Construction and Characterization of Recombinant Vectored Vaccines for Rabies Virus

Construction and Characterization of Recombinant Vectored Vaccines for Rabies Virus | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Method Article Construction and Characterization of Recombinant Vectored Vaccines for Rabies Virus Manar E. Khalifa, Muhammad Munir This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4281071/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Recombinant vectored vaccines offer trailer-made immunization strategies and are economical, quick to engineer and demand less laboratory infrastructures. Here we describe a detailed protocol for genetic manipulation of vesicular stomatitis virus (VSV) vector system encoding the antigenomic sense RNA of VSV by replacing VSV glycoprotein (VSV-G) with modular rabies virus glycoprotein (RV-G) gene. The production of replication competent recombinant VSV (rVSV) involves the transient transfection of BHK-21 cells with pVSV-expressing RV-G backbone along with transcriptional initiating helper plasmids under the control of T7 polymerase. In addition, we provide comprehensive guidelines on functional, molecular, and structural characterization of the recombinant rVSV-based rabies vaccine. Virology vaccines VSV Reverse genetics Rabies Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Before you begin Vesicular stomatitis virus (VSV) is a non-segmented, and negative strand RNA virus belonging to the family Rhabdoviridae . VSV genome is 11-kb, and it encodes five structural genes including nucleoprotein (N) phosphoprotein (P) matrix (M) glycoprotein (G) and large polymerase (L) 1 . The VSV has been demonstrated as an efficient system for generating recombinant vaccines against viruses of animal and human origins 2 owing to its capability of stable maintenance and expression of transgenes Additionally, VSV offers a versatile tool to study virus host interactions due to its wide host spectrum 3 . The Ebola rVSV-ZEBOV vaccine, based on recombinant VSV, has demonstrated high efficacy, safety, and rapid protective immunity against Ebola virus outbreaks 4 . Similarly, VSV vaccines have been engineered for SARS-COV-2 5 , Andes virus 6 and HIV 7 . Rabies virus (RV) is a highly fatal disease causing approximately 59000 human deaths annually 8 . The remarkable diverse reservoir species of RV, render its control and prevention challenging. However, substantial decrease in human rabies cases could be achieved through development of novel vaccines targeting RV reservoirs. To successfully manipulate the VSV genome and to clone transgenes in compatibility, a sequential process is carried out as outlined in Figure 1 . Mechanistically, the antigenomic cDNA of VSV can be manipulated to insert a transgene (exemplified here with full-length open reading frame (ORF) of the rabies virus surface glycoprotein (RV-G), derived from the Egyptian strain isolate (GenBank accession number MK760770.1). Therefore, RV-G can be inserted in the multiple cloning site of pVSV-dG-GFP between the M and the GFP genes using unique MluI and NheI restriction sites. Consecutively, VSV recovery involves the co-transfection of the full length antigenomic viral RNA of VSV (pVSV-dG-RV-G-GFP) along with plasmids encoding the