Phenotypic exploration of Mice with a Point Mutation in BRAT1

Phenotypic exploration of Mice with a Point Mutation in BRAT1 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Phenotypic exploration of Mice with a Point Mutation in BRAT1 Weijing Kong, Cheng Lu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6434862/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background BRAT1 (BRCA1-associated ataxia telangiectasia mutated activator 1) plays a crucial role in several vital biological processes, including the DNA damage response and the maintenance of mitochondrial homeostasis. Dysfunction in BRAT1 leads to a range of clinical phenotypes, with the majority of affected individuals succumbing before reaching one year of age. Results Through an analysis of previous literature, the homozygous BRAT1 p.V62E mutation (GTG to GAG) was selected to construct a mouse model. Homozygous BRAT1 p.V62E knock-in mice with a C57BL/6J background were generated using CRISPR/Cas9 technology, and the point mutation was confirmed by Sanger sequencing. The results revealed no significant differences between the mutant mice and wild-type controls during low-intensity testing. However, the mutant mice exhibited enhanced endurance during high-intensity testing. RNA sequencing analysis identified ten differentially expressed genes in the gastrocnemius muscle and four differentially expressed genes in the brain tissue of the mutant mice. Conclusions This represents the first successful construction of a BRAT1 mutant mouse model. This achievement not only provides confidence for developing additional mouse models but also offers a valuable perspective for understanding the relationship between BRAT1 and mitochondrial function. The mouse model demonstrates a degree of consistency with the clinical phenotypes observed in patients and may serve as a predictive tool for patient prognosis. Health sciences/Medical research/Experimental models of disease Health sciences/Medical research/Paediatric research BRAT1 mouse model mitochondria endurance Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction In 2006, Aglipay et al. identified a protein that interacts with both breast cancer 1 (BRCA1) and ataxia-telangiectasia mutated (ATM). They named this protein BAAT1 (BRCA1-associated protein required for ATM activation-1) [ 1 ]. Subsequently, the name BAAT1 was gradually replaced by BRAT1, which remains the currently accepted and widely used designation [ 2 – 4 ]. BRAT1 protein localizes to both nucleus and cytoplasm [ 1 ], suggesting its involvement in a wide range of functions. Numerous studies have reported various roles of BRAT1, including maintaining the phosphorylation level and activity of ATM [ 1 ], regulation of mTOR signaling [ 5 ], modulating glucose metabolism and mitochondrial function [ 6 ] and influencing neuronal differentiation through distinct trimeric complexes [ 7 ]. BRAT1 has long been considered as “undruggable”, but recent discoveries, such as the small molecule Curcusone D, have shown potential by associating with BRAT1 and reducing cancer cell migration [ 8 ]. These explorations, however, have been limited to the cellular level due to the absence of an appropriate animal model for BRAT1. As BRAT1 is recognized as a global regulator, the creation of a BRAT1 knockout mouse model was initially deemed unfeasible. In 2012, Puffenberger et al. described three patients exhibiting severe clinical features, including lethal multifocal seizures, hypertonia, microcephaly, apnea, and bradycardia. They subsequently named this condition Rigidity and Multifocal Seizure Syndrome, Lethal Neonatal (RMFSL) (OMIM #614498) [ 2 ]. Mutated BRAT1 (homozygous c.638_639insA) was identified in all three patients and confirmed to be pathogenic [ 2 ]. Additionally, cases with later onset and milder phenotypes associated with BRAT1 mutations have also been reported [ 9 – 11 ]. Our group provided quantitative data on the clinical phenotypes of BRAT1-related disease (BRD), offering a comprehensive overview of this condition. Among 50 patients with BRAT1 mutations, 31 (62%) had died. Of the 19 surviving patients, 11 (57.9%) were predicted to die before reaching 10 years of age [ 12 ]. Carapancea et al. reported 19 neonates with BRAT1 encephalopathy, all of whom died before reaching one year of age [ 13 ]. While point mutations in BRAT1 could theoretically serve as a basis for creating a mouse model, most point mutations are not suitable due to the associated clinical phenotype of early lethality. Based on our comprehensive understanding of BRDs, mice with the homozygous BRAT1 p.V62E (GTG to GAG) mutation emerged as a potential model for functional exploration of BRAT1. In this study, homozygous BRAT1 p.V62E (GTG to GAG) knock-in (KI) mice with C57BL/6J background were generated using CRISPR/Cas9 technology, and phenotypic investigations were conducted. To the best of our knowledge, this represents the first animal model developed for BRDs. Methods All experiments were conducted in compliance with the ethical guidelines of the International Association for the Study of Pain and were approved by the Institutional Animal Care and Use Committee at the Beijing Friendship Hospital (Beijing, China). The authors unequivocally affirmed that every experiment was rigorously conducted in strict compliance with all pertinent regulatory frameworks and ethical protocols, while also adhering meticulously to the ARRIVE guidelines. Mouse Model Generation: Wild-type (WT) mice with C57BL/6J background was offered by Cyagen Biosciences (www.cyagen.com). The mice were generated by Cyagen Biosciences using CRISPR/Cas9 technology. The KI pathogenic variant was introduced into exon 3 of BRAT1 using the following guide RNAs (gRNAs): gRNA1 (matches the forward strand): GTCCTGTGGCTTCAGCACAT GGG , and gRNA2 (matches the reverse strand): GTGGCTTCAGCACATGGGAC AGG . The p.V62E (GTG to GAG) mutation sites in donor oligo were introduced into exon 3 by homology-directed repair. Cas9 messenger RNA (mRNA), gRNA generated by in vitro transcription, and donor oligo were co-injected into fertilized eggs of C57BL/6J mouse to generate KI mouse production. Potential off-target sites were analyzed to ensure specificity. Off-target analysis for gRNA1 identified 10 sites, 9 of which were located within genes. The genes most likely to be affected by CRISPR/Cas9 manipulation include Gm47473, Klk1b24, Usp21, Iba57, Hunk, B130011K05Rik, Gm10252, and Gm47129. Similarly, off-target analysis for gRNA2 revealed 10 sites, all within genes. The genes with the highest probability of being affected are Gm47203, 2610035D17Rik, Gm12304, Gm31615, BX293558.1, Gm49978, Gldc, Gm37661, and Uri1. None of these genes are expected to contribute to BRD. Mice Maintenance: The animals were housed in a specific pathogen-free facility under controlled conditions, including a 12-hour light/dark cycle. The environment was maintained at a temperature of 20–26°C with a humidity level of 40–70%. All food, water, bedding, and other supplies introduced into the isolator were sterilized in advance to ensure a clean and controlled environment. Genotyping: The mice received from Cyagen were heterozygous for the KI mutation. DNA was extracted from mice tail with TaKaRa MiniBEST Universal Genomic DNA Extraction kit (Ver.5.0_Code No. 9765). Mice were genotyped by polymerase chain reaction (PCR) (F1: 5’-CTTAATCCTAAGGGGAAGGGATGTT-3’; R1: 5’-TTTCTAAGTAGGAGCAATGTGGGAT-3’; PCR product size: 409 bp) followed by Sanger sequencing analysis. The last generation was intercrossed to establish homozygous KI and WT (without a mutation) mice with identical background. WT mice were used as controls, whereas heterozygous mice were excluded. Treadmill running test: The ZH-PT/5S treadmill (Anhui Zhenghua Biologic) was utilized to assess endurance capacity. Training parameters (mice were acclimated to the device with three days): Tilt angle of the running platform: 0°; Electric shock intensity: 2.5 mA; Acceleration: 100 m/min². 1) First training session: The speed starts at 2 m/min and gradually increases to 10 m/min. 2) Second training session: The speed starts at 4 m/min and gradually increases to 12 m/min. 3) Third training session: The speed starts at 8 m/min and gradually increases to 14 m/min. After reaching the final speed in each training session, maintain it for 10 minutes. Mice quickly learn to avoid the shock grid during the acclimation period. Parameters for test 1 (Low intensity): Tilt angle of the running platform: 0 °; Electric shock intensity: 2.5mA; Speed: 15 m/min. The distance and time of the mouse's movement from the start until fatigue were recorded. Fatigue standard: the mouse remains consistently in the back one-third of the track; the running posture shifts from normal to a prone position; and rapid breathing is observed. Parameters for test 2 (High intensity): Tilt angle of the running platform: 15 °; Electric shock intensity: 2.5mA; Speed starts at 10 m/min and increases to 35 m/min within 10 min. Exhaustion standard: electrocuted 7 times within 15 seconds. Exhaustion time, distance, and the number of electric shocks were recorded. Rota-rod test: The accelerated rotarod test (Ugo Basile, Gemonio, Italy, model 47600) is a standard sensory-motor assessment used to evaluate animals' motor coordination and learning skills by measuring their ability to stay and run on an accelerating rod. The test was conducted over a duration of 2 minutes, with the rod accelerating from 0 to 40 rpm. The trial was stopped as soon as a mouse fell off the rod or began rotating with the rod without running. After an initial training trial, mice were tested in three trials over two days, with a 30-minute recovery period between trials. Open Field Test Exploratory activity and anxiety-like behavior were assessed using an open-field apparatus measuring 50 × 50 × 40 cm (Model: 1056306, Bai Zhong Biotechnology). Each mouse was placed in the center of the open-field apparatus, with the center zone defined as a 20 × 20 cm square. The total duration of the test was 5 minutes. Quantification of gait parameters Gait analysis was conducted using the MGT-PR Mouse Gait Behavior Analysis System (Anhui Zhenghua Biologic) following the manufacturer's standard setup steps. RNA Isolation and RNA-seq Analysis For RNA sequencing (RNA-seq), the gastrocnemius muscles from the right front leg of the mice and brain tissues were dissected and immediately frozen in liquid nitrogen. RNA isolation and RNA-seq analysis were performed by Berry Genomics. Frozen tissue samples were ground into powder using a mortar and pestle and homogenized in Qiazol reagent with the TissueLyser LT (Qiagen, Hilden, Germany). Genomic RNA extraction was carried out using the miRNeasy mini kit (Qiagen, Venlo, Netherlands) following the manufacturer’s protocol, and the RNA was eluted in a total volume of 50 μL. RNA concentration and purity were measured using the NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA). RNA quality was assessed using the RNA integrity number (RIN) on the Agilent 2100/4200 system (Agilent Technologies, Santa Clara, CA), which served as a criterion for prioritizing samples for RNA-seq data collection. After library quality control (QC), the samples were sequenced on the Illumina NovaSeq 