances of pronounced contraction. As presented in Table 3 , inflammation levels were elevated in cases of pronounced capsule contraction. Although not statistically significant, there was a trend toward increased fibroblast density and hardened breast texture in cases of pronounced contraction. To elucidate the relationship between capsule contraction extent and periostin expression alongside other fibrosis-related proteins, immunohistochemistry was performed on silicone implant capsules. Immunohistochemistry and image analysis revealed an escalation in the expression of periostin, LOX, fibronectin, Tenascin-C, and α-SMA with worsening capsule contraction (Fig. 1 ). Table 3 The relationship between clinicopathological character and capsular contraction Clinicopathological character Baker Ⅰ-Ⅱ Baker Ⅲ-Ⅳ P value Fibroblast density: moderate or above 5/12 8/9 0.067 Capsular thickness: >3mm 6/11 3/8 0.650 Inflammation: moderate or above 1/12 6/9 0.016 With pain 4/12 2/9 0.659 Breast texture hardening 0/12 3/9 0.063 3.2 Role of periostin on fibrotic function of human breast derived fibroblasts in vitro To investigate the impact of periostin on fibroblasts during fibrosis, we constructed both overexpression and interference plasmids. The expression and interference vector maps are depicted in Fig. 2 . Validation of the plasmids was conducted using 1% agarose gel electrophoresis, Western blot, and quantitative polymerase chain reaction (qPCR). After 4 weeks of screening, periostin protein and mRNA levels in stably transfected HMF7630 cells were consistent with expectations (Fig. 2 ). To assess the regulatory effect of periostin on fibrosis-related genes, we evaluated the expression of LOX, BMP-1, fibronectin, and Tenascin-C in periostin overexpression and interference cell lines. Compared to Ctrl-mPeriostin-HMF7630, both protein and mRNA levels of periostin, LOX, BMP-1, fibronectin, and Tenascin-C significantly increased in the mPeriostin-HMF7630 cell line while markedly decreased in the shPeriostin-HMF7630 cell line (Fig. 3 A, B). This confirmed the positive regulatory effect of periostin on LOX, BMP-1, fibronectin, and Tenascin-C. To explore the association between periostin expression and fibroblast proliferation, we conducted a CCK8 assay. The results indicated that the mPeriostin-HMF7630 cell line exhibited significantly enhanced proliferation compared to the Ctrl-mPeriostin-HMF7630 cell line, while the shPeriostin-HMF7630 cell line showed markedly reduced proliferation compared to the control. These findings suggest that the periostin gene promotes fibroblast proliferation (Fig. 3 C). Immunofluorescence analysis of α-SMA expression in the cell lines revealed significantly higher levels in the mPeriostin-HMF7630 cell line compared to the control (56.26 ± 3.88 vs 23.01 ± 4.75, p = 0.0009), whereas expression was notably lower in the shPeriostin-HMF7630 cell line compared to the control (13.66 ± 1.38 vs 22.07 ± 2.19, p = 0.0115) (Fig. 3 D). Given that α-SMA expression serves as a marker for fibroblast differentiation into myofibroblasts, these results suggest that periostin promotes fibroblast differentiation into myofibroblasts. To assess the impact of periostin on collagen content, we measured hydroxyproline levels in the cell lines. The mPeriostin cell strain exhibited significantly higher collagen content compared to the ctrl-mPeriostin cell strain (13.46 ± 2.57 vs 7.39 ± 0.334, p = 0.049). Although not statistically significant, the collagen content in the shPeriostin cell strain appeared lower than the control (5.63 ± 1.34 vs 7.08 ± 0.18, p = 0.174) (Fig. 3 E). 3.3 Impact of periostin, LOX and inhibitor treatment on capsule formation in mice following prosthetic implantation To assess the influence of periostin on capsule formation in vivo, we established a mouse prosthesis implantation model and investigated the effects of periostin, LOX, and inhibitor treatment on capsule formation following prosthetic implantation. β-aminopropionitrile (BAPN), the most potent inhibitor of LOXs, was utilized as the inhibitor. As illustrated in Fig. 4 B and C, compared to the silica gel + saline group, the silica gel + LOX group exhibited the slowest wound healing and more severe suppurative conditions. Wound healing was also delayed in the silica gel + Periostin group and silica gel + BAPN group, with mild suppurative conditions observed. Gross examination of the prosthesis block revealed that the silica gel + periostin group had a larger prosthesis block with surrounding tissues appearing yellow compared to the silica gel + saline group. Conversely, the prosthesis blocks of the silica gel + LOX group and silica gel + BAPN group resembled those of the control group, with surrounding tissues displaying slight yellowing (Fig. 4 D). Following 30 days of feeding, capsule tissue was harvested for subsequent experiments. QPCR and Western blot results demonstrated significantly higher expression levels of periostin and other fibrosis-related genes/proteins (LOX, BMP-1, fibronectin, Tenascin-C, and α-SMA) in the silica gel + LOX group and silica gel + periostin group compared to the silica gel + saline group. Conversely, expression levels of these genes/proteins in the silica gel + BAPN group were significantly lower than those in the control group (Fig. 5 A, B). Subsequent to H&E staining of the capsule tissue, capsule thickness was assessed. The mean thicknesses of the silica gel + Periostin group and silica gel + LOX group were significantly greater than that of the silica gel + saline group. Conversely, capsules in the silica gel + BAPN group were notably thinner than those in the control group (Fig. 6 A). Immunohistochemistry of periostin and other fibrosis-related proteins aligned with the results of QPCR and Western blot, indicating an increase in the silica gel + Periostin group and silica gel + LOX group, and a decrease in the silica gel + BAPN group (Fig. 6 B). Discussion Despite numerous investigations into capsular contracture, the underlying mechanism remains incompletely elucidated. Our study revealed a correlation between periostin expression in clinical capsular specimens and the extent of capsular contracture. In vitro experiments demonstrated that periostin promotes the proliferation of human breast fibroblasts, regulates fibrosis-related cytokine expression, induces fibroblasts to express α-SMA and differentiate into myofibroblasts, and stimulates collagen production and cross-linking. Furthermore, our findings were validated in a mouse model of prosthesis implantation, where we observed reduced capsule thickness with LOX inhibitors. To our knowledge, this study represents the first comprehensive investigation into the role of periostin in capsule formation, both in vitro and in vivo. Early studies have explored the role of TGF-β in breast prosthesis capsule formation, indicating its pivotal involvement in fibrosis initiation 16 , 17 , 18 , 19 , 20 . Subsequent investigations demonstrated that periostin, a downstream protein in the TGF-β signaling pathway, plays a crucial role in various fibrotic diseases. In a study of the mouse model of muscle atrophy, Lorts et al. found that in the absence of periostin, the TGF-β pathway was changed to support regeneration but not increase fibrosis. Therefore, targeting periostin downstream of TGF-β may offer therapeutic advantages over targeting the entire TGF-β pathway 21 . Moreover, in a study of primary pulmonary fibrosis, CP4715, an inhibitor of periostin receptor α V β 3 integrin, successfully blocked the interaction between TGF-β and periostin, becoming a potential therapeutic target for pulmonary fibrosis 22 . Some preliminary studies have shown that periostin and LOX are expressed in capsular tissues 23 , 24 , inspiring speculation regarding their role in breast prosthesis capsule formation and contracture. In clinical capsular specimens, immunohistochemistry demonstrated that the expression of periostin and other fibrosis related proteins were correlated with the degree of capsular contracture. This confirms our hypothesis that periostin may play an important role in capsule formation and contracture after breast prosthesis implantation. We further confirmed our hypothesis at the cellular level and in animal models. In the study of cell proliferation using CCK8 experiment, the data of this study showed that periostin can promote the proliferation activity of breast derived fibroblasts, and the difference was more obvious after 24 hours. Previous studies have linked fibroblast porliferation to TGF-β signaling. Thevenot et al. confirmed the relationship between mast cells and prosthesis formation in the subcutaneous prosthesis model 25 . Brazin et al. further demonstrated that the number of fibroblasts in the capsule was related to the degree of capsule contracture, and this correlation was derived from the fact that TGF-β secreted by mast cells stimulated fibroblast proliferation and collagen formation 26 . Notably, our study suggested that periostin, downstream of TGF-β, contributes to fibroblast proliferation, potentially exacerbating capsule formation and contracture. Existing studies have preliminarily understood the mechanism of periostin in the process of bone, tooth, heart and skin fibrosis. In response to inflammation and mechanical pressure, the expression of periostin and other extracellular matrix molecules are triggered by cytokines secreted by immune cells, promoting extracellular matrix (ECM) remodeling 27 . Periostin interacts with integrins on myofibroblasts, facilitating cell migration and ECM assembly 28 . Periostin constitutes a scaffold structure with tenascin-C and fibronectin to interact with type I collagen 28 . Moreover, periostin supports BMP-1-mediated LOX activation, enhancing collagen cross-linking 15 . Combined with the above studies, our study detected the expression of some key genes related to fibrosis in human breast derived fibroblasts overexpressing and interfering with periostin. Our results, consistent with those of previous studies, showed that BMP-1, LOX, fibronectin and tenascin-C are located downstream of periostin, and their protein and mRNA expressions are regulated by periostin, which increases with the expression of periostin and decreases with the interference of periostin. Among the four genes, tenascin-C was most significantly affected by periostin overexpression, and BMP-1 was most significantly affected by periostin interference. Collagen fibers undergo stabilization through covalent cross-linking, a process initiated by the oxidation of lysine residues by LOX enzymes. This enzymatic activity removes residual lysine or hydroxylysine from collagen fiber tails, facilitating the formation of sponge-like cross-links between adjacent collagen molecules. These bivalent cross-links mature into more stable trivalent forms over