Development of single nucleotide polymorphisms in key genes of taurine and betaine metabolism in Crassostrea hongkongensis and their association with content-related traits

Development of single nucleotide polymorphisms in key genes of taurine and betaine metabolism in Crassostrea hongkongensis and their association with content-related traits | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Development of single nucleotide polymorphisms in key genes of taurine and betaine metabolism in Crassostrea hongkongensis and their association with content-related traits Lingxin Kong, Ziao Chen, Zhen Jia, Qiong Deng, Peng Zhu, Youhou Xu, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5097219/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 24 Feb, 2025 Read the published version in BMC Genomics → Version 1 posted 11 You are reading this latest preprint version Abstract Background Taurine and betaine are important nutrients in Crassostrea hongkongensis and have many important biological properties. To investigate the characteristics of taurine and betaine contents and identify SNPs associated with traits in the C.hongkongensis , we cloned the full-length cDNA of key genes in taurine and betaine (unpublished data) metabolism, determined taurine and betaine content and gene expression in different tissues and months of specimen collection, and developed SNPs in the gene coding region. Results We cloned the full-length cDNA of cysteine dioxygenase ( ChCDO ) and cysteine sulfite decarboxylase ( ChCSAD ), which are key genes involved in taurine metabolism in C. hongkongensis , and found that betaine and taurine contents and the expression of key genes were regulated by seawater salinity. A total of 47 SNP markers were developed in the coding regions of ChCSAD , ChCDO , ChCDH , ChBADH , and ChBHMT using gene fragment resequencing and FLDAS-PCR. Through association analysis in a population of C. hongkongensis in the Maowei Sea, Guangxi, nine SNPs were found to be associated with taurine content, and one SNP was associated with betaine content. Haploid and linkage disequilibrium analyses showed that SNPs in ChCDO formed one linkage group with three haplotypes: ACACA, GTTTG, and GTACA. The average taurine content of the corresponding individuals was 873.88, 838.99, and 930.72 ng/g, respectively, indicating the GTACA haplotype has a significant advantage in terms of taurine content. Conclusions We identified SNPs associated with taurine and betaine contents in C.hongkongensis for the first time, and found the GTACA haplotype in the ChCDO coding region has a significant advantage in taurine content. These loci and haplotypes can serve as potential molecular markers for the molecular breeding of C. hongkongensis . Crassostrea hongkongensis taurine betaine SNP association analysis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Background With the development of the economy and deepening of people’s health awareness, an increasing number of people choose seafood with higher nutritional content [ 1 , 2 ]. Taurine and betaine are important nutrients in C. hongkongensis and have many important biological properties [ 3 , 4 ]. Oysters are also one of the most abundant natural sources of taurine. Since the beginning of the 21st century, oyster production in China has increased significantly. In 2019, China's oyster farming production reached 5.2 million tons, of which C. hongkongensis represented approximately 1.8 million, accounting for 34.45% of China's total oyster production [ 5 ]. Although the production of C. hongkongensis is high, it is still difficult to meet the market demand for high-quality oysters, and the economic benefits they bring are relatively low. The reasons behind this are factors such as excessive aquaculture in the sea and changes in the aquaculture environment, which have led to a decline in the quality of C. hongkongensis . Betaine and taurine not only serve as important nutrients in oysters but also give them a unique freshness quality [ 6 , 7 ]. With the continuous increase in research on betaine and taurine, they have been found to buffer substances for osmotic pressure fluctuations, which can improve the tolerance of biological cells to high-salt and high-osmotic environments [ 8 , 9 ]. Pierce et al. [ 10 ] found significant differences in the betaine synthesis rates among populations of Crassostrea virginica under different salinities. The betaine synthesis rate of populations adapted to high salinities was 3–4 times greater than that of populations adapted to low salinity. Song et al. [ 11 ] also found that taurine content in the adductor muscle of C. hongkongensis changed significantly with salinity. When C. hongkongensis was moved to 30‰ seawater, taurine content increased rapidly; however, 24 h after moving to 6‰ seawater, taurine content decreased by approximately 40%. Cysteine dioxygenase (CDO) and cysteine sulfinic acid decarboxylase (CSAD) are key enzymes involved in taurine synthesis [ 12 ]. Marine bivalves mainly use cysteine as a raw material to maintain taurine content in their bodies [ 13 ]. Cysteine is oxidized to cysteine sulfite (CSA) through CDO and decarboxylated to hypotaurine through CSAD. Finally, hypotaurine is oxidized to taurine. In marine mollusks, full-length cDNA sequences of CDO and CSAD genes have been cloned from Crassostrea gigas and Bathymodiolus septemdierum , and their expression levels have been found to be related to changes in taurine content [ 14 , 15 ]. Choline dehydrogenase (CDH) and betaine aldehyde dehydrogenase (BADH) have long been considered important enzymes for catalyzing the production of betaine. Betaine is generated from choline through two enzymatic reactions. First, choline is catalyzed by CDH to form betaine aldehyde, which is then oxidized to betaine by BADH [ 16 , 17 ]. Betaine homocysteine methyltransferase (BHMT) is a key enzyme in betaine catabolism [ 18 ]. Multiple metabolic pathways are involved in the decomposition of betaine in living organisms, the most common being the methionine cycle, which is catalyzed by BHMT [ 19 ]. Previous studies have shown that betaine synthesis in Litopenaeus vannamei and Chasmagnathus granulata depends on the activities of CDH and BADH [ 20 , 21 ], and the expression of BHMT was found to affect the betaine content in C. gigas [ 22 ]. To date, there have been no reports on the key genes involved in taurine and betaine metabolism in C. hongkongensis . To explore the relationship between key genes related to taurine and betaine metabolism and content-related traits in C. hongkongensis , we determined taurine and betaine contents, as well as gene expression of ChCDO , ChCSAD , ChBADH , ChCDH , and ChBHMT in different tissues and specimen collection months. Then, we conducted an association analysis to screen single-nucleotide polymorphism (SNP) loci associated with taurine and betaine contents, laying a foundation for the breeding of high-quality oysters. Methods Oyster collection Oysters used for analysis at different times and in different tissues were obtained from the Sandun Aquaculture Area in Qinzhou, Guangxi, China. Oysters for analysis at different times were collected once a month from June 2020 to April 2021. Oysters were collected from the same location, and 15 individuals were collected each time. Adductor muscles, gills, and other tissues were separated, frozen in liquid nitrogen, and stored at − 80°C for taurine and betaine content detection and RNA extraction. Samples from April were used for analysis of different tissues, including the adductor muscle, gills, mantle, gonads, digestive glands, and labial palps. One hundred and five oysters used for SNP development and association analysis were collected from Maowei Sea. The oysters were attached at the same time, and grew and developed in the same natural environment. The adductor muscle, gills, and other tissues were separated, frozen in liquid nitrogen, and stored at − 80°C for taurine and betaine content detection and RNA extraction. Full-length cDNA cloning of key genes Total RNA was extracted from the samples using the TRIzol method. The extracted RNA was measured by spectrophotometry with a nucleic acid protein concentration meter (Gene Company Limited, Thermo, China). RNA integrity was detected by 1% agarose gel electrophoresis, and RNA was reverse transcribed into cDNA with a TransGen Biotech reverse transcription kit. Primers were designed for intermediate fragment cloning using the CSAD and CDO sequences of C. gigas as references. Using cDNA as a template, 3' and 5' specific primers were designed in the cloned intermediate fragments for 3' and 5' RACE amplification (Table 1 ). The product was detected by 1% agarose gel electrophoresis, connected to the PMD19 clone vector and transformed into T1 Escherichia coli cells. After overnight cultivation and PCR detection, the bacterial suspension was sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing. Gene sequence and evolutionary analysis Utilizing ORF Finder online tools ( https://www.ncbi.nlm.nih.gov ), we predicted the open reading frame (ORF) and amino acid sequences based on the full-length cDNA sequence. We predicted the molecular weight, isoelectric point, hydrophobicity, signal peptide, and structural domain of proteins using online software such as Expasy ( https://web.expasy.org ), Signalp ( http://www.cbs.dtu.dk/services/SignalP/ ), and NCBI. After using the BLAST tool in the NCBI database for sequence alignment and searching for homologous protein sequences, we performed multiple comparisons of homologous sequences using DNAMAN 7.0 software and built an evolutionary tree using MEGA 5.1 software. Analysis of taurine and betaine content Taurine and betaine contents were detected using taurine and betaine enzyme-linked immunosorbent assay (ELISA) kits (Shanghai Meilian Biotechnology Co., Ltd., Shanghai, China). Blank, standard, and sample wells were included in testing. We added 50 µL of standard solution into each standard well, and then introduced sample diluent (40 µL) and sample solution (10 µL) to each sample well, followed by incubation at 37 ℃ for 30 min and five washes. Next, we added 50 µL of HRP enzyme-linked immunosorbent assay reagent to each well and 100 µL of acidic chromogenic agent for color development for 10 min at 37 ℃ in the dark. Absorbances were measured at 450 nm using an ELISA reader (Molecular Devices, Spectra Max Id5, USA), and the nutrient contents were calculated using a standard curve. Statistical analysis was performed using SPSS 22.0. Variance analysis was performed for samples collected at different times and from different tissues, and descriptive statistical analysis was performed for samples used for association analysis. Gene expression analysis in different tissues and at different times Total RNA was extracted from gills collected in different months and various tissue samples from April using the TRIzol method. The RNA was reverse transcribed into cDNA and diluted 10 times to serve as a quantitative PCR template (Table 1 ). Then, qRT-PCR was performed using a fluorescence quantitative PCR instrument (Bio-Rad, CFX96, USA). Each experimental group included three biological replicates and three technical replicates. L-Actin served as a reference gene. The relative expression level of the target gene was calculated using the 2- △△CT method, with results expressed as the mean ± standard deviation (SD). Analyses of variance (ANOVA) and multiple comparison testing was performed using SPSS 22.0 software. Table 1 Primers used for full-length cDNA cloning and quantitative PCR Primers Primer sequences (5′-3′) usages 15 CSAD-F1 ATGTGAGGGGTTCAAAGGTCAAAAAG Fragment cloning 1433 CSAD-R1 TCATCATTCCCTCCTTGACCTTTGGC Fragment cloning 430 CSAD-F2 GGTTTATGAAGGCTCGTGACCGCAA Fragment cloning 1643 CSAD-R2 TCATCATTCCCTCCTTGACCTTTGGC Fragment cloning 193 CDO-F1 TTTGAGGAAGGAGCTGGGCAATGGT Fragment cloning 785 CDO-R1 ACATGAGATTCCAAGCAGGTCCATAA Fragment cloning 397 CDO-F2 CATACACAACCACCCGAACTCACAC Fragment cloning 699 CDO-R2 ACCACTGAAGTCCTGATCGAATCCCA Fragment cloning 193 CDO-5-R1 ACCATTGCCCAGCTCCTTCCTCAAA 5’race 356 CDO-5-R2 CGTTCCAGCACAGAATCATCAGGTT 5’race 423 CDO-5-R3 ACGCCCTCTAGTGTTTTCATGAAGC 5’race 668 CDO-3-F1 GACGACACAAGCAAAGAGACGGAGG 3’race 627 CDO-3-F2 ATCTCTACTCGCCACCATTCACCAC 3’race 577 CDO-3-F3 CGTGCACAGAGTTGGAAACAGAAGT 3’race 433 CSAD-5-R1 TCATTGCGGTCACGAGCCTTCATAA 5’race 473 CSAD-5-R2 CTGCTTTAGTTCTTCGGGATAGGAG 5’race 685 CSAD-5-R3 AGGGAGAATACAGGGGACACTTCGT 5’race 1455 CSAD-3-F1 GGCTTCGAGAGAGACATTGACAATC 3’race 1391 CSAD-3-F2 TCAGTGTGGCCGCAAGAATGACGTT 3’race 932 CSAD-3-F3 TATGGGAATGGGCCTTGACAACCTC 3’race M13F TGTAAAACGACGGCCAGT universal primer M13R CAGGAAACAGCTATGACC universal primer UPM CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE UPS CTAATACGACTCACTATAGGGC RACE 400 qPCR-CDO-F1 GGAGCTCTACAGGAAATCGGA RT-qPCR 573qPCR-CDO-R1 TGGTGAATGGTGGCGAGTAGA RT-qPCR 137qPCR-CSAD-F AAGCCCACAGAGAAGCAGAGAA RT-qPCR 345qPCR-CSAD-R CATTGCGGTCACGAGCCTTCAT RT-qPCR CDH-qRT-F CCATCAGGCCACAACACTCTCTT RT-qPCR CDH-qRT-R ACGCCGATCTTCTTCATCAC RT-qPCR BADH-qRT-F CAGTCCTTGTATCCTCGTCAACT RT-qPCR BADH-qRT-R TATTCCTCCTGCCAGTCCTAGTT RT-qPCR BHMT-qRT-F TGTATTGGCTTTCACCTATTGC RT-qPCR BHMT-qRT-R CGACGGCCCACTCTATCATTT RT-qPCR LActinF CTGTGCTACGTTGCCCTGGACTT RT-qPCR LActinR TGGGCACCTGAATCGCTCGTT RT-qPCR Development of SNPs Using the full-length cDNA of ChCSAD , ChCDO , ChBADH , ChCDH , and ChBHMT genes as templates, Oligo 7 was used to design primers for amplifying the ORF region of genes (Table S1 ). Ten oysters with significant differences in taurine or betaine contents were selected to clone the same gene fragment, and the PCR products were sent to Shanghai Shenggong Biotechnology Co., Ltd., for sequencing. We then used DNAMAN sequence comparison to predict candidate SNPs, followed by fragment length discrepant allele specific PCR (FLDAS-PCR) and polyacrylamide gel electrophoresis for SNP validation. First, we designed two upstream primers of different lengths, each with a 3' end that paired with two SNP allele bases, using Oligo 7. At the same time, we introduced mismatches at the 3rd or 4th base of the 3' end of the two allele-specific primers to increase specificity. Then, we added base sequences of different lengths at the 5' end, downstream was a universal primer sequence. The lengths of the amplified DNA fragments were 100–200 bp. The amplified product was detected by 12% polyacrylamide gel electrophoresis. Population genotyping FLDAS-PCR and polyacrylamide gel electrophoresis were used for genotyping when the SNP density was greater than 1/20 bp. Owing to the different lengths of the upstream primers, the homozygotes were shown as a single band, and the heterozygotes as two bands with a size difference of 8 bp. Gene fragment resequencing was used for genotyping when SNP density was less than 1/20 bp. First, the target fragments of all samples were cloned, and the PCR products were recovered, purified, and sent to Shanghai Shenggong Biotechnology Co., Ltd., for sequencing. We then compared the sequencing peaks of the same target fragment from different samples and genotyped the candidate SNPs in the population. Association analysis Using SPSS 22.0, an association analysis between the content of taurine and betaine and genotype data was conducted using one-way ANOVA or