6000 (Illumina, San Diego, CA) in PE150 mode. Clean reads were mapped to the reference genome sequence using the HISAT2 tools software [14], allowing for either a perfect match or one mismatch. The reference genome was downloaded from the Ensembl database via the following link: ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/001/433/935/GCF_001433935.1_IRGSP-1.0/GCF_001433935.1_IRGSP-1.0_genomic.fna.9z. The final mapped RNA-seq data included all reads, expressed as RPKM (Reads Per Kilobase of transcript per Million mapped reads), a normalized metric based on the most abundant mRNAs detected in each sample or lane. Fold change values were calculated between groups, and the results were categorized as either "up-regulated" or "down-regulated". Results When selecting a point mutation for BRAT1, we noted that 16 patients with BRAT1 mutations had been reported to be alive (Table 1 ) [ 9 – 11 , 15 – 21 ]. Mahjoub et al. described the oldest patient (24 years old) with a homozygous BRAT1 mutation (c.185T > A, p.V62E). This patient and his younger brother exhibited notable clinical phenotypes, including mild intellectual disability, ataxia, delayed motor development, language delay, gaze-evoked nystagmus, and other symptoms [ 20 ]. Given the clinical phenotypes observed in these patients, a mouse model with the same mutation could serve as a valuable model. Additionally, using a homozygous mutation significantly reduces the cost of developing the mouse model. Table 1 Characteristics of 16 alive patients with mutated BRAT1. Reference Mutations Status during reporting Smith et al., 2016; N = 2 [ 15 ] c.1857G > A, c.2125_2128delTTTG Dead (15 months) c.1857G > A, c.2125_2128delTTTG Alive (4 years and 4 months) Oatts et al., 2017; N = 1 [ 16 ] c.294dupA,c.803G > A Alive(20 months) Nuovo et al., 2022; N = 3 [ 17 ] c.638dup, c.1395G > A Alive (15 years) c.638dup, c.1395G > A Alive (10 years) c.638dup, c.1395G > A Alive (18 years) Qi et al., 2022; N = 1 [ 18 ] c.1014A > C, c.706delC Alive (10 years) Hanes et al., 2015; N = 1 [ 9 ] c.294dupA, c.1825C > T Alive (3 years and 8 months) Mundy et al., 2015; N = 1 [ 10 ] c.294dupA, c.1925C > A Alive (6 years) Fernandez-Jaen et al., 2016; N = 1 [ 19 ] c.1564G > A, c.638dupA Alive (4 years and 6 months) Srivastava et al., 2016; N = 4 [ 11 ] c.638dupA, c.803 + 1G > C Alive (10 years) c.638dupA, c.803 + 1G > C Alive (6 years) c.638dup, c.419T > C Alive (4 years and 4 months) c.171delG, c.419T > C Alive (15 years) Mahjoub et al., 2019; N = 2 [ 20 ] Homozygous c.185T > A Alive (24 years) Homozygous c.185T > A Alive (7 years) Fowkes et al., 2022; N = 1 [ 21 ] c.294dupA, c.1925C > A Alive (20 years) AlphaFold 3.0 was used to predict the structures of both WT BRAT1 and the mutated BRAT1 (Fig. 1 ). No significant structural differences were observed between the WT BRAT1 and the mutated BRAT1 (p.V62E). The most common BRAT1 mutation, c.638_639insA/p.V214G fs189 (found in 16 out of 50 patients), is associated with severe clinical phenotypes and early death [ 22 ]. The structure of BRAT1 (p.V214G fs*189) showed obvious differences compared to the WT BRAT1. Given these findings, BRAT1 (p.V62E) was selected as the point mutation for the mouse model. Generation of BRAT1 KI mice A homozygous mouse line with the targeted mutation was generated using CRISPR/Cas9 technology, introducing the p.V62E (GTG to GAG) mutation site into exon 3. The pathogenic variant was confirmed through Sanger sequencing of PCR products (Fig. 2 ). BRAT1 KI founders were screened and confirmed to be negative for other BRD pathogenic variants within the mouse colonies. No abnormalities were observed in terms of appearance, mobility, or perinatal development in the C57BL/6J mice under normal feeding conditions (Supplemental File 1: video of mouse; the mouse model is identified by the tape on its tail). Given the extended lifespan of patients with the BRAT1 (p.V62E) mutation, the lifespan of the mouse model was closely monitored. Two model mice born on April 24, 2023, were raised until the time of writing and survived for over 18 months, equivalent to approximately 60 years in human terms (Fig. 3A). No significant abnormalities were observed during this period. Since patients with BRAT1 (p.V62E) exhibit ataxic gait, the gait of the mouse model was tested. No significant differences were observed between the mouse model and WT mice (Fig. 3B and 3C). The open field test (OFT), a common method to assess exploratory behavior and general activity in mice, also revealed no differences between the mouse model and WT mice (Fig. 3D and 3E). Treadmill running, a noninvasive method to evaluate fitness capacity, was conducted. In low-intensity tests, no obvious differences were observed between the mouse model and WT mice: both types of mice ran on the treadmill for over an hour without exhaustion. When the parameters were adjusted to high-intensity to determine peak physical capacity, the mouse model demonstrated better endurance compared to WT mice (Fig. 3F and 3H). The high-intensity rotarod test, which assesses motor coordination and balance, corroborated the treadmill results: the mouse model exhibited longer falling times than WT mice (Fig. 4). Since the mouse model exhibited some phenotypic differences compared to the WT, RNA-seq was performed to explore potential underlying mechanisms. Brain tissue and gastrocnemius muscle tissue from the legs of three mouse models and three WT mice were collected for RNA extraction. Following RNA quality assessment, one sample from the gastrocnemius muscle tissue of both the mouse model and WT was excluded due to failing quality standards. All samples from the brain tissue met the quality criteria for sequencing. QC for library preparation and RNA-seq data were all passed. In the gastrocnemius muscle tissue, ten differentially expressed genes were identified, all of which were upregulated (Table 2 ). In the brain tissue, four differentially expressed genes were found, with two upregulated and two downregulated (Table 3 ). Notably, there was no overlap in the differentially expressed genes between the brain tissue and gastrocnemius muscle tissue. Table 2 Ten differentially expressed genes in gastrocnemius muscle (GM) tissue. WT: wild type. ID GM-2 GM–3 GM-WT-1 GM-WT-3 Log2FoldChange pvalue qvalue SNAP25 0 0 36.95 102.29 -9.15 2.64E-07 0.0026 SPIB 0 0 9.54 390.55 -10.68 3.10E-07 0.0026 CD8A 0 0 11.84 203.43 -9.78 1.56E-06 0.0075 FOS 254.89 295.89 1240.64 653.04 -1.78 1.79E-06 0.0075 SARNP 100.37 86.44 285.74 510.14 -2.09 6.93E-06 0.0233 OTUD1 2089.59 2216.90 8599.67 3927.52 -1.54 1.15E-05 0.0322 CCR7 0 0 2.63 257.97 -10.06 1.68E-05 0.0383 GLYCAM1 0.02 1.49 0.33 983.23 -9.08 1.89E-05 0.0383 S100A14 0 0 4.94 180.01 -9.56 2.05E-05 0.0383 LCK 2.20 1.35 7.24 339.30 -6.52 2.89E-05 0.0487 Table 3 Four differentially expressed genes in brain tissue. WT: wild type. ID Brain-1 Brain-2 Brain − 3 Brain -WT-1 Brain -WT-2 Brain -WT-3 Log2FoldChange pvalue qvalue DZANK1 4810.33 6846.90 5115.97 10393.21 12159.68 12594.88 -1.07 8.17E-11 1.46E-06 HOXA5 200.909 368.51 4.18 1.99 0.05 8.02 5.78 2.21E-06 0.0198 GM14434 57.34 72.73 86.05 401.95 312.36 117.44 -1.94 5.49E-06 0.0266 TLX3 112.80 55.68 0 4.16E-17 4.16E-17 4.16E-17 8.84 5.95E-06 0.0266 Discussion Through an analysis of patient information and protein structure, the BRAT1 mutation (c.185T > A, p.V62E) was selected to create a mouse model for further investigation into the mechanisms of BRAT1. While the majority of the explored phenotypes showed no significant differences between the mouse model and WT mice, the mouse model demonstrated better peak physical capacity. RNA-seq was operated to explore gene-phenotype relationships. There is a notable consistency between the phenotypes observed in the mouse model and the clinical manifestations of patients with the BRAT1 (p.V62E) mutation. The patient with the BRAT1 (p.V62E) mutation is the oldest reported case (24 years old) [ 20 ], and similarly, the mouse model exhibited a long lifespan, suggesting that patients with this mutation may also have a normal lifespan. Both the mouse model and the patient experienced uneventful pregnancy and delivery, with the exception of clubfoot noted at birth in the patient. Additionally, no seizures were reported in either the mouse model or the patient. Some clinical phenotypes, such as mild intellectual disability, motor development delay, language delay, and gaze-evoked nystagmus, are challenging to assess in a mouse model. Gait analysis was conducted to determine whether the mouse model exhibits ataxia, and the OFT was performed as a neurologic examination. Both gait analysis and OFT revealed no differences between the mouse model and WT mice, indicating that this mouse model is not suitable for studying nervous system-related phenotypes. However, the mouse model is a good model for assessing physical capacity. Physical capacity in patients with BRAT1 (p.V62E) has not been thoroughly evaluated, partly due to the challenges posed by ataxic gait. Gait analysis revealed that the mouse model has a normal gait without ataxia. Treadmill running and rotarod tests were used to evaluate the physical ability of the mouse model. The results showed no significant differences between the mouse model and WT mice during low-intensity testing, but the mouse model exhibited stronger endurance during high-intensity testing. The relationship between mitochondria and motor ability has been widely discussed [ 23 – 25 ]. Knockdown of BRAT1 has been shown to increase cellular glucose demand, significantly elevate reactive oxygen species (ROS) levels, enhance glycolysis and lactate accumulation, reduce mitochondrial pyruvate dehydrogenase (PDH) activity, and disrupt mitochondrial membrane potential [ 5 , 6 ]. Patients with BRAT1 (p.V62E) also exhibit decreased native PDH levels [ 20 ]. Prior to the treadmill running test, better endurance was expected in WT mice. However, the results were the opposite, as confirmed by both the treadmill running and rotarod tests. Electron microscopy studies by Hoppeler's group in the 1970s and later identified increased mitochondrial volume in the skeletal muscle of endurance-trained individuals [ 26 ]. So et al. reported that mitochondria localization is more condensed in BRAT1 knockdown cells [ 6 ], suggesting that mutated BRAT1 may increase mitochondrial volume. These findings provide an intriguing perspective on the relationship between BRAT1 and mitochondria. Structural analysis revealed no significant differences between BRAT1 (p.V62E) and the WT protein. BRAT1 tightly interacts with the INTS9/INTS11 subunits of the Integrator complex, which is involved in processing the 3' ends of various noncoding RNAs and pre-mRNAs [ 27 ]. The missense mutation p.V62E partially disrupts the association between BRAT1 and the INTS11/INTS9 heterodimer [ 7 ]. The ten differentially expressed genes identified in the gastrocnemius muscle and the four differentially expressed genes in the brain tissue may represent potential targets of the BRAT1/INTS9/INTS11 trimeric complex. RNA-seq revealed ten differentially expressed genes in gastrocnemius muscle tissue and four differentially expressed genes in brain tissue, with no overlap between the two sets of genes. These results suggest that the function