Pro-resolving Annexin A1-derived peptide Ac2-26 reduces nociception and mitigates joint damage in experimental osteoarthritis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Pro-resolving Annexin A1-derived peptide Ac2-26 reduces nociception and mitigates joint damage in experimental osteoarthritis Paula Lima Bosi, Amanda Dias Braga, Celso Martins Queiroz-Junior, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7013885/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objectives We investigated whether treatment with Annexin A1 (AnxA1) ameliorated joint nociception and tissue damage in an experimental osteoarthritis (OA) model. Design: OA was induced by injection of collagenase into the tibiofemoral joint of wild-type (WT) and AnxA1-deficient male Balb/c mice. The control group received saline. Groups of WT mice were treated weekly with Ac2-26, an active peptide corresponding to the N-terminal region of AnxA1, in the affected joint. Mechanical nociception was analyzed weekly, and samples were collected 6 weeks after OA induction to analyze histopathology and markers of joint damage by qPCR and flow cytometry. Results The expression of Anxa1 is upregulated in the joints at the 1st and 3rd week and returned to the basal level at the 6th week after OA induction. AnxA1-deficient mice had persistent nociception and increased joint inflammation when compared to WT mice, although both groups had comparable cartilage damage. In WT mice, the treatment with Ac2-26 decreased joint nociception, tissue damage, and the expression of metalloproteinase-3 in the joint tissue, even when started in the 3rd week after induction of OA. Collagenase injection increased the number of FAP + CD90 − fibroblast-like and CX3CR1 + macrophage-like synoviocytes expressing RANKL when compared to saline-injected mice. Treatment with Ac2-26 normalized the latter parameters. Conclusions AnxA1 and Ac2-26 are promising molecules that regulate key processes in OA, effectively mitigating tissue damage and dysfunction in a model of OA in mice. Osteoarthritis Annexin A1 Inflammation Pro-resolving mediator Ac2-26 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 INTRODUCTION Osteoarthritis (OA) is one of the most important causes of functional limitation and disability, especially among women and elderly people [ 1 ]. It is a chronic disease affecting the whole joint tissues, primarily leading to progressive damage to articular cartilage and, subsequently, to the subchondral bone and surrounding synovial structures [ 2 ]. Pain is the typical OA symptom that leads people to present to healthcare providers and its diagnosis is helped with image exams [ 3 ]. Although the progression of OA is generally slow, it can potentially lead to complete joint impairment, as no OA-modifying medications have yet been approved, resulting in a strong indication for joint replacement surgery, particularly of the hip and knee joints [ 4 ], [ 5 ]. Synovitis has been directly associated with the progression of joint damage, pain, and disability in patients with OA. It is characterized by important changes in synoviocyte functions, including their uncontrolled proliferation and invasion of surrounding tissues [ 6 ], [ 7 ]. The sustained activation of these cells together with persistent leukocyte infiltration, especially composed of mononuclear cells, produce inflammatory mediators involved in the pathogenesis of OA [ 8 ]. There is also activation of matrix metalloproteinases (MMP3, MMP13) and release of alarmins (S100A8/9), which are involved in tissue damage in OA [ 9 ], [ 10 ]. In addition to eicosanoids, cytokines, such as IL-6 and TGFβ, and chemokines, such as CCL2 and CCL17, contribute to this process, which leads to the aggregation and death of chondrocytes, activation of osteoclasts and osteoblasts of the subchondral bone. Activation of these cells results in disordered cartilaginous and bone neoformation, promotes osteophytosis that coexists with erosion of the cartilage and the underlying bone, with irreversible damage to the joint [ 11 ], [ 12 ], [ 13 ], [ 14 ]. Therapeutically, steroidal (corticosteroid) and nonsteroidal (NSAID) anti-inflammatory drugs remain the most widely used analgesics but, in addition to their questionable efficacy, adverse events limit their use and do not alter the prognosis of OA[ 15 ], [ 16 ]. Pro-resolving mediators, which actively participate in interrupting the inflammatory response and promote tissue repair [ 17 ], are suggested as capable of relieving pain and halting the progression of rheumatic diseases. Their actions can be resumed by, among others, stopping polymorphonuclear infiltration in the tissue and induction of their apoptosis, enhancing their clearance by macrophages (efferocytosis), reprogramming macrophage phenotype, and promoting pain remission [ 18 ], [ 19 ]. Annexin A1 (AnxA1), a glucocorticoid-regulated protein, has a potent effect on the control of inflammation, as anti-inflammatory action by inhibiting the enzymes phospholipase A2 (PLA2) and cyclooxygenase-2 (COX-2) and stimulating the synthesis of anti-inflammatory molecules, such as the cytokine IL-10 [ 20 ], [ 21 ]. The peptide Ac2-26 derived from the N-terminal region of AnxA1 has been demonstrated to have a potent pro-resolving effect in experimental models of arthritis, reducing the intensity and durability of joint inflammation and nociception [ 22 ]. In the context of OA, a tendency towards a decrease of AnxA1 expression was observed in the cartilage of individuals suffering from the disease when compared to the cartilage of control individuals, indicating the participation of the protein in the pathogenesis of the disease [ 23 ], [ 24 ]. Thus, this study aimed to investigate the contribution and potential therapeutic use of AnxA1 to the inflammation, damage, and nociception in an experimental model of OA induced by the injection of collagenase in mice. METHODS Animals and experimental model of osteoarthritis Adult (8 weeks old) male wild-type (WT) mice and mice deficient for AnxA1 (AnxA1 −/− ) of Balb/c background were used in this study (Approved by local ethical committee #240/2020). The experimental model of OA was induced by injecting type VII collagenase (Sigma-Aldrich, C0773, 1U/10µL)) into the joint cavity of anesthetized mice (ketamine and xylazine, i.p.) at days 1 and 3, with the analyses evaluated weekly up to week 6 after the first injection of collagenase [ 25 ]. As standardization, we used the right knee for the collagenase or saline injections. Groups of WT mice were treated weekly with an intra-articular injection of Ac2-26 (10 µM / 10 µL), starting at different time points: from day 7, day 14, or day 21 after the first injection of collagenase. For the treatments, the animals were anesthetized with inhaled isoflurane. Nociception measurements were performed weekly, immediately before the treatments with Ac2-26. Untreated animals received saline injections. At different moments, mice were killed by overexposure to the anesthetic solution (ketamine and xylazine, i.p.), and joint tissues were collected for histopathology analysis and markers of joint inflammation and damage. Mechanical nociception analysis Mice were placed individually in acrylic cages (12 × 10 x 17 cm) with a wire grid floor, in a noise-controlled room, for 20 minutes. After this time, the manifestation of the exploratory behavior was nullified and all mice remained quiet, allowing the evaluation of the nociceptive response. To identify the withdrawal threshold, a von Frey electronic algesimeter (INSIGHT Instruments, Ribeirão Preto, SP, Brazil) was applied according to the methods previously used [ 26 ]. Using a portable force transducer with a polypropylene tip (4.15 mm), a vertical and constant force was applied to the central plantar surface of the mouse's paw, a stimulus for knee flexion, that triggers a paw withdrawal movement, the characteristic aversive behavior. The maximum value (in grams) was recorded by an electronic component of the device. The withdrawal threshold was calculated by repeating the procedure in triplicate for each mouse (and the means were expressed as absolute values) and was conducted in a blinded experimental condition. Histology H&E and Safranin-O/fast green staining Samples from the tibiofemoral joint were collected and fixed in 10% (v/v) buffered formalin (pH 7.4) for 48 h and decalcified for 30 days in 14% EDTA (pH 7.3). Tissues were embedded in paraffin, sectioned (5 µm), and stained with Hematoxylin-Eosin (H&E). Then, the samples were examined and classified by a pathologist blindly regarding the following parameters: severity of synovial hyperplasia, intensity of inflammatory infiltrate, and changes in bone and cartilage. For the OA score, the samples were also stained Safranin-O/fast green via standard procedures. Two examiners blinded to the treatment groups evaluated the severity of cartilage degradation using a (32). The evaluation parameters were as follows: 1) cartilage structure (0–6), 2) cartilage cells (0–3), 3) Safranin-O/Fast Green staining (0–4), and 4) tidemark integrity (0–1). Western Blot The protein content of the periarticular tissue from the experimental OA model was determined using the Bradford assay reagent. The extracts (20 µg) were separated by electrophoresis on a 10% SDS-PAGE gel and transferred to nitrocellulose membranes. The membranes were blocked overnight at 4°C with PBS containing 5% (w/v) skim milk and 0.1% Tween 20, washed three times with PBS containing 0.1% Tween 20, and then incubated with anti-AnxA1 and anti-β-actin antibodies in PBS containing 5% (w/v) BSA and 0.1% Tween 20. After washing, the membranes were incubated with a peroxidase-conjugated secondary antibody. Immunoreactive bands were visualized using an ECL detection system. AnxA1 values were quantified using densitometric analysis software (ImageJ, National Institutes of Health, Bethesda, MD). Changes in protein levels were estimated relative to the control (saline-injected group), and the results were expressed as an increase in arbitrary units of AnxA1 normalized to β-actin values in the same sample. Quantification of mRNA expression by qRT-PCR Total RNA was extracted and isolated from the tissue surrounding the joint of mice using Trizol reagent (Invitrogen Life Technologies Corporation- Carlsbad, CA, USA) according to the manufacturer's instructions. The purity of the total RNA was determined using a Nanodrop 1000 spectrophotometer (Thermo Scientific- Waltham, MA, USA). For the reverse transcription of 500 ng of total RNA isolated to cDNA, a mixture containing the reserve transcriptase, SuperScript III, a recombinant ribonuclease inhibitor (RNAse Out; Invitrogen Life Technologies Corporation), and dithiothreitol (DTT; 1 mM) was used. The reverse transcription step was performed in duplicate and the total cDNA concentration was similar in all samples. For quantitative real-time qPCR, the Power SYBR Master Mix reagent (Invitrogen Life Technologies Corporation) and the pars primers (Integrated DNA Technologies- Coralville, IA, USA) plus cDNA were placed in a 96-well plate, in duplicate, at a total reaction volume of 10 µL, using the StepOneTM system (Applied Biosystems, Waltham, MA, USA) in programmed reaction: initial heating at 95°C for 10 min, followed by 40 cycles at 95°C for 60 s and 48°C for 1 min. Data were analyzed using the StepOneTM System software and processed by the 2^-ΔCT method. This method directly uses the CT (threshold cycle) information generated by a qPCR system to calculate the relative expression of genes in the target and reference samples, using a reference gene to normalize the RT-qPCR. The primer pairs sequences used were: mmp3 : FW: CACTCACAGACCTGACTCGGTT RV: AAGCAGGATCACAGTTGGCTGG il10 : FW: TCTGGCTCTGCTACTGGTCT RV: CTCCAGGCTCCCTCTGTTG The initiator and probe sequences were verified with the BLAST™ software. The 18s was used as the reference control gene and the results were expressed as "Fold Increase" compared to the negative control groups injected with saline. Flow cytometry analysis A pool of two synovial tissues from the tibiofemoral joint was used for each sample analyzed by flow cytometry. Samples were incubated with collagenase (10 mg/mL; Collagenase D – Sigma Aldrich #C2139) for 1 h at 37°C followed by passage through a 70 µm cell strainer to obtain cell suspensions. For the identification of macrophage population, anti-CD45 PercP (Biolegends #103131), anti-CD11b APC-Cy7 (BD Pharmingen #562127), anti-F4/80 FITC (Biolegends #123107), and anti-CX3CR1 + PECy7 (Biolegends #149015) were used. Anti-CD90 PE (Biolegends #109006) and anti-FAP BV421 (eBioscience #BMS168) were used for synovial fibroblasts. Anti-RANKL PE (BD Pharmingen #560295) was used for the analysis of synoviocyte activation. After surface marking (30 min), cells were fixed by incubation with 4% formaldehyde for 20 minutes. The negative controls were cells labeled only with secondary anti-rabbit antibodies bound to fluorochromes. The labeled cells were acquired with the BD FACSCanto II cell analyzer (BD Bioscience) and analyzed with the FlowJo software (Tree Star Inc., USA). Statistical analysis The data obtained were statistically analyzed and the normality of the data (Shapiro-Wilk test) using the GraphPad Prism v9.5 program (GraphPad Software Inc., CA, USA) and expressed as mean ± standard error of the mean (SEM). The differences between the means were compared using analysis of variance (ANOVA) with Tukey's post-test. The results were considered significant when the p-value < 0.05 (*). RESULTS AnxA1 is transiently expressed in synovial tissue and its absence is associated with increased joint nociception and inflammation in experimental OA After induction of experimental OA in wild-type animals, the tissue surrounding the affected joint was removed to evaluate AnxA1 expression. As observed in Fig. 1 , there was an increase in the expression of the intact and active form of AnxA1 on days 7 and 21, with a return to basal levels on day 42. As pain is a hallmark of OA disability, we evaluated mechanical nociception at different time points after collagenase injection (Fig. 1 C, D). The peak of joint nociception occurred 1 week after the first intra-articular challenge with collagenase, with a very low force tolerated by these mice as observed by their paw withdrawal threshold (Fig. 1 C). It is also clear that the nociception decreased over the following weeks, as demonstrated in other studies using the same OA model [ 27 ], [ 28 ], but there was still hypernociception above the results found in the basal evaluations. The maximal nociception observed in AnxA1 −/− mice was like that observed in WT mice, but the increased nociception did not return to baseline in AnxA1 −/− mice (Fig. 1 C). The evaluation of the area under the curves (AUC) of nociception showed that AnxA1 −/− mice had lower paw withdrawal thresholds (Fig. 1 D). Given that significant tissue alterations in joint structures in this model manifest weeks after collagenase injection [ 27 ], [ 29 ], the histopathological analysis was performed only at 6 weeks after the first collagenase challenge, the last period of observation. This model and the disease in humans are associated with relatively mild synovitis and signs of inflammation when compared to other common arthritis, such as rheumatoid arthritis [ 30 ] and gout [ 31 ]. As evidenced by H&E staining, a mild inflammatory score was evident in collagenase-injected WT mice as compared to saline-injected WT mice (Fig. 2 A, B). However, OA Anxa1 −/− mice had increased inflammatory scores when compared to the OA WT group (Fig. 2 A, B). On the other hand, based on Safranin-O/Fast-green staining, both OA WT and OA Anxa1 −/− groups presented intense loss of joint structure compared to the respective saline-injected groups, but without differences between them (Fig. 2 A, C). Treatment with the AnxA1-derived peptide, Ac2-26, improves nociception and joint damage in experimental OA As there was sustained higher nociception and increased inflammatory score in the absence of AnxA1 as compared to WT mice in this model, it was investigated whether the peptide Ac2-26 could control these hallmark signs of OA disease. Ac2-26 is the N-terminal part of Annexin-A1 and mimics the anti-inflammatory and pro-resolving effects of the intact protein [ 32 ]. Ac2-26 was given intra-articularly once a week, in the same joint that received collagenase, and treatment started at the 1st, 2nd, or 3rd week after the first injection of collagenase (Fig. 3 A). Nociception was evaluated weekly just before the treatment with Ac2-26. As shown in Fig. 3 B, the treatment with Ac2-26 decreased joint nociception regardless of when it was started. By analyzing the areas under the curve, plotted from one week after the beginning of each treatment, there was a significant reduction of joint nociception (higher paw withdrawal threshold) when the Ac2-26 treatment started from the 1st and 3rd week after the first injection of collagenase (Fig. 3 C). Interestingly, there was no reduction in the inflammatory score in the histopathology analysis regardless of the moment when the treatment was started (data shown). However, the treatment strategies caused a substantial reduction in bone and cartilage damage as evaluated using the OARSI score for this model as compared to the non-treated osteoarthritic group (Fig. 4 B, C). The reduction of tissue damage in Ac2-26-treated mice was associated with reduced levels of metalloproteinase 3 in the tissue surrounding the joint in these groups (Fig. 5 B). Interestingly, there was a tendency to increase IL-10 in this tissue with Ac2-26 treatment (Fig. 5 C), corroborating with reduced joint damage. Treatment with Ac2-26 decreased the activation of synoviocytes Activated macrophages and fibroblast-like synoviocytes play a critical role in the pathogenesis of OA, invading surrounding tissues and releasing cytokines and enzymes that cause inflammation, bone and cartilage degradation, and pain [ 33 ], [ 34 ], [ 35 ]. Here, mouse synovium tissues were collected 42 days after collagenase injection for the analysis of synoviocyte activation. There was an increased number of synovial CX3CR1 + macrophages (Fig. 6 A) and lining (FAP + CD90 − ) (Fig. 6 C) and sublining (FAP + CD90 + ) (Fig. 6 E) fibroblast populations over the saline-injected groups. The treatment with Ac2-26 decreased the number of macrophage-like (Fig. 6 A) and lining fibroblast-like synoviocytes (Fig. 6 C). In addition, Ac2-26 treatment decreased the number of these synovial cells expressing RANKL (Fig. 6 B, D), a critical molecule involved in osteoclast formation and consequently bone degradation [ 36 ] (Fig. 6 B, F). There were no differences in the number and activation of sublining synovial fibroblasts upon Ac2-26 treatment (Fig. 6 E, F). DISCUSSION Despite the advances in the knowledge about the mechanisms related to the pathogenesis of OA, current treatment options are not effective in preventing disease progression, and pharmacological treatments are mostly limited to symptom control [ 37 ]. Inflammation of the synovial membrane (synovitis) of joints affected by OA is directly associated with joint dysfunction and damage, resulting in continued activation of resident synovial cells, such as macrophages and fibroblasts [ 38 ]. Here, we investigated whether AnxA1, a well-known pro-resolving mediator, could control joint inflammation, damage, and nociception in an experimental model of OA in mice. The main findings of this study are summarized as follows: 1) Studies in AnxA1-deficient mice showed that endogenous AnxA1 is an important molecule that controls nociception and joint inflammation; 2) Mice that received the AnxA1-mimetic Ac2-26 into the affected joint had reduced nociception and tissue damage, even when treatment was started at a later time point after OA induction; 3) Ac2-26 treatment downregulated MMP3 secretion in joint tissue; 4) Ac2-26 treatment reduced the number of macrophage-like and fibroblast-like synoviocytes expressing RANKL. Altogether, these results clearly show that AnxA1 plays a relevant role in controlling joint inflammation and damage in OA and it can be used therapeutically to treat OA. Synovitis in OA joints is generally less severe than in other rheumatic diseases, such as rheumatoid arthritis, gout, or bacterial arthritis. However, it directly correlates with the progression of tissue remodeling and symptom severity in OA patients [ 39 ], [ 40 ]. Thus, a better characterization of the inflammatory environment and markers of synoviocyte and leukocyte activation in the OA joints should be a constant need to find mechanisms of this disease that consequently help the progression of developing new strategies to deal with it. On the other hand, very few studies have explored if and how mediators that share pro-resolving properties could control OA pathology. Recently, Shih and colleagues demonstrated that the systemic treatment with maresin 1, a specialized pro-resolving lipid mediator, reduced joint nociception of the monosodium iodoacetate (MIA) model of OA in mice, decreasing the expression of the neurotransmitter calcitonin-gene related peptide (CGRP) and markers of macrophage activation in the dorsal root ganglia (DRG) [ 41 ]. In addition, Ac2-26, the same molecule we used, reduced the senescence status of TNF-stimulated chondrocytes, preventing senescence-related gene expression and NF-κB activation [ 42 ]. Here, we provided the first evidence on how the pro-resolving mediator AnxA1 or its mimetics may serve as an alternative strategy to control joint inflammation, damage, and dysfunction in OA. AnxA1 and its active N-terminal-derived peptide Ac2-26 are potent anti-inflammatory and pro-resolving mediators that modulate inflammatory processes [ 32 ]. Their main contributions to the resolution of inflammation came from studies of neutrophilic inflammation. Essentially, AnxA1 and Ac2-26 cause neutrophil apoptosis and stimulate its clearance by enhancing its efferocytosis by macrophages [ 43 ], [ 44 ]. Furthermore, the capacity of AnxA1 to change the macrophage phenotype to M2 and Mres (resolving-like macrophages) leads to the reduction of the levels of pro-inflammatory cytokines and promotes tissue repair [ 32 ], [ 45 ], [ 46 ]. Although OA pathogenesis seems to be independent of neutrophil activation, key features of AnxA1 and Ac2-26 beyond their effect on neutrophils could explain the beneficial effects in this OA model. The discovery of molecules to avoid chondrocyte death and cartilage and bone degradation is are important achievement for OA management. Different enzymes that cause cartilage degradation in OA joints, such as ADAMTS-4 and ADAMTS-5, which cleave aggrecan from its hyaluronic acid structure, and matrix metalloproteinases (MMPs), targeting type II collagen, further weaken the collagen network, culminating in progressive joint deterioration [ 47 ]. It has been shown that Ac2-26 downregulates ADAMTS-4 in TNF-stimulated chondrocytes, evidencing the direct effect of this molecule in cartilage cells [ 42 ]. Here, the treatment with Ac2-26 in the affected joint reduced the extension of cartilage damage and MMP3 expression in periarticular tissue even when it was started after 3 weeks of collagenase challenge, a time point with already signs of cartilage and bone changes (data not shown). In addition, there was a reduction in the number of macrophage-like and fibroblast-like synoviocytes expressing RANKL, a well-known molecule involved in osteoclastogenesis and bone remodeling [ 48 ]. However, it needs to be determined if Ac2-26 or other pro-resolving mediator prevents or reverts the progression of tissue damage in this model of OA. In our study, AnxA1-deficient mice had persistent joint nociception while the treatment with Ac2-26 in WT mice prevented it. Some works have already demonstrated the anti-nociceptive effects of endogenous AnxA1, as AnxA1-deficient mice had exacerbated nociception in an acetic acid-induced abdominal writhing model compared to WT mice [ 31 ]. In models of arthritis in mice, the systemic treatment with Ac2-26 reduced joint nociception [ 22 ], [ 31 ]. Interesting, silencing AnxA1 in DRG [ 49 ] or intrathecal injection of Ac2-26 [ 50 ] reduced thermal and mechanical nociception, evidencing the antinociceptive effect of AnxA1 at neuron levels. Here, the decreased joint nociception caused by treatment with Ac2-26 could be associated with reduced tissue damage and synoviocyte activation or a direct effect on the nociceptors present in the joints and the DRG. In conclusion, our results indicate that AnxA1 or Ac2-26 actively contributes to improving joint degeneration and dysfunction characteristic of OA pathology. These findings highlight the need for a deeper investigation into the underlying mechanisms and further exploration of whether the class of pro-resolving mediators holds promise for controlling OA features. Declarations Acknowledgments We thank Frankcineia Assis, Ilma Marçal, and Hermes Ribeiro for their technical assistance. Author contributions P.L.B. and F.A.A. analyzed the data and wrote the paper; P.L.B., A.D.B., C.M.Q.J., G.C.M., V.L.S.O., and I.G. performed the experiments and analyzed data; A.M.K. and M.M.T. provided expertise and improvements in the issue and helped with paper discussion; P.L.B. and F.A.A. designed the research; All authors reviewed and agreed to the published version of the manuscript. Role of the funding source This work was financially supported by Fundação de Amparo à Pesquisa de Minas Gerais (FAPEMIG - APQ-00110-22), Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), The National Council for Scientific and Technological Development (CNPq - #403767/2021-0), and Fundo de Apoio à Pesquisa e Educação da Sociedade Brasileira de Reumatologia. Conflict of interest There are no financial conflicts of interest to disclose. The authors have declared that no conflict of interest exists. Declaration of Generative AI in scientific writing There is nothing to disclose References Neogi T. The Epidemiology and Impact of Pain in Osteoarthritis. Osteoarthritis and cartilage / OARS, Osteoarthritis Research Society . 