t-testing. SNP markers that showed significant differences between different genotypes were considered associated with taurine or betaine content. Haploid and linkage analysis We used Haploview 4.2 to perform haplotype and linkage analyses for the SNPs considered significant from the association analysis and used ANOVA in SPSS 22.0 to statistically analyze the taurine and betaine content between individuals with different haplotypes. Results Characteristics of full-length cDNA of ChCSAD and ChCDO The total length of ChCSAD cDNA was 2140 bp (NCBI login number: OP792983), including a 55-bp 5' untranslated region (UTR), 417-bp 3' UTR, and 668-bp ORF, encoding a total of 555 amino acids (Fig. S1 ). The relative molecular weight of the protein was 63.45 KDa, and its isoelectric point was 7.60. The ChCSAD protein was predicted to contain a conserved pyridoxal-deC domain (113–479) (Fig. S2 ). The total length of the ChCDO cDNA was 1402 bp (NCBI login number: OP792984), including a 5' UTR of 196 bp, 3' UTR of 705 bp, and ORF of 501 bp, encoding a total of 166 amino acids (Fig. S3 ). The relative molecular weight of the protein was 19.04 KDa, with an isoelectric point of 6.41. The predicted conserved domain in the ChCDO protein was a CDOI domain (1–140) (Fig. S4) Homology and phylogenetic analysis of ChCSAD and ChCDO Alignment of the amino acid sequences of ChGSAD and ChCDO in C. hongkongensis with those of C. gigas , C. virginica , and C. angulata revealed high amino acid conservation (Fig. 1 ). The phylogenetic tree showed that ChCSAD and ChCDO in C. hongkongensis were closely related to those in other invertebrates such as C. gigas and C. angulata (Fig. 2 ). Betaine and taurine contents and key gene expression in different tissues The highest betaine content in C. hongkongensis was found in the digestive gland (827.51 µg/g), and this amount was significantly higher than that in other tissues ( P < 0.05) (Fig. 3 a). ChCDH and ChBADH were expressed at the highest levels in the adductor muscle ( P < 0.05), whereas ChBHMT was expressed in the digestive gland ( P < 0.05) (Fig. 3 b–d). Taurine content was the highest in the digestive gland (970.81 µg/g), and this amount was significantly higher than that in other tissues ( P < 0.05) (Fig. 4 a). The expression of ChCSAD reached its highest level in the digestive gland ( P < 0.05), whereas ChCDO was highest in the adductor muscle and digestive gland ( P < 0.05) (Fig. 4 b–c). Betaine and taurine contents and key gene expression in different months Betaine content in C. hongkongensis steadily increased from 754.08 µg/g in February to a peak of 999.25 µg/g in April, then rapidly dropped to the lowest level of 743.01 µg/g in December (Fig. 5 a). Expression of ChCDH was high from January to February, significantly decreased from February to March and remained low from March to November. Expression of ChBADH was high from January to April, decreased significantly from April to June and remained low from June to November. ChBHMT expression was significantly higher in January than in the other months ( P < 0.05) and remained low after a significant decrease in February (Fig. 5 b–d). Taurine and betaine contents showed a similar trend, with taurine content increasing from February to April and reaching its highest value of 852.32 µg/g in April. From June to December, taurine showed a decreasing trend and dropped to its lowest value of 666.75 µg/g in November (Fig. 6 a). ChCSAD and ChCDO expression levels gradually increased from January, reaching their highest levels in April and March, respectively, and then gradually decreased ( P < 0.05) (Fig. 6 b–c). Characteristics of betaine and taurine content in association analysis population The taurine content of the experimental individuals ranged from 779.46–957.30 µg/g (Fig. S5a), with an average of 862.95 ± 51.42 µg/g and a coefficient of variation (CV) of 5.96%; The betaine content of the experimental individuals ranged from 809.69-1036.57 µg/g (Fig. S5b), with an average of 911.02 ± 67.18 µg/g and a coefficient of variation (CV) of 7.37%. There is significant variation in the content of taurine and betaine, which follows a normal distribution ( P > 0.05 ) and is suitable for conducting association analysis. SNPs in the coding regions of key genes Using gene fragment cloning, Sanger sequencing, and multi-sequence alignment, 107 candidate SNPs were predicted for ChCSAD , ChCDO , ChBADH , ChCDH , and ChBHMT . A total of 107 sets of primers were designed, and 47 SNP loci were validated, all of which were successfully genotyped in the experimental population (Fig. 7 ). The number of SNPs for each gene is shown in Table S2 , and information on the 47 validated SNP loci is shown in Table S3 . SNPs associated with betaine and taurine contents Nine SNPs were significantly correlated with taurine content ( P < 0.05), and one SNP was significantly correlated with betaine content ( P < 0.05) (Table 2 ). Among them, three SNPs caused coding amino acid changes. SNP ChCDO -46 changed lysine (Lys) to glutamate (Glu), ChCDO -394 changed threonine (Thr) to serine (Ser), and ChCDH -1585 changed asparagine (Asn) to aspartate (Asp) (Table 3 ). Table 2 SNPs associated with taurine and betaine contents Number SNPs Genotype Content (µg/g) P -value Associated trait 1 ChCDO -46 AA 873.16 0.004 taurine AG 843.39 2 ChCDO -252 AA 872.15 0.010 taurine AG 845.32 3 ChCDO -375 CC 873.45 0.027 taurine CT 845.78 TT 846.66 4 ChCDO -384 GG 872.37 0.025 taurine GT 844.78 TT 882.99 5 ChCDO -387 AA 872.76 AG 846.31 0.038 taurine GG 846.66 6 ChCDO -393 CC 872.76 0.038 taurine CT 846.31 TT 846.66 7 ChCDO -394 AA 872.34 0.029 taurine AT 844.17 TT 872.43 8 ChCDO -417 CC 872.34 0.009 taurine CT 843.34 9 ChCDO -423 AA 872.34 0.017 taurine AG 843.34 GG 930.72 10 ChCDH -1585 G/G 905.48 0.017 betaine A/G 838.26 Table 3 Information on non-synonymous mutation SNPs SNPs Nucleotide variant Amino acid variant ChCDO -46 A→G Lys→Glu ChCDO-394 A→T Thr→Ser ChCDH-1585 A→G Asn→Asp Haplotype and linkage analysis Among the nine SNPs associated with taurine content, five ( ChCDO -387, ChCDO -393, ChCDO -394, ChCDO -417, ChCDO -423) formed a linkage group and three haplotypes (Fig. 8 ), ACACA, GTTTG, and GTACA, with haplotype frequencies of 0.781, 0.176, and 0.033, respectively. Among them, the GTACA haplotype had a significant advantage in taurine content (Table 4 ). Table 4 Results of the haplotype analysis Haplotype CDO 387 CDO 393 CDO 394 CDO 417 CDO 423 Frequency Taurine content (µg/g) H1 A C A C A 0.781 873.88 H2 G T T T G 0.176 838.99 H3 G T A C A 0.033 930.72 Discussion Characteristics of betaine and taurine content and key gene expression in C. hongkongensis In this study, we found that betaine content in the digestive glands of C. hongkongensis was the highest among all tissues ( P < 0.05). We speculate that the digestive gland is the energy and fat storage organ, as well as food digestive organ, and the main site of betaine synthesis in oysters [ 23 ]. ChCDH and ChBHMT are highly expressed in the digestive gland and adductor muscles, whereas ChBADH is highly expressed in adductor muscles. The adductor muscle is an important component of oyster muscles, and it plays an important role in energy storage, metabolism, and other life processes. The adductor muscle of purple-shelled clams synthesizes betaine from choline, and we speculate that it has the same function as the oyster adductor muscle [ 24 ]. As a filter-feeding animal, C. hongkongensis mainly filters and feeds on planktonic algae and organic debris to meet its energy needs. The digestive gland is an important organ that participates in oyster lipid and carbohydrate metabolism [ 25 ]. The highest taurine content was found in the digestive gland, suggesting that the digestive glands of oysters have functions similar to those of the livers of higher animals, and that it is the main organ for synthesizing taurine [ 26 ]. ChCSAD is expressed most highly in the digestive gland, suggesting that ChCSAD is a key gene involved in the synthesis of taurine in oysters, and that the digestive gland is the main organ for taurine synthesis in oysters. Chen et al. [ 27 ] found that CSAD was widely expressed in all tissues of razor clams, with the highest expression in the liver. ChCDO is highly expressed in the adductor muscle, possibly due to its indirect involvement in the regulation of taurine osmotic pressure in oysters, with the adductor muscle serving as the main site for taurine metabolism and accumulation during salinity adaptation. As early as 1966, Lynch [ 28 ] found significant changes in the contents of taurine, alanine, glycine, and proline in the shell-closing muscle of American oysters with changes in salinity. Factors affecting betaine and taurine content and gene expression in C. hongkongensis Betaine is a buffering substance for osmotic pressure fluctuations that can enhance the tolerance of biological cells to high salt and high osmotic environments and increase the tolerance of aquatic animals to osmotic pressure fluctuations [ 29 – 31 ]. Free amino acids (FAA) have also been shown to play a major role in regulating intracellular osmotic pressure and cell volume [ 32 ]. Taurine, one of the main free amino acids in shellfish, plays an important role in maintaining osmotic pressure in oysters. When salinity decreases, oysters release large amounts of taurine to adapt to low-osmotic environments. Conversely, taurine accumulates in and adapts to highly osmotic environments [ 33 ]. In our study, we found that the levels of betaine and taurine in C. hongkongensis reached their highest levels in April, possibly because of an increase in salinity caused by high temperatures and low rainfall in Guangxi in April. Taurine and betaine contents showed a downward trend from June to December, which may have been due to increased rainfall after May that continued until October, resulting in a decrease in seawater salinity. Lin et al. [ 34 ] also found that betaine content in oysters changes when exposed to changes in external salinity. Taurine also participates in osmotic regulation to reduce the damage to oysters caused by changes in environmental salinity. Huang et al. [ 35 ] found that the taurine content of oysters in high-salinity waters was higher than that in low-salinity waters. The present study also found that the levels of betaine and taurine in oysters changed with changes in seawater salinity, further indicating that betaine and taurine may be involved in osmotic pressure regulation in oysters. ChBADH , ChCDH , and ChBHMT are the key enzymes involved in the synthesis and decomposition of betaine in oysters. ChBADH and ChCDH levels were high from January to April and from January to February, respectively. Other researchers have proposed that when oysters are subjected to external salinity stress, the expression levels of ChBADH and ChCDH increase, and betaine content increases accordingly [ 36 ]. ChCDH only remained at a high level from January to February, possibly because of its role as a pre-catalytic enzyme in the betaine synthesis pathway, and because its expression time was earlier than that of ChBADH [ 20 ]. The expression level of ChBHMT was high in January, possibly because of the continuous increase in salinity in the Maowei Sea of Guangxi in that mongth. Under high salt stress, ChBHMT expression decreases in oysters to maintain the corresponding osmotic pressure. In recent years, BHMT has been reported to maintain the osmotic pressure balance in various aquatic animals such as Apostichopus japonicus [ 37 ] and Atlantic salmon [ 38 ]. In our study, taurine content was the highest in April, and the expression of ChCDO and ChCSAD reached their highest levels in March and April, respectively. At this time, salinity was also at its highest level, indicating that oysters can improve the efficiency of taurine synthesis and adaptively compensate for high osmotic pressure. This indirectly suggests that ChCDO and ChCSAD are involved in the regulation of osmotic pressure in C. hongkongensis [ 39 ]. The expression of ChCDO peaked before that of ChCSAD , which may be because the former is an upstream regulatory factor in the taurine synthesis pathway. Coding region SNPs and development efficiency Approximately 90% of the mutations in DNA sequences are single-base mutations, which contribute to the rich genetic diversity of organisms [ 40 ]. Genetic diversity is beneficial for the environmental adaptability and selective breeding of species. Most SNPs are located in the non-coding regions of the genome and play important roles in population genetics and evolutionary research [ 41 , 42 ], whereas SNP loci in the coding region have high genetic stability [ 43 ]. In this study, 107 SNP loci were detected in five key gene-coding regions of C. hongkongensis , and 47 SNP markers were successfully developed using FLDAS-PCR and polyacrylamide gel technology. The success rate of SNP development was 43.9% (47/107). The success rate of SNP development using high resolution melting (HRM) technology for C. gigas glycogen phosphorylase was 33.3% (14/42) [ 44 ], reflecting the relatively high success rate of FLDAS-PCR technology in SNP development. However, FLDAS-PCR technology has low throughput and is not suitable for large-scale SNP detection and development. Correlations between SNPs and trait content SNP sites with synonymous mutations do not alter the encoded amino acid sequence, but synonymous mutations can affect phenotypes by altering mRNA secondary structure stability, translation efficiency, and protein folding [ 45 ]. Non-synonymous mutations are single-nucleotide mutations that cause changes in amino acid sequences and that are likely to affect DNA transcription and subsequent translation processes, thereby affecting the structure and function of proteins. These are known as functional SNPs [ 46 ]. In this study, we identified nine SNP sites associated with taurine content in the ChCDO coding region of C. hongkongensis . ChCDO -46 and ChCDO -394 are non-synonymous mutations that cause amino acids changes from lysine to glutamate and from threonine to serine, respectively. Only one SNP, ChCDH -1585, was found to be associated with betaine content in the ChCDH coding region of C. hongkongensis . This is a non-synonymous mutation that causes an asparagine-to-aspartate change. Haploid-level analysis is considered more robust than single-marker allele-level analysis [ 47 ], and haplotype linkage disequilibrium and taurine association analyses can better illustrate the correlation between SNPs and taurine content. The results of this study showed that the five SNP loci that were significantly associated with taurine content formed a linkage group and resulted in three haplotypes, among which the GTACA haplotype had a significant advantage in taurine content. Conclusions In this study, we cloned the full-length cDNA of ChCDO and ChCSAD , which are key genes involved in taurine metabolism in C. hongkongensis , and found that betaine and taurine contents and the expression of key genes were regulated by seawater salinity. Using Sanger sequencing and multiple sequence alignment, 107 candidate SNPs were predicted in the coding regions of the key genes involved in betaine and taurine metabolism in C. hongkongensis , including ChCDH , ChBADH , ChBHMT , ChCDO , and ChCSAD . Forty-seven SNPs were successfully validated and genotyped using FLDAS-PCR and gene fragment resequencing. Nine SNPs were associated with taurine content in the ChCDO coding region ( P < 0.05), and one SNP was associated with betaine content in the ChCDH coding region ( P < 0.05). The results of linkage disequilibrium analysis showed that the five SNPs in the coding region of ChCDO form a linkage group and result in three haplotypes, among which the haplotype GTACA has a significant advantage. These loci and haplotypes can serve as potential molecular markers for the molecular breeding of C. hongkongensis . Abbreviations ANOVA, analysis of variance; BADH, betaine aldehyde dehydrogenase; BHMT, betaine homocysteine methyltransferase; CDH, choline dehydrogenase; CDO, cysteine dioxygenase; CSA, cysteine sulfite; CSAD, cysteine sulfinic acid decarboxylase; ELISA, enzyme-linked immunosorbent assay; FLDAS-PCR, fragment length discrepant allele specific PCR; HRM, high resolution melting; ORF, open reading frame; UTR, untranslated region Declarations Authors’contributions All authors contributed to the study conception and design. Experiment design, methodology, and Resources were performed by Z.S. Y.X., P.Z., L.K. performed the investigation and gene expression analysis. Material preparation was performed by Z.C., Z.J. and Q.D. The draft of the manuscript was written by L.K., and all authors reviewed the manuscript. All authors read and approved the final. manuscript. Funding This work was supported by the Natural Science Foundation of Guangxi (No. 2023GXNSFAA026503), the Guangxi Key Research and Development Program (2023AB17105), the Marine Science Guangxi First-Class Subject, Beibu Gulf University (No. DRC002), the Counterpart Aid Project for Discipline Construction from Guangxi University (Grant No. 2023B03), and the Scientific Research and Technology Development Plan Project of Qinzhou (No. 20223637). Availability of data and materials All data generated during this study or analysis are included in the published articles, sequence data is available in the NCBI GenBank database (https://www.ncbi.nlm.nih.gov/genbank/) under accession number OP792983 and OP792984. Ethics approval and consent to participate The oysters used in this study were marine-cultured animals, and all experiments were conducted according to the regulations established by the local and central government. No specific permissions were required to collect oysters or conduct the experiments described. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Author details Guangxi Key Laboratory of Beibu Gulf Marine Biodiversity Conservation, Pinglu Canal and Beibu Gulf Coastal Ecosystem Observation and Research Station of Guangxi, College of Marine Sciences, Beibu Gulf University, Qinzhou 535011, China References Gormley TR, Neumann T, Fagan JD, Brunton NP. Taurine content of raw and processed fish fillets/portions. Eur Food Res Technol. 2007;225(5):837-842. https://doi.org/10.1007/s00217-006-0489-4. Pinto W, Rønnestad I, Jordal AO, Gomes AS, Dinis MT, Aragão C. Cloning, tissue and ontogenetic expression of the taurine transporter in the flatfish Senegalese sole (Solea senegalensis). Amino Acids. 2012;42(4):1317-1327. https://doi.org/10.1007/s00726-010-0826-6. Chesney RW. Taurine: Its Biological Role and Clinical Implications. Adv Pediatr. 1985;32(1):1-42. Stapleton PP, Charles RP, Redmond HP, Bouchier-Hayes DJ. Taurine and human nutrition. Clin Nutr. 1997;16(3):103-108. https://doi.org/10.1016/S0261-5614(97)80234-8. Ministry of Agriculture and Rural Affairs of the People’s Republic of China, National Fisheries Technology Extension Center, & China Society of Fisheries. China Fishery Statistical Yearbook. China Agriculture Press. 2021;pp:1-144. Fuke S, Konosu S. Taste-active components in some foods: A review of Japanese research. Physiol Behav.1991;49(5):863-868. https://doi.org/10.1016/0031-9384(91)90195-T. Konosu TH. Determination of β-alanine betaine and glycine betaine in some marine invertebrates. Bull Jan Soc Sci Fish. 1975;41: 743-746. https://doi.org/10.2331/suisan.41.743. Abdel-Tawwab M, Monier MN. Stimulatory effect of dietary taurine on growth performance, digestive enzymes activity, antioxidant capacity, and tolerance of common carp, Cyprinus carpio L., fry to salinity stress. Fish Physiol Biochem. 2018; 44(2):639-649. https://doi.org/10.1007/s10695-017-0459-8. Feng Y, Xu HJ., Liu D, Chen ZT, Xu JF, Zhi R, Li XG. Application of betaine in aquatic animal production. Feed Review. 2013;(08):38-40. https://doi.org/10.3969/j.issn.1001-0084.2013.08.010. Pierce SK, Rowland-Faux LM, Crombie BN. The mechanism of glycine betaine regulation in response to hyperosmotic stress in oyster mitochondria: A comparative study of Atlantic and Chesapeake Bay oysters. J Exp Zool. 1995;271(3):161-170. https://doi.org/10.1002/jez.1402710302. Song X, Lü W, Ibrahim S, Deng Y, Li Q, Yue C. Identification of free amino acids (FAA) that are important as major intracellular osmolytes in the estuarine Hong Kong oyster, Crassostrea hongkongensis. Aquacult rep. 2023;28:101464. https://doi.org/10.1016/j.aqrep.2023.101464. Zhao X, Li Q, Meng Q, Yue C, Xu C. Identification and expression of cysteine sulfinate decarboxylase, possible regulation of taurine biosynthesis in Crassostrea gigas in response to low salinity. Sci Rep. 2017;7(1):5505. https://doi.org/10.1038/s41598-017-05852-6. Welborn JR, Manahan DT. Taurine Metabolism In Larvae Of Marine Molluscs (Bivalvia, Gastropoda). J Exp Biol. 1995;198(8):1791-1799. https://doi.org/10.1242/jeb.198.8.1791. Meng J, Zhu Q, Zhang L, Li C, Li L, She Z, Huang B, Zhang G. Genome and transcriptome analyses provide insight into the euryhaline adaptation mechanism of Crassostrea gigas . Plos One. 2013;8(3):e58563. https://doi.org/10.1371/journal.pone.0058563. Nagasaki T, Hongo Y, Koito T, Nakamura-Kusakabe I, Shimamura S, Takaki Y, Yoshida T, Maruyama T, Inoue K. Cysteine dioxygenase and cysteine sulfinate decarboxylase genes of the deep-sea mussel Bathymodiolus septemdierum: possible involvement in hypotaurine synthesis and adaptation to hydrogen sulfide. Amino Acids. 2015;47(3):571-578. https://doi.org/10.1007/s00726-014-1891-z. Fan XG, Zhang T, Li J, Han HJ, Gao LD, Zhang ST, Chen N. Betaine metabolism in microorganism and its application. Bull ferment sci technol. 2018;47(03):151-156. https://doi.org/10.16774/j.cnki.issn.1674-2214.2018.03.006. Kidd MT, Ferket PR, Garlich JD. Nutritional and osmoregulatory functions of betaine. Worlds Poult Sci J. 1997;53(2):125-139. https://doi.org/10.1079/WPS19970013. Sakamoto A, Nishimura Y, Ono H, Sakura N. Betaine and homocysteine concentrations in foods. Pediatr Int. 2002;44(4):409-413. https://doi.org/10.1046/j.1442-200X.2002.01591.x1. Veeranki S, Tyagi SC. Defective Homocysteine Metabolism: Potential Implications for Skeletal Muscle Malfunction.Int J Mol Sci. 2013;14(7):15074-15091. https://doi.org/10.3390/ijms140715074. Delgado-Gaytán MF, Gómez-Jiménez S, Gámez-Alejo LA, Rosas-Rodríguez JA, Figueroa-Soto CG, Valenzuela-Soto EM. Effect of salinity on the synthesis and concentration of glycine betaine in osmoregulatory tissues from juvenile shrimps Litopenaeus vannamei. Comp Biochem Physiol A Mol Integr Physiol. 2020;240:110628. https://doi.org/10.1016/j.cbpa.2019.110628. Jahn MP, Cavagni GM, Kaiser D, Kucharski LC. Osmotic effect of choline and glycine betaine on the gills and hepatopancreas of the Chasmagnathus granulata crab submitted to hyperosmotic stress. J Exp Mar Biol Ecol. 2006;334(1):1-9. https://doi.org/10.1016/j.jembe.2006.01.006. Shi R, Li C, Qi H, Liu S, Wang W, Li L, Zhang G. Construction of a high-resolution genetic map of Crassostrea gigas: QTL mapping and GWAS applications revealed candidate genes controlling nutritional traits. Aquaculture. 2020;527:735427. https://doi.org/10.1016/j.aquaculture.2020.735427. Qian YX, Song JJ. Effects of salinity and betaine on bhmt mrna expression in Lateolabrax japonicus. Zool Res. 2011;32(3):277-284. https://doi.org/10.3724/SP.J.1141.2011.03277. De Vooys CGN, Geenevasen JAJ. Biosynthesis and role in osmoregulation of glycine-betaine in the Mediterranean mussel Mytilus galloprovincialis LMK. Comp Biochem Physiol B Biochem Mol Biol. 2002;132(2):409-414. https://doi.org/10.1016/S1096-4959(02)00052-0. Yepiz-Plascencia G, Galván TG, Vargas-Albores F, García-Bañuelos M. Synthesis of Hemolymph High-Density Lipoprotein β-Glucan Binding Protein by Penaeus vannamei Shrimp Hepatopancreas. Mar Biotechnol(NY). 2000;2(5):485-492. https://doi.org/10.1007/s101260000030. Li XJ, Tang JZ, Song P, Wu Q, Ju FF, Liu Z, Lu SQ. Molecular cloning and expression of casd in Carassius auratus . Ocean Et Limnol Sin. 2018;49(01):134-141. Chen YH , Deng M, Dong ZG, Li YF, Niu DH. Function of taurine and its synthesis-related genes in hypertonic regulation of Sinonovacula constricta. Comp Biochem Physiol A Mol Integr Physiol. 2024;287:111536. https://doi.org/10.1016/j.cbpa.2023.111536. Lynch MP. Effects of environmental salinity of free amino acids of Crassostrea virginica gmelin. Comp Biochem Physiol. 1966;19(4):783-790. https://doi.org/10.1016/0010-406X(66)90434-81. Imbard A, Benoist J, Esse R, Gupta S, Lebon S, de Vriese AS, de Baulny HO, Kruger W, Schiff M, Blom HJ. High homocysteine induces betaine depletion. Bioscience rep. 2015;35(4):e222. https://doi.org/10.1042/BSR20150094. Lu J, Luo S, Jin T, Wang L, Yang G, Lu X, Chen J. Betaine protects ayu ( Plecoglossus altivelis ) against Vibrio anguillarum infection in salinity by regulating the immunomodulatory activity of monocytes/macrophages. Aquaculture.2021;536:736482. https://doi.org/10.1016/j.aquaculture.2021.736482. Safi A, Akrami R. Effect of betaine as a feed Atractant on growth, survival and resistance to heat and salinity stressors on wild Common carp (Cyprinus carpio) juvenile. 2013;15-24. Pourmozaffar S, Tamadoni Jahromi S, Rameshi H, Sadeghi A, Bagheri T, Behzadi S, Gozari M, Zahedi MR, Abrari Lazarjani S. The role of salinity in physiological responses of bivalves. Rev Aquacult. 2020;12(3):1548-1566. https://doi.org/10.1111/raq.123971. Sokolov EP, Sokolova IM. Compatible osmolytes modulate mitochondrial function in a marine osmoconformer Crassostrea gigas (Thunberg, 1793). Mitochondrion. 2019;45:29-37. https://doi.org/10.1016/j.mito.2018.02.002. Lin HS, Qin XM, Zhang CH, Huang YQ, Gao JL, Liu LL, Luo B, Yang FM. Comparative analysis of nutritional components and flavor characteristics of cultivated oyster from different coastal areas of china. South China Fisher Sci. 2019;15(2): 110-120. https://doi.org/10.1046/j.1442-200X.2002.01591.x. Huang YQ, Yang FM, Qin XM, Zhang CH, Lin HS, Gao JL. Chemical composition and characteristic odorans of oyster (Crassostrea hongkongensis) from different culture areas. Food Sci. 2019;40(14):236-242. https://doi.org/10.7506/spkx1002-6630-20180822-239. Rosas-Rodríguez JA, Soñanez-Organis JG, Miranda-Cruz MM, Poom-Llamas JJ, Stephens-Camacho N, Adan-Bante NP. Betaine aldehyde dehydrogenase is regulated during wssv infection in white shrimp. Isj-Invert Surviv J. 2019;16:113-119. https://doi.org/10.25431/1824-307X/isj.v0i0.113-119. Zhao Y, Bu SY, Wang H, Cui H, Hao ZJ, Xu RR, Li SH, Cheng YQ, Ma T. Cloning of Betaine Homocysteine Methyltransferase 1 (bhmt1) Gene from Apostichopus japonicus and Its Expression Pattern under Low Salinity Stress. J of Yantai Univ.(Nat Sci Eng Ed).2022;35(04):434-442. https://doi.org/10.13951/j.cnki.37-1213/n.210712. Kwasek K, Terova G, Lee B, Bossi E, Saroglia M, Dabrowski K. Dietary methionine supplementation alters the expression of genes involved in methionine metabolism in salmonids. Aquaculture. 2014;433:223-228. https://doi.org/10.1016/j.aquaculture.2014.05.031. Zhao X, Li Q, Meng Q, Yue C, Xu C. Identification and expression of cysteine sulfinate decarboxylase, possible regulation of taurine biosynthesis in Crassostrea gigas in response to low salinity. Sci Rep. 2017;7(1):5505. https://doi.org/10.1038/s41598-017-05852-6. Collins FS, Brooks LD, Chakravarti A. A DNA polymorphism discovery resource for research on human genetic variation. Genome Res. 1998;8(12):1229-1231. https://doi.org/10.1101/gr.8.12.1229. Oruç ÖE, Dursun Ö. An application of information theoretical measures for DNA structure. Turkiye Klin J Biostat. 2011;3(1):1-7. Fiume E, Christou P, Gianì S, Breviario D. Introns are key regulatory elements of rice tubulin expression. Planta. 2004;218(5):693-703. https://doi.org/10.1007/s00425-003-1150-0. Tang LQ, Xiao CL, Wang WP. 2012. Research and application progress of snp markers. Chinese Agric Sci Bull. 2012;28(12):154-158. https://doi.org/10.3969/j.issn.1000-6850.2012.12.028. She Z, Li L, Qi H, Song K, Que H, Zhang G. Candidate Gene Polymorphisms and their Association with Glycogen Content in the Pacific Oyster Crassostrea gigas. Plos One. 2015;10(5):e124401. https://doi.org/10.1371/journal.pone.0124401. Cartegni L, Chew SL, Krainer AR. Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat Rev Genet. 2002;3(4):285-298. https://doi.org/10.1038/nrg775. Rothschild MF, Messer LA, Vincent A. Molecular approaches to improved pig fertility. J Reprod Fertil Suppl. 1997;(52):227-236. Clark AG. The role of haplotypes in candidate gene studies. Genet Epidemiol. 2004; 27(4):321-333. https://doi.org/10.1002/gepi.20025. Additional Declarations No competing interests reported. Supplementary Files Additionalfile1.zip Additionalfile2.xlsx Graphicalabstract.pdf Cite Share Download PDF Status: Published Journal Publication published 24 Feb, 2025 Read the published version in BMC Genomics → Version 1 posted Editorial decision: Revision requested 26 Nov, 2024 Reviews received at journal 26 Nov, 2024 Reviewers agreed at journal 07 Nov, 2024 Reviews received at journal 27 Oct, 2024 Reviewers agreed at journal 06 Oct, 2024 Reviewers agreed at journal 20 Sep, 2024 Reviewers invited by journal 20 Sep, 2024 Editor invited by journal 19 Sep, 2024 Editor assigned by journal 18 Sep, 2024 Submission checks completed at journal 18 Sep, 2024 First submitted to journal 16 Sep, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5097219","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":383167172,"identity":"08e89584-8d2d-4ce6-a43d-870254a2c508","order_by":0,"name":"Lingxin Kong","email":"","orcid":"","institution":"Beibu Gulf University","correspondingAuthor":false,"prefix":"","firstName":"Lingxin","middleName":"","lastName":"Kong","suffix":""},{"id":383167173,"identity":"30fa1348-25fb-4058-9ba5-34bd682d0088","order_by":1,"name":"Ziao Chen","email":"","orcid":"","institution":"Beibu Gulf University","correspondingAuthor":false,"prefix":"","firstName":"Ziao","middleName":"","lastName":"Chen","suffix":""},{"id":383167174,"identity":"11fbcd65-f21f-4755-8664-e1528947bcb0","order_by":2,"name":"Zhen Jia","email":"","orcid":"","institution":"Beibu Gulf University","correspondingAuthor":false,"prefix":"","firstName":"Zhen","middleName":"","lastName":"Jia","suffix":""},{"id":383167175,"identity":"3a65c3ad-c239-4f1a-87a2-0ad068d90d87","order_by":3,"name":"Qiong Deng","email":"","orcid":"","institution":"Beibu Gulf University","correspondingAuthor":false,"prefix":"","firstName":"Qiong","middleName":"","lastName":"Deng","suffix":""},{"id":383167176,"identity":"0d135f2c-80ce-4551-9298-6659240bfa06","order_by":4,"name":"Peng Zhu","email":"","orcid":"","institution":"Beibu Gulf University","correspondingAuthor":false,"prefix":"","firstName":"Peng","middleName":"","lastName":"Zhu","suffix":""},{"id":383167177,"identity":"8b982855-0b87-4a45-b9d5-f7d7fab8aeb8","order_by":5,"name":"Youhou Xu","email":"","orcid":"","institution":"Beibu Gulf University","correspondingAuthor":false,"prefix":"","firstName":"Youhou","middleName":"","lastName":"Xu","suffix":""},{"id":383167178,"identity":"ad5733a4-765f-4b66-b368-cd67cf54d784","order_by":6,"name":"Zhicai She","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxElEQVRIiWNgGAWjYDACCRBRcSABzOEhXssZkrUwtpGiRX528+EPP+fdyZOPSGB88LaNQd6ckBaDO8cSDHu3PSs2vJHAbDi3jcFwZwMhLRI5BsmM2w4nbpyRwCbN28aQYHCAkMNm5H84zDgHrIX9N1FaGG7kMDYzNhxOnC+RwMZMlBaDG2nGjD3HnhUb8DxslpxzTsJwA2GHJT/+8KMGGGLtyQc/vCmzkSfsMLh1BxgbGKAxSySQbyBB8SgYBaNgFIwsAAA3akTdqHXoLQAAAABJRU5ErkJggg==","orcid":"","institution":"Beibu Gulf University","correspondingAuthor":true,"prefix":"","firstName":"Zhicai","middleName":"","lastName":"She","suffix":""}],"badges":[],"createdAt":"2024-09-16 11:55:53","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5097219/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5097219/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12864-025-11373-8","type":"published","date":"2025-02-24T15:57:50+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":71767769,"identity":"18609e47-0ba0-4e8f-a31f-bf23e92862d4","added_by":"auto","created_at":"2024-12-18 12:05:14","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":4010239,"visible":true,"origin":"","legend":"\u003cp\u003eMultiple sequence alignments of\u003cem\u003e \u003c/em\u003eChCSAD\u003cem\u003e \u003c/em\u003e(A) and ChCDO (B)\u003c/p\u003e\n\u003cp\u003eBlack: domains with high similarity; blue: domains with lower similarity; red: domains with relatively high similarity.