of the BRAT1 gene may vary across different tissues. No direct connection was found between these 14 genes and mitochondrial function. Among the identified genes, SPIB[ 28 ], CD8A[ 29 ], LCK[ 30 ], FOS[ 31 ], OTUD1[ 32 ], S100A14[ 33 ] and CCR7[ 34 ] are closely associated with the immune system and represent important targets in immunological research. Haydo et al. reported that BRAT1 contributes to glioblastoma (GBM) growth and invasion [ 35 ]. In the brain tissue of the mouse model, HOXA5 was upregulated by the mutated BRAT1. HOXA5 amplification has been identified as a genetic biomarker for predicting worse GBM outcomes, as it enhances PTPRZ1-mediated survival of glioma stem cells [ 36 ]. These findings suggest that point mutations in BRAT1 may influence the immune system and GBM growth and invasion. However, no significant expression changes related to these effects were observed at the mouse model level. Conclusions This study presents the first successfully constructed BRAT1 mutant mouse model, marking a significant milestone in BRAT1 research. This achievement not only provides confidence for developing additional mouse models but also offers an intriguing perspective on understanding the relationship between BRAT1 and mitochondrial function. The mouse model demonstrates a degree of consistency with the clinical phenotypes observed in patients and may serve as a predictive tool for patient prognosis. The diverse functions of BRAT1 highlight its complexity and underscore the need for further research to fully elucidate its roles and mechanisms. Abbreviations BRCA1: breast cancer 1. ATM: ataxia-telangiectasia mutated. BAAT1/BRAT1: BRCA1-associated protein required for ATM activation-1. RMFSL: Rigidity and Multifocal Seizure Syndrome, Lethal Neonatal. BRD: BRAT1-related disease. KI: knock-in. PCR: polymerase chain reaction. WT: wild-type. RNA-seq: RNA sequencing. RIN: RNA integrity number. QC: quality control. OFT: open field test. ROS: reactive oxygen species. PDH: pyruvate dehydrogenase. GBM: glioblastoma. Declarations 1. Ethics approval and consent to participate Not applicable. 2. Consent for publication Not applicable. 3. Availability of data and materials Data can be made available from the corresponding author after discussion with the Institutional Review Board. 4. Competing interests The authors declare that they have no competing interests. 5. Funding This work was supported by a grant from the National Natural Science Foundation of China (82202059). 6. Authors' contributions WJ K wrote the manuscript, supervised data and manuscript. C L collected and analyzed related articles and data. All authors read and approved the final manuscript. 7. Acknowledgments Not applicable. References Aglipay JA, Martin SA, Tawara H, Lee SW, Ouchi T: ATM activation by ionizing radiation requires BRCA1-associated BAAT1 . The Journal of biological chemistry 2006, 281 (14):9710-9718 doi: 10.1074/jbc.M510332200. Puffenberger EG, Jinks RN, Sougnez C, Cibulskis K, Willert RA, Achilly NP, Cassidy RP, Fiorentini CJ, Heiken KF, Lawrence JJ et al : Genetic mapping and exome sequencing identify variants associated with five novel diseases . PloS one 2012, 7 (1):e28936 doi: 10.1371/journal.pone.0028936. Saunders CJ, Miller NA, Soden SE, Dinwiddie DL, Noll A, Alnadi NA, Andraws N, Patterson ML, Krivohlavek LA, Fellis J et al : Rapid whole-genome sequencing for genetic disease diagnosis in neonatal intensive care units . Science translational medicine 2012, 4 (154):154ra135 doi: 10.1126/scitranslmed.3004041. Hooshmand SJ, Chohan KL, Raghunathan A, Renaud DL, Ruff MW: BRAT1-Associated Leukodystrophy Exacerbated by Classic Hodgkin Lymphoma-Directed Therapy . The neurologist 2023 doi: 10.1097/nrl.0000000000000539. So EY, Ouchi T: The Potential Role of BRCA1-Associated ATM Activator-1 (BRAT1) in Regulation of mTOR . Journal of cancer biology & research 2013, 1 (1) doi: So EY, Ouchi T: BRAT1 deficiency causes increased glucose metabolism and mitochondrial malfunction . BMC cancer 2014, 14 :548 doi: 10.1186/1471-2407-14-548. Dokaneheifard S, Gomes Dos Santos H: Neuronal differentiation requires BRAT1 complex to remove REST from chromatin . 2024, 121 (23):e2318740121 doi: 10.1073/pnas.2318740121. Cui C, Dwyer BG, Liu C, Abegg D, Cai ZJ, Hoch DG, Yin X, Qiu N, Liu JQ, Adibekian A: Total Synthesis and Target Identification of the Curcusone Diterpenes . 2021, 143 (11):4379-4386 doi: 10.1021/jacs.1c00557. Hanes I, Kozenko M, Callen DJ: Lethal Neonatal Rigidity and Multifocal Seizure Syndrome--A Misnamed Disorder? Pediatric neurology 2015, 53 (6):535-540 doi: 10.1016/j.pediatrneurol.2015.09.002. Mundy SA, Krock BL, Mao R, Shen JJ: BRAT1-related disease--identification of a patient without early lethality . American journal of medical genetics Part A 2016, 170 (3):699-702 doi: 10.1002/ajmg.a.37434. Srivastava S, Olson HE, Cohen JS, Gubbels CS, Lincoln S, Davis BT, Shahmirzadi L, Gupta S, Picker J, Yu TW et al : BRAT1 mutations present with a spectrum of clinical severity . American journal of medical genetics Part A 2016, 170 (9):2265-2273 doi: 10.1002/ajmg.a.37783. Kong W, Cao X, Lu C: Clinical characteristics of BRAT1-related disease: a systematic literature review . Acta neurologica Belgica 2024, 124 (4):1281-1288 doi: 10.1007/s13760-024-02507-y. Carapancea E, Cornet MC: Clinical and Neurophysiologic Phenotypes in Neonates With BRAT1 Encephalopathy . 2023, 100 (12):e1234-e1247 doi: 10.1212/wnl.0000000000206755. Kim D, Langmead B, Salzberg SL: HISAT: a fast spliced aligner with low memory requirements . 2015, 12 (4):357-360 doi: 10.1038/nmeth.3317. Smith NJ, Lipsett J, Dibbens LM, Heron SE: BRAT1-associated neurodegeneration: Intra-familial phenotypic differences in siblings . American journal of medical genetics Part A 2016, 170 (11):3033-3038 doi: 10.1002/ajmg.a.37853. Oatts JT, Duncan JL, Hoyt CS, Slavotinek AM, Moore AT: Inner retinal dystrophy in a patient with biallelic sequence variants in BRAT1 . Ophthalmic genetics 2017, 38 (6):559-561 doi: 10.1080/13816810.2017.1290118. Nuovo S, Baglioni V, De Mori R, Tardivo S, Caputi C, Ginevrino M, Micalizzi A, Masuelli L, Federici G, Casella A et al : Clinical variability at the mild end of BRAT1-related spectrum: Evidence from two families with genotype-phenotype discordance . Human mutation 2022, 43 (1):67-73 doi: 10.1002/humu.24293. Qi Y, Ji X, Ding H, Liu L, Zhang Y, Yin A: Novel Biallelic Variant in the BRAT1 Gene Caused Nonprogressive Cerebellar Ataxia Syndrome . Frontiers in genetics 2022, 13 :821587 doi: 10.3389/fgene.2022.821587. Fernández-Jaén A, Álvarez S, So EY, Ouchi T, Jiménez de la Peña M, Duat A, Fernández-Mayoralas DM, Fernández-Perrone AL, Albert J, Calleja-Pérez B: Mutations in BRAT1 cause autosomal recessive progressive encephalopathy: Report of a Spanish patient . European journal of paediatric neurology : EJPN : official journal of the European Paediatric Neurology Society 2016, 20 (3):421-425 doi: 10.1016/j.ejpn.2016.02.009. Mahjoub A, Cihlarova Z, Tétreault M, MacNeil L, Sondheimer N, Caldecott KW, Hanzlikova H, Yoon G: Homozygous pathogenic variant in BRAT1 associated with nonprogressive cerebellar ataxia . Neurology Genetics 2019, 5 (5):e359 doi: 10.1212/nxg.0000000000000359. Fowkes R, Elwan M, Akay E, Mitchell CJ, Thomas RH, Lewis-Smith D: A review of the clinical spectrum of BRAT1 disorders and case of developmental and epileptic encephalopathy surviving into adulthood . Epilepsy & behavior reports 2022, 19 :100549 doi: 10.1016/j.ebr.2022.100549. Kong W, Cao X, Lu C: Clinical characteristics of BRAT1-related disease: a systematic literature review . Acta neurologica Belgica 2024 doi: 10.1007/s13760-024-02507-y. Group. MSGLAMS: Temporal dynamics of the multi-omic response to endurance exercise training . Nature 2024, 629 (8010):174-183 doi: 10.1038/s41586-023-06877-w. Hargreaves M, Spriet LL: Skeletal muscle energy metabolism during exercise . 2020, 2 (9):817-828 doi: 10.1038/s42255-020-0251-4. Garibotti MC, Perry CGR: Strength athletes and mitochondria: it's about 'time' . 2023, 601 (14):2753-2754 doi: 10.1113/jp284856. Hoppeler H, Howald H, Conley K, Lindstedt SL, Claassen H, Vock P, Weibel ER: Endurance training in humans: aerobic capacity and structure of skeletal muscle . Journal of applied physiology (Bethesda, Md : 1985) 1985, 59 (2):320-327 doi: 10.1152/jappl.1985.59.2.320. Cihlarova Z, Kubovciak J, Sobol M, Krejcikova K: BRAT1 links Integrator and defective RNA processing with neurodegeneration . 2022, 13 (1):5026 doi: 10.1038/s41467-022-32763-6. Montes-Moreno S, Ramos-Medina R, Martínez-López A, Barrionuevo Cornejo C, Parra Cubillos A, Quintana-Truyenque S, Rodriguez Pinilla SM, Pajares R, Sanchez-Verde L, Martinez-Torrecuadrada J et al : SPIB, a novel immunohistochemical marker for human blastic plasmacytoid dendritic cell neoplasms: characterization of its expression in major hematolymphoid neoplasms . Blood 2013, 121 (4):643-647 doi: 10.1182/blood-2012-08-447599. Chu J, Tang S, Li T, Fan H: The Role of CD8A in the Immune Microenvironment of Breast Cancer . Frontiers in bioscience (Landmark edition) 2024, 29 (2):73 doi: 10.31083/j.fbl2902073. Wu J, Li G, Li L, Li D, Dong Z, Jiang P: Asparagine enhances LCK signalling to potentiate CD8(+) T-cell activation and anti-tumour responses . 2021, 23 (1):75-86 doi: 10.1038/s41556-020-00615-4. Ma S, Sandhoff R, Luo X, Shang F: Serine enrichment in tumors promotes regulatory T cell accumulation through sphinganine-mediated regulation of c-Fos . 2024, 9 (94):eadg8817 doi: 10.1126/sciimmunol.adg8817. Oikawa D, Shimizu K: Pleiotropic Roles of a KEAP1-Associated Deubiquitinase, OTUD1 . 2023, 12 (2) doi: 10.3390/antiox12020350. Wang C, Chen Y, Xinpeng Y, Xu R, Song J, Ruze R, Xu Q, Zhao Y: Construction of immune-related signature and identification of S100A14 determining immune-suppressive microenvironment in pancreatic cancer . BMC cancer 2022, 22 (1):879 doi: 10.1186/s12885-022-09927-0. Liu J, Cheng Y, Zhang X, Chen Y, Zhu H, Chen K, Liu S, Li Z, Cao X: Glycosyltransferase Extl1 promotes CCR7-mediated dendritic cell migration to restrain infection and autoimmunity . Cell reports 2023, 42 (1):111991 doi: 10.1016/j.celrep.2023.111991. Haydo A, Schmidt J, Crider A, Kögler T, Ertl J, Hehlgans S, Hoffmann ME, Rathore R, Güllülü Ö, Wang Y et al : BRAT1 - a new therapeutic target for glioblastoma . Cellular and molecular life sciences : CMLS 2025, 82 (1):52 doi: 10.1007/s00018-024-05553-0. He ZC, Liu Q, Yang KD, Chen C, Zhang XN, Wang WY, Zeng H, Wang B, Liu YQ, Luo M et al : HOXA5 is amplified in glioblastoma stem cells and promotes tumor progression by transcriptionally activating PTPRZ1 . Cancer letters 2022, 533 :215605 doi: 10.1016/j.canlet.2022.215605. Additional Declarations No competing interests reported. Supplementary Files SupplementalFile1.mp4 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6434862","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":456931115,"identity":"a3adfb17-6202-4ad3-a4bf-04ed944c1807","order_by":0,"name":"Weijing Kong","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0ElEQVRIiWNgGAWjYBACCQaGxAcfKiTs+JmZDz4gVkuy4YwzFsmS7WzJBsRqYZPmbKtg3HCex0yAKC2SMxIeGzOwSTAbH2YwY2CosYkmqEVaIiHxcQGPBJ/ZYYa0BwzH0nIbCGmRk05INp4hIcEM1HLcgLHhMFFa0qR5DCQYNzcztkkQpUUarCVBgnEDMzMbcVok5z8ABvIBiWSJw2zMBgnE+EXizJnEBx//1dnx95//+OBDjQ1hLQwMPAkIdgIuRaiA/QBx6kbBKBgFo2DkAgCyGTvbgqQ2RAAAAABJRU5ErkJggg==","orcid":"","institution":"Capital Medical University","correspondingAuthor":true,"prefix":"","firstName":"Weijing","middleName":"","lastName":"Kong","suffix":""},{"id":456931117,"identity":"36eafc64-4890-431e-89f8-189fd73cea12","order_by":1,"name":"Cheng Lu","email":"","orcid":"","institution":"Beijing Hong Jian Medical Device Company","correspondingAuthor":false,"prefix":"","firstName":"Cheng","middleName":"","lastName":"Lu","suffix":""}],"badges":[],"createdAt":"2025-04-12 13:38:06","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6434862/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6434862/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":83039284,"identity":"cf59a6a9-0e21-4719-822d-4df13d87fcea","added_by":"auto","created_at":"2025-05-19 10:36:25","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":539408,"visible":true,"origin":"","legend":"\u003cp\u003eStructures of BRAT1 WT (A), BRAT1 p.V62E (B) and BRAT1 p.V214G fs*189 (C) predicted by AlphaFold 3. The purple ball represents iron ion bound to BRAT1.