viral ribonucleoprotein complex (RNP). The RNP is formed by P and L along with N proteins. Upon co-transfecting the RNP complex with the antigenome viral RNA, the RNA is transcribed by T7 polymerase; supplied by infecting the cells with the recombinant fowl pox virus (rFPV). Consequently, the translation of encoded proteins occurs, allowing the assembly of nucleoprotein around the antigenomic RNA and polymerase to replicate forming RNP containing the genomic RNA. The assembly of the infectious virus occurs following the transcription of the mRNA from the genomic RNP and its translation 9,10 (Figure 2) . The M protein required for assembly and budding is not provided in trans since it is produced from the virally encoded M gene released from the generated infectious viral particles 11,12 . Since all the DNA constructs are under the control of T7 RNA polymerase promoter, the rFPV can be utilized to infect cells as a source of T7 RNA polymerase in trans . The efficiency of T7 polymerase promoter infection can be assessed by transfecting the BHK-21 cells with pCITE GFP plasmid, which encodes GFP under the control of T7 promotor 11 . Collectively, this protocol provides a detailed method for the generation of a replication competent VSV carrying a transgene of RV, with the potential to serve as a recombinant vaccine. Biosafety Since VSV is a biosafety level 2 pathogen, all experiments involving handling of VSV should be carried out in a certified biological safety cabinet in designated labs. Thus, before starting, it is necessary to obtain all required documentation to accomplish biosafety level-2 (BSL-2) work. Plasmids Timing : [4-5 days,] 1. To generate the pCAGG-RV-G-HA vector, retrieve the full codon sequence of RV-G gene from NCBI (GenBank accession number MK760770). Codon optimize the RV-G sequence for Homo sapiens and clone the synthesized RV-G in pCAGG vector with HA tag at the C-terminus, referred to as pCAGG-RV-G-HA plasmid. 2. For the generation of rVSVs, the following plasmids are required: i. rVSV-dG-RV-G-GFP ii. pBS-P-ФT Plasmid iii. pBS-L-ФT Plasmid iv. pBS-N-ФT Plasmid v. pBS-G-ФT Plasmid 3. Transform each of these plasmids into DH5 alpha competent cells using the heat shock transformation procedure. 4. Grow the transformed bacteria on LB agar plates, supplemented with ampicillin (100 mg/mL) overnight (16 h) at 37 ˚C. Critical: If no colonies are found, prepare duplicate LB plates of each plasmid, incubate one of them at 30 ˚ C and the other plate at 37 ˚C overnight. 5. Pick a single colony and incubate it in 100 mL LB media supplemented with 100 mg/mL ampicillin overnight at 37 ˚C in shaker incubator. 6. Lyse the bacteria, extract and purify the plasmid DNAs using the Qiagen midi prep kit following the manufacturer instructions. 7. Determine the concentration of the plasmid DNAs by nanodrop method. Primer and probe design Timing: [4 days ] 8. For cloning the full codon optimized sequence of RV-G in the multiple cloning site of pVSV-dG-GFP (flanking the region between M and GFP genes using two restriction sites MluI and NheI) (Figure 3 A) . Design the forward and reverse primers as follows: The forward primer (RV-G F) contains MluI site (underlined, italic letters) and the first 20 nucleotides of the coding region of the G gene (bold letters), nucleotides before the restriction sites represented the complementary bases to the vector sequence. The reverse primer (RV-G R) contains the last 27 nucleotides of the G gene (bold letters) followed by NheI site (underlined italic letters). 