time. 29 , 30 . LOX activity not only influences the shape of collagen fibers but also contributes to the complex layered structure observed in tissues such as the cornea 31 . Consequently, LOX-mediated covalent cross-linking is a crucial step in collagen formation, ultimately determining the mechanical properties of the extracellular matrix. Studies in periostin-deficient mice and post-myocardial infarction heart tissues have highlighted the common occurrence of collagen cross-linking abnormalities 32 , underscoring the essential role of periostin in establishing and maintaining connective tissue mechanical properties. As mentioned above, Maruhashi et al. confirmed that periostin supports the hydrolysis activation of LOX mediated by BMP-1 in the extracellular matrix, thereby strengthening the cross-linking of collagen 15 . Our study further corroborated this relationship, showing significant changes in LOX expression following periostin modulation. Additionally, periostin-overexpressing cells exhibited elevated hydroxyproline levels, a marker of collagen production 33 , suggesting a role for periostin in promoting collagen synthesis and cross-linking through LOX activity. Myofibroblasts, contractile fibroblasts crucial for wound healing, are commonly observed within breast prosthesis capsules 34 . These cells arise from fibroblast differentiation under appropriate stimulation and subsequently generate contractile forces to facilitate wound closure 35 . ɑ-SMA serves as a marker of myofibroblast differentiation 36 and is associated with the degree of capsule contracture 7 . Bui et al. believed that the continuous activation of fibroblasts and myofibroblasts may cause the contracture of prosthesis capsule 7 , while antagonising the estrogen of myofibroblasts can alleviate the severity of contracture 37 . Previous studies have found that periostin can regulate the expression of the downstream gene ɑ-SMA 11 , 38 . In periostin silenced mice, the number of ɑ-SMA positive myofibroblasts in lung tissue decreased, thus avoiding hyperoxia mediated pulmonary interstitial fibrosis 39 . Our study, consistent with previous findings, revealed an increase in ɑ-SMA expression with worsening capsule contracture, both in clinical specimens and periostin-overexpressing fibroblasts. Hence, periostin's regulation of downstream ɑ-SMA expression likely contributes to myofibroblast differentiation during breast prosthesis capsule formation. In animal models, periostin and LOX were found to increase capsule thickness, whereas LOX inhibition significantly reduced thickness. These findings were consistent with in vitro results demonstrating changes in fibrosis-related gene and protein expression. Some researchers have demonstrated that knockdown of LOX expression or inhibition of LOX activity alleviates the lung fibrosis 40 . Our study is the first to utilize a LOX inhibitor to mitigate fibrosis in a prosthesis implantation model, indicating the potential possibility of clinical application to reduce capsule contracture. However, unexpected outcomes, including severe inflammation and delayed wound healing in periostin and LOX treatment groups, underscore the complexities of their roles in tissue repair and inflammation. The role of periostin in inflammation and tissue repair has been studied for many years 41 – 43 . Some researchers found that regeneration and repair is delayed in the absence of periostin 44 , 45 . LOX is also considered to be a promoter of tissue repair after injury 46 . A few investigators have reported some approaches to accelerating healing of injured tissues through up-regulating the LOX in the acute phase after injury 47 . Our findings challenge this notion, highlighting the need for further research to elucidate the precise roles of periostin and LOX in inflammation and tissue repair processes. In conclusion, our study sheds light on the critical role of periostin in breast prosthesis capsule formation and contracture mechanisms. By regulating other fibrosis-related genes, promoting fibroblasts proliferation, influencing collagen production and myofibroblasts differentiation, periostin emerges as a potential therapeutic target for mitigating capsule contracture in breast augmentation patients, warranting further investigation into its specific mechanisms and clinical applications. Declarations Disclosure The authors have no financial interests to disclose. None of the authors has a potential conflict of interest concerning this article’s research, authorship, or publication. Data availability All data generated or analysed during this study are included in this published article and its supplementary information files. References Headon H KA, Mokbel K.: Capsular Contracture after Breast Augmentation: An Update for Clinical Practice. Arch Plast Surg 2015, 42:532-43. Ali A, Picado O, Mathew PJ, Ovadia S, Thaller SR: Risk Factors for Capsular Contracture in Alloplastic Reconstructive and Augmentation Mammaplasty: Analysis of the National Surgical Quality Improvement Program (NSQIP) Database. Aesthetic plastic surgery 2023, 47:1678-82. Steiert AE BM, Sorg H.: Capsular contracture by silicone breast implants: possible causes, biocompatibility, and prophylactic strategies. Med Devices (Auckl) 2013, 6:211-8. Coombs DM, Grover R, Prassinos A, Gurunluoglu R: Breast augmentation surgery: Clinical considerations. Cleveland Clinic journal of medicine 2019, 86:111-22. Prantl L SS, Fichtner-Feigl S, Pöppl N, Eisenmann-Klein M, Schwarze H, Füchtmeier B.: Clinical and morphological conditions in capsular contracture formed around silicone breast implants. Plast Reconstr Surg 2007, 120:275-84. Rocco N RC, Moja L, Amato B, Iannone L, Testa S, Spano A, Catanuto G, Accurso A, Nava MB: Different types of implants for reconstructive breast surgery. Cochrane Database Syst Rev 2016, 16:CD010895. Bui JM PT, Ren CD, Nofrey B, Teitelbaum S, Van Epps DE.: Histological characterization of human breast implant capsules. Aesthetic Plast Surg 2015, 39:306-15. Kim CHK, D. H.,Oh, S. H.,Song, S. Y.: Human Embryonic Stem Cell-Derived Endothelial Precursor Cell Conditioned Medium Reduces the Thickness of the Capsule Around Silicone Implants in Rats. Annals of plastic surgery 2015, 75:348-52. Achilles RB, DV DES, Quintana HT, Malinverni ACM, CFG DEM, Branda GW, Renno ACM, Ribeiro DA: Cytotoxicity, Inflammatory Activity, and Angiogenesis Are Induced by Different Silicone Implants. In vivo (Athens, Greece) 2022, 36:1252-8. Bérniz C, Carmona-Torre F, Gómez-Martínez C, Fernéndez-Ciriza L, Del Pozo JL, Hontanilla B: Breast Implant Capsule: A Murine Model Comparing Capsular Contracture Susceptibility Among Six Breast Implants Available in the Market. Aesthetic plastic surgery 2023, 47:2093-105. Conway SJ IK, Kudo Y, Litvin J, Markwald R, Ouyang G, Arron JR, Holweg CT, Kudo A.: The role of periostin in tissue remodeling across health and disease. Cell Mol Life Sci 2014, 71:1279-88. Liu AY ZH, Ouyang G.: Periostin, a multifunctional matricellular protein in inflammatory and tumor microenvironments. Matrix Biol 2014, 37:150-6. Kormann R, Kavvadas P, Placier S, Vandermeersch S, Dorison A, Dussaule JC, Chadjichristos CE, Prakoura N, Chatziantoniou C: Periostin Promotes Cell Proliferation and Macrophage Polarization to Drive Repair after AKI. Journal of the American Society of Nephrology : JASN 2020, 31:85-100. Lee YJ KI, Park SA, Kim Y, Lee JE, Noh DY, Kim KT, Ryu SH, Suh PG.: Periostin-binding DNA aptamer inhibits breast cancer growth and metastasis. Mol Ther 2013, 21:1004-13. Maruhashi T, Kii I, Saito M, Kudo A: Interaction between periostin and BMP-1 promotes proteolytic activation of lysyl oxidase. J Biol Chem 2010, 285:13294-303. Kuhn A, Singh S, Smith PD, Ko F, Falcone R, Lyle WG, Maggi SP, Wells KE, Robson MC: Periprosthetic breast capsules contain the fibrogenic cytokines TGF-beta1 and TGF-beta2, suggesting possible new treatment approaches. Annals of plastic surgery 2000, 44:387-91. Ruiz-de-Erenchun R, Dotor de las Herrerias J, Hontanilla B: Use of the transforming growth factor-beta1 inhibitor peptide in periprosthetic capsular fibrosis: experimental model with tetraglycerol dipalmitate. Plastic and reconstructive surgery 2005, 116:1370-8. Schlesinger SL, Ellenbogen R, Desvigne MN, Svehlak S, Heck R: Zafirlukast (Accolate): A new treatment for capsular contracture. Aesthet Surg J 2002, 22:329-36. Katzel EB KP, Tierney R, Williams JP, Awad HA, O'keefe RJ, Langstein HN.: The impact of Smad3 loss of function on TGF-β signaling and radiation-induced capsular contracture. Plast Reconstr Surg 2011, 127:2263-9. Zeplin PH L-AA, Schmidt K.: Surface modification of silicone breast implants by binding the antifibrotic drug halofuginone reduces capsular fibrosis. Plastic and reconstructive surgery 2010, 126:266-74. Lorts A SJ, Baudino TA, McNally EM, Molkentin JD.: Deletion of periostin reduces muscular dystrophy and fibrosis in mice by modulating the transforming growth factor-β pathway. . Proc Natl Acad Sci U S A 2012, 109:10978-83. Nanri Y, Nunomura S, Terasaki Y, Yoshihara T, Hirano Y, Yokosaki Y, Yamaguchi Y, Feghali-Bostwick C, Ajito K, Murakami S, Conway SJ, Izuhara K: Cross-Talk between Transforming Growth Factor-β and Periostin Can Be Targeted for Pulmonary Fibrosis. American journal of respiratory cell and molecular biology 2020, 62:204-16. Poh PSP, Schmauss V, McGovern JA, Schmauss D, Chhaya MP, Foehr P, Seeger M, Ntziachristos V, Hutmacher DW, van Griensven M, Schantz JT, Balmayor ER: Non-linear optical microscopy and histological analysis of collagen, elastin and lysyl oxidase expression in breast capsular contracture. European journal of medical research 2018, 23:30. Bae HS, Son HY, Lee JP, Chang H, Park JU: The Role of Periostin in Capsule Formation on Silicone Implants. BioMed research international 2018, 2018:3167037. Thevenot PT, Baker DW, Weng H, Sun MW, Tang L: The pivotal role of fibrocytes and mast cells in mediating fibrotic reactions to biomaterials. Biomaterials 2011, 32:8394-403. Brazin J MS, Groh B, Mehrara B, Hidalgo D, Otterburn D, Silver RB, Spector JA: Mast cells in the periprosthetic breast capsule. Aesthetic Plast Surg 2014, 38:592-601. Chiquet M GL, Lutz R, Maier S.: From mechanotransduction to extracellular matrix gene expression in fibroblasts. Biochimica et biophysica acta 2009, 1793:911-20. A. K: Periostin in fibrillogenesis for tissue regeneration: periostin actions inside and outside the cell. Cell Mol Life Sci 2011, 68:3201-7. Bella J, Hulmes DJ: Fibrillar Collagens. Sub-cellular biochemistry 2017, 82:457-90. Vallet SD, Ricard-Blum S: Lysyl oxidases: from enzyme activity to extracellular matrix cross-links. Essays Biochem 2019, 63:349-64. Herchenhan A UF, Eliasson P, Weis M, Eyre D, Kadler KE, Magnusson SP, Kjaer M: Lysyl Oxidase Activity Is Required for Ordered Collagen Fibrillogenesis by Tendon Cells. J Biol Chem 2015, 