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6434862/v1/72b91c6d483a50e4b69665a6.jpg"},{"id":83039288,"identity":"697a7029-ea60-4246-9c17-f2225ee611be","added_by":"auto","created_at":"2025-05-19 10:36:26","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1159778,"visible":true,"origin":"","legend":"\u003cp\u003eA. Chromatogram of WT mouse and KI mouse depicting the targeted area. The changed codon is marked with an orange rectangle. B: PCR analysis on KI and WT mouse.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6434862/v1/eee74058bd10ad42162500f9.jpg"},{"id":83039286,"identity":"fcd8c2bb-51b1-4bb7-b3bd-f8219595e824","added_by":"auto","created_at":"2025-05-19 10:36:25","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":867671,"visible":true,"origin":"","legend":"\u003cp\u003eA: Comparative age between humans and mice during their life span (modified from Daniela Ratto et al. 2019). The red arrow marks date of birth and last observed date. B: Gait analysis for the mouse model. C: Gait analysis for WT mice. D: Track plots of the mouse model during the open field. E: Track plots of WT mice during the open field test. F: Total distance in the open field test. H: Central zone entries in the open field test.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6434862/v1/4375e382bba5473dd11dcdd2.jpg"},{"id":83041207,"identity":"24f9c519-978a-4f53-a101-717016b0f061","added_by":"auto","created_at":"2025-05-19 10:44:25","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":131250,"visible":true,"origin":"","legend":"\u003cp\u003eA: Movement distance in the high-intensity treadmill running test. B: Exhaustion time in the high-intensity treadmill running test. C: Falling time in the high-intensity rotarod test.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6434862/v1/4f8c46b6dcced5d1b337c7af.jpg"},{"id":84036647,"identity":"6c15a6cb-5434-4653-85db-60cf7881dcf2","added_by":"auto","created_at":"2025-06-06 04:16:48","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4610653,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6434862/v1/2bf47cc5-f2f1-4d9e-a270-25692cb19b39.pdf"},{"id":83039296,"identity":"5947b1ce-3780-44f5-986d-2c7c1dec0732","added_by":"auto","created_at":"2025-05-19 10:36:26","extension":"mp4","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":4002721,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalFile1.mp4","url":"https://assets-eu.researchsquare.com/files/rs-6434862/v1/d59b30d18250aadd791bbf67.mp4"}],"financialInterests":"No competing interests reported.","formattedTitle":"Phenotypic exploration of Mice with a Point Mutation in BRAT1","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIn 2006, Aglipay et al. identified a protein that interacts with both breast cancer 1 (BRCA1) and ataxia-telangiectasia mutated (ATM). They named this protein BAAT1 (BRCA1-associated protein required for ATM activation-1) [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Subsequently, the name BAAT1 was gradually replaced by BRAT1, which remains the currently accepted and widely used designation [\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. BRAT1 protein localizes to both nucleus and cytoplasm [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], suggesting its involvement in a wide range of functions. Numerous studies have reported various roles of BRAT1, including maintaining the phosphorylation level and activity of ATM [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], regulation of mTOR signaling [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], modulating glucose metabolism and mitochondrial function [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] and influencing neuronal differentiation through distinct trimeric complexes [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. BRAT1 has long been considered as \u0026ldquo;undruggable\u0026rdquo;, but recent discoveries, such as the small molecule Curcusone D, have shown potential by associating with BRAT1 and reducing cancer cell migration [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. These explorations, however, have been limited to the cellular level due to the absence of an appropriate animal model for BRAT1. As BRAT1 is recognized as a global regulator, the creation of a BRAT1 knockout mouse model was initially deemed unfeasible.\u003c/p\u003e \u003cp\u003eIn 2012, Puffenberger et al. described three patients exhibiting severe clinical features, including lethal multifocal seizures, hypertonia, microcephaly, apnea, and bradycardia. They subsequently named this condition Rigidity and Multifocal Seizure Syndrome, Lethal Neonatal (RMFSL) (OMIM #614498) [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Mutated BRAT1 (homozygous c.638_639insA) was identified in all three patients and confirmed to be pathogenic [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Additionally, cases with later onset and milder phenotypes associated with BRAT1 mutations have also been reported [\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Our group provided quantitative data on the clinical phenotypes of BRAT1-related disease (BRD), offering a comprehensive overview of this condition. Among 50 patients with BRAT1 mutations, 31 (62%) had died. Of the 19 surviving patients, 11 (57.9%) were predicted to die before reaching 10 years of age [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Carapancea et al. reported 19 neonates with BRAT1 encephalopathy, all of whom died before reaching one year of age [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. While point mutations in BRAT1 could theoretically serve as a basis for creating a mouse model, most point mutations are not suitable due to the associated clinical phenotype of early lethality.\u003c/p\u003e \u003cp\u003eBased on our comprehensive understanding of BRDs, mice with the homozygous BRAT1 p.V62E (GTG to GAG) mutation emerged as a potential model for functional exploration of BRAT1. In this study, homozygous BRAT1 p.V62E (GTG to GAG) knock-in (KI) mice with C57BL/6J background were generated using CRISPR/Cas9 technology, and phenotypic investigations were conducted. To the best of our knowledge, this represents the first animal model developed for BRDs.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003eAll experiments were conducted in compliance with the ethical guidelines of the International Association for the Study of Pain and were approved by the Institutional Animal Care and Use Committee at the Beijing Friendship Hospital (Beijing, China). The authors unequivocally affirmed that every experiment was rigorously conducted in strict compliance with all pertinent regulatory frameworks and ethical protocols, while also adhering meticulously to the ARRIVE guidelines.\u003c/p\u003e\n\u003cp\u003eMouse Model Generation:\u003c/p\u003e\n\u003cp\u003eWild-type (WT) mice with C57BL/6J background was offered by Cyagen Biosciences (www.cyagen.com). The mice were generated by Cyagen Biosciences using CRISPR/Cas9 technology. The KI pathogenic variant was introduced into exon 3 of BRAT1 using the following guide RNAs (gRNAs): gRNA1 (matches the forward strand): GTCCTGTGGCTTCAGCACAT\u003cu\u003eGGG\u003c/u\u003e, and gRNA2 (matches the reverse strand): GTGGCTTCAGCACATGGGAC\u003cu\u003eAGG\u003c/u\u003e. The p.V62E (GTG to GAG) mutation sites in donor oligo were introduced into exon 3 by homology-directed repair. Cas9 messenger RNA (mRNA), gRNA generated by in vitro transcription, and donor oligo were co-injected into fertilized eggs of C57BL/6J mouse to generate KI mouse production.\u003c/p\u003e\n\u003cp\u003ePotential off-target sites were analyzed to ensure specificity. Off-target analysis for gRNA1 identified 10 sites, 9 of which were located within genes. The genes most likely to be affected by CRISPR/Cas9 manipulation include Gm47473, Klk1b24, Usp21, Iba57, Hunk, B130011K05Rik, Gm10252, and Gm47129. Similarly, off-target analysis for gRNA2 revealed 10 sites, all within genes. The genes with the highest probability of being affected are Gm47203, 2610035D17Rik, Gm12304, Gm31615, BX293558.1, Gm49978, Gldc, Gm37661, and Uri1. None of these genes are expected to contribute to BRD.\u003c/p\u003e\n\u003cp\u003eMice Maintenance:\u003c/p\u003e\n\u003cp\u003eThe animals were housed in a specific pathogen-free facility under controlled conditions, including a 12-hour light/dark cycle. The environment was maintained at a temperature of 20\u0026ndash;26\u0026deg;C with a humidity level of 40\u0026ndash;70%. All food, water, bedding, and other supplies introduced into the isolator were sterilized in advance to ensure a clean and controlled environment.\u003c/p\u003e\n\u003cp\u003eGenotyping:\u003c/p\u003e\n\u003cp\u003eThe mice received from Cyagen were heterozygous for the KI mutation. DNA was extracted from mice tail with TaKaRa MiniBEST Universal Genomic DNA Extraction kit (Ver.5.0_Code No. 9765). Mice were genotyped by polymerase chain reaction (PCR) (F1: 5\u0026rsquo;-CTTAATCCTAAGGGGAAGGGATGTT-3\u0026rsquo;; R1: 5\u0026rsquo;-TTTCTAAGTAGGAGCAATGTGGGAT-3\u0026rsquo;; PCR product size: 409 bp) followed by Sanger sequencing analysis. The last generation was intercrossed to establish homozygous KI and WT (without a mutation) mice with identical background. WT mice were used as controls, whereas heterozygous mice were excluded.\u003c/p\u003e\n\u003cp\u003eTreadmill running test:\u003c/p\u003e\n\u003cp\u003eThe ZH-PT/5S treadmill (Anhui Zhenghua Biologic) was utilized to assess endurance capacity.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTraining parameters (mice were acclimated to the device with three days):\u003c/p\u003e\n\u003cp\u003eTilt angle of the running platform: 0\u0026deg;; Electric shock intensity: 2.5 mA; Acceleration: 100 m/min\u0026sup2;.\u003c/p\u003e\n\u003cp\u003e1) First training session: The speed starts at 2 m/min and gradually increases to 10 m/min.\u003c/p\u003e\n\u003cp\u003e2) Second training session: The speed starts at 4 m/min and gradually increases to 12 m/min.\u003c/p\u003e\n\u003cp\u003e3) Third training session: The speed starts at 8 m/min and gradually increases to 14 m/min.