2013;21(9):1145. 10.1016/J.JOCA.2013.03.018 Hunter DJ, Bierma-Zeinstra S, Osteoarthritis. Lancet. 2019;393(10182):1745–59. 10.1016/S0140-6736(19)30417-9/ASSET/20A9DE8C-08A4-4EB9-8439-5447D2AF4C7A/MAIN.ASSETS/GR4.SML . Hunter DJ, McDougall JJ, Keefe FJ. The symptoms of OA and the genesis of pain. Rheum Dis Clin North Am. 2008;34(3):623. 10.1016/J.RDC.2008.05.004 . Primorac D, Molnar V, Rod E, et al. Knee Osteoarthritis: A Review of Pathogenesis and State-Of-The-Art Non-Operative Therapeutic Considerations. Genes (Basel). 2020;11(8):854. 10.3390/GENES11080854 . Motta F, Barone E, Sica A, Selmi C. Inflammaging and Osteoarthritis. Clinical Reviews in Allergy & Immunology 2022 64:2 . 2022;64(2):222–238. 10.1007/S12016-022-08941-1 Sellam J, Berenbaum F. The role of synovitis in pathophysiology and clinical symptoms of osteoarthritis. Nature Reviews Rheumatology 2010 6:11 . 2010;6(11):625–635. 10.1038/nrrheum.2010.159 Sanchez-Lopez E, Coras R, Torres A, Lane NE, Guma M. Synovial inflammation in osteoarthritis progression. Nature Reviews Rheumatology 2022 18:5 . 2022;18(5):258–275. 10.1038/s41584-022-00749-9 Thomson A, Hilkens CMU. Synovial Macrophages in Osteoarthritis: The Key to Understanding Pathogenesis? Front Immunol. 2021;12. 10.3389/FIMMU.2021.678757 . Bondeson J, Wainwright SD, Lauder S, Amos N, Hughes CE. The role of synovial macrophages and macrophage-produced cytokines in driving aggrecanases, matrix metalloproteinases, and other destructive and inflammatory responses in osteoarthritis. Arthritis Res Ther. 2006;8(6). 10.1186/AR2099 . Van Den Bosch MH, Blom AB, Schelbergen RF, et al. Alarmin S100A9 Induces Proinflammatory and Catabolic Effects Predominantly in the M1 Macrophages of Human Osteoarthritic Synovium. J Rheumatol. 2016;43(10):1874–84. 10.3899/JRHEUM.160270 . Kang F, Wu Q, Zhou X, Huang D, Ji Y. IL-6 Enhances Osteocyte-Mediated Osteoclastogenesis by Promoting JAK2 and RANKL Activity In Vitro. Cell Physiol Biochem. 2017;41:1360–9. 10.1159/000465455 . Luo P, Yuan Q, Wan X, Yang M, Xu P. Effects of Immune Cells and Cytokines on Different Cells in OA. J Inflamm Res. 2023;16:2329. 10.2147/JIR.S413578 . Molnar V, Matišić V, Kodvanj I, et al. Cytokines and Chemokines Involved in Osteoarthritis Pathogenesis. Int J Mol Sci. 2021;22(17):9208. 10.3390/IJMS22179208 . Borzì RM, Mazzetti I, Marcu KB, Facchini A. Chemokines in cartilage degradation. Clin Orthop Relat Res . 2004;427(SUPPL.). 10.1097/01.BLO.0000143805.64755.4F Magni A, Agostoni P, Bonezzi C, et al. Management of Osteoarthritis: Expert Opinion on NSAIDs. Pain Ther. 2021;10(2):783. 10.1007/S40122-021-00260-1 . Malanga GA, Stone S, Capella T. Topical Review Corticosteroids: Review of the History, the Effectiveness, and Adverse Effects in the Treatment of Joint Pain. Accessed April 24, 2025. Perretti M, Cooper D, Dalli J, Norling LV. Immune resolution mechanisms in inflammatory arthritis. Nature Reviews Rheumatology 2017 13:2 . 2017;13(2):87–99. 10.1038/nrrheum.2016.193 Sugimoto MA, Sousa LP, Pinho V, Perretti M, Teixeira MM. Resolution of inflammation: What controls its onset? Front Immunol. 2016;7(APR). 10.3389/fimmu.2016.00160 . Serhan CN, Savill J. Resolution of inflammation: the beginning programs the end. Nature Immunology 2005 6:12 . 2005;6(12):1191–1197. 10.1038/ni1276 Parente L, Solito E. Annexin 1: More than an anti-phospholipase protein. Inflamm Res. 2004;53(4):125–32. 10.1007/S00011-003-1235-Z/METRICS . Ferlazzo V, D’Agostino P, Milano S, et al. Anti-inflammatory effects of annexin-1: stimulation of IL-10 release and inhibition of nitric oxide synthesis. Int Immunopharmacol. 2003;3(10–11):1363–9. 10.1016/S1567-5769(03)00133-4 . Qin X, He L, Fan D, Liang W, Wang Q, Fang J. Targeting the resolution pathway of inflammation using Ac2–26 peptide-loaded PEGylated lipid nanoparticles for the remission of rheumatoid arthritis. Asian J Pharm Sci. 2021;16(4):483. 10.1016/J.AJPS.2021.03.001 . Jeremiasse B, Matta C, Fellows CR, et al. Alterations in the chondrocyte surfaceome in response to pro-inflammatory cytokines. BMC Mol Cell Biol. 2020;21(1):1–18. 10.1186/S12860-020-00288-9/TABLES/3 . Guo D, Tan W, Wang F, et al. Proteomic analysis of human articular cartilage: identification of differentially expressed proteins in knee osteoarthritis. Joint Bone Spine. 2008;75(4):439–44. 10.1016/J.JBSPIN.2007.12.003 . Van Der Kraan PM, Vitters EL, Van Beuningen HM, Van De Putte LBA, Van Den Berg WB. Degenerative knee joint lesions in mice after a single intra-articular collagenase injection. A new model of osteoarthritis. J Exp Pathol (Oxford) . 1990;71(1):19. Accessed April 24, 2025. https://pmc.ncbi.nlm.nih.gov/articles/PMC1998679/ Sachs D, Coelho FM, Costa VV, et al. Cooperative role of tumour necrosis factor-α, interleukin-1β and neutrophils in a novel behavioural model that concomitantly demonstrates articular inflammation and hypernociception in mice. Br J Pharmacol. 2011;162(1):72. 10.1111/J.1476-5381.2010.00895.X . Weber P, Bevc K, Fercher D, et al. The collagenase-induced osteoarthritis (CIOA) model: Where mechanical damage meets inflammation. Osteoarthr Cartil Open. 2024;6(4). 10.1016/J.OCARTO.2024.100539 . Adães S, Mendonça M, Santos TN, Castro-Lopes JM, Ferreira-Gomes J, Neto FL. Intra-articular injection of collagenase in the knee of rats as an alternative model to study nociception associated with osteoarthritis. Arthritis Res Ther. 2014;16(1):R10. 10.1186/AR4436 . Van Der Kraan PM, Vitters EL, Van Beuningen HM, Van De Putte LBA, Van Den Berg WB. Degenerative knee joint lesions in mice after a single intra-articular collagenase injection. A new model of osteoarthritis. J Exp Pathol (Oxford) . 1990;71(1):19. Accessed April 27, 2025. https://pmc.ncbi.nlm.nih.gov/articles/PMC1998679/ Mustonen AM, Käkelä R, Lehenkari P, et al. Distinct fatty acid signatures in infrapatellar fat pad and synovial fluid of patients with osteoarthritis versus rheumatoid arthritis. Arthritis Res Ther. 2019;21(1):1–11. 10.1186/S13075-019-1914-Y/FIGURES/2 . Galvão I, Vago JP, Barroso LC, et al. Annexin A1 promotes timely resolution of inflammation in murine gout. Eur J Immunol. 2017;47(3):585–96. 10.1002/EJI.201646551 . Sugimoto MA, Vago JP, Teixeira MM, Sousa LP. Annexin A1 and the Resolution of Inflammation: Modulation of Neutrophil Recruitment, Apoptosis, and Clearance. J Immunol Res. 2016;2016(1):8239258. 10.1155/2016/8239258 . Bondeson J, Wainwright SD, Lauder S, Amos N, Hughes CE. The role of synovial macrophages and macrophage-produced cytokines in driving aggrecanases, matrix metalloproteinases, and other destructive and inflammatory responses in osteoarthritis. Arthritis Res Ther. 2006;8(6):1–12. 10.1186/ar2099 . Griffin TM, Scanzello CR. Innate inflammation and synovial macrophages in osteoarthritis pathophysiology. Clin Exp Rheumatol. 2019;37(5):57–63. Maglaviceanu A, Wu B, Kapoor M. Fibroblast-like synoviocytes: Role in synovial fibrosis associated with osteoarthritis. Wound Repair Regeneration. 2021;29(4):642–9. 10.1111/wrr.12939 . Leibbrandt A, Penninger JM. RANKL/RANK as key factors for osteoclast development and bone loss in arthropathies. Adv Exp Med Biol. 2009;649:100–13. 10.1007/978-1-4419-0298-6_7 . Peng X, Chen X, Zhang Y, Tian Z, Wang M, Chen Z. Advances in the pathology and treatment of osteoarthritis. J Adv Res Published online January. 2025;30. 10.1016/J.JARE.2025.01.053 . Scanzello CR, Goldring SR. The role of synovitis in osteoarthritis pathogenesis. Bone. 2012;51(2):249–57. 10.1016/J.BONE.2012.02.012 . Loeuille D, Chary-Valckenaere I, Champigneulle J, et al. Macroscopic and microscopic features of synovial membrane inflammation in the osteoarthritic knee: correlating magnetic resonance imaging findings with disease severity. Arthritis Rheum. 2005;52(11):3492–501. 10.1002/ART.21373 . Atukorala I, Kwoh CK, Guermazi A, et al. SYNOVITIS IN KNEE OSTEOARTHRITIS: A PRECURSOR OF DISEASE? Ann Rheum Dis. 2014;75(2):390. 10.1136/ANNRHEUMDIS-2014-205894 . Shih YRV, Tao H, Gilpin A, Lee YW, Perikamana SM, Varghese S. Specialized pro-resolving mediator Maresin 1 attenuates pain in a mouse model of osteoarthritis. Osteoarthritis Cartilage. 2024;33(3):341–50. 10.1016/J.JOCA.2024.10.018/ATTACHMENT/5F18E447-BE73-4DE5-9806-2C946FE26940/MMC2.XLSX . Yang L, Gong K, Ren G, Chen B. The Annexin A1 Protein Mimetic Peptide Ac2-26 prevents cellular senescence of CHON-001 chondrocytes against tumor necrosis factor-α via the Nrf2/NF-κB pathway. Biotechnol Appl Biochem Published online. 2024. 10.1002/BAB.2695 . Galvão I, Vago JP, Barroso LC, et al. Annexin A1 promotes timely resolution of inflammation in murine gout. Eur J Immunol. 2017;47(3):585–96. 10.1002/eji.201646551 . Vago JP, Nogueira CRC, Tavares LP, et al. Annexin A1 modulates natural and glucocorticoid-induced resolution of inflammation by enhancing neutrophil apoptosis. J Leukoc Biol. 2012;92(2):249–58. 10.1189/JLB.0112008 . Leoni G, Neumann PA, Kamaly N, et al. Annexin A1-containing extracellular vesicles and polymeric nanoparticles promote epithelial wound repair. J Clin Invest. 2015;125(3):1215–27. 10.1172/JCI76693 . McArthur S, Juban G, Gobbetti T, et al. Annexin A1 drives macrophage skewing to accelerate muscle regeneration through AMPK activation. J Clin Invest. 2020;130(3):1156. 10.1172/JCI124635 . Jiang L, Lin J, Zhao S, et al. ADAMTS5 in Osteoarthritis: Biological Functions, Regulatory Network, and Potential Targeting Therapies. Front Mol Biosci. 2021;8:703110. 10.3389/FMOLB.2021.703110 . Liang J, Liu L, Feng H, et al. Therapeutics of osteoarthritis and pharmacological mechanisms: A focus on RANK/RANKL signaling. Biomed Pharmacother. 2023;167. 10.1016/J.BIOPHA.2023.115646 . Zhang Y, Ma S, Ke X, et al. The mechanism of Annexin A1 to modulate TRPV1 and nociception in dorsal root ganglion neurons. Cell Biosci. 2021;11(1). 10.1186/S13578-021-00679-1 . Pei L, Zhang J, Zhao F, et al. Annexin 1 exerts anti-nociceptive effects after peripheral inflammatory pain through formyl-peptide-receptor-like 1 in rat dorsal root ganglion. Br J Anaesth. 2011;107(6):948–58. 10.1093/BJA/AER299 . Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigure1.