290:16440-50. Shimazaki M NK, Kii I, Kashima T, Amizuka N, Li M, Saito M, Fukuda K, Nishiyama T, Kitajima S, Saga Y, Fukayama M, Sata M, Kudo A.: Periostin is essential for cardiac healing after acute myocardial infarction. The Journal of experimental medicine 2008, 205:295-303. Wang Z, Chesler NC: Role of collagen content and cross-linking in large pulmonary arterial stiffening after chronic hypoxia. Biomechanics and modeling in mechanobiology 2012, 11:279-89. Hwang K, Sim HB, Huan F, Kim DJ: Myofibroblasts and capsular tissue tension in breast capsular contracture. Aesthetic plastic surgery 2010, 34:716-21. Baker JL, Jr., Chandler ML, LeVier RR: Occurrence and activity of myofibroblasts in human capsular tissue surrounding mammary implants. Plastic and reconstructive surgery 1981, 68:905-12. Powell DW: Myofibroblasts: paracrine cells important in health and disease. Transactions of the American Clinical and Climatological Association 2000, 111:271-92; discussion 92-3. Persichetti P, Segreto F, Carotti S, Marangi GF, Tosi D, Morini S: Oestrogen receptor-alpha and -beta expression in breast implant capsules: experimental findings and clinical correlates. J Plast Reconstr Aesthet Surg 2014, 67:308-15. Ashley SL, Wilke CA, Kim KK, Moore BB: Periostin regulates fibrocyte function to promote myofibroblast differentiation and lung fibrosis. Mucosal Immunol 2017, 10:341-51. Bozyk PD BJ, Popova AP, Anyanwu AC, Linn MD, Goldsmith AM, Pryhuber GS, Moore BB, Hershenson MB.: Neonatal periostin knockout mice are protected from hyperoxia-induced alveolar simplication. PLoS One 2012, 7:e31336. Cheng T LQ, Zhang R, Zhang Y, Chen J, Yu R, Ge G: Lysyl oxidase promotes bleomycin-induced lung fibrosis through modulating inflammation. J Mol Cell Biol 2014, 6:506-15. Sonnenberg-Riethmacher E, Miehe M, Riethmacher D: Periostin in Allergy and Inflammation. Frontiers in immunology 2021, 12:722170. Walker JT, McLeod K, Kim S, Conway SJ, Hamilton DW: Periostin as a multifunctional modulator of the wound healing response. Cell and tissue research 2016, 365:453-65. Yang L, Guo T, Chen Y, Bian K: The Multiple Roles of Periostin in Non-Neoplastic Disease. Cells 2022, 12. Nishiyama T, Kii I, Kashima TG, Kikuchi Y, Ohazama A, Shimazaki M, Fukayama M, Kudo A: Delayed re-epithelialization in periostin-deficient mice during cutaneous wound healing. PLoS One 2011, 6:e18410. Shih CH, Lacagnina M, Leuer-Bisciotti K, Pröschel C: Astroglial-derived periostin promotes axonal regeneration after spinal cord injury. The Journal of neuroscience : the official journal of the Society for Neuroscience 2014, 34:2438-43. Cai L XX, Kong X, Xie J: The Role of the Lysyl Oxidases in Tissue Repair and Remodeling: A Concise Review. Tissue Eng Regen Med 2017, 14:15-30. Pathi SD, Acevedo JF, Keller PW, Kishore AH, Miller RT, Wai CY, Word RA: Recovery of the injured external anal sphincter after injection of local or intravenous mesenchymal stem cells. Obstetrics and gynecology 2012, 119:134-44. Additional Declarations No competing interests reported. Supplementary Files WBFigure2.pdf WBFigure3.pdf WBFigure5.pdf Cite Share Download PDF Status: Published Journal Publication published 15 Jul, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 08 Aug, 2024 Editor assigned by journal 06 Aug, 2024 Editor invited by journal 12 Jun, 2024 Submission checks completed at journal 11 Jun, 2024 First submitted to journal 07 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4547511","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":319048963,"identity":"ecc29372-7c97-4757-8ee0-e32dc3b4d0b8","order_by":0,"name":"Ying Yang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1ElEQVRIiWNgGAWjYNACAxDBfODAhx+kaWFLPDizhzSreIwPc7ARY/7xs4df8xTcseuXyPlwmIGHQZ5f7AABLWfy0qx5DJ4lz5yRu+FwgQWD4czZCQS0HMgxM+YxOJxscAOoZQYPQ4LBbUJazr+Bacl5cJiHjRgtN3KMHwO12AEZDMRpkbzxxoxxjsHhBMmeZwbAQJYg7Be+8znGH978OWzPz578+MOHHzby/NIEtCgcYGCT4mFgSGyA8CXwKwcB+QYG5o/AZGJPWOkoGAWjYBSMWAAAMzxK16wmIPQAAAAASUVORK5CYII=","orcid":"","institution":"The First Affiliated Hospital of Kunming Medical University","correspondingAuthor":true,"prefix":"","firstName":"Ying","middleName":"","lastName":"Yang","suffix":""},{"id":319048964,"identity":"cf0e5c7f-8f45-4275-bb43-0e84d3af4373","order_by":1,"name":"Shumo Li","email":"","orcid":"","institution":"The First Affiliated Hospital of Kunming Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shumo","middleName":"","lastName":"Li","suffix":""},{"id":319048965,"identity":"8cf5991a-d912-4f9b-ae9f-2ba7676069cb","order_by":2,"name":"Li Bian","email":"","orcid":"","institution":"The First Affiliated Hospital of Kunming Medical University","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Bian","suffix":""},{"id":319048966,"identity":"0cd20c6f-562e-4055-9bc2-44192a629551","order_by":3,"name":"Xiaoming Dai","email":"","orcid":"","institution":"The First Affiliated Hospital of Kunming Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoming","middleName":"","lastName":"Dai","suffix":""},{"id":319048967,"identity":"ce63dd02-6a42-4ce5-b4ff-28746d586f56","order_by":4,"name":"Jun Hu","email":"","orcid":"","institution":"The First Affiliated Hospital of Kunming Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jun","middleName":"","lastName":"Hu","suffix":""},{"id":319048968,"identity":"1cb9950e-da15-4140-912c-d3b7e2d9ed92","order_by":5,"name":"Yun Ma","email":"","orcid":"","institution":"The First Affiliated Hospital of Kunming Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yun","middleName":"","lastName":"Ma","suffix":""},{"id":319048969,"identity":"1026a2f3-7083-4f05-a625-93cd7fa5eef4","order_by":6,"name":"Zhiyuan Wang","email":"","orcid":"","institution":"The First Affiliated Hospital of Kunming Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhiyuan","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2024-06-07 17:30:50","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4547511/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4547511/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-11409-9","type":"published","date":"2025-07-15T15:57:11+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":59134958,"identity":"5ba9a988-c73b-4bd6-9b8e-61c79356e023","added_by":"auto","created_at":"2024-06-26 18:07:42","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2229919,"visible":true,"origin":"","legend":"\u003cp\u003eThe immunohistochemical cxpression of periostin and other fibrosis related protein in prostate capsules with different degrees of capsular contraction. A. The immunohistochemical images of periostin, LOX, α-SMA, Tenascin-C and Fibronectin in capsules of Baker grade I to Ⅳ. B. The IOD value of immunohistochemical stain of periostin and other fibrosis related markers in capsules of Baker grade I to Ⅳ. ( Compared with stage Ⅰ,*\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05、**\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01、***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01;Compared with stage Ⅱ,# \u003cem\u003eP\u003c/em\u003e<0.05、## \u003cem\u003eP\u003c/em\u003e<0.01;Compared with stage Ⅲ, \u0026amp;\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05、\u0026amp;\u0026amp;\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01)\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-4547511/v1/d7ad22f4c67b87f53840e881.png"},{"id":59134411,"identity":"8b864549-5a4a-4efe-b31f-c781ca5d8a3d","added_by":"auto","created_at":"2024-06-26 17:51:43","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":645714,"visible":true,"origin":"","legend":"\u003cp\u003eIdentification, screening, lentiviral packaging, and transfection of overexpressing and interfering periostin plasmid vectors. A. Periostin expression vector map. B. Periostin interference vector map. C. The expression of periostin mRNA tested by QPCR 72 hours after transfection. D. The expression of periostin protein tested by Western Blot 72 hours after transfection. E. The result of the 1% agarose gel electropporesis. F. The expression of periostin protein and mRNA tested by Western Blot and QPCR after lentiviral infection and puromycin screening.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-4547511/v1/1f68d65f9cd11d99cad4e79f.png"},{"id":59134404,"identity":"0dd653d6-69fd-414c-afff-4c532ccf1a1d","added_by":"auto","created_at":"2024-06-26 17:51:42","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1507757,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression of periostin and other fibrosis related genes in the cell lines after lentiviral infection and 4-weeks puromycin screening, the proliferation, and the influence on fibrosis related functions. A. Periostin, LOX, BMP-1, Fibronectin and Tenascin-C protein expression were detected by Western Blot. *\u003cem\u003eP\u003c/em\u003e<0.05, ** \u003cem\u003eP\u003c/em\u003e<0.01; B. QRT-PCR detected mRNA expression; C. The proliferation of cell lines tested by CCK-8 assay; D. The expression of α-SMA in the cell lines after lentiviral infection and puromycin sceening tested by immunofluorescence (×200). The red fluorescence represented α-SMA signals, and the blue fluorescence represented nucleus. E. The content of hydroxyproline (HYP) in the cell lines after lentiviral infection and puromycin screening.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-4547511/v1/dbf979d39dd63da98229b804.png"},{"id":59134672,"identity":"9a4a3098-59f6-4614-a649-10d81a10f0a2","added_by":"auto","created_at":"2024-06-26 17:59:42","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2042657,"visible":true,"origin":"","legend":"\u003cp\u003eThe diagram of mouse model of prosthesis implantation with periostin, LOX and BAPN treatment. (A) Modeling process diagram. a) Hemispherical silicone prosthesis; b) Cut skin into bags; c) Implant spherical silicone prosthesis; d) Suture and disinfect the skin. (B) Process record chart. (C) Animal diagram of each model group. The silica gel+LOX group had the slowest wound healing and more severe suppurative condition. (D) General drawing of silicone implants. The silica gel+periostin group had a larger prosthesis block and the surrounding tissues were yellow.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-4547511/v1/11e996d19ba9b2de318a789c.png"},{"id":59134409,"identity":"bdfd99ca-bf95-4c64-8b82-be7cdc53c3b7","added_by":"auto","created_at":"2024-06-26 17:51:42","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":824534,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression of periostin and other fibrosis related genes in the prosthesis capsules of mouse model with periostin, LOX and BAPN treatment. A. Statistical histogram of qPCR detection of priostin, LOX, BMP-1, fibronectin, tenascin-C and α-SMA in 4 groups; B. Western blotting detection of 6 proteins in 4 groups. *\u003cem\u003eP\u003c/em\u003e<0.05, ** \u003cem\u003eP\u003c/em\u003e<0.01, *** \u003cem\u003eP\u003c/em\u003e<0.005.