\u003c/p\u003e\n\u003cp\u003eAfter reaching the final speed in each training session, maintain it for 10 minutes. Mice quickly learn to avoid the shock grid during the acclimation period.\u003c/p\u003e\n\u003cp\u003eParameters for test 1 (Low intensity):\u003c/p\u003e\n\u003cp\u003eTilt angle of the running platform: 0 \u0026deg;; Electric shock intensity: 2.5mA; Speed: 15 m/min. The distance and time of the mouse\u0026apos;s movement from the start until fatigue were recorded.\u003c/p\u003e\n\u003cp\u003eFatigue standard: the mouse remains consistently in the back one-third of the track; the running posture shifts from normal to a prone position; and rapid breathing is observed.\u003c/p\u003e\n\u003cp\u003eParameters for test 2 (High intensity):\u003c/p\u003e\n\u003cp\u003eTilt angle of the running platform: 15 \u0026deg;; Electric shock intensity: 2.5mA;\u003c/p\u003e\n\u003cp\u003eSpeed starts at 10 m/min and increases to 35 m/min within 10 min.\u003c/p\u003e\n\u003cp\u003eExhaustion standard: electrocuted 7 times within 15 seconds.\u003c/p\u003e\n\u003cp\u003eExhaustion time, distance, and the number of electric shocks were recorded.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eRota-rod test:\u003c/p\u003e\n\u003cp\u003eThe accelerated rotarod test (Ugo Basile, Gemonio, Italy, model 47600) is a standard sensory-motor assessment used to evaluate animals\u0026apos; motor coordination and learning skills by measuring their ability to stay and run on an accelerating rod. The test was conducted over a duration of 2 minutes, with the rod accelerating from 0 to 40 rpm. The trial was stopped as soon as a mouse fell off the rod or began rotating with the rod without running. After an initial training trial, mice were tested in three trials over two days, with a 30-minute recovery period between trials.\u003c/p\u003e\n\u003cp\u003eOpen Field Test\u003c/p\u003e\n\u003cp\u003eExploratory activity and anxiety-like behavior were assessed using an open-field apparatus measuring 50 \u0026times; 50 \u0026times; 40 cm (Model: 1056306, Bai Zhong Biotechnology). Each mouse was placed in the center of the open-field apparatus, with the center zone defined as a 20 \u0026times; 20 cm square. The total duration of the test was 5 minutes.\u003c/p\u003e\n\u003cp\u003eQuantification of gait parameters\u003c/p\u003e\n\u003cp\u003eGait analysis was conducted using the MGT-PR Mouse Gait Behavior Analysis System (Anhui Zhenghua Biologic) following the manufacturer\u0026apos;s standard setup steps.\u003c/p\u003e\n\u003cp\u003eRNA Isolation and RNA-seq Analysis\u003c/p\u003e\n\u003cp\u003eFor RNA sequencing (RNA-seq), the gastrocnemius muscles from the right front leg of the mice and brain tissues were dissected and immediately frozen in liquid nitrogen. RNA isolation and RNA-seq analysis were performed by Berry Genomics. Frozen tissue samples were ground into powder using a mortar and pestle and homogenized in Qiazol reagent with the TissueLyser LT (Qiagen, Hilden, Germany). Genomic RNA extraction was carried out using the miRNeasy mini kit (Qiagen, Venlo, Netherlands) following the manufacturer\u0026rsquo;s protocol, and the RNA was eluted in a total volume of 50 \u0026mu;L. RNA concentration and purity were measured using the NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA). RNA quality was assessed using the RNA integrity number (RIN) on the Agilent 2100/4200 system (Agilent Technologies, Santa Clara, CA), which served as a criterion for prioritizing samples for RNA-seq data collection.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAfter library quality control (QC), the samples were sequenced on the Illumina NovaSeq 6000 (Illumina, San Diego, CA) in PE150 mode. Clean reads were mapped to the reference genome sequence using the HISAT2 tools software [14], allowing for either a perfect match or one mismatch. The reference genome was downloaded from the Ensembl database via the following link: ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/001/433/935/GCF_001433935.1_IRGSP-1.0/GCF_001433935.1_IRGSP-1.0_genomic.fna.9z.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe final mapped RNA-seq data included all reads, expressed as RPKM (Reads Per Kilobase of transcript per Million mapped reads), a normalized metric based on the most abundant mRNAs detected in each sample or lane. Fold change values were calculated between groups, and the results were categorized as either \u0026quot;up-regulated\u0026quot; or \u0026quot;down-regulated\u0026quot;.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eWhen selecting a point mutation for BRAT1, we noted that 16 patients with BRAT1 mutations had been reported to be alive (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) [\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan additionalcitationids=\"CR16 CR17 CR18 CR19 CR20\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Mahjoub et al. described the oldest patient (24 years old) with a homozygous BRAT1 mutation (c.185T\u0026thinsp;\u0026gt;\u0026thinsp;A, p.V62E). This patient and his younger brother exhibited notable clinical phenotypes, including mild intellectual disability, ataxia, delayed motor development, language delay, gaze-evoked nystagmus, and other symptoms [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Given the clinical phenotypes observed in these patients, a mouse model with the same mutation could serve as a valuable model. Additionally, using a homozygous mutation significantly reduces the cost of developing the mouse model.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCharacteristics of 16 alive patients with mutated BRAT1.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMutations\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eStatus during reporting\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSmith\u0026nbsp;et\u0026nbsp;al.,\u0026nbsp;2016;\u0026nbsp;N\u0026thinsp;=\u0026thinsp;2 [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.1857G\u0026thinsp;\u0026gt;\u0026thinsp;A, c.2125_2128delTTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDead (15 months)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.1857G\u0026thinsp;\u0026gt;\u0026thinsp;A, c.2125_2128delTTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAlive (4 years and 4 months)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOatts\u0026nbsp;et\u0026nbsp;al.,\u0026nbsp;2017; N\u0026thinsp;=\u0026thinsp;1 [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.294dupA,c.803G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAlive(20 months)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eNuovo\u0026nbsp;et\u0026nbsp;al.,\u0026nbsp;2022; N\u0026thinsp;=\u0026thinsp;3 [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.638dup,\u0026nbsp;c.1395G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAlive (15 years)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.638dup,\u0026nbsp;c.1395G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAlive (10 years)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.638dup,\u0026nbsp;c.1395G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAlive (18 years)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eQi\u0026nbsp;et\u0026nbsp;al.,\u0026nbsp;2022; N\u0026thinsp;=\u0026thinsp;1 [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.1014A\u0026nbsp;\u0026gt;\u0026nbsp;C,\u0026nbsp;c.706delC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAlive (10 years)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHanes\u0026nbsp;et\u0026nbsp;al.,\u0026nbsp;2015;\u0026nbsp;N\u0026thinsp;=\u0026thinsp;1 [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.294dupA,\u0026nbsp;c.1825C\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAlive (3 years and 8 months)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMundy\u0026nbsp;et\u0026nbsp;al.,\u0026nbsp;2015;\u0026nbsp;N\u0026thinsp;=\u0026thinsp;1 [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.294dupA,\u0026nbsp;c.1925C\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAlive (6 years)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFernandez-Jaen\u0026nbsp;et\u0026nbsp;al.,\u0026nbsp;2016;\u0026nbsp;N\u0026thinsp;=\u0026thinsp;1 [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.1564G\u0026thinsp;\u0026gt;\u0026thinsp;A,\u0026nbsp;c.638dupA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAlive (4 years and 6 months)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eSrivastava\u0026nbsp;et\u0026nbsp;al.,\u0026nbsp;2016;\u0026nbsp;N\u0026thinsp;=\u0026thinsp;4 [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.638dupA,\u0026nbsp;c.803\u0026thinsp;+\u0026thinsp;1G\u0026thinsp;\u0026gt;\u0026thinsp;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAlive (10 years)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.638dupA,\u0026nbsp;c.803\u0026thinsp;+\u0026thinsp;1G\u0026thinsp;\u0026gt;\u0026thinsp;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAlive (6 years)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.638dup,\u0026nbsp;c.419T\u0026thinsp;\u0026gt;\u0026thinsp;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAlive (4 years and 4 months)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.171delG,\u0026nbsp;c.419T\u0026thinsp;\u0026gt;\u0026thinsp;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAlive (15 years)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMahjoub\u0026nbsp;et\u0026nbsp;al.,\u0026nbsp;2019;\u0026nbsp;N\u0026thinsp;=\u0026thinsp;2 [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHomozygous\u0026nbsp;c.185T\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAlive (24 years)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHomozygous\u0026nbsp;c.185T\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAlive (7 years)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFowkes\u0026nbsp;et\u0026nbsp;al.,\u0026nbsp;2022;\u0026nbsp;N\u0026thinsp;=\u0026thinsp;1 [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.294dupA,\u0026nbsp;c.1925C\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAlive (20 years)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eAlphaFold 3.0 was used to predict the structures of both WT BRAT1 and the mutated BRAT1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). No significant structural differences were observed between the WT BRAT1 and the mutated BRAT1 (p.V62E). The most common BRAT1 mutation, c.638_639insA/p.V214G fs189 (found in 16 out of 50 patients), is associated with severe clinical phenotypes and early death [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The structure of BRAT1 (p.V214G fs*189) showed obvious differences compared to the WT BRAT1. Given these findings, BRAT1 (p.V62E) was selected as the point mutation for the mouse model.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eGeneration of \u003cem\u003eBRAT1\u003c/em\u003e KI mice\u003c/p\u003e \u003cp\u003eA homozygous mouse line with the targeted mutation was generated using CRISPR/Cas9 technology, introducing the p.V62E (GTG to GAG) mutation site into exon 3. The pathogenic variant was confirmed through Sanger sequencing of PCR products (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). \u003cem\u003eBRAT1\u003c/em\u003e KI founders were screened and confirmed to be negative for other BRD pathogenic variants within the mouse colonies.