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7013885","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":492890189,"identity":"8658f28e-5e32-4412-878d-f2f88ea7861c","order_by":0,"name":"Paula Lima Bosi","email":"","orcid":"","institution":"Universidade Federal de Minas Gerais","correspondingAuthor":false,"prefix":"","firstName":"Paula","middleName":"Lima","lastName":"Bosi","suffix":""},{"id":492890190,"identity":"5fbb92ee-e9b2-4a9d-97fb-7509d3890290","order_by":1,"name":"Amanda Dias Braga","email":"","orcid":"","institution":"Universidade Federal de Minas Gerais","correspondingAuthor":false,"prefix":"","firstName":"Amanda","middleName":"Dias","lastName":"Braga","suffix":""},{"id":492890191,"identity":"ed16e3f7-561a-4a1d-b337-4d684e4d01f1","order_by":2,"name":"Celso Martins Queiroz-Junior","email":"","orcid":"","institution":"Universidade Federal de Minas Gerais","correspondingAuthor":false,"prefix":"","firstName":"Celso","middleName":"Martins","lastName":"Queiroz-Junior","suffix":""},{"id":492890192,"identity":"7e4e9836-4801-46f9-8aec-60c33adc55cd","order_by":3,"name":"Gabrielly Carvalho Mattos","email":"","orcid":"","institution":"Universidade Federal de Minas Gerais","correspondingAuthor":false,"prefix":"","firstName":"Gabrielly","middleName":"Carvalho","lastName":"Mattos","suffix":""},{"id":492890193,"identity":"646097a5-0a4b-409e-97d3-3113dc1b736f","order_by":4,"name":"Vivian Louise Soares Oliveira","email":"","orcid":"","institution":"Universidade Federal de Minas Gerais","correspondingAuthor":false,"prefix":"","firstName":"Vivian","middleName":"Louise Soares","lastName":"Oliveira","suffix":""},{"id":492890194,"identity":"aee25136-8438-4aef-b96a-29d8eab9ac3a","order_by":5,"name":"Izabela Galvão","email":"","orcid":"","institution":"Universidade Federal de Minas Gerais","correspondingAuthor":false,"prefix":"","firstName":"Izabela","middleName":"","lastName":"Galvão","suffix":""},{"id":492890195,"identity":"ae8369b4-1cba-4fa5-b5b6-007c68106bd7","order_by":6,"name":"Adriana Maria Kakehasi","email":"","orcid":"","institution":"Universidade Federal de Minas Gerais","correspondingAuthor":false,"prefix":"","firstName":"Adriana","middleName":"Maria","lastName":"Kakehasi","suffix":""},{"id":492890196,"identity":"8ab37679-395e-4c5b-be68-1639c50f1469","order_by":7,"name":"Mauro Martins Teixeira","email":"","orcid":"","institution":"Universidade Federal de Minas Gerais","correspondingAuthor":false,"prefix":"","firstName":"Mauro","middleName":"Martins","lastName":"Teixeira","suffix":""},{"id":492890197,"identity":"616f99fd-345b-4a88-b3cd-86a9ac63cb02","order_by":8,"name":"Flávio Almeida Amaral","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0klEQVRIiWNgGAWjYBAC9gYwZSHHxsADpG2AWIKAFp4DYErCGKIljQQtiQ3Ea2E/nfi5okYivY/97AFmnoRtdg3SvQ/wa+HJ3Sx55phEbhtPXgJQy+3kBpnjBni12DPkbpBsYANqkeAxYOb9cTuZQSKNgMP4327+2fBPIp0NpAVkC2EtErnbJBvbJBJgWuyI0PJ2m2Vjn4QhyC8H5yTcTmCTOUbIYbmbbzZ8s5GXbz978MGbhNv2/NJt+LWggANAnEiKBgiwJ1nHKBgFo2AUDHsAAFfbPZT1Pi1gAAAAAElFTkSuQmCC","orcid":"","institution":"Universidade Federal de Minas Gerais","correspondingAuthor":true,"prefix":"","firstName":"Flávio","middleName":"Almeida","lastName":"Amaral","suffix":""}],"badges":[],"createdAt":"2025-06-30 20:08:08","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7013885/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7013885/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":88023440,"identity":"985e355c-d45d-4dc9-b29d-f08887ab15cf","added_by":"auto","created_at":"2025-07-31 14:16:52","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":360393,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnxA1 is transiently upregulated in the joint tissue of collagenase-induced OA in mice and controls joint nociception. \u003c/strong\u003eWT mice were challenged with intra-articular injection of collagenase VII on days 1 and 3 and the control group received saline (10 µL). Periarticular tissue was collected 1, 3, and 6 weeks later to evaluate AnxA1 expression by (A) Western blot and (B) plotted as densitometry of intact AnxA1 (37 Kda) when normalized by β-actin expression. (C) The kinetics of joint nociception of WT and AnxA1-deficient (AnxA1\u003csup\u003e-/-\u003c/sup\u003e) mice were assessed weekly and (D) plotted as the area under the curve considering the paw withdrawal threshold. A: (*) for p\u0026lt;0.05 when compared to the control group (N=3) using one way ANOVA followed by the Turkey´s post-test. B: (#) for p\u0026lt;0.05 when compared to the control WT mice (N=4-5) using unpaired t test.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7013885/v1/58564e9a18698a79ce1473f8.png"},{"id":88024269,"identity":"57714943-b802-4d5e-951a-c6800628c4f8","added_by":"auto","created_at":"2025-07-31 14:24:53","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":673786,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe absence of AnxA1 increases joint inflammation after collagenase injection.\u003c/strong\u003e Wild-type (WT) and AnxA1-deficient (AnxA1\u003csup\u003e-/-\u003c/sup\u003e) mice were challenged with intra-articular injection of collagenase VII on days 1 and 3 and the control group received saline (10 µL). Joint tissues were collected 6 weeks later for histopathological analysis. (A) Representative images of hematoxylin and eosin (HE) and Safranin-O/fast green staining. (B) Inflammatory score. (C) OARSI score. (*) for p\u0026lt;0.05 when compared to the control group and (#) for p\u0026lt;0.05 when compared to the control WT mice (N=3-5) using one way ANOVA followed by the Turkey´s post-test.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7013885/v1/119b27b26fdc7932fc77371e.png"},{"id":88024268,"identity":"62c9925d-de9b-402f-9cef-1c19f2ca7b35","added_by":"auto","created_at":"2025-07-31 14:24:53","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":677152,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe treatment with Ac2-26 reduces joint nociception after collagenase injection.\u003c/strong\u003e Wild-type (WT) mice were challenged with intra-articular injection of collagenase VII on days 1 and 3 and the control group received saline (10 µL). After 1, 2, or 3 weeks post collagenase injection, mice were treated weekly with Ac2-26 (10 µM / 10 µL; i.a.) up to week 5. The nociception was just before the Ac2-26 treatment. (A) Scheme showing the strategy of Ac2-26 treatment. (B) The kinetics of joint nociception were assessed weekly and (C) plotted as the area under the curve considering the paw withdrawal threshold. (*) for p\u0026lt;0.05 when compared to the control group and (#) for p\u0026lt;0.05 when compared to untreated OA group (N=5) using one way ANOVA followed by the Turkey´s post-test.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7013885/v1/cef9cb23c326eb3050d8c440.png"},{"id":88024879,"identity":"852be28c-88e5-422d-a33c-cd53a65aaec7","added_by":"auto","created_at":"2025-07-31 14:32:53","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1009953,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe treatment with Ac2-26 reduces joint damage after collagenase injection.\u003c/strong\u003e Wild-type (WT) mice were challenged with intra-articular injection of collagenase VII on days 1 and 3 and the control group received saline (10 µL). After 1, 2, or 3 weeks post collagenase injection, mice were treated weekly with Ac2-26 (10 µM / 10 µL; i.a.) up to week 5. Joint tissues were collected 6 weeks later for histopathological analysis. (A) Scheme showing the strategy of Ac2-26 treatment. (B) OARSI score. (C) Representative images of hematoxylin and eosin (HE) and Safranin-O/fast green staining. (*) for p\u0026lt;0.05 when compared to the control group and (#) for p\u0026lt;0.05 when compared to untreated OA group (N=4-5) using one way ANOVA followed by the Turkey´s post-test.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7013885/v1/96762e41cfe7c83b301524ef.png"},{"id":88023445,"identity":"32189516-19cc-4830-a376-5b856cc75758","added_by":"auto","created_at":"2025-07-31 14:16:53","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":300083,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe treatment with Ac2-26 modulates genes in the joint after collagenase injection. \u003c/strong\u003eWild-type (WT) mice were challenged with intra-articular injection of collagenase VII on days 1 and 3 and the control group received saline (10 µL). After 1, 2, or 3 weeks post collagenase injection, mice were treated weekly with Ac2-26 (10 µM / 10 µL; i.a.) up to week 5. Joint tissues were collected 6 weeks later for the analysis of gene expression by PCR. (A) Scheme showing the strategy of Ac2-26 treatment. Expression of (B) \u003cem\u003emmp3\u003c/em\u003e and (C) \u003cem\u003eil10\u003c/em\u003egenes. (*) for p\u0026lt;0.05 when compared to the control group and (#) for p\u0026lt;0.05 when compared to untreated OA group (N=4-5) using one way ANOVA followed by the Turkey´s post-test.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7013885/v1/01722b5e65cd729b087e7c96.png"},{"id":88023455,"identity":"18731c61-4c5f-494b-b527-ed9347b90905","added_by":"auto","created_at":"2025-07-31 14:16:53","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":846909,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe treatment with Ac2-26 reduces the activation of synoviocytes after collagenase injection. \u003c/strong\u003eWild-type (WT) mice were challenged with intra-articular injection of collagenase VII on days 1 and 3 and the control group received saline (10 µL). After 3 weeks post collagenase injection, mice were treated weekly with Ac2-26 (10 µM / 10 µL; i.a.) up to week 5. Joint tissues were collected 6 weeks later for the analysis of synoviocyte population and activation by flow cytometry. (A) Number and (B) RANKL expressing macrophage-like synoviocytes. (C) Number and (D) RANKL expressing CD90\u003csup\u003e+\u003c/sup\u003eFAP\u003csup\u003e+\u003c/sup\u003e fibroblast-like synoviocytes. (E) Number and (F) RANKL expressing CD90\u003csup\u003e-\u003c/sup\u003eFAP\u003csup\u003e+\u003c/sup\u003e fibroblast-like synoviocytes. (*) for p\u0026lt;0.05 when compared to the control group and (#) for p\u0026lt;0.05 when compared to untreated OA group (N=5) using one way ANOVA followed by the Turkey´s post-test.\u003c/p\u003e","description":"","filename":"floatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-7013885/v1/10d87993c568efdb08d52299.png"},{"id":92620131,"identity":"637cda23-7e4d-4dfc-a106-f6f11eb3f408","added_by":"auto","created_at":"2025-10-01 19:01:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4848751,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7013885/v1/0ec55b8e-c01c-476a-992f-0e8a8cd3aaa9.pdf"},{"id":88023442,"identity":"dae24f94-fd83-4c88-9543-810d0b4d6ab4","added_by":"auto","created_at":"2025-07-31 14:16:52","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":271413,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigure1.docx","url":"https://assets-eu.researchsquare.com/files/rs-7013885/v1/0516746a80149e6931255d4b.