9. Upon RV-G cloning into pVSV-dG-GFP and after the rVSV-dG-RV-G-GFP rescue, confirm the stability of RV-G insert by designing primers flanking the RV-G insert in the rVSV-dG-RV-G-GFP,so that the forward primer (VSV-up) encompass the last 33 nucleotides of M gene, and the reverse primer (VSV-down) flank the first 39 nucleotides of GFP gene as demonstrated in schematic diagram (Figure 5 A ). 10. To assess the growth kinetics of the generated rVSV-dG-RV-G-GFP compared to the rVSV-GFP WT, employ the absolute qPCR method to allow comparative quantification between the viral genomic RNA copies of both rVSV-dG-RV-G-GFP and rVSV-GFP-WT. The VSV N gene is targeted since VSV genome RNA replication is proportional to the amount of N protein synthesized 16 . To this end, design and synthesize a VSV N probe, considering the following parameters as previously described 17 : a. Tm of the probe to be 8–10 °C above Tm of the designed primers b. Avoid primer dimer, design the probe length to range from 18-30 bases. c. Ensure that the amplification product length does not exceed 150 bp to ensure high qPCR efficiency. d. BLAST the amplicon product to ensure the specificity of the amplified region. e. The following websites can be used to validate the designed primer/probe https://eu.idtdna.com/pages/tools/oligoanalyzer for primer/dimer detection, https://www.thermofisher.com/be/en/home/life-science/pcr/real-time-pcr/real-time-pcr-learning-center/real-time-pcr-basics/efficiency-real-time-pcr-qpcr.htmL f. Synthesize and label the designed probes with FAM and TAMRA at the 5’ end and 3’ ends; respectively. Cell line maintenance Timing: [2-3 days] 11. Remove BHK-21 cells cryovial from liquid nitrogen and thaw at 37 ˚C immediately. Upon thawing, add 10 mL of pre-warmed growth medium slowly to the thawed cell suspension and centrifuge at 200 xg for 5 min. Discard the supernatant and resuspend the pellet in prewarmed growth medium. Incubate the cells in cell culture flasks at 37 ˚C with 5% CO2. The BHK-21 cells are routinely passaged 2-3 times /week when the cells are 80-90% confluent. 12. Maintain the BHK-21 cells in DMEM with GlutaMAX, supplemented with 10% FBS, and 1X antibiotic antimycotic solution. Key resources table REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse RV Glycoprotein antibody Bio-Rad Cat# MCA2828 Mouse VSV M antibody Abcam, UK Cat# EB0011 Goat anti-Mouse IgG (H+L) Secondary Antibody, HRP Abcam, UK Cat# ab6789 Alexa-fluor goat anti-mouse IgG (468) Invitrogen, USA Cat# A11001 Bacterial and virus strains MAX Efficiency™ DH5α Competent Cells Thermo Scientific, USA Cat# 18258012 Chemicals, peptides, and recombinant proteins Acrylamide/Bis Solution (30%) Bio-Rad, China Cat# 1610158 Agarose low EEO NBS-biologicals, Cambridge, UK (United Kingdom) Cat# R1040 Ammonium persulfate (APS) Bio-Rad, Japan Cat# 1610700 Ampicillin-Na-salt Sigma-Aldrich, St. Louis, USA Cat# A9518 Antibiotic-Antimycotic (100 X) Gibco, Life Technologies, UK Cat# 15240062 BSA (Albumin Bovine Fraction