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNo abnormalities were observed in terms of appearance, mobility, or perinatal development in the C57BL/6J mice under normal feeding conditions (Supplemental File 1: video of mouse; the mouse model is identified by the tape on its tail).\u003c/p\u003e \u003cp\u003eGiven the extended lifespan of patients with the BRAT1 (p.V62E) mutation, the lifespan of the mouse model was closely monitored. Two model mice born on April 24, 2023, were raised until the time of writing and survived for over 18 months, equivalent to approximately 60 years in human terms (Fig.\u0026nbsp;3A). No significant abnormalities were observed during this period.\u003c/p\u003e \u003cp\u003eSince patients with BRAT1 (p.V62E) exhibit ataxic gait, the gait of the mouse model was tested. No significant differences were observed between the mouse model and WT mice (Fig.\u0026nbsp;3B and 3C). The open field test (OFT), a common method to assess exploratory behavior and general activity in mice, also revealed no differences between the mouse model and WT mice (Fig.\u0026nbsp;3D and 3E).\u003c/p\u003e \u003cp\u003eTreadmill running, a noninvasive method to evaluate fitness capacity, was conducted. In low-intensity tests, no obvious differences were observed between the mouse model and WT mice: both types of mice ran on the treadmill for over an hour without exhaustion. When the parameters were adjusted to high-intensity to determine peak physical capacity, the mouse model demonstrated better endurance compared to WT mice (Fig.\u0026nbsp;3F and 3H). The high-intensity rotarod test, which assesses motor coordination and balance, corroborated the treadmill results: the mouse model exhibited longer falling times than WT mice (Fig.\u0026nbsp;4).\u003c/p\u003e \u003cp\u003eSince the mouse model exhibited some phenotypic differences compared to the WT, RNA-seq was performed to explore potential underlying mechanisms. Brain tissue and gastrocnemius muscle tissue from the legs of three mouse models and three WT mice were collected for RNA extraction. Following RNA quality assessment, one sample from the gastrocnemius muscle tissue of both the mouse model and WT was excluded due to failing quality standards. All samples from the brain tissue met the quality criteria for sequencing. QC for library preparation and RNA-seq data were all passed.\u003c/p\u003e \u003cp\u003eIn the gastrocnemius muscle tissue, ten differentially expressed genes were identified, all of which were upregulated (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). In the brain tissue, four differentially expressed genes were found, with two upregulated and two downregulated (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Notably, there was no overlap in the differentially expressed genes between the brain tissue and gastrocnemius muscle tissue.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eTen differentially expressed genes in gastrocnemius muscle (GM) tissue. WT: wild type.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGM-2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGM\u0026ndash;3\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGM-WT-1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGM-WT-3\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eLog2FoldChange\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003epvalue\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eqvalue\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSNAP25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e36.95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e102.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e-9.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.64E-07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.0026\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSPIB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e9.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e390.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e-10.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.10E-07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.0026\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD8A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e11.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e203.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e-9.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.56E-06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.0075\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFOS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e254.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e295.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1240.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e653.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e-1.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.79E-06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.0075\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSARNP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e86.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e285.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e510.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e-2.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e6.93E-06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.0233\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOTUD1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2089.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2216.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8599.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3927.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e-1.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.15E-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.0322\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCCR7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e257.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e-10.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.68E-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.0383\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGLYCAM1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e983.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e-9.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.89E-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.0383\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS100A14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4.94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e180.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e-9.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.05E-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.0383\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e339.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e-6.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.89E-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.0487\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eFour differentially expressed genes in brain tissue. WT: wild type.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"10\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBrain-1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBrain-2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrain \u0026minus;\u0026thinsp;3\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBrain -WT-1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eBrain -WT-2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eBrain -WT-3\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eLog2FoldChange\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003epvalue\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eqvalue\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDZANK1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4810.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e6846.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5115.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10393.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e12159.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e12594.88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e-1.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e8.17E-11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.46E-06\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHOXA5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e200.909\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e368.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e8.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e5.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e2.21E-06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.0198\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM14434\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e57.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e72.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e86.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e401.95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e312.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e117.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e-1.94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e5.49E-06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.0266\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTLX3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e112.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e55.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.16E-17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.16E-17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4.16E-17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e8.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e5.95E-06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.0266\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThrough an analysis of patient information and protein structure, the BRAT1 mutation (c.185T\u0026thinsp;\u0026gt;\u0026thinsp;A, p.V62E) was selected to create a mouse model for further investigation into the mechanisms of BRAT1. While the majority of the explored phenotypes showed no significant differences between the mouse model and WT mice, the mouse model demonstrated better peak physical capacity. RNA-seq was operated to explore gene-phenotype relationships.\u003c/p\u003e \u003cp\u003eThere is a notable consistency between the phenotypes observed in the mouse model and the clinical manifestations of patients with the BRAT1 (p.V62E) mutation. The patient with the BRAT1 (p.V62E) mutation is the oldest reported case (24 years old) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], and similarly, the mouse model exhibited a long lifespan, suggesting that patients with this mutation may also have a normal lifespan. Both the mouse model and the patient experienced uneventful pregnancy and delivery, with the exception of clubfoot noted at birth in the patient. Additionally, no seizures were reported in either the mouse model or the patient.