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Pro-resolving Annexin A1-derived peptide Ac2-26 reduces nociception and mitigates joint damage in experimental osteoarthritis","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eOsteoarthritis (OA) is one of the most important causes of functional limitation and disability, especially among women and elderly people [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. It is a chronic disease affecting the whole joint tissues, primarily leading to progressive damage to articular cartilage and, subsequently, to the subchondral bone and surrounding synovial structures [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Pain is the typical OA symptom that leads people to present to healthcare providers and its diagnosis is helped with image exams [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Although the progression of OA is generally slow, it can potentially lead to complete joint impairment, as no OA-modifying medications have yet been approved, resulting in a strong indication for joint replacement surgery, particularly of the hip and knee joints [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSynovitis has been directly associated with the progression of joint damage, pain, and disability in patients with OA. It is characterized by important changes in synoviocyte functions, including their uncontrolled proliferation and invasion of surrounding tissues [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The sustained activation of these cells together with persistent leukocyte infiltration, especially composed of mononuclear cells, produce inflammatory mediators involved in the pathogenesis of OA [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. There is also activation of matrix metalloproteinases (MMP3, MMP13) and release of alarmins (S100A8/9), which are involved in tissue damage in OA [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In addition to eicosanoids, cytokines, such as IL-6 and TGFβ, and chemokines, such as CCL2 and CCL17, contribute to this process, which leads to the aggregation and death of chondrocytes, activation of osteoclasts and osteoblasts of the subchondral bone. Activation of these cells results in disordered cartilaginous and bone neoformation, promotes osteophytosis that coexists with erosion of the cartilage and the underlying bone, with irreversible damage to the joint [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Therapeutically, steroidal (corticosteroid) and nonsteroidal (NSAID) anti-inflammatory drugs remain the most widely used analgesics but, in addition to their questionable efficacy, adverse events limit their use and do not alter the prognosis of OA[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e\u003cp\u003ePro-resolving mediators, which actively participate in interrupting the inflammatory response and promote tissue repair [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], are suggested as capable of relieving pain and halting the progression of rheumatic diseases. Their actions can be resumed by, among others, stopping polymorphonuclear infiltration in the tissue and induction of their apoptosis, enhancing their clearance by macrophages (efferocytosis), reprogramming macrophage phenotype, and promoting pain remission [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Annexin A1 (AnxA1), a glucocorticoid-regulated protein, has a potent effect on the control of inflammation, as anti-inflammatory action by inhibiting the enzymes phospholipase A2 (PLA2) and cyclooxygenase-2 (COX-2) and stimulating the synthesis of anti-inflammatory molecules, such as the cytokine IL-10 [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The peptide Ac2-26 derived from the N-terminal region of AnxA1 has been demonstrated to have a potent pro-resolving effect in experimental models of arthritis, reducing the intensity and durability of joint inflammation and nociception [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. In the context of OA, a tendency towards a decrease of AnxA1 expression was observed in the cartilage of individuals suffering from the disease when compared to the cartilage of control individuals, indicating the participation of the protein in the pathogenesis of the disease [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Thus, this study aimed to investigate the contribution and potential therapeutic use of AnxA1 to the inflammation, damage, and nociception in an experimental model of OA induced by the injection of collagenase in mice.\u003c/p\u003e"},{"header":"METHODS","content":"\u003cp\u003e\u003cb\u003eAnimals and experimental model of osteoarthritis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAdult (8 weeks old) male wild-type (WT) mice and mice deficient for AnxA1 (AnxA1\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e) of Balb/c background were used in this study (Approved by local ethical committee #240/2020). The experimental model of OA was induced by injecting type VII collagenase (Sigma-Aldrich, C0773, 1U/10\u0026micro;L)) into the joint cavity of anesthetized mice (ketamine and xylazine, i.p.) at days 1 and 3, with the analyses evaluated weekly up to week 6 after the first injection of collagenase [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. As standardization, we used the right knee for the collagenase or saline injections.\u003c/p\u003e\u003cp\u003eGroups of WT mice were treated weekly with an intra-articular injection of Ac2-26 (10 \u0026micro;M / 10 \u0026micro;L), starting at different time points: from day 7, day 14, or day 21 after the first injection of collagenase. For the treatments, the animals were anesthetized with inhaled isoflurane. Nociception measurements were performed weekly, immediately before the treatments with Ac2-26. Untreated animals received saline injections. At different moments, mice were killed by overexposure to the anesthetic solution (ketamine and xylazine, i.p.), and joint tissues were collected for histopathology analysis and markers of joint inflammation and damage.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMechanical nociception analysis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eMice were placed individually in acrylic cages (12 \u0026times; 10 x 17 cm) with a wire grid floor, in a noise-controlled room, for 20 minutes. After this time, the manifestation of the exploratory behavior was nullified and all mice remained quiet, allowing the evaluation of the nociceptive response. To identify the withdrawal threshold, a von Frey electronic algesimeter (INSIGHT Instruments, Ribeir\u0026atilde;o Preto, SP, Brazil) was applied according to the methods previously used [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Using a portable force transducer with a polypropylene tip (4.15 mm), a vertical and constant force was applied to the central plantar surface of the mouse's paw, a stimulus for knee flexion, that triggers a paw withdrawal movement, the characteristic aversive behavior. The maximum value (in grams) was recorded by an electronic component of the device. The withdrawal threshold was calculated by repeating the procedure in triplicate for each mouse (and the means were expressed as absolute values) and was conducted in a blinded experimental condition.\u003c/p\u003e\u003cp\u003e\u003cb\u003eHistology H\u0026amp;E and Safranin-O/fast green staining\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSamples from the tibiofemoral joint were collected and fixed in 10% (v/v) buffered formalin (pH 7.4) for 48 h and decalcified for 30 days in 14% EDTA (pH 7.3). Tissues were embedded in paraffin, sectioned (5 \u0026micro;m), and stained with Hematoxylin-Eosin (H\u0026amp;E). Then, the samples were examined and classified by a pathologist blindly regarding the following parameters: severity of synovial hyperplasia, intensity of inflammatory infiltrate, and changes in bone and cartilage.\u003c/p\u003e\u003cp\u003eFor the OA score, the samples were also stained Safranin-O/fast green via standard procedures. Two examiners blinded to the treatment groups evaluated the severity of cartilage degradation using a (32). The evaluation parameters were as follows: 1) cartilage structure (0\u0026ndash;6), 2) cartilage cells (0\u0026ndash;3), 3) Safranin-O/Fast Green staining (0\u0026ndash;4), and 4) tidemark integrity (0\u0026ndash;1).\u003c/p\u003e\u003cp\u003e\u003cb\u003eWestern Blot\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe protein content of the periarticular tissue from the experimental OA model was determined using the Bradford assay reagent. The extracts (20 \u0026micro;g) were separated by electrophoresis on a 10% SDS-PAGE gel and transferred to nitrocellulose membranes. The membranes were blocked overnight at 4\u0026deg;C with PBS containing 5% (w/v) skim milk and 0.1% Tween 20, washed three times with PBS containing 0.1% Tween 20, and then incubated with anti-AnxA1 and anti-β-actin antibodies in PBS containing 5% (w/v) BSA and 0.1% Tween 20. After washing, the membranes were incubated with a peroxidase-conjugated secondary antibody. Immunoreactive bands were visualized using an ECL detection system. AnxA1 values were quantified using densitometric analysis software (ImageJ, National Institutes of Health, Bethesda, MD). Changes in protein levels were estimated relative to the control (saline-injected group), and the results were expressed as an increase in arbitrary units of AnxA1 normalized to β-actin values in the same sample.\u003c/p\u003e\u003cp\u003e\u003cb\u003eQuantification of mRNA expression by qRT-PCR\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTotal RNA was extracted and isolated from the tissue surrounding the joint of mice using Trizol reagent (Invitrogen Life Technologies Corporation- Carlsbad, CA, USA) according to the manufacturer's instructions. The purity of the total RNA was determined using a Nanodrop 1000 spectrophotometer (Thermo Scientific- Waltham, MA, USA). For the reverse transcription of 500 ng of total RNA isolated to cDNA, a mixture containing the reserve transcriptase, SuperScript III, a recombinant ribonuclease inhibitor (RNAse Out; Invitrogen Life Technologies Corporation), and dithiothreitol (DTT; 1 mM) was used. The reverse transcription step was performed in duplicate and the total cDNA concentration was similar in all samples. For quantitative real-time qPCR, the Power SYBR Master Mix reagent (Invitrogen Life Technologies Corporation) and the pars primers (Integrated DNA Technologies- Coralville, IA, USA) plus cDNA were placed in a 96-well plate, in duplicate, at a total reaction volume of 10 \u0026micro;L, using the StepOneTM system (Applied Biosystems, Waltham, MA, USA) in programmed reaction: initial heating at 95\u0026deg;C for 10 min, followed by 40 cycles at 95\u0026deg;C for 60 s and 48\u0026deg;C for 1 min. Data were analyzed using the StepOneTM System software and processed by the 2^-ΔCT method. This method directly uses the CT (threshold cycle) information generated by a qPCR system to calculate the relative expression of genes in the target and reference samples, using a reference gene to normalize the RT-qPCR. The primer pairs sequences used were:\u003c/p\u003e\u003cp\u003e\u003cem\u003emmp3\u003c/em\u003e: FW: CACTCACAGACCTGACTCGGTT\u003c/p\u003e\u003cp\u003eRV: AAGCAGGATCACAGTTGGCTGG\u003c/p\u003e\u003cp\u003e\u003cem\u003eil10\u003c/em\u003e: FW: TCTGGCTCTGCTACTGGTCT\u003c/p\u003e\u003cp\u003eRV: CTCCAGGCTCCCTCTGTTG\u003c/p\u003e\u003cp\u003eThe initiator and probe sequences were verified with the BLAST\u0026trade; software. The 18s was used as the reference control gene and the results were expressed as \"Fold Increase\" compared to the negative control groups injected with saline.\u003c/p\u003e\u003cp\u003e\u003cb\u003eFlow cytometry analysis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eA pool of two synovial tissues from the tibiofemoral joint was used for each sample analyzed by flow cytometry. Samples were incubated with collagenase (10 mg/mL; Collagenase D \u0026ndash; Sigma Aldrich #C2139) for 1 h at 37\u0026deg;C followed by passage through a 70 \u0026micro;m cell strainer to obtain cell suspensions. For the identification of macrophage population, anti-CD45 PercP (Biolegends #103131), anti-CD11b APC-Cy7 (BD Pharmingen #562127), anti-F4/80 FITC (Biolegends #123107), and anti-CX3CR1\u003csup\u003e+\u003c/sup\u003e PECy7 (Biolegends #149015) were used. Anti-CD90 PE (Biolegends #109006) and anti-FAP BV421 (eBioscience #BMS168) were used for synovial fibroblasts. Anti-RANKL PE (BD Pharmingen #560295) was used for the analysis of synoviocyte activation. After surface marking (30 min), cells were fixed by incubation with 4% formaldehyde for 20 minutes. The negative controls were cells labeled only with secondary anti-rabbit antibodies bound to fluorochromes. The labeled cells were acquired with the BD FACSCanto II cell analyzer (BD Bioscience) and analyzed with the FlowJo software (Tree Star Inc., USA).\u003c/p\u003e\u003cdiv id=\"Sec2\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eThe data obtained were statistically analyzed and the normality of the data (Shapiro-Wilk test) using the GraphPad Prism v9.5 program (GraphPad Software Inc., CA, USA) and expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM). The differences between the means were compared using analysis of variance (ANOVA) with Tukey's post-test. The results were considered significant when the p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 (*).\u003c/p\u003e\u003c/div\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cb\u003eAnxA1 is transiently expressed in synovial tissue and its absence is associated with increased joint nociception and inflammation in experimental OA\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAfter induction of experimental OA in wild-type animals, the tissue surrounding the affected joint was removed to evaluate AnxA1 expression. As observed in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, there was an increase in the expression of the intact and active form of AnxA1 on days 7 and 21, with a return to basal levels on day 42.