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-4547511/v1/b31b057deafeba04c0e143aa.png"},{"id":59134408,"identity":"184018b0-3dbd-472c-988a-f084d4db77d0","added_by":"auto","created_at":"2024-06-26 17:51:42","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1799165,"visible":true,"origin":"","legend":"\u003cp\u003eThe thickness and the expression of immunohistochemical markers of the mouse model capsules treated with periostin, LOX and BAPN. A. The thickness of the implants capsules in 4 groups. B. The immunohistochemical expression of priostin, LOX, BMP-1, fibronectin, tenascin-C and α-SMA of the capsules in 4 groups. *\u003cem\u003eP\u003c/em\u003e<0.05, ** \u003cem\u003eP\u003c/em\u003e<0.01, *** \u003cem\u003eP\u003c/em\u003e<0.005.\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-4547511/v1/d2a50e879ef8ddf9f2bf66bb.png"},{"id":87219825,"identity":"bd61a3c1-41d3-4bf6-b599-c2675fe39a97","added_by":"auto","created_at":"2025-07-21 16:05:39","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":12270431,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4547511/v1/20e4ad8b-be87-4446-9ff5-2b626ed49e25.pdf"},{"id":59134673,"identity":"0bcaaa1b-f61f-440a-8948-23520cba3477","added_by":"auto","created_at":"2024-06-26 17:59:42","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":126650,"visible":true,"origin":"","legend":"","description":"","filename":"WBFigure2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4547511/v1/5c7e4b5411faeca54d9b9f5a.pdf"},{"id":59134413,"identity":"069bb58b-c2ce-44eb-97dc-24a4faeacb2f","added_by":"auto","created_at":"2024-06-26 17:51:43","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":115936,"visible":true,"origin":"","legend":"","description":"","filename":"WBFigure3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4547511/v1/417156c852ade33f1ff46d36.pdf"},{"id":59134410,"identity":"2c20d3d9-082b-44ab-a912-84d36c9d6564","added_by":"auto","created_at":"2024-06-26 17:51:42","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":397688,"visible":true,"origin":"","legend":"","description":"","filename":"WBFigure5.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4547511/v1/8756fd7a7f35ef27f67db8d9.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The Role and Mechanism of Periostin in the Formation of Breast Prosthesis Capsule","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAfter decades of continuous upgrading, silicone prostheses have become the most commonly used type of implant in breast augmentation surgery. Capsular contraction represents the most prevalent complication after breast augmentation, serving as the major reason underlying patient dissatisfaction and additional subsequent surgeries. Reported incidence of capsular contraction have varied, ranging from 2.8\u0026ndash;20.4% in previous reports\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e, with isolated reports indicating rates as high as 80%\u003csup\u003e3\u003c/sup\u003e. Capsule is the fibrous tissue around the surgical implants or prostheses. The formation of the capsule is like the two sides of a coin: it holds the implant in place and causes the pain, sclerosis, masses and malformation at the same time. Presently, effective preventative and therapeutic strategies remain elusive, necessitating reoperation in cases of severe capsular contracture, thereby inflicting significant physical and psychological trauma upon patients\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe formation of fibrous envelope is the body\u0026rsquo;s protective response to exogenous implants and typically occurs within 1 to 2 weeks after operations. The main component cells of the capsule include fibroblasts, myofibroblasts and inflammatory cells such as macrophage, polymorpnonuclear leukocytes, lymphocytes, plasma cells and mastocytes\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Numerous factors influence the development of capsular contracture, encompassing surgical techniques, implant characteristics, infectious agents, and other variables contributing to contracture pathogenesis\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Despite extensive research, the precise mechanisms governing capsule formation and contracture remain incompletely understood. Overall, exogenous implants incite inflammation, prompting fibroblast-mediated collagen deposition, and myofibroblast-induced tissue contraction. When the physiological wound healing process stagnates, pathological changes ensue, culminating in capsular contracture\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. A large number of studies, including implant types, surface characteristics, surgical methodologies, and bacterial infections, have endeavored to elucidate the intricate mechanisms of capsule formation and contracture, in order to seek effective therapeutic and preventative methods\u003csup\u003e\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePeriostin, a 90kDa secreted glycoprotein encoded by the \u003cem\u003ePostn\u003c/em\u003e gene, is a member of the transforming growth factor-beta (TGF-β) protein-induced superfamily with very low expression in normal adult tissues but strongly mediated secretion into the extracellular interstitium after acute injury\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Extensive literature has studied the important role of periostin in a variety of areas, including bone regeneration, bone marrow fibrosis, myocardial infarction recovery, airway inflammation, idiopathic pulmonary fibrosis, muscle atrophy and fibrosis, kidney disease, skin inflammation, joint stiffness, and tumor progression, invasion, metastasis, and fibrosis\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, 13 14\u003c/sup\u003e. Previous studies have highlighted periostin's ability to augment active lysyl oxidase (LOX) levels, thereby facilitating collagen cross-linking and enhancing connective tissue mechanical properties\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Given its central involvement in fibrotic processes, we hypothesize that periostin may play a crucial regulatory role in capsule formation and contractures, although no prior reports have explored its specific contribution to these processes following breast prosthesis implantation. Consequently, our study observed the expression of periostin and its correlation with the degree of capsule contracture within the capsule of human breast silicone implants. By using human breast derived fibroblasts with manipulated periostin expression, we investigated its impact on other fibrosis-related cytokines, fibroblast proliferation, differentiation, and collagen synthesis. Additionally, we employed a murine model of prosthesis implantation to validate the roles of periostin and LOX in capsule formation.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cp\u003e \u003cb\u003eClinical cases collection-\u003c/b\u003e We collected a cohort of cases involving the removal of breast silicone implants or capsule removal surgeries spanning from 2009 to 2019, excluding specimens not of breast origin and those related to other types of prostheses.\u003c/p\u003e \u003cp\u003e \u003cb\u003eClinicopathological eveluation-\u003c/b\u003e Formalin-fixed, paraffin-embedded tissue sections stained with hematoxylin and eosin (HE) were examined under a microscope. Microscopic assessments encompassed various features, including capsule thickness, fibroblast density, inflammation type and severity, collagen fibril orientation, and morphological characteristics of breast glands within the specimens. Additionally, clinical and radiological data associated with these cases were systematically compiled. The Baker grading system\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e was employed to classify the degree of capsule contracture as follows: Grade I denoting normal breast appearance and touch; Grade II indicating mild contracture perceptible to the surgeon but lacking symptoms; Grade III indicative of moderate contracture, characterized by palpable firmness; and Grade IV representing severe contracture, visually apparent with symptomatic manifestations.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAntibodies\u003c/b\u003e- Rabbit polyclonal anti-periostin antibodies (Abcam, ab14041), mouse monoclonal anti-alpha smooth muscle actin (SMA) antibodies (Abcam, ab7817), rabbit polyclonal anti-Fibronectin antibodies (Proteintech, 15613-AP), rabbit polyclonal anti-LOX antibodies (Proteintech, 17958-1-AP), rabbit polyclonal anti-bone morphogenetic protein 1 (BMP1) antibodies (Affinity, DF9280), rabbit recombinant anti-beta-Actin antibodies (Proteintech, 81115-1-RR) and rabbit monoclonal anti-Tenascin-C antibodies (CST, 12221) were purchased from the sources indicated.\u003c/p\u003e \u003cp\u003e \u003cb\u003eImmunohistochemistry\u003c/b\u003e- Capsule tissues surrounding breast implants were sectioned, dewaxed, subjected to antigen retrieval, and then cooled. Endogenous peroxidases were neutralized using 3% hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e). Subsequently, sections were incubated with primary antibodies for 1 hour at room temperature, followed by incubation with secondary antibodies for 40 minutes at room temperature. Visualization was achieved through DAB staining, complemented by hematoxylin nuclear staining. Following dehydration, clearing, and mounting, image analysis was conducted utilizing Image-proplus software (Media Cybernetics, USA), with the intensity of staining quantified as the product of positive grey value and positive area (IOD).\u003c/p\u003e \u003cp\u003e \u003cb\u003eCell culture\u003c/b\u003e- Human breast-derived fibroblasts (HMF7630) obtained from CELLBIO, Shanghai, and the 293T cell line sourced from the Kunming Institute of Zoology were utilized in this study. The cells were cultured in RPMI-1640 medium (Gibco, Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (Gibco) at 37\u0026deg;C in a humidified atmosphere with 5% CO2. Medium was refreshed every 24 hours, and cells were harvested during the logarithmic growth phase for subsequent experiments.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePlasmid and cell transfection\u003c/b\u003e- Periostin expression and interference vectors were synthesized by GeneCopoeia (Guangzhou, China, see Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The sequences of short hairpin RNA (shRNA) are detailed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Following identification and screening, periostin expression, interference, and negative control plasmids were packaged with lentivirus in human embryonic kidney 293T cells using the Lenti-Pac\u0026trade; HIV Expression Packaging Kit (GeneCopoeia, Guangzhou, China). HMF7630 cells were transfected with recombinant lentivirus at a multiplicity of infection (MOI) of 5, at a growth density of 75%. Stably transfected cells were selected in the presence of 2 \u0026micro;g/ml puromycin until the infection positivity rate exceeded 80%.