\u003c/p\u003e \u003cp\u003eSome clinical phenotypes, such as mild intellectual disability, motor development delay, language delay, and gaze-evoked nystagmus, are challenging to assess in a mouse model. Gait analysis was conducted to determine whether the mouse model exhibits ataxia, and the OFT was performed as a neurologic examination. Both gait analysis and OFT revealed no differences between the mouse model and WT mice, indicating that this mouse model is not suitable for studying nervous system-related phenotypes. However, the mouse model is a good model for assessing physical capacity. Physical capacity in patients with BRAT1 (p.V62E) has not been thoroughly evaluated, partly due to the challenges posed by ataxic gait. Gait analysis revealed that the mouse model has a normal gait without ataxia. Treadmill running and rotarod tests were used to evaluate the physical ability of the mouse model. The results showed no significant differences between the mouse model and WT mice during low-intensity testing, but the mouse model exhibited stronger endurance during high-intensity testing.\u003c/p\u003e \u003cp\u003eThe relationship between mitochondria and motor ability has been widely discussed [\u003cspan additionalcitationids=\"CR24\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Knockdown of BRAT1 has been shown to increase cellular glucose demand, significantly elevate reactive oxygen species (ROS) levels, enhance glycolysis and lactate accumulation, reduce mitochondrial pyruvate dehydrogenase (PDH) activity, and disrupt mitochondrial membrane potential [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Patients with BRAT1 (p.V62E) also exhibit decreased native PDH levels [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Prior to the treadmill running test, better endurance was expected in WT mice. However, the results were the opposite, as confirmed by both the treadmill running and rotarod tests.\u003c/p\u003e \u003cp\u003eElectron microscopy studies by Hoppeler's group in the 1970s and later identified increased mitochondrial volume in the skeletal muscle of endurance-trained individuals [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. So et al. reported that mitochondria localization is more condensed in BRAT1 knockdown cells [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], suggesting that mutated BRAT1 may increase mitochondrial volume. These findings provide an intriguing perspective on the relationship between BRAT1 and mitochondria.\u003c/p\u003e \u003cp\u003eStructural analysis revealed no significant differences between BRAT1 (p.V62E) and the WT protein. BRAT1 tightly interacts with the INTS9/INTS11 subunits of the Integrator complex, which is involved in processing the 3' ends of various noncoding RNAs and pre-mRNAs [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The missense mutation p.V62E partially disrupts the association between BRAT1 and the INTS11/INTS9 heterodimer [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The ten differentially expressed genes identified in the gastrocnemius muscle and the four differentially expressed genes in the brain tissue may represent potential targets of the BRAT1/INTS9/INTS11 trimeric complex.\u003c/p\u003e \u003cp\u003eRNA-seq revealed ten differentially expressed genes in gastrocnemius muscle tissue and four differentially expressed genes in brain tissue, with no overlap between the two sets of genes. These results suggest that the function of the BRAT1 gene may vary across different tissues. No direct connection was found between these 14 genes and mitochondrial function. Among the identified genes, SPIB[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], CD8A[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], LCK[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], FOS[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], OTUD1[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], S100A14[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] and CCR7[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] are closely associated with the immune system and represent important targets in immunological research. Haydo et al. reported that BRAT1 contributes to glioblastoma (GBM) growth and invasion [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In the brain tissue of the mouse model, HOXA5 was upregulated by the mutated BRAT1. HOXA5 amplification has been identified as a genetic biomarker for predicting worse GBM outcomes, as it enhances PTPRZ1-mediated survival of glioma stem cells [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. These findings suggest that point mutations in BRAT1 may influence the immune system and GBM growth and invasion. However, no significant expression changes related to these effects were observed at the mouse model level.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThis study presents the first successfully constructed BRAT1 mutant mouse model, marking a significant milestone in BRAT1 research. This achievement not only provides confidence for developing additional mouse models but also offers an intriguing perspective on understanding the relationship between BRAT1 and mitochondrial function. The mouse model demonstrates a degree of consistency with the clinical phenotypes observed in patients and may serve as a predictive tool for patient prognosis. The diverse functions of BRAT1 highlight its complexity and underscore the need for further research to fully elucidate its roles and mechanisms.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eBRCA1: breast cancer 1.\u003c/p\u003e\n\u003cp\u003eATM: ataxia-telangiectasia mutated.\u003c/p\u003e\n\u003cp\u003eBAAT1/BRAT1: BRCA1-associated protein required for ATM activation-1.\u003c/p\u003e\n\u003cp\u003eRMFSL: Rigidity and Multifocal Seizure Syndrome, Lethal Neonatal.\u003c/p\u003e\n\u003cp\u003eBRD: BRAT1-related disease.\u003c/p\u003e\n\u003cp\u003eKI: knock-in.\u003c/p\u003e\n\u003cp\u003ePCR: polymerase chain reaction.\u003c/p\u003e\n\u003cp\u003eWT: wild-type.\u003c/p\u003e\n\u003cp\u003eRNA-seq: RNA sequencing.\u003c/p\u003e\n\u003cp\u003eRIN: RNA integrity number.\u003c/p\u003e\n\u003cp\u003eQC: quality control.\u003c/p\u003e\n\u003cp\u003eOFT: open field test.\u003c/p\u003e\n\u003cp\u003eROS: reactive oxygen species.\u003c/p\u003e\n\u003cp\u003ePDH: pyruvate dehydrogenase.\u003c/p\u003e\n\u003cp\u003eGBM: glioblastoma.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003e1. Ethics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2. Consent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3. Availability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData can be made available from the corresponding author after discussion with the Institutional Review Board.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4. Competing interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e5. Funding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by a grant from the National Natural Science Foundation of China (82202059).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e6. Authors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWJ K wrote the manuscript, supervised data and manuscript. C L collected and analyzed related articles and data. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e7. Acknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAglipay JA, Martin SA, Tawara H, Lee SW, Ouchi T: \u003cstrong\u003eATM activation by ionizing radiation requires BRCA1-associated BAAT1\u003c/strong\u003e. \u003cem\u003eThe Journal of biological chemistry \u003c/em\u003e2006, \u003cstrong\u003e281\u003c/strong\u003e(14):9710-9718 doi: 10.1074/jbc.M510332200.\u003c/li\u003e\n\u003cli\u003ePuffenberger EG, Jinks RN, Sougnez C, Cibulskis K, Willert RA, Achilly NP, Cassidy RP, Fiorentini CJ, Heiken KF, Lawrence JJ\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eGenetic mapping and exome sequencing identify variants associated with five novel diseases\u003c/strong\u003e. \u003cem\u003ePloS one \u003c/em\u003e2012, \u003cstrong\u003e7\u003c/strong\u003e(1):e28936 doi: 10.1371/journal.pone.0028936.\u003c/li\u003e\n\u003cli\u003eSaunders CJ, Miller NA, Soden SE, Dinwiddie DL, Noll A, Alnadi NA, Andraws N, Patterson ML, Krivohlavek LA, Fellis J\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eRapid whole-genome sequencing for genetic disease diagnosis in neonatal intensive care units\u003c/strong\u003e. \u003cem\u003eScience translational medicine \u003c/em\u003e2012, \u003cstrong\u003e4\u003c/strong\u003e(154):154ra135 doi: 10.1126/scitranslmed.3004041.\u003c/li\u003e\n\u003cli\u003eHooshmand SJ, Chohan KL, Raghunathan A, Renaud DL, Ruff MW: \u003cstrong\u003eBRAT1-Associated Leukodystrophy Exacerbated by Classic Hodgkin Lymphoma-Directed Therapy\u003c/strong\u003e. \u003cem\u003eThe neurologist \u003c/em\u003e2023 doi: 10.1097/nrl.0000000000000539.\u003c/li\u003e\n\u003cli\u003eSo EY, Ouchi T: \u003cstrong\u003eThe Potential Role of BRCA1-Associated ATM Activator-1 (BRAT1) in Regulation of mTOR\u003c/strong\u003e. \u003cem\u003eJournal of cancer biology \u0026amp; research \u003c/em\u003e2013, \u003cstrong\u003e1\u003c/strong\u003e(1) doi:\u003c/li\u003e\n\u003cli\u003eSo EY, Ouchi T: \u003cstrong\u003eBRAT1 deficiency causes increased glucose metabolism and mitochondrial malfunction\u003c/strong\u003e. \u003cem\u003eBMC cancer \u003c/em\u003e2014, \u003cstrong\u003e14\u003c/strong\u003e:548 doi: 10.1186/1471-2407-14-548.\u003c/li\u003e\n\u003cli\u003eDokaneheifard S, Gomes Dos Santos H: \u003cstrong\u003eNeuronal differentiation requires BRAT1 complex to remove REST from chromatin\u003c/strong\u003e. 2024, \u003cstrong\u003e121\u003c/strong\u003e(23):e2318740121 doi: 10.1073/pnas.2318740121.\u003c/li\u003e\n\u003cli\u003eCui C, Dwyer BG, Liu C, Abegg D, Cai ZJ, Hoch DG, Yin X, Qiu N, Liu JQ, Adibekian A: \u003cstrong\u003eTotal Synthesis and Target Identification of the Curcusone Diterpenes\u003c/strong\u003e. 2021, \u003cstrong\u003e143\u003c/strong\u003e(11):4379-4386 doi: 10.1021/jacs.1c00557.\u003c/li\u003e\n\u003cli\u003eHanes I, Kozenko M, Callen DJ: \u003cstrong\u003eLethal Neonatal Rigidity and Multifocal Seizure Syndrome--A Misnamed Disorder?\u003c/strong\u003e \u003cem\u003ePediatric neurology \u003c/em\u003e2015, \u003cstrong\u003e53\u003c/strong\u003e(6):535-540 doi: 10.1016/j.pediatrneurol.2015.09.002.\u003c/li\u003e\n\u003cli\u003eMundy SA, Krock BL, Mao R, Shen JJ: \u003cstrong\u003eBRAT1-related disease--identification of a patient without early lethality\u003c/strong\u003e. \u003cem\u003eAmerican journal of medical genetics Part A \u003c/em\u003e2016, \u003cstrong\u003e170\u003c/strong\u003e(3):699-702 doi: 10.1002/ajmg.a.37434.\u003c/li\u003e\n\u003cli\u003eSrivastava S, Olson HE, Cohen JS, Gubbels CS, Lincoln S, Davis BT, Shahmirzadi L, Gupta S, Picker J, Yu TW\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eBRAT1 mutations present with a spectrum of clinical severity\u003c/strong\u003e. \u003cem\u003eAmerican journal of medical genetics Part A \u003c/em\u003e2016, \u003cstrong\u003e170\u003c/strong\u003e(9):2265-2273 doi: 10.1002/ajmg.a.37783.\u003c/li\u003e\n\u003cli\u003eKong W, Cao X, Lu C: \u003cstrong\u003eClinical characteristics of BRAT1-related disease: a systematic literature review\u003c/strong\u003e. \u003cem\u003eActa neurologica Belgica \u003c/em\u003e2024, \u003cstrong\u003e124\u003c/strong\u003e(4):1281-1288 doi: 10.1007/s13760-024-02507-y.