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eAs pain is a hallmark of OA disability, we evaluated mechanical nociception at different time points after collagenase injection (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, D). The peak of joint nociception occurred 1 week after the first intra-articular challenge with collagenase, with a very low force tolerated by these mice as observed by their paw withdrawal threshold (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). It is also clear that the nociception decreased over the following weeks, as demonstrated in other studies using the same OA model [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], but there was still hypernociception above the results found in the basal evaluations. The maximal nociception observed in AnxA1\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice was like that observed in WT mice, but the increased nociception did not return to baseline in AnxA1\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). The evaluation of the area under the curves (AUC) of nociception showed that AnxA1\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice had lower paw withdrawal thresholds (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003eGiven that significant tissue alterations in joint structures in this model manifest weeks after collagenase injection [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], the histopathological analysis was performed only at 6 weeks after the first collagenase challenge, the last period of observation. This model and the disease in humans are associated with relatively mild synovitis and signs of inflammation when compared to other common arthritis, such as rheumatoid arthritis [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] and gout [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. As evidenced by H\u0026amp;E staining, a mild inflammatory score was evident in collagenase-injected WT mice as compared to saline-injected WT mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, B). However, OA Anxa1\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice had increased inflammatory scores when compared to the OA WT group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, B). On the other hand, based on Safranin-O/Fast-green staining, both OA WT and OA Anxa1\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e groups presented intense loss of joint structure compared to the respective saline-injected groups, but without differences between them (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, C).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eTreatment with the AnxA1-derived peptide, Ac2-26, improves nociception and joint damage in experimental OA\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAs there was sustained higher nociception and increased inflammatory score in the absence of AnxA1 as compared to WT mice in this model, it was investigated whether the peptide Ac2-26 could control these hallmark signs of OA disease. Ac2-26 is the N-terminal part of Annexin-A1 and mimics the anti-inflammatory and pro-resolving effects of the intact protein [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Ac2-26 was given intra-articularly once a week, in the same joint that received collagenase, and treatment started at the 1st, 2nd, or 3rd week after the first injection of collagenase (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Nociception was evaluated weekly just before the treatment with Ac2-26. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, the treatment with Ac2-26 decreased joint nociception regardless of when it was started. By analyzing the areas under the curve, plotted from one week after the beginning of each treatment, there was a significant reduction of joint nociception (higher paw withdrawal threshold) when the Ac2-26 treatment started from the 1st and 3rd week after the first injection of collagenase (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eInterestingly, there was no reduction in the inflammatory score in the histopathology analysis regardless of the moment when the treatment was started (data shown). However, the treatment strategies caused a substantial reduction in bone and cartilage damage as evaluated using the OARSI score for this model as compared to the non-treated osteoarthritic group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, C). The reduction of tissue damage in Ac2-26-treated mice was associated with reduced levels of metalloproteinase 3 in the tissue surrounding the joint in these groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Interestingly, there was a tendency to increase IL-10 in this tissue with Ac2-26 treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC), corroborating with reduced joint damage.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eTreatment with Ac2-26 decreased the activation of synoviocytes\u003c/b\u003e\u003c/p\u003e\u003cp\u003eActivated macrophages and fibroblast-like synoviocytes play a critical role in the pathogenesis of OA, invading surrounding tissues and releasing cytokines and enzymes that cause inflammation, bone and cartilage degradation, and pain [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Here, mouse synovium tissues were collected 42 days after collagenase injection for the analysis of synoviocyte activation. There was an increased number of synovial CX3CR1\u003csup\u003e+\u003c/sup\u003e macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA) and lining (FAP\u003csup\u003e+\u003c/sup\u003eCD90\u003csup\u003e\u0026minus;\u003c/sup\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC) and sublining (FAP\u003csup\u003e+\u003c/sup\u003eCD90\u003csup\u003e+\u003c/sup\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE) fibroblast populations over the saline-injected groups. The treatment with Ac2-26 decreased the number of macrophage-like (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA) and lining fibroblast-like synoviocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). In addition, Ac2-26 treatment decreased the number of these synovial cells expressing RANKL (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB, D), a critical molecule involved in osteoclast formation and consequently bone degradation [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB, F). There were no differences in the number and activation of sublining synovial fibroblasts upon Ac2-26 treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE, F).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eDespite the advances in the knowledge about the mechanisms related to the pathogenesis of OA, current treatment options are not effective in preventing disease progression, and pharmacological treatments are mostly limited to symptom control [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Inflammation of the synovial membrane (synovitis) of joints affected by OA is directly associated with joint dysfunction and damage, resulting in continued activation of resident synovial cells, such as macrophages and fibroblasts [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Here, we investigated whether AnxA1, a well-known pro-resolving mediator, could control joint inflammation, damage, and nociception in an experimental model of OA in mice. The main findings of this study are summarized as follows: 1) Studies in AnxA1-deficient mice showed that endogenous AnxA1 is an important molecule that controls nociception and joint inflammation; 2) Mice that received the AnxA1-mimetic Ac2-26 into the affected joint had reduced nociception and tissue damage, even when treatment was started at a later time point after OA induction; 3) Ac2-26 treatment downregulated MMP3 secretion in joint tissue; 4) Ac2-26 treatment reduced the number of macrophage-like and fibroblast-like synoviocytes expressing RANKL. Altogether, these results clearly show that AnxA1 plays a relevant role in controlling joint inflammation and damage in OA and it can be used therapeutically to treat OA.\u003c/p\u003e\u003cp\u003eSynovitis in OA joints is generally less severe than in other rheumatic diseases, such as rheumatoid arthritis, gout, or bacterial arthritis. However, it directly correlates with the progression of tissue remodeling and symptom severity in OA patients [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Thus, a better characterization of the inflammatory environment and markers of synoviocyte and leukocyte activation in the OA joints should be a constant need to find mechanisms of this disease that consequently help the progression of developing new strategies to deal with it. On the other hand, very few studies have explored if and how mediators that share pro-resolving properties could control OA pathology. Recently, Shih and colleagues demonstrated that the systemic treatment with maresin 1, a specialized pro-resolving lipid mediator, reduced joint nociception of the monosodium iodoacetate (MIA) model of OA in mice, decreasing the expression of the neurotransmitter calcitonin-gene related peptide (CGRP) and markers of macrophage activation in the dorsal root ganglia (DRG) [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. In addition, Ac2-26, the same molecule we used, reduced the senescence status of TNF-stimulated chondrocytes, preventing senescence-related gene expression and NF-κB activation [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Here, we provided the first evidence on how the pro-resolving mediator AnxA1 or its mimetics may serve as an alternative strategy to control joint inflammation, damage, and dysfunction in OA.\u003c/p\u003e\u003cp\u003eAnxA1 and its active N-terminal-derived peptide Ac2-26 are potent anti-inflammatory and pro-resolving mediators that modulate inflammatory processes [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Their main contributions to the resolution of inflammation came from studies of neutrophilic inflammation. Essentially, AnxA1 and Ac2-26 cause neutrophil apoptosis and stimulate its clearance by enhancing its efferocytosis by macrophages [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Furthermore, the capacity of AnxA1 to change the macrophage phenotype to M2 and Mres (resolving-like macrophages) leads to the reduction of the levels of pro-inflammatory cytokines and promotes tissue repair [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e], [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Although OA pathogenesis seems to be independent of neutrophil activation, key features of AnxA1 and Ac2-26 beyond their effect on neutrophils could explain the beneficial effects in this OA model. The discovery of molecules to avoid chondrocyte death and cartilage and bone degradation is are important achievement for OA management. Different enzymes that cause cartilage degradation in OA joints, such as ADAMTS-4 and ADAMTS-5, which cleave aggrecan from its hyaluronic acid structure, and matrix metalloproteinases (MMPs), targeting type II collagen, further weaken the collagen network, culminating in progressive joint deterioration [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. It has been shown that Ac2-26 downregulates ADAMTS-4 in TNF-stimulated chondrocytes, evidencing the direct effect of this molecule in cartilage cells [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Here, the treatment with Ac2-26 in the affected joint reduced the extension of cartilage damage and MMP3 expression in periarticular tissue even when it was started after 3 weeks of collagenase challenge, a time point with already signs of cartilage and bone changes (data not shown). In addition, there was a reduction in the number of macrophage-like and fibroblast-like synoviocytes expressing RANKL, a well-known molecule involved in osteoclastogenesis and bone remodeling [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. However, it needs to be determined if Ac2-26 or other pro-resolving mediator prevents or reverts the progression of tissue damage in this model of OA.