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5097219/v1/3d2bfd0ce2d01a4c9a411062.png"},{"id":71767765,"identity":"e8a9dd68-a7cf-48bf-a706-c3d2eb1bd00e","added_by":"auto","created_at":"2024-12-18 12:05:14","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":422517,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic analysis of ChCSAD\u003cem\u003e \u003c/em\u003e(A) and ChCDO (B)\u003c/p\u003e\n\u003cp\u003eThe number next to the internal branch represents the value based on 1000 repeated calculations, and 0.2 represents the genetic distance.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5097219/v1/4fc2d2c51d1b601e49a94ed1.png"},{"id":71769781,"identity":"8145b45e-1a88-4629-992b-66ca34a326b1","added_by":"auto","created_at":"2024-12-18 12:13:14","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":688593,"visible":true,"origin":"","legend":"\u003cp\u003eBetaine contents and gene expression in different tissues\u003c/p\u003e\n\u003cp\u003ea, Betaine contents in different tissues of\u003cem\u003eC. hongkongensis\u003c/em\u003e; b, \u003cem\u003eChBHMT\u003c/em\u003eexpression\u003cem\u003e \u003c/em\u003ein different tissues; c, \u003cem\u003eChCDH\u003c/em\u003e expression in different tissues; d, \u003cem\u003eChBADH\u003c/em\u003e expression in different tissues. Different letters indicate significant differences (\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5097219/v1/f3cc75cb5f7be1a938e718f5.png"},{"id":71769782,"identity":"e0efe808-029b-404c-928c-4dbd3af1dfcd","added_by":"auto","created_at":"2024-12-18 12:13:15","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":222897,"visible":true,"origin":"","legend":"\u003cp\u003eTaurine contents and gene expression in different tissues\u003c/p\u003e\n\u003cp\u003ea, Taurine contents in different tissues of\u003cem\u003eC. hongkongensis\u003c/em\u003e; b, \u003cem\u003eChCSAD \u003c/em\u003eexpression in different tissues; c, \u003cem\u003eChCDO\u003c/em\u003e expression\u003cem\u003e \u003c/em\u003ein different tissues. Different letters indicate significant differences (\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5097219/v1/6a60aec4cda11f5047a74371.png"},{"id":71769783,"identity":"e714e990-b56a-482f-adef-ee6feab9146f","added_by":"auto","created_at":"2024-12-18 12:13:15","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":363357,"visible":true,"origin":"","legend":"\u003cp\u003eBetaine contents and gene expression in different months\u003c/p\u003e\n\u003cp\u003ea, Betaine contents in \u003cem\u003eC.hongkongensis\u003c/em\u003e in different months; b, \u003cem\u003eChBHMT\u003c/em\u003e expression in different months; c, \u003cem\u003eChCDH\u003c/em\u003e expression in different months; d, \u003cem\u003eChBADH \u003c/em\u003eexpression in different months. Different letters indicate significant differences (\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-5097219/v1/6bc0a40a2f7d6129ff0b22e2.png"},{"id":71767772,"identity":"02e179d7-1653-4669-976f-a46f89e48c8c","added_by":"auto","created_at":"2024-12-18 12:05:15","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":157899,"visible":true,"origin":"","legend":"\u003cp\u003eTaurine contents and gene expression in different months\u003c/p\u003e\n\u003cp\u003ea, Taurine content in\u003cem\u003e C. hongkongensis \u003c/em\u003ein different months; b, \u003cem\u003eChCSAD\u003c/em\u003e expression in different months; c, \u003cem\u003eChCDO\u003c/em\u003e expression in different months. Different letters indicate significant differences (\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-5097219/v1/98d1b9fab412add50be6fdf6.png"},{"id":71767777,"identity":"1c492f6e-96e5-4d3a-a5e8-3b41364d8f0c","added_by":"auto","created_at":"2024-12-18 12:05:15","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":733464,"visible":true,"origin":"","legend":"\u003cp\u003eSNP genotyping results\u003c/p\u003e\n\u003cp\u003ea, SNP genotyping results based on FLDAS-PCR of the three different genotypes shown; two bands indicate heterozygous and one band indicates homozygous; b, SNP genotyping results based on gene fragment resequencing for nucleotide site 252 indicated by the arrow; the single peak in the figure above indicates homozygous, and the double peaks in the figure below indicate heterozygous.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-5097219/v1/35ac31472f1f86adde508100.png"},{"id":71767773,"identity":"13f66a6e-7e23-48af-848a-8f7cbdfb4647","added_by":"auto","created_at":"2024-12-18 12:05:15","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1319067,"visible":true,"origin":"","legend":"\u003cp\u003eLinkage disequilibrium (LD) for the nine SNPs associated with taurine\u003c/p\u003e\n\u003cp\u003eSNP IDs are shown in the upper panels. D' \u0026gt; 80 was the threshold of linkage disequilibrium. Darker colors indicate stronger linkage disequilibrium of SNPs.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-5097219/v1/63b49c079d2c4aa5f7fcd99f.png"},{"id":77622518,"identity":"009d96c2-e03e-4446-be67-c1084592c824","added_by":"auto","created_at":"2025-03-03 16:07:51","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":10775214,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5097219/v1/0949b865-adb8-4169-9b93-9aa49333f496.pdf"},{"id":71767775,"identity":"eac51a3a-29bf-4d2c-8ffe-207456fed15d","added_by":"auto","created_at":"2024-12-18 12:05:15","extension":"zip","order_by":13,"title":"","display":"","copyAsset":false,"role":"supplement","size":7747882,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile1.zip","url":"https://assets-eu.researchsquare.com/files/rs-5097219/v1/73af2680200f1071bd6dbcf6.zip"},{"id":71767778,"identity":"9a3a2f85-518a-4fb3-91a4-0dfef3f886bd","added_by":"auto","created_at":"2024-12-18 12:05:15","extension":"xlsx","order_by":14,"title":"","display":"","copyAsset":false,"role":"supplement","size":17997,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-5097219/v1/512e66422fc346a9ae72084d.xlsx"},{"id":71767767,"identity":"685f0589-b75a-4ea2-8fb5-86d79201c960","added_by":"auto","created_at":"2024-12-18 12:05:14","extension":"pdf","order_by":15,"title":"","display":"","copyAsset":false,"role":"supplement","size":300118,"visible":true,"origin":"","legend":"","description":"","filename":"Graphicalabstract.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5097219/v1/62dac676282376323c733267.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Development of single nucleotide polymorphisms in key genes of taurine and betaine metabolism in Crassostrea hongkongensis and their association with content-related traits","fulltext":[{"header":"Background","content":"\u003cp\u003eWith the development of the economy and deepening of people\u0026rsquo;s health awareness, an increasing number of people choose seafood with higher nutritional content [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Taurine and betaine are important nutrients in \u003cem\u003eC. hongkongensis\u003c/em\u003e and have many important biological properties [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Oysters are also one of the most abundant natural sources of taurine. Since the beginning of the 21st century, oyster production in China has increased significantly. In 2019, China's oyster farming production reached 5.2\u0026nbsp;million tons, of which \u003cem\u003eC. hongkongensis\u003c/em\u003e represented approximately 1.8\u0026nbsp;million, accounting for 34.45% of China's total oyster production [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Although the production of \u003cem\u003eC. hongkongensis\u003c/em\u003e is high, it is still difficult to meet the market demand for high-quality oysters, and the economic benefits they bring are relatively low. The reasons behind this are factors such as excessive aquaculture in the sea and changes in the aquaculture environment, which have led to a decline in the quality of \u003cem\u003eC. hongkongensis\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eBetaine and taurine not only serve as important nutrients in oysters but also give them a unique freshness quality [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. With the continuous increase in research on betaine and taurine, they have been found to buffer substances for osmotic pressure fluctuations, which can improve the tolerance of biological cells to high-salt and high-osmotic environments [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Pierce et al. [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] found significant differences in the betaine synthesis rates among populations of \u003cem\u003eCrassostrea virginica\u003c/em\u003e under different salinities. The betaine synthesis rate of populations adapted to high salinities was 3\u0026ndash;4 times greater than that of populations adapted to low salinity. Song et al. [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] also found that taurine content in the adductor muscle of \u003cem\u003eC. hongkongensis\u003c/em\u003e changed significantly with salinity. When \u003cem\u003eC. hongkongensis\u003c/em\u003e was moved to 30\u0026permil; seawater, taurine content increased rapidly; however, 24 h after moving to 6\u0026permil; seawater, taurine content decreased by approximately 40%.\u003c/p\u003e \u003cp\u003eCysteine dioxygenase (CDO) and cysteine sulfinic acid decarboxylase (CSAD) are key enzymes involved in taurine synthesis [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Marine bivalves mainly use cysteine as a raw material to maintain taurine content in their bodies [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Cysteine is oxidized to cysteine sulfite (CSA) through CDO and decarboxylated to hypotaurine through CSAD. Finally, hypotaurine is oxidized to taurine. In marine mollusks, full-length cDNA sequences of CDO and CSAD genes have been cloned from \u003cem\u003eCrassostrea gigas\u003c/em\u003e and \u003cem\u003eBathymodiolus septemdierum\u003c/em\u003e, and their expression levels have been found to be related to changes in taurine content [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Choline dehydrogenase (CDH) and betaine aldehyde dehydrogenase (BADH) have long been considered important enzymes for catalyzing the production of betaine. Betaine is generated from choline through two enzymatic reactions. First, choline is catalyzed by CDH to form betaine aldehyde, which is then oxidized to betaine by BADH [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Betaine homocysteine methyltransferase (BHMT) is a key enzyme in betaine catabolism [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Multiple metabolic pathways are involved in the decomposition of betaine in living organisms, the most common being the methionine cycle, which is catalyzed by BHMT [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Previous studies have shown that betaine synthesis in \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e and \u003cem\u003eChasmagnathus granulata\u003c/em\u003e depends on the activities of CDH and BADH [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], and the expression of \u003cem\u003eBHMT\u003c/em\u003e was found to affect the betaine content in \u003cem\u003eC. gigas\u003c/em\u003e [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. To date, there have been no reports on the key genes involved in taurine and betaine metabolism in \u003cem\u003eC. hongkongensis\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eTo explore the relationship between key genes related to taurine and betaine metabolism and content-related traits in \u003cem\u003eC. hongkongensis\u003c/em\u003e, we determined taurine and betaine contents, as well as gene expression of \u003cem\u003eChCDO\u003c/em\u003e, \u003cem\u003eChCSAD\u003c/em\u003e, \u003cem\u003eChBADH\u003c/em\u003e, \u003cem\u003eChCDH\u003c/em\u003e, and \u003cem\u003eChBHMT\u003c/em\u003e in different tissues and specimen collection months. Then, we conducted an association analysis to screen single-nucleotide polymorphism (SNP) loci associated with taurine and betaine contents, laying a foundation for the breeding of high-quality oysters.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eOyster collection\u003c/h2\u003e \u003cp\u003eOysters used for analysis at different times and in different tissues were obtained from the Sandun Aquaculture Area in Qinzhou, Guangxi, China. Oysters for analysis at different times were collected once a month from June 2020 to April 2021. Oysters were collected from the same location, and 15 individuals were collected each time. Adductor muscles, gills, and other tissues were separated, frozen in liquid nitrogen, and stored at \u0026minus;\u0026thinsp;80\u0026deg;C for taurine and betaine content detection and RNA extraction. Samples from April were used for analysis of different tissues, including the adductor muscle, gills, mantle, gonads, digestive glands, and labial palps.\u003c/p\u003e \u003cp\u003eOne hundred and five oysters used for SNP development and association analysis were collected from Maowei Sea. The oysters were attached at the same time, and grew and developed in the same natural environment. The adductor muscle, gills, and other tissues were separated, frozen in liquid nitrogen, and stored at \u0026minus;\u0026thinsp;80\u0026deg;C for taurine and betaine content detection and RNA extraction.