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequences of shRNA\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSense (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eshPeriostin-a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTGCTTATTGTTAACCCTAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eshPeriostin-b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCACTTGTAAGAACTGGTATA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eshPeriostin-c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCAACGTGAATGTTGAATTAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eshPeriostin-d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTGACAGTATAACAGTAAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eRNA isolation and quantitative real-time polymerase chain reaction (qRT-PCR)\u003c/b\u003e - Total RNA was extracted from cells using Trizol reagent (MRC, Germany) as per the manufacturer's protocol, followed by reverse transcription to synthesize first-strand cDNA using the All-in-OneTM First-Strand-cDNA Synthesis Kit (GeneCopoeia, USA). Specific primer sets for periostin, LOX, BMP-1, Fibronectin, Tenascin C, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were designed (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Quantitative real-time polymerase chain reaction (qRT-PCR) was conducted using the All-in-OneTM qPCR Mix (GeneCopoeia, USA) on a Real-Time PCR Detection System (2720 Thermo, USA). All experiments were independently replicated three times, with relative mRNA levels normalized to endogenous GAPDH mRNA using the relative quantification comparative Ct method.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequences of primers used for qRT-PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene (Homo)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePOSTN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAAATGTCTGTGCCCTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCTTTCCCTCGATCTCCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLOX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAGCCACTATGACCTGCTTGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGGGGTTTACACTGACCTTTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBMP-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCGGGGGTGATGTGAAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGGGTAGTTGGGCGATTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFibronectin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCCCATTATGCCGTTGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAAATGACCACTTCCAAAGCCTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTenascin-C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACATCGCATCAACATCCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCTCCAGTCTGCTCAGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCTGAGTACGTCGTGGAGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTGATGATCTTGAGGCTGTTGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eWestern blot analysis\u003c/b\u003e- Transfected cells were washed with phosphate-buffered saline (PBS) and lysed in radioimmunoprecipitation assay (RIPA) buffer containing protease inhibitor. The resulting supernatant was collected and stored at -80\u0026deg;C. Protein samples were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to polyvinylidene fluoride (PVDF) membranes, and blocked with 5% skim milk for 1 hour. Membranes were then incubated with specific primary antibodies at room temperature for 2 hours. Following incubation with secondary horseradish peroxidase (HRP)-conjugated antibodies (dilution 1:4000) for 1.5 hours at room temperature, membranes were washed thrice with Tris-buffered saline with Tween (TBST), incubated with Immobilon Western Chemiluminescent horseradish peroxidase substrate (Millipore), and exposed to medical x-ray film (Carestream).\u003c/p\u003e \u003cp\u003e \u003cb\u003eCCK8 assay\u003c/b\u003e- Cells in logarithmic growth phase were digested and centrifuged. The cell number was determined in a cell counting plate, and the digested cells were adjusted to 5x10\u003csup\u003e4\u003c/sup\u003e cells/ml. Subsequently, cells were inoculated into a 96-well cell culture plate at a rate of 5x10\u003csup\u003e3\u003c/sup\u003e cells/well (100\u0026micro;l per well), with three wells allocated for each cell group simultaneously. At 0h, 24h, 48h, and 72h post-inoculation, 10\u0026micro;l of CCK-8 solution was added to each well. After 2 hours of incubation at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e, absorbance at 450nm was measured.\u003c/p\u003e \u003cp\u003e \u003cb\u003eImmunofluorescence Microscopy-\u003c/b\u003e Cells from selected cell lines in logarithmic growth phase were digested and centrifuged to prepare a 10\u003csup\u003e5\u003c/sup\u003e cell suspension. Subsequently, 1ml of each suspension was plated onto a 24-well cell slide (three wells per cell line). After cell adherence, slides were removed from the incubator, washed three times with PBS, and fixed in 4% paraformaldehyde in PBS for 30 minutes at room temperature. Following PBS washes, cells were blocked with 5% bovine serum albumin for 30 minutes at 37\u0026deg;C. Primary antibody (α-SMA:1/100) was then applied and incubated overnight at 4\u0026deg;C in 2% bovine serum albumin. After washing, cells were incubated with fluorescence-tagged secondary antibodies (Goat Anti-Mouse IgG H\u0026amp;L Alexa Fluor\u0026reg; 647; 1:2000) for 1 hour at 37\u0026deg;C, followed by additional PBS washes. Nuclei were stained with DIPA (Molecular Probes, Invitrogen), and fluorescent images were captured using a fluorescence microscope (BX61; Olympus, Japan).\u003c/p\u003e \u003cp\u003e \u003cb\u003eHydroxyproline measurement\u003c/b\u003e- To assess periostin's impact on collagen content, hydroxyproline levels were measured in cell lines. Hydroxyproline was extracted from 5\u0026nbsp;million stable screening cell lines according to the manufacturer's instructions provided with the hydroxyproline assay kit (Abcam). Absorbance was measured at a wavelength of 560 nm, and hydroxyproline content in the cell lines was calculated.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAnimal experiments\u003c/b\u003e- Sixty female Kunming (KM) mice aged 6\u0026ndash;8 weeks were divided into four groups: silicone\u0026thinsp;+\u0026thinsp;physiological saline, silicone\u0026thinsp;+\u0026thinsp;periostin, silicone\u0026thinsp;+\u0026thinsp;LOX, and silicone\u0026thinsp;+\u0026thinsp;BAPN, with 15 mice per group. Each group underwent the following procedure: after anesthesia induction, incisions were made bilaterally 0.5cm from the midline of the back to expose the skin and sarcolemma, creating 1.5cm pockets. Disinfected 1ml hemispherical silicone implants were inserted, and incisions were closed. Mice received subcutaneous injections of periostin, LOX, LOX inhibitor BAPN, or control physiological saline around the prosthesis, administered once daily at a dose of 200mg/kg for 30 days. Weekly photographs were taken to monitor wound surface changes. After 30 days, silicone prostheses and surrounding tissues were excised for further analysis.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eEthics approval-\u003c/strong\u003e \u003cp\u003e All methods were carried out in accordance with relevant guidelines and regulations.The study protocol involving human tissues was approved by the Ethics Committee of The First Affiliated Hospital of Kunming Medical University. The informed consent was obtained from all participants. All experiments were performed in accordance with the ethical guidelines of the 2013 Declaration of Helsinki. The material was anonymized at the time of collection. Animal care and experiments were conducted in compliance with ARRIVE guidelines, with approval obtained from the Animal Ethics Committee of Kunming Medical University (Kmmu20230546).\u003c/p\u003e \u003c/p\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Periostin expression in human breast capsules of silicon implants\u003c/h2\u003e \u003cp\u003eTo assess the association between periostin expression and the extent of capsule contracture, we collected clinical capsule specimens from breast implant cases and analyzed the relationship between periostin expression and clinicopathological characteristics. Twenty-one capsule specimens from 11 breast implant cases were obtained, comprising 12 classified as Baker Grades I-II and 9 as Baker Grades III-IV based on the clinical degree of capsule contraction. All cases involved females with a mean age of 42.3 years (range: 29–42). The duration of prosthesis implantation ranged from 1 to 30 years, with an average of 12.64 years. Silicone implants were used in all 11 cases, with 10 cases yielding bilateral breast capsule specimens and 1 case yielding a unilateral specimen. Clinically, pain or discomfort was reported in 3 cases, breast lumps (including multiple lumps) in 4 cases, breast texture hardening in 2 cases, breast deformation in 4 cases, signs of infection such as swelling and fever in 1 case, and breast softening with mass formation following a car accident in 1 case.