\u003c/p\u003e\u003cp\u003eIn our study, AnxA1-deficient mice had persistent joint nociception while the treatment with Ac2-26 in WT mice prevented it. Some works have already demonstrated the anti-nociceptive effects of endogenous AnxA1, as AnxA1-deficient mice had exacerbated nociception in an acetic acid-induced abdominal writhing model compared to WT mice [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In models of arthritis in mice, the systemic treatment with Ac2-26 reduced joint nociception [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Interesting, silencing AnxA1 in DRG [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e] or intrathecal injection of Ac2-26 [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e] reduced thermal and mechanical nociception, evidencing the antinociceptive effect of AnxA1 at neuron levels. Here, the decreased joint nociception caused by treatment with Ac2-26 could be associated with reduced tissue damage and synoviocyte activation or a direct effect on the nociceptors present in the joints and the DRG.\u003c/p\u003e\u003cp\u003eIn conclusion, our results indicate that AnxA1 or Ac2-26 actively contributes to improving joint degeneration and dysfunction characteristic of OA pathology. These findings highlight the need for a deeper investigation into the underlying mechanisms and further exploration of whether the class of pro-resolving mediators holds promise for controlling OA features.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Frankcineia Assis, Ilma Mar\u0026ccedil;al, and Hermes Ribeiro for their technical assistance.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eP.L.B. and F.A.A. analyzed the data and wrote the paper; P.L.B., A.D.B., C.M.Q.J., G.C.M., V.L.S.O., and I.G. performed the experiments and analyzed data; A.M.K. and M.M.T. provided expertise and improvements in the issue and helped with paper discussion; P.L.B. and F.A.A. designed the research; All authors reviewed and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRole of the funding source\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was financially supported by Funda\u0026ccedil;\u0026atilde;o de Amparo \u0026agrave; Pesquisa de Minas Gerais (FAPEMIG - APQ-00110-22), Coordena\u0026ccedil;\u0026atilde;o de Aperfei\u0026ccedil;oamento de Pessoal de N\u0026iacute;vel Superior (CAPES), The National Council for Scientific and Technological Development (CNPq - #403767/2021-0), and Fundo de Apoio \u0026agrave; Pesquisa e Educa\u0026ccedil;\u0026atilde;o da Sociedade Brasileira de Reumatologia.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere are no financial conflicts of interest to disclose. The authors have declared that no conflict of interest exists.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Generative AI in scientific writing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere is nothing to disclose\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eNeogi T. The Epidemiology and Impact of Pain in Osteoarthritis. \u003cem\u003eOsteoarthritis and cartilage\u003c/em\u003e / \u003cem\u003eOARS, Osteoarthritis Research Society\u003c/em\u003e. 2013;21(9):1145. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.JOCA.2013.03.018\u003c/span\u003e\u003cspan address=\"10.1016/J.JOCA.2013.03.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHunter DJ, Bierma-Zeinstra S, Osteoarthritis. Lancet. 2019;393(10182):1745\u0026ndash;59. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0140-6736(19)30417-9/ASSET/20A9DE8C-08A4-4EB9-8439-5447D2AF4C7A/MAIN.ASSETS/GR4.SML\u003c/span\u003e\u003cspan address=\"10.1016/S0140-6736(19)30417-9/ASSET/20A9DE8C-08A4-4EB9-8439-5447D2AF4C7A/MAIN.ASSETS/GR4.SML\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHunter DJ, McDougall JJ, Keefe FJ. The symptoms of OA and the genesis of pain. Rheum Dis Clin North Am. 2008;34(3):623. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.RDC.2008.05.004\u003c/span\u003e\u003cspan address=\"10.1016/J.RDC.2008.05.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePrimorac D, Molnar V, Rod E, et al. Knee Osteoarthritis: A Review of Pathogenesis and State-Of-The-Art Non-Operative Therapeutic Considerations. Genes (Basel). 2020;11(8):854. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/GENES11080854\u003c/span\u003e\u003cspan address=\"10.3390/GENES11080854\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMotta F, Barone E, Sica A, Selmi C. Inflammaging and Osteoarthritis. \u003cem\u003eClinical Reviews in Allergy \u0026amp; Immunology 2022 64:2\u003c/em\u003e. 2022;64(2):222\u0026ndash;238. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/S12016-022-08941-1\u003c/span\u003e\u003cspan address=\"10.1007/S12016-022-08941-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSellam J, Berenbaum F. The role of synovitis in pathophysiology and clinical symptoms of osteoarthritis. \u003cem\u003eNature Reviews Rheumatology 2010 6:11\u003c/em\u003e. 2010;6(11):625\u0026ndash;635. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrrheum.2010.159\u003c/span\u003e\u003cspan address=\"10.1038/nrrheum.2010.159\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSanchez-Lopez E, Coras R, Torres A, Lane NE, Guma M. Synovial inflammation in osteoarthritis progression. \u003cem\u003eNature Reviews Rheumatology 2022 18:5\u003c/em\u003e. 2022;18(5):258\u0026ndash;275. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41584-022-00749-9\u003c/span\u003e\u003cspan address=\"10.1038/s41584-022-00749-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eThomson A, Hilkens CMU. Synovial Macrophages in Osteoarthritis: The Key to Understanding Pathogenesis? Front Immunol. 2021;12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/FIMMU.2021.678757\u003c/span\u003e\u003cspan address=\"10.3389/FIMMU.2021.678757\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBondeson J, Wainwright SD, Lauder S, Amos N, Hughes CE. The role of synovial macrophages and macrophage-produced cytokines in driving aggrecanases, matrix metalloproteinases, and other destructive and inflammatory responses in osteoarthritis. Arthritis Res Ther. 2006;8(6). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/AR2099\u003c/span\u003e\u003cspan address=\"10.1186/AR2099\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVan Den Bosch MH, Blom AB, Schelbergen RF, et al. Alarmin S100A9 Induces Proinflammatory and Catabolic Effects Predominantly in the M1 Macrophages of Human Osteoarthritic Synovium. J Rheumatol. 2016;43(10):1874\u0026ndash;84. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3899/JRHEUM.160270\u003c/span\u003e\u003cspan address=\"10.3899/JRHEUM.160270\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKang F, Wu Q, Zhou X, Huang D, Ji Y. IL-6 Enhances Osteocyte-Mediated Osteoclastogenesis by Promoting JAK2 and RANKL Activity In Vitro. Cell Physiol Biochem. 2017;41:1360\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1159/000465455\u003c/span\u003e\u003cspan address=\"10.1159/000465455\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLuo P, Yuan Q, Wan X, Yang M, Xu P. Effects of Immune Cells and Cytokines on Different Cells in OA. J Inflamm Res. 2023;16:2329. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2147/JIR.S413578\u003c/span\u003e\u003cspan address=\"10.2147/JIR.S413578\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMolnar V, Matišić V, Kodvanj I, et al. Cytokines and Chemokines Involved in Osteoarthritis Pathogenesis. Int J Mol Sci. 2021;22(17):9208. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/IJMS22179208\u003c/span\u003e\u003cspan address=\"10.3390/IJMS22179208\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBorz\u0026igrave; RM, Mazzetti I, Marcu KB, Facchini A. Chemokines in cartilage degradation. \u003cem\u003eClin Orthop Relat Res\u003c/em\u003e. 2004;427(SUPPL.). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/01.BLO.0000143805.64755.4F\u003c/span\u003e\u003cspan address=\"10.1097/01.BLO.0000143805.64755.4F\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMagni A, Agostoni P, Bonezzi C, et al. Management of Osteoarthritis: Expert Opinion on NSAIDs. Pain Ther. 2021;10(2):783. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/S40122-021-00260-1\u003c/span\u003e\u003cspan address=\"10.1007/S40122-021-00260-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMalanga GA, Stone S, Capella T. Topical Review Corticosteroids: Review of the History, the Effectiveness, and Adverse Effects in the Treatment of Joint Pain. Accessed April 24, 2025. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003c/span\u003e\u003cspan address=\"http://www.painphysicianjournal.comwww.painphysicianjournal.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePerretti M, Cooper D, Dalli J, Norling LV. Immune resolution mechanisms in inflammatory arthritis. \u003cem\u003eNature Reviews Rheumatology 2017 13:2\u003c/em\u003e. 2017;13(2):87\u0026ndash;99. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrrheum.2016.193\u003c/span\u003e\u003cspan address=\"10.1038/nrrheum.2016.193\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSugimoto MA, Sousa LP, Pinho V, Perretti M, Teixeira MM. Resolution of inflammation: What controls its onset? Front Immunol. 2016;7(APR). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2016.00160\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2016.00160\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSerhan CN, Savill J. Resolution of inflammation: the beginning programs the end. \u003cem\u003eNature Immunology 2005 6:12\u003c/em\u003e. 2005;6(12):1191\u0026ndash;1197. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ni1276\u003c/span\u003e\u003cspan address=\"10.1038/ni1276\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eParente L, Solito E. Annexin 1: More than an anti-phospholipase protein. Inflamm Res. 2004;53(4):125\u0026ndash;32. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/S00011-003-1235-Z/METRICS\u003c/span\u003e\u003cspan address=\"10.1007/S00011-003-1235-Z/METRICS\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFerlazzo V, D\u0026rsquo;Agostino P, Milano S, et al. Anti-inflammatory effects of annexin-1: stimulation of IL-10 release and inhibition of nitric oxide synthesis. Int Immunopharmacol. 2003;3(10\u0026ndash;11):1363\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S1567-5769(03)00133-4\u003c/span\u003e\u003cspan address=\"10.1016/S1567-5769(03)00133-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQin X, He L, Fan D, Liang W, Wang Q, Fang J. Targeting the resolution pathway of inflammation using Ac2\u0026ndash;26 peptide-loaded PEGylated lipid nanoparticles for the remission of rheumatoid arthritis. Asian J Pharm Sci. 2021;16(4):483. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.AJPS.2021.03.001\u003c/span\u003e\u003cspan address=\"10.1016/J.AJPS.2021.03.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJeremiasse B, Matta C, Fellows CR, et al. Alterations in the chondrocyte surfaceome in response to pro-inflammatory cytokines. BMC Mol Cell Biol. 2020;21(1):1\u0026ndash;18. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/S12860-020-00288-9/TABLES/3\u003c/span\u003e\u003cspan address=\"10.1186/S12860-020-00288-9/TABLES/3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuo D, Tan W, Wang F, et al. Proteomic analysis of human articular cartilage: identification of differentially expressed proteins in knee osteoarthritis. Joint Bone Spine. 2008;75(4):439\u0026ndash;44. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.JBSPIN.2007.12.003\u003c/span\u003e\u003cspan address=\"10.1016/J.JBSPIN.2007.12.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVan Der Kraan PM, Vitters EL, Van Beuningen HM, Van De Putte LBA, Van Den Berg WB. Degenerative knee joint lesions in mice after a single intra-articular collagenase injection. A new model of osteoarthritis. \u003cem\u003eJ Exp Pathol (Oxford)\u003c/em\u003e. 1990;71(1):19. Accessed April 24, 2025. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pmc.ncbi.nlm.nih.gov/articles/PMC1998679/\u003c/span\u003e\u003cspan address=\"https://pmc.ncbi.nlm.nih.gov/articles/PMC1998679/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSachs D, Coelho FM, Costa VV, et al. Cooperative role of tumour necrosis factor-α, interleukin-1β and neutrophils in a novel behavioural model that concomitantly demonstrates articular inflammation and hypernociception in mice. Br J Pharmacol. 2011;162(1):72. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/J.1476-5381.2010.00895.X\u003c/span\u003e\u003cspan address=\"10.1111/J.1476-5381.2010.00895.X\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWeber P, Bevc K, Fercher D, et al. The collagenase-induced osteoarthritis (CIOA) model: Where mechanical damage meets inflammation. Osteoarthr Cartil Open. 2024;6(4). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.OCARTO.2024.100539\u003c/span\u003e\u003cspan address=\"10.1016/J.OCARTO.2024.100539\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAd\u0026atilde;es S, Mendon\u0026ccedil;a M, Santos TN, Castro-Lopes JM, Ferreira-Gomes J, Neto FL. Intra-articular injection of collagenase in the knee of rats as an alternative model to study nociception associated with osteoarthritis. Arthritis Res Ther. 2014;16(1):R10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/AR4436\u003c/span\u003e\u003cspan address=\"10.1186/AR4436\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVan Der Kraan PM, Vitters EL, Van Beuningen HM, Van De Putte LBA, Van Den Berg WB. Degenerative knee joint lesions in mice after a single intra-articular collagenase injection. A new model of osteoarthritis. \u003cem\u003eJ Exp Pathol (Oxford)\u003c/em\u003e. 1990;71(1):19. Accessed April 27, 2025. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pmc.ncbi.nlm.nih.gov/articles/PMC1998679/\u003c/span\u003e\u003cspan address=\"https://pmc.ncbi.nlm.nih.gov/articles/PMC1998679/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMustonen AM, K\u0026auml;kel\u0026auml; R, Lehenkari P, et al. Distinct fatty acid signatures in infrapatellar fat pad and synovial fluid of patients with osteoarthritis versus rheumatoid arthritis. Arthritis Res Ther. 2019;21(1):1\u0026ndash;11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/S13075-019-1914-Y/FIGURES/2\u003c/span\u003e\u003cspan address=\"10.1186/S13075-019-1914-Y/FIGURES/2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGalv\u0026atilde;o I, Vago JP, Barroso LC, et al. Annexin A1 promotes timely resolution of inflammation in murine gout. Eur J Immunol. 2017;47(3):585\u0026ndash;96. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/EJI.201646551\u003c/span\u003e\u003cspan address=\"10.1002/EJI.201646551\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSugimoto MA, Vago JP, Teixeira MM, Sousa LP. Annexin A1 and the Resolution of Inflammation: Modulation of Neutrophil Recruitment, Apoptosis, and Clearance. J Immunol Res. 2016;2016(1):8239258. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2016/8239258\u003c/span\u003e\u003cspan address=\"10.1155/2016/8239258\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBondeson J, Wainwright SD, Lauder S, Amos N, Hughes CE. The role of synovial macrophages and macrophage-produced cytokines in driving aggrecanases, matrix metalloproteinases, and other destructive and inflammatory responses in osteoarthritis. Arthritis Res Ther. 2006;8(6):1\u0026ndash;12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/ar2099\u003c/span\u003e\u003cspan address=\"10.1186/ar2099\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGriffin TM, Scanzello CR. Innate inflammation and synovial macrophages in osteoarthritis pathophysiology. Clin Exp Rheumatol. 2019;37(5):57\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMaglaviceanu A, Wu B, Kapoor M. Fibroblast-like synoviocytes: Role in synovial fibrosis associated with osteoarthritis. Wound Repair Regeneration. 2021;29(4):642\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/wrr.12939\u003c/span\u003e\u003cspan address=\"10.1111/wrr.12939\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLeibbrandt A, Penninger JM. RANKL/RANK as key factors for osteoclast development and bone loss in arthropathies. Adv Exp Med Biol. 2009;649:100\u0026ndash;13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/978-1-4419-0298-6_7\u003c/span\u003e\u003cspan address=\"10.1007/978-1-4419-0298-6_7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePeng X, Chen X, Zhang Y, Tian Z, Wang M, Chen Z. Advances in the pathology and treatment of osteoarthritis. J Adv Res Published online January. 2025;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.JARE.2025.01.053\u003c/span\u003e\u003cspan address=\"10.1016/J.JARE.2025.01.053\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eScanzello CR, Goldring SR. The role of synovitis in osteoarthritis pathogenesis. Bone. 2012;51(2):249\u0026ndash;57. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.BONE.2012.02.012\u003c/span\u003e\u003cspan address=\"10.1016/J.BONE.2012.02.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLoeuille D, Chary-Valckenaere I, Champigneulle J, et al. Macroscopic and microscopic features of synovial membrane inflammation in the osteoarthritic knee: correlating magnetic resonance imaging findings with disease severity. Arthritis Rheum. 2005;52(11):3492\u0026ndash;501. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ART.21373\u003c/span\u003e\u003cspan address=\"10.1002/ART.21373\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAtukorala I, Kwoh CK, Guermazi A, et al. SYNOVITIS IN KNEE OSTEOARTHRITIS: A PRECURSOR OF DISEASE? Ann Rheum Dis. 2014;75(2):390. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1136/ANNRHEUMDIS-2014-205894\u003c/span\u003e\u003cspan address=\"10.1136/ANNRHEUMDIS-2014-205894\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShih YRV, Tao H, Gilpin A, Lee YW, Perikamana SM, Varghese S. Specialized pro-resolving mediator Maresin 1 attenuates pain in a mouse model of osteoarthritis. Osteoarthritis Cartilage. 2024;33(3):341\u0026ndash;50. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.JOCA.2024.10.018/ATTACHMENT/5F18E447-BE73-4DE5-9806-2C946FE26940/MMC2.XLSX\u003c/span\u003e\u003cspan address=\"10.1016/J.JOCA.2024.10.018/ATTACHMENT/5F18E447-BE73-4DE5-9806-2C946FE26940/MMC2.XLSX\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang L, Gong K, Ren G, Chen B. The Annexin A1 Protein Mimetic Peptide Ac2-26 prevents cellular senescence of CHON-001 chondrocytes against tumor necrosis factor-α via the Nrf2/NF-κB pathway. Biotechnol Appl Biochem Published online. 2024. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/BAB.2695\u003c/span\u003e\u003cspan address=\"10.1002/BAB.2695\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGalv\u0026atilde;o I, Vago JP, Barroso LC, et al. Annexin A1 promotes timely resolution of inflammation in murine gout. Eur J Immunol. 2017;47(3):585\u0026ndash;96. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/eji.201646551\u003c/span\u003e\u003cspan address=\"10.1002/eji.201646551\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVago JP, Nogueira CRC, Tavares LP, et al. Annexin A1 modulates natural and glucocorticoid-induced resolution of inflammation by enhancing neutrophil apoptosis. J Leukoc Biol. 2012;92(2):249\u0026ndash;58. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1189/JLB.0112008\u003c/span\u003e\u003cspan address=\"10.1189/JLB.0112008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLeoni G, Neumann PA, Kamaly N, et al. Annexin A1-containing extracellular vesicles and polymeric nanoparticles promote epithelial wound repair. J Clin Invest. 2015;125(3):1215\u0026ndash;27. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1172/JCI76693\u003c/span\u003e\u003cspan address=\"10.1172/JCI76693\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMcArthur S, Juban G, Gobbetti T, et al. Annexin A1 drives macrophage skewing to accelerate muscle regeneration through AMPK activation. J Clin Invest. 2020;130(3):1156. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1172/JCI124635\u003c/span\u003e\u003cspan address=\"10.1172/JCI124635\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJiang L, Lin J, Zhao S, et al. ADAMTS5 in Osteoarthritis: Biological Functions, Regulatory Network, and Potential Targeting Therapies. Front Mol Biosci. 2021;8:703110. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/FMOLB.2021.703110\u003c/span\u003e\u003cspan address=\"10.3389/FMOLB.2021.703110\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiang J, Liu L, Feng H, et al. Therapeutics of osteoarthritis and pharmacological mechanisms: A focus on RANK/RANKL signaling. Biomed Pharmacother. 2023;167. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.BIOPHA.2023.115646\u003c/span\u003e\u003cspan address=\"10.1016/J.BIOPHA.2023.115646\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Y, Ma S, Ke X, et al. The mechanism of Annexin A1 to modulate TRPV1 and nociception in dorsal root ganglion neurons. Cell Biosci. 2021;11(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/S13578-021-00679-1\u003c/span\u003e\u003cspan address=\"10.1186/S13578-021-00679-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePei L, Zhang J, Zhao F, et al. Annexin 1 exerts anti-nociceptive effects after peripheral inflammatory pain through formyl-peptide-receptor-like 1 in rat dorsal root ganglion. Br J Anaesth. 2011;107(6):948\u0026ndash;58. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/BJA/AER299\u003c/span\u003e\u003cspan address=\"10.1093/BJA/AER299\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Osteoarthritis, Annexin A1, Inflammation, Pro-resolving mediator, Ac2-26","lastPublishedDoi":"10.21203/rs.3.rs-7013885/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7013885/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjectives\u003c/h2\u003e\u003cp\u003eWe investigated whether treatment with Annexin A1 (AnxA1) ameliorated joint nociception and tissue damage in an experimental osteoarthritis (OA) model.\u003c/p\u003e\u003ch2\u003eDesign:\u003c/h2\u003e\u003cp\u003eOA was induced by injection of collagenase into the tibiofemoral joint of wild-type (WT) and AnxA1-deficient male Balb/c mice. The control group received saline. Groups of WT mice were treated weekly with Ac2-26, an active peptide corresponding to the N-terminal region of AnxA1, in the affected joint. Mechanical nociception was analyzed weekly, and samples were collected 6 weeks after OA induction to analyze histopathology and markers of joint damage by qPCR and flow cytometry.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eThe expression of Anxa1 is upregulated in the joints at the 1st and 3rd week and returned to the basal level at the 6th week after OA induction. AnxA1-deficient mice had persistent nociception and increased joint inflammation when compared to WT mice, although both groups had comparable cartilage damage. In WT mice, the treatment with Ac2-26 decreased joint nociception, tissue damage, and the expression of metalloproteinase-3 in the joint tissue, even when started in the 3rd week after induction of OA. Collagenase injection increased the number of FAP\u003csup\u003e+\u003c/sup\u003eCD90\u003csup\u003e\u0026minus;\u003c/sup\u003e fibroblast-like and CX3CR1\u003csup\u003e+\u003c/sup\u003emacrophage-like synoviocytes expressing RANKL when compared to saline-injected mice. Treatment with Ac2-26 normalized the latter parameters.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e\u003cp\u003eAnxA1 and Ac2-26 are promising molecules that regulate key processes in OA, effectively mitigating tissue damage and dysfunction in a model of OA in mice.\u003c/p\u003e","manuscriptTitle":"Pro-resolving Annexin A1-derived peptide Ac2-26 reduces nociception and mitigates joint damage in experimental osteoarthritis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-31 14:16:48","doi":"10.21203/rs.3.rs-7013885/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"fdedbcc1-08de-4054-98eb-21c90a884849","owner":[],"postedDate":"July 31st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-01T18:53:24+00:00","versionOfRecord":[],"versionCreatedAt":"2025-07-31 14:16:48","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7013885","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7013885","identity":"rs-7013885","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.