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eFull-length cDNA cloning of key genes\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from the samples using the TRIzol method. The extracted RNA was measured by spectrophotometry with a nucleic acid protein concentration meter (Gene Company Limited, Thermo, China). RNA integrity was detected by 1% agarose gel electrophoresis, and RNA was reverse transcribed into cDNA with a TransGen Biotech reverse transcription kit. Primers were designed for intermediate fragment cloning using the CSAD and CDO sequences of \u003cem\u003eC. gigas\u003c/em\u003e as references. Using cDNA as a template, 3' and 5' specific primers were designed in the cloned intermediate fragments for 3' and 5' RACE amplification (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The product was detected by 1% agarose gel electrophoresis, connected to the PMD19 clone vector and transformed into T1 \u003cem\u003eEscherichia coli\u003c/em\u003e cells. After overnight cultivation and PCR detection, the bacterial suspension was sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing.\u003c/p\u003e\n\u003ch3\u003eGene sequence and evolutionary analysis\u003c/h3\u003e\n\u003cp\u003eUtilizing ORF Finder online tools (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), we predicted the open reading frame (ORF) and amino acid sequences based on the full-length cDNA sequence. We predicted the molecular weight, isoelectric point, hydrophobicity, signal peptide, and structural domain of proteins using online software such as Expasy (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://web.expasy.org\u003c/span\u003e\u003cspan address=\"https://web.expasy.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), Signalp (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.cbs.dtu.dk/services/SignalP/\u003c/span\u003e\u003cspan address=\"http://www.cbs.dtu.dk/services/SignalP/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and NCBI. After using the BLAST tool in the NCBI database for sequence alignment and searching for homologous protein sequences, we performed multiple comparisons of homologous sequences using DNAMAN 7.0 software and built an evolutionary tree using MEGA 5.1 software.\u003c/p\u003e\n\u003ch3\u003eAnalysis of taurine and betaine content\u003c/h3\u003e\n\u003cp\u003eTaurine and betaine contents were detected using taurine and betaine enzyme-linked immunosorbent assay (ELISA) kits (Shanghai Meilian Biotechnology Co., Ltd., Shanghai, China). Blank, standard, and sample wells were included in testing. We added 50 \u0026micro;L of standard solution into each standard well, and then introduced sample diluent (40 \u0026micro;L) and sample solution (10 \u0026micro;L) to each sample well, followed by incubation at 37 ℃ for 30 min and five washes. Next, we added 50 \u0026micro;L of HRP enzyme-linked immunosorbent assay reagent to each well and 100 \u0026micro;L of acidic chromogenic agent for color development for 10 min at 37 ℃ in the dark. Absorbances were measured at 450 nm using an ELISA reader (Molecular Devices, Spectra Max Id5, USA), and the nutrient contents were calculated using a standard curve. Statistical analysis was performed using SPSS 22.0. Variance analysis was performed for samples collected at different times and from different tissues, and descriptive statistical analysis was performed for samples used for association analysis.\u003c/p\u003e\n\u003ch3\u003eGene expression analysis in different tissues and at different times\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from gills collected in different months and various tissue samples from April using the TRIzol method. The RNA was reverse transcribed into cDNA and diluted 10 times to serve as a quantitative PCR template (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Then, qRT-PCR was performed using a fluorescence quantitative PCR instrument (Bio-Rad, CFX96, USA). Each experimental group included three biological replicates and three technical replicates. L-Actin served as a reference gene. The relative expression level of the target gene was calculated using the 2-\u003csup\u003e△△CT\u003c/sup\u003e method, with results expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Analyses of variance (ANOVA) and multiple comparison testing was performed using SPSS 22.0 software.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for full-length cDNA cloning and quantitative PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimers\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequences (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eusages\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e15 CSAD-F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGTGAGGGGTTCAAAGGTCAAAAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFragment cloning\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1433 CSAD-R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCATCATTCCCTCCTTGACCTTTGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFragment cloning\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e430 CSAD-F2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTTTATGAAGGCTCGTGACCGCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFragment cloning\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1643 CSAD-R2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCATCATTCCCTCCTTGACCTTTGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFragment cloning\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e193 CDO-F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTGAGGAAGGAGCTGGGCAATGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFragment cloning\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e785 CDO-R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACATGAGATTCCAAGCAGGTCCATAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFragment cloning\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e397 CDO-F2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATACACAACCACCCGAACTCACAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFragment cloning\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e699 CDO-R2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCACTGAAGTCCTGATCGAATCCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFragment cloning\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e193 CDO-5-R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCATTGCCCAGCTCCTTCCTCAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo;race\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e356 CDO-5-R2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGTTCCAGCACAGAATCATCAGGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo;race\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e423 CDO-5-R3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACGCCCTCTAGTGTTTTCATGAAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo;race\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e668 CDO-3-F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACGACACAAGCAAAGAGACGGAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u0026rsquo;race\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e627 CDO-3-F2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCTCTACTCGCCACCATTCACCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u0026rsquo;race\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e577 CDO-3-F3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGTGCACAGAGTTGGAAACAGAAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u0026rsquo;race\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e433 CSAD-5-R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCATTGCGGTCACGAGCCTTCATAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo;race\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e473 CSAD-5-R2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGCTTTAGTTCTTCGGGATAGGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo;race\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e685 CSAD-5-R3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGGAGAATACAGGGGACACTTCGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo;race\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1455 CSAD-3-F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCTTCGAGAGAGACATTGACAATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u0026rsquo;race\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1391 CSAD-3-F2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCAGTGTGGCCGCAAGAATGACGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u0026rsquo;race\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e932 CSAD-3-F3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTATGGGAATGGGCCTTGACAACCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u0026rsquo;race\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eM13F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTAAAACGACGGCCAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003euniversal primer\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eM13R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGGAAACAGCTATGACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003euniversal primer\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUPM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRACE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUPS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTAATACGACTCACTATAGGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRACE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e400 qPCR-CDO-F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAGCTCTACAGGAAATCGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRT-qPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e573qPCR-CDO-R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGTGAATGGTGGCGAGTAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRT-qPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e137qPCR-CSAD-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGCCCACAGAGAAGCAGAGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRT-qPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e345qPCR-CSAD-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATTGCGGTCACGAGCCTTCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRT-qPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCDH-qRT-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCATCAGGCCACAACACTCTCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRT-qPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCDH-qRT-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACGCCGATCTTCTTCATCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRT-qPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBADH-qRT-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGTCCTTGTATCCTCGTCAACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRT-qPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBADH-qRT-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTATTCCTCCTGCCAGTCCTAGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRT-qPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBHMT-qRT-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTATTGGCTTTCACCTATTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRT-qPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBHMT-qRT-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGACGGCCCACTCTATCATTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRT-qPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLActinF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGTGCTACGTTGCCCTGGACTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRT-qPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLActinR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGGCACCTGAATCGCTCGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRT-qPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDevelopment of SNPs\u003c/h2\u003e \u003cp\u003eUsing the full-length cDNA of \u003cem\u003eChCSAD\u003c/em\u003e, \u003cem\u003eChCDO\u003c/em\u003e, \u003cem\u003eChBADH\u003c/em\u003e, \u003cem\u003eChCDH\u003c/em\u003e, and \u003cem\u003eChBHMT\u003c/em\u003e genes as templates, Oligo 7 was used to design primers for amplifying the ORF region of genes (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Ten oysters with significant differences in taurine or betaine contents were selected to clone the same gene fragment, and the PCR products were sent to Shanghai Shenggong Biotechnology Co., Ltd., for sequencing. We then used DNAMAN sequence comparison to predict candidate SNPs, followed by fragment length discrepant allele specific PCR (FLDAS-PCR) and polyacrylamide gel electrophoresis for SNP validation. First, we designed two upstream primers of different lengths, each with a 3' end that paired with two SNP allele bases, using Oligo 7. At the same time, we introduced mismatches at the 3rd or 4th base of the 3' end of the two allele-specific primers to increase specificity. Then, we added base sequences of different lengths at the 5' end, downstream was a universal primer sequence. The lengths of the amplified DNA fragments were 100\u0026ndash;200 bp. The amplified product was detected by 12% polyacrylamide gel electrophoresis.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePopulation genotyping\u003c/h3\u003e\n\u003cp\u003eFLDAS-PCR and polyacrylamide gel electrophoresis were used for genotyping when the SNP density was greater than 1/20 bp. Owing to the different lengths of the upstream primers, the homozygotes were shown as a single band, and the heterozygotes as two bands with a size difference of 8 bp.\u003c/p\u003e \u003cp\u003eGene fragment resequencing was used for genotyping when SNP density was less than 1/20 bp. First, the target fragments of all samples were cloned, and the PCR products were recovered, purified, and sent to Shanghai Shenggong Biotechnology Co., Ltd., for sequencing. We then compared the sequencing peaks of the same target fragment from different samples and genotyped the candidate SNPs in the population.\u003c/p\u003e\n\u003ch3\u003eAssociation analysis\u003c/h3\u003e\n\u003cp\u003eUsing SPSS 22.0, an association analysis between the content of taurine and betaine and genotype data was conducted using one-way ANOVA or t-testing. SNP markers that showed significant differences between different genotypes were considered associated with taurine or betaine content.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eHaploid and linkage analysis\u003c/h2\u003e \u003cp\u003eWe used Haploview 4.2 to perform haplotype and linkage analyses for the SNPs considered significant from the association analysis and used ANOVA in SPSS 22.0 to statistically analyze the taurine and betaine content between individuals with different haplotypes.