V) Sigma-Aldrich, St. Louis, USA Cat# 05482 Carboxy-methyl-cellulose sodium salt Sigma Aldrich Cat# C4888-500G Crystal Violet Sigma-Aldrich, St. Louis, USA Cat# C0775 DAPI Thermo Scientific, USA Cat# 62247 DMEM, high glucose, GlutaMAX™ Supplement pyruvate Gibco, Thermo Fisher, UK Cat# 10569010 EDTA Millipore, USA Cat# 324503 Ethanol Fisher Scientific, UK Cat# 2107463 Fetal bovine serum Gibco, Life Technologies, UK Cat# 10500-64 GelRed® Nucleic Acid Stain 10000X Water Millipore Cat# SCT123 GeneRuler 1 kb DNA Ladder Thermo Scientific, USA Cat# SM0311 HEPES buffer (1M) Gibco™ Cat# 15630080 L-glutamine (200 mM) Gibco, life technologies, UK Cat# 25030-081 LIVE/DEAD™ Fixable Violet Dead Cell Stain Kit Thermo Fisher, USA Cat# L34964 MEM (10 X) Gibco, life technologies, UK Cat# 21430-020 Methanol Fisher Scientific, UK Cat# 2196137 MluI-HF New England Biolabs, UK Cat# R3198S NheI-HF New England Biolabs, UK Cat# R3131S Non-Essential Amino Acids Solution (100X) Gibco, Life Technologies, UK Cat# 11140050 NP-40 Thermo Scientific, USA Cat# 85124 Nuclease free water Thermo Scientific, USA Cat# 10977-035 NuPAGE (transfer buffer) Novex, Life Technologies, USA Cat# 2270643 Opti-MEM Gibco, life technologies, UK Cat# 31985-070 Paraformaldehyde (4%) Thermo Scientific, USA Cat# J19943-k2 Permeabilization buffer (10 X) Thermo Scientific, USA Cat# 00833356 Pierce Protease inhibitor tablet Thermo Scientific, USA Cat# A32963 Pierce™ ECL western blotting substrate Thermo Scientific, USA Cat# 32106 Potassium phosphate dibasic Sigma-Aldrich, St. Louis, USA Cat# P0662 Pre-stained Protein Ladder (10-180 kDa) Abcam, USA Cat# ab116027 Q5-high fidelity DNA polymerase New England Biolabs, UK Cat# M0491S SDS-sample buffer Life Technologies, USA Cat# 1597380 SDS-solution 10% Bio-Rad, USA Cat# 1610416 Skimmed milk powder Millipore, Switzerland Cat# 70166 Sodium bicarbonate solution (7.5%) Sigma-Aldrich, St. Louis, USA Cat# S5761 Sodium chloride Sigma-Aldrich, St. Louis, USA Cat# S5886 Sodium dodecyl sulphate (SDS) Sigma-Aldrich, St. Louis, USA Cat# L3771 Sodium hydroxide Sigma-Aldrich, St. Louis, USA Cat# 221465 Sodium phosphate dibasic Sigma-Aldrich, St. Louis, USA Cat# S5136 T4 DNA ligase New England Biolabs, UK Cat# M0202 TEMED Bio-Rad, USA Cat# 1610801 Tris-base Sigma-Aldrich, St. Louis, USA Cat# 252859 Tris-EDTA 1X Fisher scientific, USA Cat# BP2473 Triton X-100 Sigma-Aldrich, St. Louis, USA Cat# T8787 Trizma hydrochloride Sigma-Aldrich, St. Louis, USA Cat# RDD009 Trypsin 2.5% Gibco, Thermo Fisher, UK Cat# 15090-046 TurboFect ™Transfection Reagent Thermo Scientific, USA Cat# R0532 Tween -20 Sigma-Aldrich, St. Louis, USA Cat# P2287 VECTASHIELD antifade mounting buffer Vector Laboratories, USA Cat# ZH1108 β-mercaptoethanol Bio-Rad, China Cat# 1610710 Critical commercial assays QIAamp ® Viral RNA mini kit QIAGEN, Germany Cat# 52906 GeneJET Plasmid Midiprep Kit QIAGEN, Germany Cat# K0482 Gene JET Gel Extraction Kit Thermo Fisher, Lithuania Cat# 01237174 SuperScript™ III Platinum™ One-Step RT-qPCR Invitrogen, Thermo Fisher Scientific Cat# 11732088 Experimental models: Cell lines BHK-21 cells ATCC ATCC No: CCL-10 Oligonucleotides RV-G F: TGTTTACGCGTCACTATGGTGCCCCAGGCCCTGCT Invitrogen, Thermo Fisher Scientific N/A RV-G R: ATGAAGAATCTGGCTAGCAGGATTTGAGTTACAGCCGTGTCTCGCCCCCGCTCTT Invitrogen, Thermo