\u003c/p\u003e \u003cp\u003eCapsule formation was observed in 20 specimens under microscopic examination. The relationship between clinicopathological characteristics and the extent of capsular contraction is summarized in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Baker Grades III-IV were defined as instances of pronounced contraction. As presented in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, inflammation levels were elevated in cases of pronounced capsule contraction. Although not statistically significant, there was a trend toward increased fibroblast density and hardened breast texture in cases of pronounced contraction. To elucidate the relationship between capsule contraction extent and periostin expression alongside other fibrosis-related proteins, immunohistochemistry was performed on silicone implant capsules. Immunohistochemistry and image analysis revealed an escalation in the expression of periostin, LOX, fibronectin, Tenascin-C, and α-SMA with worsening capsule contraction (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe relationship between clinicopathological character and capsular contraction\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eClinicopathological character\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBaker Ⅰ-Ⅱ\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBaker Ⅲ-Ⅳ\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e value\u003c/p\u003e \u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFibroblast density: moderate or above\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5/12\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8/9\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.067\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCapsular thickness: \u0026gt;3mm\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6/11\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3/8\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.650\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eInflammation: moderate or above\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1/12\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6/9\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.016\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWith pain\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4/12\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2/9\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.659\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBreast texture hardening\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0/12\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3/9\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.063\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e \u003cp\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Role of periostin on fibrotic function of human breast derived fibroblasts in vitro\u003c/h2\u003e \u003cp\u003eTo investigate the impact of periostin on fibroblasts during fibrosis, we constructed both overexpression and interference plasmids. The expression and interference vector maps are depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Validation of the plasmids was conducted using 1% agarose gel electrophoresis, Western blot, and quantitative polymerase chain reaction (qPCR). After 4 weeks of screening, periostin protein and mRNA levels in stably transfected HMF7630 cells were consistent with expectations (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo assess the regulatory effect of periostin on fibrosis-related genes, we evaluated the expression of LOX, BMP-1, fibronectin, and Tenascin-C in periostin overexpression and interference cell lines. Compared to Ctrl-mPeriostin-HMF7630, both protein and mRNA levels of periostin, LOX, BMP-1, fibronectin, and Tenascin-C significantly increased in the mPeriostin-HMF7630 cell line while markedly decreased in the shPeriostin-HMF7630 cell line (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B). This confirmed the positive regulatory effect of periostin on LOX, BMP-1, fibronectin, and Tenascin-C.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo explore the association between periostin expression and fibroblast proliferation, we conducted a CCK8 assay. The results indicated that the mPeriostin-HMF7630 cell line exhibited significantly enhanced proliferation compared to the Ctrl-mPeriostin-HMF7630 cell line, while the shPeriostin-HMF7630 cell line showed markedly reduced proliferation compared to the control. These findings suggest that the periostin gene promotes fibroblast proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eImmunofluorescence analysis of α-SMA expression in the cell lines revealed significantly higher levels in the mPeriostin-HMF7630 cell line compared to the control (56.26 ± 3.88 vs 23.01 ± 4.75, \u003cem\u003ep\u003c/em\u003e = 0.0009), whereas expression was notably lower in the shPeriostin-HMF7630 cell line compared to the control (13.66 ± 1.38 vs 22.07 ± 2.19, \u003cem\u003ep\u003c/em\u003e = 0.0115) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Given that α-SMA expression serves as a marker for fibroblast differentiation into myofibroblasts, these results suggest that periostin promotes fibroblast differentiation into myofibroblasts.\u003c/p\u003e \u003cp\u003eTo assess the impact of periostin on collagen content, we measured hydroxyproline levels in the cell lines. The mPeriostin cell strain exhibited significantly higher collagen content compared to the ctrl-mPeriostin cell strain (13.46 ± 2.57 vs 7.39 ± 0.334, \u003cem\u003ep\u003c/em\u003e = 0.049). Although not statistically significant, the collagen content in the shPeriostin cell strain appeared lower than the control (5.63 ± 1.34 vs 7.08 ± 0.18, \u003cem\u003ep\u003c/em\u003e = 0.174) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Impact of periostin, LOX and inhibitor treatment on capsule formation in mice following prosthetic implantation\u003c/h2\u003e \u003cp\u003eTo assess the influence of periostin on capsule formation in vivo, we established a mouse prosthesis implantation model and investigated the effects of periostin, LOX, and inhibitor treatment on capsule formation following prosthetic implantation. β-aminopropionitrile (BAPN), the most potent inhibitor of LOXs, was utilized as the inhibitor. As illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB and C, compared to the silica gel + saline group, the silica gel + LOX group exhibited the slowest wound healing and more severe suppurative conditions. Wound healing was also delayed in the silica gel + Periostin group and silica gel + BAPN group, with mild suppurative conditions observed. Gross examination of the prosthesis block revealed that the silica gel + periostin group had a larger prosthesis block with surrounding tissues appearing yellow compared to the silica gel + saline group. Conversely, the prosthesis blocks of the silica gel + LOX group and silica gel + BAPN group resembled those of the control group, with surrounding tissues displaying slight yellowing (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFollowing 30 days of feeding, capsule tissue was harvested for subsequent experiments. QPCR and Western blot results demonstrated significantly higher expression levels of periostin and other fibrosis-related genes/proteins (LOX, BMP-1, fibronectin, Tenascin-C, and α-SMA) in the silica gel + LOX group and silica gel + periostin group compared to the silica gel + saline group. Conversely, expression levels of these genes/proteins in the silica gel + BAPN group were significantly lower than those in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, B).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSubsequent to H\u0026amp;E staining of the capsule tissue, capsule thickness was assessed. The mean thicknesses of the silica gel + Periostin group and silica gel + LOX group were significantly greater than that of the silica gel + saline group. Conversely, capsules in the silica gel + BAPN group were notably thinner than those in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Immunohistochemistry of periostin and other fibrosis-related proteins aligned with the results of QPCR and Western blot, indicating an increase in the silica gel + Periostin group and silica gel + LOX group, and a decrease in the silica gel + BAPN group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eDespite numerous investigations into capsular contracture, the underlying mechanism remains incompletely elucidated. Our study revealed a correlation between periostin expression in clinical capsular specimens and the extent of capsular contracture. In vitro experiments demonstrated that periostin promotes the proliferation of human breast fibroblasts, regulates fibrosis-related cytokine expression, induces fibroblasts to express α-SMA and differentiate into myofibroblasts, and stimulates collagen production and cross-linking. Furthermore, our findings were validated in a mouse model of prosthesis implantation, where we observed reduced capsule thickness with LOX inhibitors. To our knowledge, this study represents the first comprehensive investigation into the role of periostin in capsule formation, both in vitro and in vivo.\u003c/p\u003e\u003cp\u003eEarly studies have explored the role of TGF-β in breast prosthesis capsule formation, indicating its pivotal involvement in fibrosis initiation\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Subsequent investigations demonstrated that periostin, a downstream protein in the TGF-β signaling pathway, plays a crucial role in various fibrotic diseases. In a study of the mouse model of muscle atrophy, Lorts et al. found that in the absence of periostin, the TGF-β pathway was changed to support regeneration but not increase fibrosis. Therefore, targeting periostin downstream of TGF-β may offer therapeutic advantages over targeting the entire TGF-β pathway\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Moreover, in a study of primary pulmonary fibrosis, CP4715, an inhibitor of periostin receptor α\u003csub\u003eV\u003c/sub\u003eβ\u003csub\u003e3\u003c/sub\u003e integrin, successfully blocked the interaction between TGF-β and periostin, becoming a potential therapeutic target for pulmonary fibrosis\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. Some preliminary studies have shown that periostin and LOX are expressed in capsular tissues\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e, inspiring speculation regarding their role in breast prosthesis capsule formation and contracture. In clinical capsular specimens, immunohistochemistry demonstrated that the expression of periostin and other fibrosis related proteins were correlated with the degree of capsular contracture. This confirms our hypothesis that periostin may play an important role in capsule formation and contracture after breast prosthesis implantation. We further confirmed our hypothesis at the cellular level and in animal models.\u003c/p\u003e\u003cp\u003eIn the study of cell proliferation using CCK8 experiment, the data of this study showed that periostin can promote the proliferation activity of breast derived fibroblasts, and the difference was more obvious after 24 hours. Previous studies have linked fibroblast porliferation to TGF-β signaling. Thevenot et al. confirmed the relationship between mast cells and prosthesis formation in the subcutaneous prosthesis model\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Brazin et al. further demonstrated that the number of fibroblasts in the capsule was related to the degree of capsule contracture, and this correlation was derived from the fact that TGF-β secreted by mast cells stimulated fibroblast proliferation and collagen formation\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Notably, our study suggested that periostin, downstream of TGF-β, contributes to fibroblast proliferation, potentially exacerbating capsule formation and contracture.