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eCharacteristics of full-length cDNA of\u003c/b\u003e \u003cb\u003eChCSAD\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eChCDO\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe total length of \u003cem\u003eChCSAD\u003c/em\u003e cDNA was 2140 bp (NCBI login number: OP792983), including a 55-bp 5' untranslated region (UTR), 417-bp 3' UTR, and 668-bp ORF, encoding a total of 555 amino acids (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The relative molecular weight of the protein was 63.45 KDa, and its isoelectric point was 7.60. The \u003cem\u003eChCSAD\u003c/em\u003e protein was predicted to contain a conserved pyridoxal-deC domain (113\u0026ndash;479) (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). The total length of the \u003cem\u003eChCDO\u003c/em\u003e cDNA was 1402 bp (NCBI login number: OP792984), including a 5' UTR of 196 bp, 3' UTR of 705 bp, and ORF of 501 bp, encoding a total of 166 amino acids (Fig. \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e). The relative molecular weight of the protein was 19.04 KDa, with an isoelectric point of 6.41. The predicted conserved domain in the \u003cem\u003eChCDO\u003c/em\u003e protein was a CDOI domain (1\u0026ndash;140) (Fig. S4)\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eHomology and phylogenetic analysis of ChCSAD and ChCDO\u003c/h2\u003e \u003cp\u003eAlignment of the amino acid sequences of ChGSAD and ChCDO in \u003cem\u003eC. hongkongensis\u003c/em\u003e with those of \u003cem\u003eC. gigas\u003c/em\u003e, \u003cem\u003eC. virginica\u003c/em\u003e, and \u003cem\u003eC. angulata\u003c/em\u003e revealed high amino acid conservation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The phylogenetic tree showed that ChCSAD and ChCDO in \u003cem\u003eC. hongkongensis\u003c/em\u003e were closely related to those in other invertebrates such as \u003cem\u003eC. gigas\u003c/em\u003e and \u003cem\u003eC. angulata\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eBetaine and taurine contents and key gene expression in different tissues\u003c/h2\u003e \u003cp\u003eThe highest betaine content in \u003cem\u003eC. hongkongensis\u003c/em\u003e was found in the digestive gland (827.51 \u0026micro;g/g), and this amount was significantly higher than that in other tissues (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). \u003cem\u003eChCDH\u003c/em\u003e and \u003cem\u003eChBADH\u003c/em\u003e were expressed at the highest levels in the adductor muscle (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), whereas \u003cem\u003eChBHMT\u003c/em\u003e was expressed in the digestive gland (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e3\u003c/span\u003eb\u0026ndash;d). Taurine content was the highest in the digestive gland (970.81 \u0026micro;g/g), and this amount was significantly higher than that in other tissues (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). The expression of \u003cem\u003eChCSAD\u003c/em\u003e reached its highest level in the digestive gland (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), whereas \u003cem\u003eChCDO\u003c/em\u003e was highest in the adductor muscle and digestive gland (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eb\u0026ndash;c).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eBetaine and taurine contents and key gene expression in different months\u003c/h2\u003e \u003cp\u003eBetaine content in \u003cem\u003eC. hongkongensis\u003c/em\u003e steadily increased from 754.08 \u0026micro;g/g in February to a peak of 999.25 \u0026micro;g/g in April, then rapidly dropped to the lowest level of 743.01 \u0026micro;g/g in December (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). Expression of \u003cem\u003eChCDH\u003c/em\u003e was high from January to February, significantly decreased from February to March and remained low from March to November. Expression of \u003cem\u003eChBADH\u003c/em\u003e was high from January to April, decreased significantly from April to June and remained low from June to November. \u003cem\u003eChBHMT\u003c/em\u003e expression was significantly higher in January than in the other months (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and remained low after a significant decrease in February (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e5\u003c/span\u003eb\u0026ndash;d).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTaurine and betaine contents showed a similar trend, with taurine content increasing from February to April and reaching its highest value of 852.32 \u0026micro;g/g in April. From June to December, taurine showed a decreasing trend and dropped to its lowest value of 666.75 \u0026micro;g/g in November (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). \u003cem\u003eChCSAD\u003c/em\u003e and \u003cem\u003eChCDO\u003c/em\u003e expression levels gradually increased from January, reaching their highest levels in April and March, respectively, and then gradually decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e6\u003c/span\u003eb\u0026ndash;c).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eCharacteristics of betaine and taurine content in association analysis population\u003c/h2\u003e \u003cp\u003eThe taurine content of the experimental individuals ranged from 779.46\u0026ndash;957.30 \u0026micro;g/g (Fig. S5a), with an average of 862.95\u0026thinsp;\u0026plusmn;\u0026thinsp;51.42 \u0026micro;g/g and a coefficient of variation (CV) of 5.96%; The betaine content of the experimental individuals ranged from 809.69-1036.57 \u0026micro;g/g (Fig. S5b), with an average of 911.02\u0026thinsp;\u0026plusmn;\u0026thinsp;67.18 \u0026micro;g/g and a coefficient of variation (CV) of 7.37%. There is significant variation in the content of taurine and betaine, which follows a normal distribution (\u003cem\u003eP\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/em\u003e) and is suitable for conducting association analysis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eSNPs in the coding regions of key genes\u003c/h2\u003e \u003cp\u003eUsing gene fragment cloning, Sanger sequencing, and multi-sequence alignment, 107 candidate SNPs were predicted for \u003cem\u003eChCSAD\u003c/em\u003e, \u003cem\u003eChCDO\u003c/em\u003e, \u003cem\u003eChBADH\u003c/em\u003e, \u003cem\u003eChCDH\u003c/em\u003e, and \u003cem\u003eChBHMT\u003c/em\u003e. A total of 107 sets of primers were designed, and 47 SNP loci were validated, all of which were successfully genotyped in the experimental population (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e7\u003c/span\u003e). The number of SNPs for each gene is shown in Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e, and information on the 47 validated SNP loci is shown in Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eSNPs associated with betaine and taurine contents\u003c/h2\u003e \u003cp\u003eNine SNPs were significantly correlated with taurine content (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and one SNP was significantly correlated with betaine content (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Among them, three SNPs caused coding amino acid changes. SNP \u003cem\u003eChCDO\u003c/em\u003e-46 changed lysine (Lys) to glutamate (Glu), \u003cem\u003eChCDO\u003c/em\u003e-394 changed threonine (Thr) to serine (Ser), and \u003cem\u003eChCDH\u003c/em\u003e-1585 changed asparagine (Asn) to aspartate (Asp) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSNPs associated with taurine and betaine contents\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNumber\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSNPs\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGenotype\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eContent (\u0026micro;g/g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e-value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAssociated trait\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eChCDO\u003c/em\u003e-46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e873.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.004\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003etaurine\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e843.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eChCDO\u003c/em\u003e-252\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e872.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"1\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e0.010\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003etaurine\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e845.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eChCDO\u003c/em\u003e-375\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e873.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.027\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003etaurine\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e845.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e846.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eChCDO\u003c/em\u003e-384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e872.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.025\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003etaurine\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e844.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e882.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eChCDO\u003c/em\u003e-387\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e872.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e846.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.038\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003etaurine\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e846.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eChCDO\u003c/em\u003e-393\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e872.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.038\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003etaurine\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e846.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e846.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eChCDO\u003c/em\u003e-394\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e872.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.029\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003etaurine\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e844.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e872.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eChCDO\u003c/em\u003e-417\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e872.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Tabb\" border=\"1\"\u003e \u003ccolgroup cols=\"1\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e0.009\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003etaurine\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e843.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eChCDO\u003c/em\u003e-423\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e872.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.017\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003etaurine\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e843.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e930.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eChCDH\u003c/em\u003e-1585\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eG/G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e905.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.017\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ebetaine\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eA/G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e838.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eInformation on non-synonymous mutation SNPs\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSNPs\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNucleotide variant\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAmino acid variant\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eChCDO\u003c/em\u003e-46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA\u0026rarr;G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLys\u0026rarr;Glu\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eChCDO-394\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA\u0026rarr;T\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eThr\u0026rarr;Ser\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eChCDH-1585\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA\u0026rarr;G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAsn\u0026rarr;Asp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eHaplotype and linkage analysis\u003c/h2\u003e \u003cp\u003eAmong the nine SNPs associated with taurine content, five (\u003cem\u003eChCDO\u003c/em\u003e-387, \u003cem\u003eChCDO\u003c/em\u003e-393, \u003cem\u003eChCDO\u003c/em\u003e-394, \u003cem\u003eChCDO\u003c/em\u003e-417, \u003cem\u003eChCDO\u003c/em\u003e-423) formed a linkage group and three haplotypes (Fig.\u0026nbsp;\u003cspan refid=\"Fig13\" class=\"InternalRef\"\u003e8\u003c/span\u003e), ACACA, GTTTG, and GTACA, with haplotype frequencies of 0.781, 0.176, and 0.033, respectively. Among them, the GTACA haplotype had a significant advantage in taurine content (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eResults of the haplotype analysis\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHaplotype\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCDO 387\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCDO 393\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCDO 394\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCDO 417\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCDO 423\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFrequency\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eTaurine content (\u0026micro;g/g)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eH1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.781\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e873.88\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eH2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.176\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e838.99\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eH3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.033\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e930.72\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003e \u003cb\u003eCharacteristics of betaine and taurine content and key gene expression in\u003c/b\u003e \u003cb\u003eC. hongkongensis\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn this study, we found that betaine content in the digestive glands of \u003cem\u003eC. hongkongensis\u003c/em\u003e was the highest among all tissues (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). We speculate that the digestive gland is the energy and fat storage organ, as well as food digestive organ, and the main site of betaine synthesis in oysters [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. \u003cem\u003eChCDH\u003c/em\u003e and \u003cem\u003eChBHMT\u003c/em\u003e are highly expressed in the digestive gland and adductor muscles, whereas \u003cem\u003eChBADH\u003c/em\u003e is highly expressed in adductor muscles. The adductor muscle is an important component of oyster muscles, and it plays an important role in energy storage, metabolism, and other life processes. The adductor muscle of purple-shelled clams synthesizes betaine from choline, and we speculate that it has the same function as the oyster adductor muscle [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. As a filter-feeding animal, \u003cem\u003eC. hongkongensis\u003c/em\u003e mainly filters and feeds on planktonic algae and organic debris to meet its energy needs. The digestive gland is an important organ that participates in oyster lipid and carbohydrate metabolism [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe highest taurine content was found in the digestive gland, suggesting that the digestive glands of oysters have functions similar to those of the livers of higher animals, and that it is the main organ for synthesizing taurine [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. \u003cem\u003eChCSAD\u003c/em\u003e is expressed most highly in the digestive gland, suggesting that \u003cem\u003eChCSAD\u003c/em\u003e is a key gene involved in the synthesis of taurine in oysters, and that the digestive gland is the main organ for taurine synthesis in oysters. Chen et al. [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] found that CSAD was widely expressed in all tissues of razor clams, with the highest expression in the liver. \u003cem\u003eChCDO\u003c/em\u003e is highly expressed in the adductor muscle, possibly due to its indirect involvement in the regulation of taurine osmotic pressure in oysters, with the adductor muscle serving as the main site for taurine metabolism and accumulation during salinity adaptation. As early as 1966, Lynch [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] found significant changes in the contents of taurine, alanine, glycine, and proline in the shell-closing muscle of American oysters with changes in salinity.