\u003c/li\u003e\n\u003cli\u003eCarapancea E, Cornet MC: \u003cstrong\u003eClinical and Neurophysiologic Phenotypes in Neonates With BRAT1 Encephalopathy\u003c/strong\u003e. 2023, \u003cstrong\u003e100\u003c/strong\u003e(12):e1234-e1247 doi: 10.1212/wnl.0000000000206755.\u003c/li\u003e\n\u003cli\u003eKim D, Langmead B, Salzberg SL: \u003cstrong\u003eHISAT: a fast spliced aligner with low memory requirements\u003c/strong\u003e. 2015, \u003cstrong\u003e12\u003c/strong\u003e(4):357-360 doi: 10.1038/nmeth.3317.\u003c/li\u003e\n\u003cli\u003eSmith NJ, Lipsett J, Dibbens LM, Heron SE: \u003cstrong\u003eBRAT1-associated neurodegeneration: Intra-familial phenotypic differences in siblings\u003c/strong\u003e. \u003cem\u003eAmerican journal of medical genetics Part A \u003c/em\u003e2016, \u003cstrong\u003e170\u003c/strong\u003e(11):3033-3038 doi: 10.1002/ajmg.a.37853.\u003c/li\u003e\n\u003cli\u003eOatts JT, Duncan JL, Hoyt CS, Slavotinek AM, Moore AT: \u003cstrong\u003eInner retinal dystrophy in a patient with biallelic sequence variants in BRAT1\u003c/strong\u003e. \u003cem\u003eOphthalmic genetics \u003c/em\u003e2017, \u003cstrong\u003e38\u003c/strong\u003e(6):559-561 doi: 10.1080/13816810.2017.1290118.\u003c/li\u003e\n\u003cli\u003eNuovo S, Baglioni V, De Mori R, Tardivo S, Caputi C, Ginevrino M, Micalizzi A, Masuelli L, Federici G, Casella A\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eClinical variability at the mild end of BRAT1-related spectrum: Evidence from two families with genotype-phenotype discordance\u003c/strong\u003e. \u003cem\u003eHuman mutation \u003c/em\u003e2022, \u003cstrong\u003e43\u003c/strong\u003e(1):67-73 doi: 10.1002/humu.24293.\u003c/li\u003e\n\u003cli\u003eQi Y, Ji X, Ding H, Liu L, Zhang Y, Yin A: \u003cstrong\u003eNovel Biallelic Variant in the BRAT1 Gene Caused Nonprogressive Cerebellar Ataxia Syndrome\u003c/strong\u003e. \u003cem\u003eFrontiers in genetics \u003c/em\u003e2022, \u003cstrong\u003e13\u003c/strong\u003e:821587 doi: 10.3389/fgene.2022.821587.\u003c/li\u003e\n\u003cli\u003eFern\u0026aacute;ndez-Ja\u0026eacute;n A, \u0026Aacute;lvarez S, So EY, Ouchi T, Jim\u0026eacute;nez de la Pe\u0026ntilde;a M, Duat A, Fern\u0026aacute;ndez-Mayoralas DM, Fern\u0026aacute;ndez-Perrone AL, Albert J, Calleja-P\u0026eacute;rez B: \u003cstrong\u003eMutations in BRAT1 cause autosomal recessive progressive encephalopathy: Report of a Spanish patient\u003c/strong\u003e. \u003cem\u003eEuropean journal of paediatric neurology : EJPN : official journal of the European Paediatric Neurology Society \u003c/em\u003e2016, \u003cstrong\u003e20\u003c/strong\u003e(3):421-425 doi: 10.1016/j.ejpn.2016.02.009.\u003c/li\u003e\n\u003cli\u003eMahjoub A, Cihlarova Z, T\u0026eacute;treault M, MacNeil L, Sondheimer N, Caldecott KW, Hanzlikova H, Yoon G: \u003cstrong\u003eHomozygous pathogenic variant in BRAT1 associated with nonprogressive cerebellar ataxia\u003c/strong\u003e. \u003cem\u003eNeurology Genetics \u003c/em\u003e2019, \u003cstrong\u003e5\u003c/strong\u003e(5):e359 doi: 10.1212/nxg.0000000000000359.\u003c/li\u003e\n\u003cli\u003eFowkes R, Elwan M, Akay E, Mitchell CJ, Thomas RH, Lewis-Smith D: \u003cstrong\u003eA review of the clinical spectrum of BRAT1 disorders and case of developmental and epileptic encephalopathy surviving into adulthood\u003c/strong\u003e. \u003cem\u003eEpilepsy \u0026amp; behavior reports \u003c/em\u003e2022, \u003cstrong\u003e19\u003c/strong\u003e:100549 doi: 10.1016/j.ebr.2022.100549.\u003c/li\u003e\n\u003cli\u003eKong W, Cao X, Lu C: \u003cstrong\u003eClinical characteristics of BRAT1-related disease: a systematic literature review\u003c/strong\u003e. \u003cem\u003eActa neurologica Belgica \u003c/em\u003e2024 doi: 10.1007/s13760-024-02507-y.\u003c/li\u003e\n\u003cli\u003eGroup. MSGLAMS: \u003cstrong\u003eTemporal dynamics of the multi-omic response to endurance exercise training\u003c/strong\u003e. \u003cem\u003eNature \u003c/em\u003e2024, \u003cstrong\u003e629\u003c/strong\u003e(8010):174-183 doi: 10.1038/s41586-023-06877-w.\u003c/li\u003e\n\u003cli\u003eHargreaves M, Spriet LL: \u003cstrong\u003eSkeletal muscle energy metabolism during exercise\u003c/strong\u003e. 2020, \u003cstrong\u003e2\u003c/strong\u003e(9):817-828 doi: 10.1038/s42255-020-0251-4.\u003c/li\u003e\n\u003cli\u003eGaribotti MC, Perry CGR: \u003cstrong\u003eStrength athletes and mitochondria: it\u0026apos;s about \u0026apos;time\u0026apos;\u003c/strong\u003e. 2023, \u003cstrong\u003e601\u003c/strong\u003e(14):2753-2754 doi: 10.1113/jp284856.\u003c/li\u003e\n\u003cli\u003eHoppeler H, Howald H, Conley K, Lindstedt SL, Claassen H, Vock P, Weibel ER: \u003cstrong\u003eEndurance training in humans: aerobic capacity and structure of skeletal muscle\u003c/strong\u003e. \u003cem\u003eJournal of applied physiology (Bethesda, Md : 1985) \u003c/em\u003e1985, \u003cstrong\u003e59\u003c/strong\u003e(2):320-327 doi: 10.1152/jappl.1985.59.2.320.\u003c/li\u003e\n\u003cli\u003eCihlarova Z, Kubovciak J, Sobol M, Krejcikova K: \u003cstrong\u003eBRAT1 links Integrator and defective RNA processing with neurodegeneration\u003c/strong\u003e. 2022, \u003cstrong\u003e13\u003c/strong\u003e(1):5026 doi: 10.1038/s41467-022-32763-6.\u003c/li\u003e\n\u003cli\u003eMontes-Moreno S, Ramos-Medina R, Mart\u0026iacute;nez-L\u0026oacute;pez A, Barrionuevo Cornejo C, Parra Cubillos A, Quintana-Truyenque S, Rodriguez Pinilla SM, Pajares R, Sanchez-Verde L, Martinez-Torrecuadrada J\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eSPIB, a novel immunohistochemical marker for human blastic plasmacytoid dendritic cell neoplasms: characterization of its expression in major hematolymphoid neoplasms\u003c/strong\u003e. \u003cem\u003eBlood \u003c/em\u003e2013, \u003cstrong\u003e121\u003c/strong\u003e(4):643-647 doi: 10.1182/blood-2012-08-447599.\u003c/li\u003e\n\u003cli\u003eChu J, Tang S, Li T, Fan H: \u003cstrong\u003eThe Role of CD8A in the Immune Microenvironment of Breast Cancer\u003c/strong\u003e. \u003cem\u003eFrontiers in bioscience (Landmark edition) \u003c/em\u003e2024, \u003cstrong\u003e29\u003c/strong\u003e(2):73 doi: 10.31083/j.fbl2902073.\u003c/li\u003e\n\u003cli\u003eWu J, Li G, Li L, Li D, Dong Z, Jiang P: \u003cstrong\u003eAsparagine enhances LCK signalling to potentiate CD8(+) T-cell activation and anti-tumour responses\u003c/strong\u003e. 2021, \u003cstrong\u003e23\u003c/strong\u003e(1):75-86 doi: 10.1038/s41556-020-00615-4.\u003c/li\u003e\n\u003cli\u003eMa S, Sandhoff R, Luo X, Shang F: \u003cstrong\u003eSerine enrichment in tumors promotes regulatory T cell accumulation through sphinganine-mediated regulation of c-Fos\u003c/strong\u003e. 2024, \u003cstrong\u003e9\u003c/strong\u003e(94):eadg8817 doi: 10.1126/sciimmunol.adg8817.\u003c/li\u003e\n\u003cli\u003eOikawa D, Shimizu K: \u003cstrong\u003ePleiotropic Roles of a KEAP1-Associated Deubiquitinase, OTUD1\u003c/strong\u003e. 2023, \u003cstrong\u003e12\u003c/strong\u003e(2) doi: 10.3390/antiox12020350.\u003c/li\u003e\n\u003cli\u003eWang C, Chen Y, Xinpeng Y, Xu R, Song J, Ruze R, Xu Q, Zhao Y: \u003cstrong\u003eConstruction of immune-related signature and identification of S100A14 determining immune-suppressive microenvironment in pancreatic cancer\u003c/strong\u003e. \u003cem\u003eBMC cancer \u003c/em\u003e2022, \u003cstrong\u003e22\u003c/strong\u003e(1):879 doi: 10.1186/s12885-022-09927-0.\u003c/li\u003e\n\u003cli\u003eLiu J, Cheng Y, Zhang X, Chen Y, Zhu H, Chen K, Liu S, Li Z, Cao X: \u003cstrong\u003eGlycosyltransferase Extl1 promotes CCR7-mediated dendritic cell migration to restrain infection and autoimmunity\u003c/strong\u003e. \u003cem\u003eCell reports \u003c/em\u003e2023, \u003cstrong\u003e42\u003c/strong\u003e(1):111991 doi: 10.1016/j.celrep.2023.111991.\u003c/li\u003e\n\u003cli\u003eHaydo A, Schmidt J, Crider A, K\u0026ouml;gler T, Ertl J, Hehlgans S, Hoffmann ME, Rathore R, G\u0026uuml;ll\u0026uuml;l\u0026uuml; \u0026Ouml;, Wang Y\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eBRAT1 - a new therapeutic target for glioblastoma\u003c/strong\u003e. \u003cem\u003eCellular and molecular life sciences : CMLS \u003c/em\u003e2025, \u003cstrong\u003e82\u003c/strong\u003e(1):52 doi: 10.1007/s00018-024-05553-0.\u003c/li\u003e\n\u003cli\u003eHe ZC, Liu Q, Yang KD, Chen C, Zhang XN, Wang WY, Zeng H, Wang B, Liu YQ, Luo M\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eHOXA5 is amplified in glioblastoma stem cells and promotes tumor progression by transcriptionally activating PTPRZ1\u003c/strong\u003e. \u003cem\u003eCancer letters \u003c/em\u003e2022, \u003cstrong\u003e533\u003c/strong\u003e:215605 doi: 10.1016/j.canlet.2022.215605.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"BRAT1, mouse model, mitochondria, endurance","lastPublishedDoi":"10.21203/rs.3.rs-6434862/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6434862/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eBRAT1 (BRCA1-associated ataxia telangiectasia mutated activator 1) plays a crucial role in several vital biological processes, including the DNA damage response and the maintenance of mitochondrial homeostasis. Dysfunction in BRAT1 leads to a range of clinical phenotypes, with the majority of affected individuals succumbing before reaching one year of age.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThrough an analysis of previous literature, the homozygous BRAT1 p.V62E mutation (GTG to GAG) was selected to construct a mouse model. Homozygous BRAT1 p.V62E knock-in mice with a C57BL/6J background were generated using CRISPR/Cas9 technology, and the point mutation was confirmed by Sanger sequencing. The results revealed no significant differences between the mutant mice and wild-type controls during low-intensity testing. However, the mutant mice exhibited enhanced endurance during high-intensity testing. RNA sequencing analysis identified ten differentially expressed genes in the gastrocnemius muscle and four differentially expressed genes in the brain tissue of the mutant mice.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThis represents the first successful construction of a BRAT1 mutant mouse model. This achievement not only provides confidence for developing additional mouse models but also offers a valuable perspective for understanding the relationship between BRAT1 and mitochondrial function. The mouse model demonstrates a degree of consistency with the clinical phenotypes observed in patients and may serve as a predictive tool for patient prognosis.\u003c/p\u003e","manuscriptTitle":"Phenotypic exploration of Mice with a Point Mutation in BRAT1","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-19 10:36:21","doi":"10.21203/rs.3.rs-6434862/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0649920f-1349-42e1-80a9-b0a54f0b1ed8","owner":[],"postedDate":"May 19th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":48563512,"name":"Health sciences/Medical research/Experimental models of disease"},{"id":48563513,"name":"Health sciences/Medical research/Paediatric research"}],"tags":[],"updatedAt":"2025-06-06T04:08:38+00:00","versionOfRecord":[],"versionCreatedAt":"2025-05-19 10:36:21","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6434862","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6434862","identity":"rs-6434862","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}