\u003c/p\u003e\u003cp\u003eExisting studies have preliminarily understood the mechanism of periostin in the process of bone, tooth, heart and skin fibrosis. In response to inflammation and mechanical pressure, the expression of periostin and other extracellular matrix molecules are triggered by cytokines secreted by immune cells, promoting extracellular matrix (ECM) remodeling\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Periostin interacts with integrins on myofibroblasts, facilitating cell migration and ECM assembly\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Periostin constitutes a scaffold structure with tenascin-C and fibronectin to interact with type I collagen\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Moreover, periostin supports BMP-1-mediated LOX activation, enhancing collagen cross-linking\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Combined with the above studies, our study detected the expression of some key genes related to fibrosis in human breast derived fibroblasts overexpressing and interfering with periostin. Our results, consistent with those of previous studies, showed that BMP-1, LOX, fibronectin and tenascin-C are located downstream of periostin, and their protein and mRNA expressions are regulated by periostin, which increases with the expression of periostin and decreases with the interference of periostin. Among the four genes, tenascin-C was most significantly affected by periostin overexpression, and BMP-1 was most significantly affected by periostin interference.\u003c/p\u003e\u003cp\u003eCollagen fibers undergo stabilization through covalent cross-linking, a process initiated by the oxidation of lysine residues by LOX enzymes. This enzymatic activity removes residual lysine or hydroxylysine from collagen fiber tails, facilitating the formation of sponge-like cross-links between adjacent collagen molecules. These bivalent cross-links mature into more stable trivalent forms over time.\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. LOX activity not only influences the shape of collagen fibers but also contributes to the complex layered structure observed in tissues such as the cornea\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Consequently, LOX-mediated covalent cross-linking is a crucial step in collagen formation, ultimately determining the mechanical properties of the extracellular matrix. Studies in periostin-deficient mice and post-myocardial infarction heart tissues have highlighted the common occurrence of collagen cross-linking abnormalities\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e, underscoring the essential role of periostin in establishing and maintaining connective tissue mechanical properties. As mentioned above, Maruhashi et al. confirmed that periostin supports the hydrolysis activation of LOX mediated by BMP-1 in the extracellular matrix, thereby strengthening the cross-linking of collagen\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Our study further corroborated this relationship, showing significant changes in LOX expression following periostin modulation. Additionally, periostin-overexpressing cells exhibited elevated hydroxyproline levels, a marker of collagen production\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e, suggesting a role for periostin in promoting collagen synthesis and cross-linking through LOX activity.\u003c/p\u003e\u003cp\u003eMyofibroblasts, contractile fibroblasts crucial for wound healing, are commonly observed within breast prosthesis capsules\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. These cells arise from fibroblast differentiation under appropriate stimulation and subsequently generate contractile forces to facilitate wound closure\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. ɑ-SMA serves as a marker of myofibroblast differentiation\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e and is associated with the degree of capsule contracture\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Bui et al. believed that the continuous activation of fibroblasts and myofibroblasts may cause the contracture of prosthesis capsule\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e, while antagonising the estrogen of myofibroblasts can alleviate the severity of contracture\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Previous studies have found that periostin can regulate the expression of the downstream gene ɑ-SMA\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. In periostin silenced mice, the number of ɑ-SMA positive myofibroblasts in lung tissue decreased, thus avoiding hyperoxia mediated pulmonary interstitial fibrosis\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. Our study, consistent with previous findings, revealed an increase in ɑ-SMA expression with worsening capsule contracture, both in clinical specimens and periostin-overexpressing fibroblasts. Hence, periostin's regulation of downstream ɑ-SMA expression likely contributes to myofibroblast differentiation during breast prosthesis capsule formation.\u003c/p\u003e\u003cp\u003eIn animal models, periostin and LOX were found to increase capsule thickness, whereas LOX inhibition significantly reduced thickness. These findings were consistent with in vitro results demonstrating changes in fibrosis-related gene and protein expression. Some researchers have demonstrated that knockdown of LOX expression or inhibition of LOX activity alleviates the lung fibrosis\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. Our study is the first to utilize a LOX inhibitor to mitigate fibrosis in a prosthesis implantation model, indicating the potential possibility of clinical application to reduce capsule contracture. However, unexpected outcomes, including severe inflammation and delayed wound healing in periostin and LOX treatment groups, underscore the complexities of their roles in tissue repair and inflammation. The role of periostin in inflammation and tissue repair has been studied for many years\u003csup\u003e\u003cspan additionalcitationids=\"CR42\" citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e–\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. Some researchers found that regeneration and repair is delayed in the absence of periostin\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. LOX is also considered to be a promoter of tissue repair after injury\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. A few investigators have reported some approaches to accelerating healing of injured tissues through up-regulating the LOX in the acute phase after injury\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. Our findings challenge this notion, highlighting the need for further research to elucidate the precise roles of periostin and LOX in inflammation and tissue repair processes.\u003c/p\u003e\u003cp\u003eIn conclusion, our study sheds light on the critical role of periostin in breast prosthesis capsule formation and contracture mechanisms. By regulating other fibrosis-related genes, promoting fibroblasts proliferation, influencing collagen production and myofibroblasts differentiation, periostin emerges as a potential therapeutic target for mitigating capsule contracture in breast augmentation patients, warranting further investigation into its specific mechanisms and clinical applications.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eDisclosure\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no financial interests to disclose. None of the authors has a potential conflict of interest concerning this article\u0026rsquo;s research, authorship, or publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analysed during this study are included in this published article and its supplementary information files.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eHeadon H KA, Mokbel K.: Capsular Contracture after Breast Augmentation: An Update for Clinical Practice. Arch Plast Surg 2015, 42:532-43.\u003c/li\u003e\n\u003cli\u003eAli A, Picado O, Mathew PJ, Ovadia S, Thaller SR: Risk Factors for Capsular Contracture in Alloplastic Reconstructive and Augmentation Mammaplasty: Analysis of the National Surgical Quality Improvement Program (NSQIP) Database. Aesthetic plastic surgery 2023, 47:1678-82.\u003c/li\u003e\n\u003cli\u003eSteiert AE BM, Sorg H.: Capsular contracture by silicone breast implants: possible causes, biocompatibility, and prophylactic strategies. Med Devices (Auckl) 2013, 6:211-8.\u003c/li\u003e\n\u003cli\u003eCoombs DM, Grover R, Prassinos A, Gurunluoglu R: Breast augmentation surgery: Clinical considerations. Cleveland Clinic journal of medicine 2019, 86:111-22.\u003c/li\u003e\n\u003cli\u003ePrantl L SS, Fichtner-Feigl S, P\u0026ouml;ppl N, Eisenmann-Klein M, Schwarze H, F\u0026uuml;chtmeier B.: Clinical and morphological conditions in capsular contracture formed around silicone breast implants. Plast Reconstr Surg 2007, 120:275-84.\u003c/li\u003e\n\u003cli\u003eRocco N RC, Moja L, Amato B, Iannone L, Testa S, Spano A, Catanuto G, Accurso A, Nava MB: Different types of implants for reconstructive breast surgery. Cochrane Database Syst Rev 2016, 16:CD010895.\u003c/li\u003e\n\u003cli\u003eBui JM PT, Ren CD, Nofrey B, Teitelbaum S, Van Epps DE.: Histological characterization of human breast implant capsules. Aesthetic Plast Surg 2015, 39:306-15.\u003c/li\u003e\n\u003cli\u003eKim CHK, D. H.,Oh, S. H.,Song, S. Y.: Human Embryonic Stem Cell-Derived Endothelial Precursor Cell Conditioned Medium Reduces the Thickness of the Capsule Around Silicone Implants in Rats. Annals of plastic surgery 2015, 75:348-52.\u003c/li\u003e\n\u003cli\u003eAchilles RB, DV DES, Quintana HT, Malinverni ACM, CFG DEM, Branda GW, Renno ACM, Ribeiro DA: Cytotoxicity, Inflammatory Activity, and Angiogenesis Are Induced by Different Silicone Implants. In vivo (Athens, Greece) 2022, 36:1252-8.\u003c/li\u003e\n\u003cli\u003eB\u0026eacute;rniz C, Carmona-Torre F, G\u0026oacute;mez-Mart\u0026iacute;nez C, Fern\u0026eacute;ndez-Ciriza L, Del Pozo JL, Hontanilla B: Breast Implant Capsule: A Murine Model Comparing Capsular Contracture Susceptibility Among Six Breast Implants Available in the Market. Aesthetic plastic surgery 2023, 47:2093-105.\u003c/li\u003e\n\u003cli\u003eConway SJ IK, Kudo Y, Litvin J, Markwald R, Ouyang G, Arron JR, Holweg CT, Kudo A.: The role of periostin in tissue remodeling across health and disease. Cell Mol Life Sci 2014, 71:1279-88.\u003c/li\u003e\n\u003cli\u003eLiu AY ZH, Ouyang G.: Periostin, a multifunctional matricellular protein in inflammatory and tumor microenvironments. Matrix Biol 2014, 37:150-6.\u003c/li\u003e\n\u003cli\u003eKormann R, Kavvadas P, Placier S, Vandermeersch S, Dorison A, Dussaule JC, Chadjichristos CE, Prakoura N, Chatziantoniou C: Periostin Promotes Cell Proliferation and Macrophage Polarization to Drive Repair after AKI. Journal of the American Society of Nephrology : JASN 2020, 31:85-100.\u003c/li\u003e\n\u003cli\u003eLee YJ KI, Park SA, Kim Y, Lee JE, Noh DY, Kim KT, Ryu SH, Suh PG.: Periostin-binding DNA aptamer inhibits breast cancer growth and metastasis. Mol Ther 2013, 21:1004-13.\u003c/li\u003e\n\u003cli\u003eMaruhashi T, Kii I, Saito M, Kudo A: Interaction between periostin and BMP-1 promotes proteolytic activation of lysyl oxidase. J Biol Chem 2010, 285:13294-303.