\u003c/p\u003e \u003cp\u003e \u003cb\u003eFactors affecting betaine and taurine content and gene expression in\u003c/b\u003e \u003cb\u003eC. hongkongensis\u003c/b\u003e\u003c/p\u003e \u003cp\u003eBetaine is a buffering substance for osmotic pressure fluctuations that can enhance the tolerance of biological cells to high salt and high osmotic environments and increase the tolerance of aquatic animals to osmotic pressure fluctuations [\u003cspan additionalcitationids=\"CR30\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Free amino acids (FAA) have also been shown to play a major role in regulating intracellular osmotic pressure and cell volume [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Taurine, one of the main free amino acids in shellfish, plays an important role in maintaining osmotic pressure in oysters. When salinity decreases, oysters release large amounts of taurine to adapt to low-osmotic environments. Conversely, taurine accumulates in and adapts to highly osmotic environments [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. In our study, we found that the levels of betaine and taurine in \u003cem\u003eC. hongkongensis\u003c/em\u003e reached their highest levels in April, possibly because of an increase in salinity caused by high temperatures and low rainfall in Guangxi in April. Taurine and betaine contents showed a downward trend from June to December, which may have been due to increased rainfall after May that continued until October, resulting in a decrease in seawater salinity. Lin et al. [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] also found that betaine content in oysters changes when exposed to changes in external salinity. Taurine also participates in osmotic regulation to reduce the damage to oysters caused by changes in environmental salinity. Huang et al. [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e] found that the taurine content of oysters in high-salinity waters was higher than that in low-salinity waters. The present study also found that the levels of betaine and taurine in oysters changed with changes in seawater salinity, further indicating that betaine and taurine may be involved in osmotic pressure regulation in oysters.\u003c/p\u003e \u003cp\u003e\u003cem\u003eChBADH\u003c/em\u003e, \u003cem\u003eChCDH\u003c/em\u003e, and \u003cem\u003eChBHMT\u003c/em\u003e are the key enzymes involved in the synthesis and decomposition of betaine in oysters. \u003cem\u003eChBADH\u003c/em\u003e and \u003cem\u003eChCDH\u003c/em\u003e levels were high from January to April and from January to February, respectively. Other researchers have proposed that when oysters are subjected to external salinity stress, the expression levels of \u003cem\u003eChBADH\u003c/em\u003e and \u003cem\u003eChCDH\u003c/em\u003e increase, and betaine content increases accordingly [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. \u003cem\u003eChCDH\u003c/em\u003e only remained at a high level from January to February, possibly because of its role as a pre-catalytic enzyme in the betaine synthesis pathway, and because its expression time was earlier than that of \u003cem\u003eChBADH\u003c/em\u003e [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. The expression level of \u003cem\u003eChBHMT\u003c/em\u003e was high in January, possibly because of the continuous increase in salinity in the Maowei Sea of Guangxi in that mongth. Under high salt stress, \u003cem\u003eChBHMT\u003c/em\u003e expression decreases in oysters to maintain the corresponding osmotic pressure. In recent years, BHMT has been reported to maintain the osmotic pressure balance in various aquatic animals such as \u003cem\u003eApostichopus japonicus\u003c/em\u003e [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] and \u003cem\u003eAtlantic salmon\u003c/em\u003e [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. In our study, taurine content was the highest in April, and the expression of \u003cem\u003eChCDO\u003c/em\u003e and \u003cem\u003eChCSAD\u003c/em\u003e reached their highest levels in March and April, respectively. At this time, salinity was also at its highest level, indicating that oysters can improve the efficiency of taurine synthesis and adaptively compensate for high osmotic pressure. This indirectly suggests that \u003cem\u003eChCDO\u003c/em\u003e and \u003cem\u003eChCSAD\u003c/em\u003e are involved in the regulation of osmotic pressure in \u003cem\u003eC. hongkongensis\u003c/em\u003e [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. The expression of \u003cem\u003eChCDO\u003c/em\u003e peaked before that of \u003cem\u003eChCSAD\u003c/em\u003e, which may be because the former is an upstream regulatory factor in the taurine synthesis pathway.\u003c/p\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eCoding region SNPs and development efficiency\u003c/h2\u003e \u003cp\u003eApproximately 90% of the mutations in DNA sequences are single-base mutations, which contribute to the rich genetic diversity of organisms [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Genetic diversity is beneficial for the environmental adaptability and selective breeding of species. Most SNPs are located in the non-coding regions of the genome and play important roles in population genetics and evolutionary research [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], whereas SNP loci in the coding region have high genetic stability [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. In this study, 107 SNP loci were detected in five key gene-coding regions of \u003cem\u003eC. hongkongensis\u003c/em\u003e, and 47 SNP markers were successfully developed using FLDAS-PCR and polyacrylamide gel technology. The success rate of SNP development was 43.9% (47/107). The success rate of SNP development using high resolution melting (HRM) technology for \u003cem\u003eC. gigas\u003c/em\u003e glycogen phosphorylase was 33.3% (14/42) [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e], reflecting the relatively high success rate of FLDAS-PCR technology in SNP development. However, FLDAS-PCR technology has low throughput and is not suitable for large-scale SNP detection and development.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eCorrelations between SNPs and trait content\u003c/h2\u003e \u003cp\u003eSNP sites with synonymous mutations do not alter the encoded amino acid sequence, but synonymous mutations can affect phenotypes by altering mRNA secondary structure stability, translation efficiency, and protein folding [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Non-synonymous mutations are single-nucleotide mutations that cause changes in amino acid sequences and that are likely to affect DNA transcription and subsequent translation processes, thereby affecting the structure and function of proteins. These are known as functional SNPs [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. In this study, we identified nine SNP sites associated with taurine content in the \u003cem\u003eChCDO\u003c/em\u003e coding region of \u003cem\u003eC. hongkongensis\u003c/em\u003e. \u003cem\u003eChCDO\u003c/em\u003e-46 and \u003cem\u003eChCDO\u003c/em\u003e-394 are non-synonymous mutations that cause amino acids changes from lysine to glutamate and from threonine to serine, respectively. Only one SNP, \u003cem\u003eChCDH\u003c/em\u003e-1585, was found to be associated with betaine content in the \u003cem\u003eChCDH\u003c/em\u003e coding region of \u003cem\u003eC. hongkongensis\u003c/em\u003e. This is a non-synonymous mutation that causes an asparagine-to-aspartate change. Haploid-level analysis is considered more robust than single-marker allele-level analysis [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e], and haplotype linkage disequilibrium and taurine association analyses can better illustrate the correlation between SNPs and taurine content. The results of this study showed that the five SNP loci that were significantly associated with taurine content formed a linkage group and resulted in three haplotypes, among which the GTACA haplotype had a significant advantage in taurine content.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn this study, we cloned the full-length cDNA of \u003cem\u003eChCDO\u003c/em\u003e and \u003cem\u003eChCSAD\u003c/em\u003e, which are key genes involved in taurine metabolism in \u003cem\u003eC. hongkongensis\u003c/em\u003e, and found that betaine and taurine contents and the expression of key genes were regulated by seawater salinity. Using Sanger sequencing and multiple sequence alignment, 107 candidate SNPs were predicted in the coding regions of the key genes involved in betaine and taurine metabolism in \u003cem\u003eC. hongkongensis\u003c/em\u003e, including \u003cem\u003eChCDH\u003c/em\u003e, \u003cem\u003eChBADH\u003c/em\u003e, \u003cem\u003eChBHMT\u003c/em\u003e, \u003cem\u003eChCDO\u003c/em\u003e, and \u003cem\u003eChCSAD\u003c/em\u003e. Forty-seven SNPs were successfully validated and genotyped using FLDAS-PCR and gene fragment resequencing. Nine SNPs were associated with taurine content in the \u003cem\u003eChCDO\u003c/em\u003e coding region (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and one SNP was associated with betaine content in the \u003cem\u003eChCDH\u003c/em\u003e coding region (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The results of linkage disequilibrium analysis showed that the five SNPs in the coding region of \u003cem\u003eChCDO\u003c/em\u003e form a linkage group and result in three haplotypes, among which the haplotype GTACA has a significant advantage. These loci and haplotypes can serve as potential molecular markers for the molecular breeding of \u003cem\u003eC. hongkongensis\u003c/em\u003e.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eANOVA, analysis of variance; BADH, betaine aldehyde dehydrogenase; BHMT, betaine homocysteine methyltransferase; CDH, choline dehydrogenase; CDO, cysteine dioxygenase; CSA, cysteine sulfite; CSAD, cysteine sulfinic acid decarboxylase; ELISA, enzyme-linked immunosorbent assay; FLDAS-PCR, fragment length discrepant allele specific PCR; HRM, high resolution melting; ORF, open reading frame; UTR, untranslated region\u003c/p\u003e\n"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo;contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design. Experiment design, methodology, and Resources were performed by Z.S. Y.X., P.Z., L.K. performed the investigation and gene expression analysis. Material preparation was performed by Z.C., Z.J. and Q.D. The draft of the manuscript was written by L.K., and all authors reviewed the manuscript. All authors read and approved the final. manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Natural Science Foundation of Guangxi (No. 2023GXNSFAA026503), the Guangxi Key Research and Development Program (2023AB17105), the Marine Science Guangxi First-Class Subject, Beibu Gulf University (No. DRC002), the Counterpart Aid Project for Discipline Construction from Guangxi University (Grant No. 2023B03), and the Scientific Research and Technology Development Plan Project of Qinzhou (No. 20223637).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated during this study or analysis are included in the published articles, sequence data is available in the NCBI GenBank database (https://www.ncbi.nlm.nih.gov/genbank/) under accession number OP792983 and OP792984.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe oysters used in this study were marine-cultured animals, and all experiments were conducted according to the regulations established by the local and central government. No specific permissions were required to collect oysters or conduct the experiments described.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGuangxi Key Laboratory of Beibu Gulf Marine Biodiversity Conservation, Pinglu Canal and Beibu Gulf Coastal Ecosystem Observation and Research Station of Guangxi, College of Marine Sciences, Beibu Gulf University, Qinzhou 535011, China\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eGormley TR, Neumann T, Fagan JD, Brunton NP. Taurine content of raw and processed fish fillets/portions. Eur Food Res Technol. 2007;225(5):837-842. https://doi.org/10.1007/s00217-006-0489-4.\u003c/li\u003e\n\u003cli\u003ePinto W, R\u0026oslash;nnestad I, Jordal AO, Gomes AS, Dinis MT, Arag\u0026atilde;o C. Cloning, tissue and ontogenetic expression of the taurine transporter in the flatfish Senegalese sole (Solea senegalensis). Amino Acids. 2012;42(4):1317-1327. https://doi.org/10.1007/s00726-010-0826-6.\u003c/li\u003e\n\u003cli\u003eChesney RW. Taurine: Its Biological Role and Clinical Implications. Adv Pediatr. 1985;32(1):1-42.\u003c/li\u003e\n\u003cli\u003eStapleton PP, Charles RP, Redmond HP, Bouchier-Hayes DJ. Taurine and human nutrition. Clin Nutr. 1997;16(3):103-108. https://doi.org/10.1016/S0261-5614(97)80234-8.\u003c/li\u003e\n\u003cli\u003eMinistry of Agriculture and Rural Affairs of the People\u0026rsquo;s Republic of China, National Fisheries Technology Extension Center, \u0026amp; China Society of Fisheries. China Fishery Statistical Yearbook. China Agriculture Press. 2021;pp:1-144.\u003c/li\u003e\n\u003cli\u003eFuke S, Konosu S. Taste-active components in some foods: A review of Japanese research. Physiol Behav.1991;49(5):863-868. https://doi.org/10.1016/0031-9384(91)90195-T.\u003c/li\u003e\n\u003cli\u003eKonosu TH. Determination of \u0026beta;-alanine betaine and glycine betaine in some marine invertebrates. Bull Jan Soc Sci Fish. 1975;41: 743-746. https://doi.org/10.2331/suisan.41.743.\u003c/li\u003e\n\u003cli\u003eAbdel-Tawwab M, Monier MN. Stimulatory effect of dietary taurine on growth performance, digestive enzymes activity, antioxidant capacity, and tolerance of common carp, \u003cem\u003eCyprinus carpio\u003c/em\u003e L., fry to salinity stress. Fish Physiol Biochem. 2018;\u003cem\u003e \u003c/em\u003e44(2):639-649. https://doi.org/10.1007/s10695-017-0459-8.\u003c/li\u003e\n\u003cli\u003eFeng Y, Xu HJ., Liu D, Chen ZT, Xu JF, Zhi R, Li XG. Application of betaine in aquatic animal production. Feed Review. 2013;(08):38-40. https://doi.org/10.3969/j.issn.1001-0084.2013.08.010.\u003c/li\u003e\n\u003cli\u003ePierce SK, Rowland-Faux LM, Crombie BN. The mechanism of glycine betaine regulation in response to hyperosmotic stress in oyster mitochondria: A comparative study of Atlantic and Chesapeake Bay oysters. J Exp Zool. 1995;271(3):161-170. https://doi.org/10.1002/jez.1402710302.\u003c/li\u003e\n\u003cli\u003eSong X, L\u0026uuml; W, Ibrahim S, Deng Y, Li Q, Yue C. Identification of free amino acids (FAA) that are important as major intracellular osmolytes in the estuarine Hong Kong oyster, Crassostrea hongkongensis. Aquacult rep. 2023;28:101464. https://doi.org/10.1016/j.aqrep.2023.101464.\u003c/li\u003e\n\u003cli\u003eZhao X, Li Q, Meng Q, Yue C, Xu C. Identification and expression of cysteine sulfinate decarboxylase, possible regulation of taurine biosynthesis in Crassostrea gigas in response to low salinity. Sci Rep. 2017;7(1):5505. https://doi.org/10.1038/s41598-017-05852-6.\u003c/li\u003e\n\u003cli\u003eWelborn JR, Manahan DT. Taurine Metabolism In Larvae Of Marine Molluscs (Bivalvia, Gastropoda). J Exp Biol. 1995;198(8):1791-1799. https://doi.org/10.1242/jeb.198.8.1791.\u003c/li\u003e\n\u003cli\u003eMeng J, Zhu Q, Zhang L, Li C, Li L, She Z, Huang B, Zhang G. Genome and transcriptome analyses provide insight into the euryhaline adaptation mechanism of \u003cem\u003eCrassostrea gigas\u003c/em\u003e. Plos One. 2013;8(3):e58563. https://doi.org/10.1371/journal.pone.0058563.\u003c/li\u003e\n\u003cli\u003eNagasaki T, Hongo Y, Koito T, Nakamura-Kusakabe I, Shimamura S, Takaki Y, Yoshida T, Maruyama T, Inoue K. Cysteine dioxygenase and cysteine sulfinate decarboxylase genes of the deep-sea mussel Bathymodiolus septemdierum: possible involvement in hypotaurine synthesis and adaptation to hydrogen sulfide. Amino Acids. 2015;47(3):571-578. https://doi.org/10.1007/s00726-014-1891-z.\u003c/li\u003e\n\u003cli\u003eFan XG, Zhang T, Li J, Han HJ, Gao LD, Zhang ST, Chen N. Betaine metabolism in microorganism and its application. Bull ferment sci technol. 2018;47(03):151-156. https://doi.org/10.16774/j.cnki.issn.1674-2214.2018.03.006.\u003c/li\u003e\n\u003cli\u003eKidd MT, Ferket PR, Garlich JD. Nutritional and osmoregulatory functions of betaine. Worlds Poult Sci J. 1997;53(2):125-139. https://doi.org/10.1079/WPS19970013.\u003c/li\u003e\n\u003cli\u003eSakamoto A, Nishimura Y, Ono H, Sakura N. Betaine and homocysteine concentrations in foods. Pediatr Int. 2002;44(4):409-413. https://doi.org/10.1046/j.1442-200X.2002.01591.x1.\u003c/li\u003e\n\u003cli\u003eVeeranki S, Tyagi SC. Defective Homocysteine Metabolism: Potential Implications for Skeletal Muscle Malfunction.Int J Mol Sci. 2013;14(7):15074-15091. https://doi.org/10.3390/ijms140715074.\u003c/li\u003e\n\u003cli\u003eDelgado-Gayt\u0026aacute;n MF, G\u0026oacute;mez-Jim\u0026eacute;nez S, G\u0026aacute;mez-Alejo LA, Rosas-Rodr\u0026iacute;guez JA, Figueroa-Soto CG, Valenzuela-Soto EM. Effect of salinity on the synthesis and concentration of glycine betaine in osmoregulatory tissues from juvenile shrimps Litopenaeus vannamei. Comp Biochem Physiol A Mol Integr Physiol. 2020;240:110628. https://doi.org/10.1016/j.cbpa.2019.110628.\u003c/li\u003e\n\u003cli\u003eJahn MP, Cavagni GM, Kaiser D, Kucharski LC. Osmotic effect of choline and glycine betaine on the gills and hepatopancreas of the Chasmagnathus granulata crab submitted to hyperosmotic stress. J Exp Mar Biol Ecol. 2006;334(1):1-9. https://doi.org/10.1016/j.jembe.2006.01.006.\u003c/li\u003e\n\u003cli\u003eShi R, Li C, Qi H, Liu S, Wang W, Li L, Zhang G. Construction of a high-resolution genetic map of Crassostrea gigas: QTL mapping and GWAS applications revealed candidate genes controlling nutritional traits. Aquaculture. 2020;527:735427. https://doi.org/10.1016/j.aquaculture.2020.735427.\u003c/li\u003e\n\u003cli\u003eQian YX, Song JJ. Effects of salinity and betaine on bhmt mrna expression in Lateolabrax japonicus. Zool Res. 2011;32(3):277-284. https://doi.org/10.3724/SP.J.1141.2011.03277.\u003c/li\u003e\n\u003cli\u003eDe Vooys CGN, Geenevasen JAJ. Biosynthesis and role in osmoregulation of glycine-betaine in the Mediterranean mussel Mytilus galloprovincialis LMK. Comp Biochem Physiol B Biochem Mol Biol. 2002;132(2):409-414. https://doi.org/10.1016/S1096-4959(02)00052-0.\u003c/li\u003e\n\u003cli\u003eYepiz-Plascencia G, Galv\u0026aacute;n TG, Vargas-Albores F, Garc\u0026iacute;a-Ba\u0026ntilde;uelos M. Synthesis of Hemolymph High-Density Lipoprotein \u0026beta;-Glucan Binding Protein by Penaeus vannamei Shrimp Hepatopancreas. Mar Biotechnol(NY). 2000;2(5):485-492. https://doi.org/10.1007/s101260000030.\u003c/li\u003e\n\u003cli\u003eLi XJ, Tang JZ, Song P, Wu Q, Ju FF, Liu Z, Lu SQ. Molecular cloning and expression of casd in \u003cem\u003eCarassius auratus\u003c/em\u003e. Ocean Et Limnol Sin. 2018;49(01):134-141.\u003c/li\u003e\n\u003cli\u003eChen YH , Deng M, Dong ZG, Li YF, Niu DH. Function of taurine and its synthesis-related genes in hypertonic regulation of Sinonovacula constricta. Comp Biochem Physiol A Mol Integr Physiol. 2024;287:111536. https://doi.org/10.1016/j.cbpa.2023.111536.\u003c/li\u003e\n\u003cli\u003eLynch MP. Effects of environmental salinity of free amino acids of Crassostrea virginica gmelin. Comp Biochem Physiol. 1966;19(4):783-790. https://doi.org/10.1016/0010-406X(66)90434-81.\u003c/li\u003e\n\u003cli\u003eImbard A, Benoist J, Esse R, Gupta S, Lebon S, de Vriese AS, de Baulny HO, Kruger W, Schiff M, Blom HJ. High homocysteine induces betaine depletion. Bioscience rep. 2015;35(4):e222. https://doi.org/10.1042/BSR20150094.\u003c/li\u003e\n\u003cli\u003eLu J, Luo S, Jin T, Wang L, Yang G, Lu X, Chen J. Betaine protects ayu (\u003cem\u003ePlecoglossus altivelis\u003c/em\u003e) against \u003cem\u003eVibrio anguillarum\u003c/em\u003e infection in salinity by regulating the immunomodulatory activity of monocytes/macrophages. Aquaculture.2021;536:736482. https://doi.org/10.1016/j.aquaculture.2021.736482.\u003c/li\u003e\n\u003cli\u003eSafi A, Akrami R. Effect of betaine as a feed Atractant on growth, survival and resistance to heat and salinity stressors on wild Common carp (Cyprinus carpio) juvenile. 2013;15-24.\u003c/li\u003e\n\u003cli\u003ePourmozaffar S, Tamadoni Jahromi S, Rameshi H, Sadeghi A, Bagheri T, Behzadi S, Gozari M, Zahedi MR, Abrari Lazarjani S. The role of salinity in physiological responses of bivalves. Rev Aquacult. 2020;12(3):1548-1566. https://doi.org/10.1111/raq.123971.\u003c/li\u003e\n\u003cli\u003eSokolov EP, Sokolova IM. Compatible osmolytes modulate mitochondrial function in a marine osmoconformer Crassostrea gigas (Thunberg, 1793). Mitochondrion. 2019;45:29-37. https://doi.org/10.1016/j.mito.2018.02.002.\u003c/li\u003e\n\u003cli\u003eLin HS, Qin XM, Zhang CH, Huang YQ, Gao JL, Liu LL, Luo B, Yang FM. Comparative analysis of nutritional components and flavor characteristics of cultivated oyster from different coastal areas of china. South China Fisher Sci. 2019;15(2): 110-120. https://doi.org/10.1046/j.1442-200X.2002.01591.x.\u003c/li\u003e\n\u003cli\u003eHuang YQ, Yang FM, Qin XM, Zhang CH, Lin HS, Gao JL. Chemical composition and characteristic odorans of oyster (Crassostrea hongkongensis) from different culture areas. Food Sci. 2019;40(14):236-242. https://doi.org/10.7506/spkx1002-6630-20180822-239.\u003c/li\u003e\n\u003cli\u003eRosas-Rodr\u0026iacute;guez JA, So\u0026ntilde;anez-Organis JG, Miranda-Cruz MM, Poom-Llamas JJ, Stephens-Camacho N, Adan-Bante NP. Betaine aldehyde dehydrogenase is regulated during wssv infection in white shrimp. Isj-Invert Surviv J. 2019;16:113-119. https://doi.org/10.25431/1824-307X/isj.v0i0.113-119.\u003c/li\u003e\n\u003cli\u003eZhao Y, Bu SY, Wang H, Cui H, Hao ZJ, Xu RR, Li SH, Cheng YQ, Ma T. Cloning of Betaine Homocysteine Methyltransferase 1 (bhmt1) Gene from Apostichopus japonicus and Its Expression Pattern under Low Salinity Stress. J of Yantai Univ.(Nat Sci Eng Ed).2022;35(04):434-442. https://doi.org/10.13951/j.cnki.37-1213/n.210712.\u003c/li\u003e\n\u003cli\u003eKwasek K, Terova G, Lee B, Bossi E, Saroglia M, Dabrowski K. Dietary methionine supplementation alters the expression of genes involved in methionine metabolism in salmonids. Aquaculture. 2014;433:223-228. https://doi.org/10.1016/j.aquaculture.2014.05.031.\u003c/li\u003e\n\u003cli\u003eZhao X, Li Q, Meng Q, Yue C, Xu C. Identification and expression of cysteine sulfinate decarboxylase, possible regulation of taurine biosynthesis in Crassostrea gigas in response to low salinity. Sci Rep. 2017;7(1):5505. https://doi.org/10.1038/s41598-017-05852-6.\u003c/li\u003e\n\u003cli\u003eCollins FS, Brooks LD, Chakravarti A. A DNA polymorphism discovery resource for research on human genetic variation. Genome Res. 1998;8(12):1229-1231. https://doi.org/10.1101/gr.8.12.1229.\u003c/li\u003e\n\u003cli\u003eOru\u0026ccedil; \u0026Ouml;E, Dursun \u0026Ouml;. An application of information theoretical measures for DNA structure. Turkiye Klin J Biostat. 2011;3(1):1-7.\u003c/li\u003e\n\u003cli\u003eFiume E, Christou P, Gian\u0026igrave; S, Breviario D. Introns are key regulatory elements of rice tubulin expression. Planta. 2004;218(5):693-703. https://doi.org/10.1007/s00425-003-1150-0.\u003c/li\u003e\n\u003cli\u003eTang LQ, Xiao CL, Wang WP. 2012. Research and application progress of snp markers. Chinese Agric Sci Bull. 2012;28(12):154-158. https://doi.org/10.3969/j.issn.1000-6850.2012.12.028.\u003c/li\u003e\n\u003cli\u003eShe Z, Li L, Qi H, Song K, Que H, Zhang G. Candidate Gene Polymorphisms and their Association with Glycogen Content in the Pacific Oyster Crassostrea gigas. Plos One. 2015;10(5):e124401. https://doi.org/10.1371/journal.pone.0124401.\u003c/li\u003e\n\u003cli\u003eCartegni L, Chew SL, Krainer AR. Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat Rev Genet. 2002;3(4):285-298. https://doi.org/10.1038/nrg775.\u003c/li\u003e\n\u003cli\u003eRothschild MF, Messer LA, Vincent A. Molecular approaches to improved pig fertility. J Reprod Fertil Suppl. 1997;(52):227-236.\u003c/li\u003e\n\u003cli\u003eClark AG. The role of haplotypes in candidate gene studies. Genet Epidemiol. 2004;\u003cem\u003e \u003c/em\u003e27(4):321-333. https://doi.org/10.1002/gepi.20025.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"gics","sideBox":"Learn more about [BMC Genomics](http://bmcgenomics.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/gics","title":"BMC Genomics","twitterHandle":"#BMCGenomics","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Crassostrea hongkongensis, taurine, betaine, SNP, association analysis","lastPublishedDoi":"10.21203/rs.3.rs-5097219/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5097219/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTaurine and betaine are important nutrients in \u003cem\u003eCrassostrea hongkongensis\u003c/em\u003e and have many important biological properties. To investigate the characteristics of taurine and betaine contents and identify SNPs associated with traits in the \u003cem\u003eC.hongkongensis\u003c/em\u003e, we cloned the full-length cDNA of key genes in taurine and betaine (unpublished data) metabolism, determined taurine and betaine content and gene expression in different tissues and months of specimen collection, and developed SNPs in the gene coding region.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe cloned the full-length cDNA of cysteine dioxygenase (\u003cem\u003eChCDO\u003c/em\u003e) and cysteine sulfite decarboxylase (\u003cem\u003eChCSAD\u003c/em\u003e), which are key genes involved in taurine metabolism in \u003cem\u003eC. hongkongensis\u003c/em\u003e, and found that betaine and taurine contents and the expression of key genes were regulated by seawater salinity. A total of 47 SNP markers were developed in the coding regions of \u003cem\u003eChCSAD\u003c/em\u003e, \u003cem\u003eChCDO\u003c/em\u003e, \u003cem\u003eChCDH\u003c/em\u003e, \u003cem\u003eChBADH\u003c/em\u003e, and \u003cem\u003eChBHMT\u003c/em\u003e using gene fragment resequencing and FLDAS-PCR. Through association analysis in a population of \u003cem\u003eC. hongkongensis\u003c/em\u003e in the Maowei Sea, Guangxi, nine SNPs were found to be associated with taurine content, and one SNP was associated with betaine content. Haploid and linkage disequilibrium analyses showed that SNPs in \u003cem\u003eChCDO\u003c/em\u003e formed one linkage group with three haplotypes: ACACA, GTTTG, and GTACA. The average taurine content of the corresponding individuals was 873.88, 838.99, and 930.72 ng/g, respectively, indicating the GTACA haplotype has a significant advantage in terms of taurine content.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe identified SNPs associated with taurine and betaine contents in \u003cem\u003eC.hongkongensis\u003c/em\u003e for the first time, and found the GTACA haplotype in the \u003cem\u003eChCDO\u003c/em\u003e coding region has a significant advantage in taurine content. These loci and haplotypes can serve as potential molecular markers for the molecular breeding of \u003cem\u003eC. hongkongensis\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"Development of single nucleotide polymorphisms in key genes of taurine and betaine metabolism in Crassostrea hongkongensis and their association with content-related traits","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-12-18 12:05:09","doi":"10.21203/rs.3.rs-5097219/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-11-27T04:55:55+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-26T18:19:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"310625195498525003415538312087381741526","date":"2024-11-07T16:39:47+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-27T05:07:58+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"246619763163938725270273968544249338777","date":"2024-10-06T19:32:39+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"115439825813116272273808380363424467683","date":"2024-09-20T20:45:25+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-09-20T16:27:56+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-09-19T09:46:32+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-09-18T07:28:18+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-09-18T07:27:18+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Genomics","date":"2024-09-16T11:54:21+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"gics","sideBox":"Learn more about [BMC Genomics](http://bmcgenomics.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/gics","title":"BMC Genomics","twitterHandle":"#BMCGenomics","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a9012606-62de-482b-b10c-5170552e6e9a","owner":[],"postedDate":"December 18th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-03-03T16:02:05+00:00","versionOfRecord":{"articleIdentity":"rs-5097219","link":"https://doi.org/10.1186/s12864-025-11373-8","journal":{"identity":"bmc-genomics","isVorOnly":false,"title":"BMC Genomics"},"publishedOn":"2025-02-24 15:57:50","publishedOnDateReadable":"February 24th, 2025"},"versionCreatedAt":"2024-12-18 12:05:09","video":"","vorDoi":"10.1186/s12864-025-11373-8","vorDoiUrl":"https://doi.org/10.1186/s12864-025-11373-8","workflowStages":[]},"version":"v1","identity":"rs-5097219","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5097219","identity":"rs-5097219","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}