\u003c/li\u003e\n\u003cli\u003eKuhn A, Singh S, Smith PD, Ko F, Falcone R, Lyle WG, Maggi SP, Wells KE, Robson MC: Periprosthetic breast capsules contain the fibrogenic cytokines TGF-beta1 and TGF-beta2, suggesting possible new treatment approaches. Annals of plastic surgery 2000, 44:387-91.\u003c/li\u003e\n\u003cli\u003eRuiz-de-Erenchun R, Dotor de las Herrerias J, Hontanilla B: Use of the transforming growth factor-beta1 inhibitor peptide in periprosthetic capsular fibrosis: experimental model with tetraglycerol dipalmitate. Plastic and reconstructive surgery 2005, 116:1370-8.\u003c/li\u003e\n\u003cli\u003eSchlesinger SL, Ellenbogen R, Desvigne MN, Svehlak S, Heck R: Zafirlukast (Accolate): A new treatment for capsular contracture. Aesthet Surg J 2002, 22:329-36.\u003c/li\u003e\n\u003cli\u003eKatzel EB KP, Tierney R, Williams JP, Awad HA, O\u0026apos;keefe RJ, Langstein HN.: The impact of Smad3 loss of function on TGF-\u0026beta; signaling and radiation-induced capsular contracture. Plast Reconstr Surg 2011, 127:2263-9.\u003c/li\u003e\n\u003cli\u003eZeplin PH L-AA, Schmidt K.: Surface modification of silicone breast implants by binding the antifibrotic drug halofuginone reduces capsular fibrosis. Plastic and reconstructive surgery 2010, 126:266-74.\u003c/li\u003e\n\u003cli\u003eLorts A SJ, Baudino TA, McNally EM, Molkentin JD.: Deletion of periostin reduces muscular dystrophy and fibrosis in mice by modulating the transforming growth factor-\u0026beta; pathway. . Proc Natl Acad Sci U S A 2012, 109:10978-83.\u003c/li\u003e\n\u003cli\u003eNanri Y, Nunomura S, Terasaki Y, Yoshihara T, Hirano Y, Yokosaki Y, Yamaguchi Y, Feghali-Bostwick C, Ajito K, Murakami S, Conway SJ, Izuhara K: Cross-Talk between Transforming Growth Factor-\u0026beta; and Periostin Can Be Targeted for Pulmonary Fibrosis. American journal of respiratory cell and molecular biology 2020, 62:204-16.\u003c/li\u003e\n\u003cli\u003ePoh PSP, Schmauss V, McGovern JA, Schmauss D, Chhaya MP, Foehr P, Seeger M, Ntziachristos V, Hutmacher DW, van Griensven M, Schantz JT, Balmayor ER: Non-linear optical microscopy and histological analysis of collagen, elastin and lysyl oxidase expression in breast capsular contracture. European journal of medical research 2018, 23:30.\u003c/li\u003e\n\u003cli\u003eBae HS, Son HY, Lee JP, Chang H, Park JU: The Role of Periostin in Capsule Formation on Silicone Implants. BioMed research international 2018, 2018:3167037.\u003c/li\u003e\n\u003cli\u003eThevenot PT, Baker DW, Weng H, Sun MW, Tang L: The pivotal role of fibrocytes and mast cells in mediating fibrotic reactions to biomaterials. Biomaterials 2011, 32:8394-403.\u003c/li\u003e\n\u003cli\u003eBrazin J MS, Groh B, Mehrara B, Hidalgo D, Otterburn D, Silver RB, Spector JA: Mast cells in the periprosthetic breast capsule. Aesthetic Plast Surg 2014, 38:592-601.\u003c/li\u003e\n\u003cli\u003eChiquet M GL, Lutz R, Maier S.: From mechanotransduction to extracellular matrix gene expression in fibroblasts. Biochimica et biophysica acta 2009, 1793:911-20.\u003c/li\u003e\n\u003cli\u003eA. K: Periostin in fibrillogenesis for tissue regeneration: periostin actions inside and outside the cell. Cell Mol Life Sci 2011, 68:3201-7.\u003c/li\u003e\n\u003cli\u003eBella J, Hulmes DJ: Fibrillar Collagens. Sub-cellular biochemistry 2017, 82:457-90.\u003c/li\u003e\n\u003cli\u003eVallet SD, Ricard-Blum S: Lysyl oxidases: from enzyme activity to extracellular matrix cross-links. Essays Biochem 2019, 63:349-64.\u003c/li\u003e\n\u003cli\u003eHerchenhan A UF, Eliasson P, Weis M, Eyre D, Kadler KE, Magnusson SP, Kjaer M: Lysyl Oxidase Activity Is Required for Ordered Collagen Fibrillogenesis by Tendon Cells. J Biol Chem 2015, 290:16440-50.\u003c/li\u003e\n\u003cli\u003eShimazaki M NK, Kii I, Kashima T, Amizuka N, Li M, Saito M, Fukuda K, Nishiyama T, Kitajima S, Saga Y, Fukayama M, Sata M, Kudo A.: Periostin is essential for cardiac healing after acute myocardial infarction. The Journal of experimental medicine 2008, 205:295-303.\u003c/li\u003e\n\u003cli\u003eWang Z, Chesler NC: Role of collagen content and cross-linking in large pulmonary arterial stiffening after chronic hypoxia. Biomechanics and modeling in mechanobiology 2012, 11:279-89.\u003c/li\u003e\n\u003cli\u003eHwang K, Sim HB, Huan F, Kim DJ: Myofibroblasts and capsular tissue tension in breast capsular contracture. Aesthetic plastic surgery 2010, 34:716-21.\u003c/li\u003e\n\u003cli\u003eBaker JL, Jr., Chandler ML, LeVier RR: Occurrence and activity of myofibroblasts in human capsular tissue surrounding mammary implants. Plastic and reconstructive surgery 1981, 68:905-12.\u003c/li\u003e\n\u003cli\u003ePowell DW: Myofibroblasts: paracrine cells important in health and disease. Transactions of the American Clinical and Climatological Association 2000, 111:271-92; discussion 92-3.\u003c/li\u003e\n\u003cli\u003ePersichetti P, Segreto F, Carotti S, Marangi GF, Tosi D, Morini S: Oestrogen receptor-alpha and -beta expression in breast implant capsules: experimental findings and clinical correlates. J Plast Reconstr Aesthet Surg 2014, 67:308-15.\u003c/li\u003e\n\u003cli\u003eAshley SL, Wilke CA, Kim KK, Moore BB: Periostin regulates fibrocyte function to promote myofibroblast differentiation and lung fibrosis. Mucosal Immunol 2017, 10:341-51.\u003c/li\u003e\n\u003cli\u003eBozyk PD BJ, Popova AP, Anyanwu AC, Linn MD, Goldsmith AM, Pryhuber GS, Moore BB, Hershenson MB.: Neonatal periostin knockout mice are protected from hyperoxia-induced alveolar simplication. PLoS One 2012, 7:e31336.\u003c/li\u003e\n\u003cli\u003eCheng T LQ, Zhang R, Zhang Y, Chen J, Yu R, Ge G: Lysyl oxidase promotes bleomycin-induced lung fibrosis through modulating inflammation. J Mol Cell Biol 2014, 6:506-15.\u003c/li\u003e\n\u003cli\u003eSonnenberg-Riethmacher E, Miehe M, Riethmacher D: Periostin in Allergy and Inflammation. Frontiers in immunology 2021, 12:722170.\u003c/li\u003e\n\u003cli\u003eWalker JT, McLeod K, Kim S, Conway SJ, Hamilton DW: Periostin as a multifunctional modulator of the wound healing response. Cell and tissue research 2016, 365:453-65.\u003c/li\u003e\n\u003cli\u003eYang L, Guo T, Chen Y, Bian K: The Multiple Roles of Periostin in Non-Neoplastic Disease. Cells 2022, 12.\u003c/li\u003e\n\u003cli\u003eNishiyama T, Kii I, Kashima TG, Kikuchi Y, Ohazama A, Shimazaki M, Fukayama M, Kudo A: Delayed re-epithelialization in periostin-deficient mice during cutaneous wound healing. PLoS One 2011, 6:e18410.\u003c/li\u003e\n\u003cli\u003eShih CH, Lacagnina M, Leuer-Bisciotti K, Pr\u0026ouml;schel C: Astroglial-derived periostin promotes axonal regeneration after spinal cord injury. The Journal of neuroscience : the official journal of the Society for Neuroscience 2014, 34:2438-43.\u003c/li\u003e\n\u003cli\u003eCai L XX, Kong X, Xie J: The Role of the Lysyl Oxidases in Tissue Repair and Remodeling: A Concise Review. Tissue Eng Regen Med 2017, 14:15-30.\u003c/li\u003e\n\u003cli\u003ePathi SD, Acevedo JF, Keller PW, Kishore AH, Miller RT, Wai CY, Word RA: Recovery of the injured external anal sphincter after injection of local or intravenous mesenchymal stem cells. Obstetrics and gynecology 2012, 119:134-44.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"breast Implants/adverse effects, silicon implant, capsular contraction, periostin, fibroblasts, animals","lastPublishedDoi":"10.21203/rs.3.rs-4547511/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4547511/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCapsular contraction is the most common complication after breast augmentation or reconstruction, and is the main reason underlying patient dissatisfaction and additional subsequent surgeries. Periostin is an extracellular matrix protein and a member of TGF-β superfamily. Studies have shown that periostin is closely related to fibrosis, collagen cross-linking and tissue remodeling. In this study, we observed the expression of periostin and other fibrosis-related proteins in the capsule of human breast silicon implant, assessing their relationship with the extent of capsule fibrosis. By using human breast derived fibroblasts with manipulated periostin expression level, we explored periostin\u0026rsquo;s impact on other fibrosis-related cytokines, fibroblast proliferation, differentiation, and collagen synthesis. Furthermore, we employed a murine model of prosthesis implantation to elucidate the roles of periostin and lysyl oxidase (LOX) in capsule formation. Immunohistochemical analysis of clinical capsular specimens revealed a significant correlation between periostin expression levels and the severity of capsular contracture. In vitro experiments using human breast-derived fibroblasts demonstrated that periostin promotes fibroblast proliferation and regulates the expression of key fibrosis-related proteins such as LOX, BMP-1, fibronectin, and tenascin-C at both protein and mRNA levels. Moreover, periostin was found to induce fibroblast differentiation into myofibroblasts and enhance collagen production. In the murine model of prosthesis implantation, periostin and LOX were observed to increase the thickness of the prosthesis capsule, whereas the administration of the LOX inhibitor β-aminopropionitrile (BAPN) significantly attenuated capsule formation. Our study underscores the significant role of periostin in the pathogenesis of breast prosthesis capsule formation and contracture. These findings provide novel insights into the mechanisms underlying capsular contracture and suggest periostin as a potential therapeutic target for mitigating this complication.\u003c/p\u003e","manuscriptTitle":"The Role and Mechanism of Periostin in the Formation of Breast Prosthesis Capsule","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-26 17:51:37","doi":"10.21203/rs.3.rs-4547511/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-08-08T04:24:13+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-08-06T08:37:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-06-12T14:40:13+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-06-11T04:11:48+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-06-07T17:29:35+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"99739a54-ba43-474f-aea8-50b10f4dcb08","owner":[],"postedDate":"June 26th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-07-21T16:05:25+00:00","versionOfRecord":{"articleIdentity":"rs-4547511","link":"https://doi.org/10.1038/s41598-025-11409-9","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-07-15 15:57:11","publishedOnDateReadable":"July 15th, 2025"},"versionCreatedAt":"2024-06-26 17:51:37","video":"","vorDoi":"10.1038/s41598-025-11409-9","vorDoiUrl":"https://doi.org/10.1038/s41598-025-11409-9","workflowStages":[]},"version":"v1","identity":"rs-4547511","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4547511","identity":"rs-4547511","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.