Fisher Scientific N/A VSV-UP: GCCCACCATGGGAGCGTGGGTCCTGGATTCTATCAGCCACTTC Invitrogen, Thermo Fisher Scientific N/A VSV down: TGGGACAACTCCAGTGAAAAGTTCTTCTCCTTTACTCAT Invitrogen, Thermo Fisher Scientific N/A qPCR-VSV N-F: TGATCGACTTTGGATTGTCTTCTAA Invitrogen, Thermo Fisher Scientific N/A qPCR-VSV-N R: TCTGGTGGATCTGAGCAGAAGAG Invitrogen, Thermo Fisher Scientific N/A qPCR-VSV-N Probe: FAM-ATATTCTTCCGTCAAAAACCCTGCCTTCCA-TAM Invitrogen, Thermo Fisher Scientific N/A Random Hexamers (100 mL) Invitrogen, Thermo Fisher Scientific Cat# N8080127 Recombinant DNA pBS-P-ФT Plasmid Kerafast, USA Cat# EH1014 pBS-L-ФT Plasmid Kerafast, USA Cat# EH1015 pBS-N-ФT Plasmid Kerafast, USA Cat# EH1013 pBS-G-ФT Plasmid Kerafast, USA Cat# EH1016 VSV-dG-GFP-2.6 plasmid expression vector Kerafast, USA Cat# EH1026 pCAGG-RV-G-HA This study N/A pVSV-dG-RV-G-GFP This study N/A Software and algorithms ZEN Microscopy software Carl Zeiss Imaging, Jena (blue) 3.6 Graphpad prism GraphPad Software Inc. Version 9 CFX Manager™ Software Bio-Rad, UK Version 3.1 Other 0.2 ml PCR tubes Applied Biosystem N/A 0.45-, 0.2 um filter STAR LAB, UK Cat# E4780-1456 1.5 ml microcentrifuge tubes Merck Cat# HS4323 6-Well cell culture plate Greiner Cat# 657160 Autoclave Astell, UK N/A Bacterial incubator 37 oC SANYO, Switzerland N/A Blotting papers Bio-Rad, USA Cat# 170396 Cell culture CO2 incubator Panasonic, Japan N/A Cell culture flask with filter cap 75 cm2 Greiner Cat# 658175 Centrifuge 5424 R Eppendorf, Germany N/A Centrifuge Allegra X-30R Beckman Coulter, UK N/A Centrifuge tube 50 mL Greiner Cat# 227261 CFX96 Real-Time system Bio-Rad, UK N/A ChemiDocTM MP imaging system Bio-Rad, UK N/A Cryovials, 1.8 mL Corning, Mexico N/A CytoFLEX Flow Cytometer Beckman Coulter, USA N/A Latex gloves Fisher Scientific N/A Nano-Drop 2000c spectrophotometer Thermo Scientific Cat#ND2000CLAPTOP Nunc™ Thermanox™ Coverslips Thermo Scientific Cat# 174942 Parafilm Star lab, Hamburg Cat# 13080 Petri dishes for bacteria, 100 mm Sarstedt, Germany N/A Pipette tips 1 mL, 200 mL, 10 mL STAR LAB, UK N/A Pipettes 200 µL-1 mL, 20–200 µL and 0.5 mL–1 mL Gilson N/A PTC-200 Peltier Thermal Cycler Universal Resource Trading Ltd, UK N/A PVDF membrane Thermo Scientific Cat# 88518 qPCR-tube 0.1 mL Bio-Rad, USA N/A SDS-PAGE system Bio-Rad, UK N/A Strippette, 5, 10, 25 mL Corning, Mexico N/A Trans- blot turbo membrane blotter Bio-Rad, UK N/A UV transilluminator Syngene, UK N/A Vortex SLS, lab basics, UK N/A ZOETM fluorescent cell imager Bio-Rad, UK N/A Materials and equipment setup (optional) Plaque overlay medium. Reagent Amount (500 mL) Sterile bottled water 142 mL 10X MEM 50 mL Sodium Bicarbonate Solution (7.5%) 15 mL L-glutamine/Gluta-Max 5 mL Non-Essential Amino Acids 5 mL HEPES (1M) 13 mL Fetal bovine serum 20 mL Critical : Firstly prepare 500 ml of 3% Carboxy methyl cellulose (CMC) in Millipore water, autoclave, then keep at room temperature to cool down, then place the CMC solution in cold room overnight to dissolve. On the day of plaque assay, add the above components (500 mL) to the dissolved 3% CMC (500 mL) solution and keep on magnetic stirrer to mix properly. 1X Phosphate Buffered Saline (PBS) (pH, 7.4) Reagent Final concentration Amount (1 L) KCl (mw: 74.551 g/mol) 200 mg Na2HPO4 (mw: 141.96 g/mol) 1.44 gm KH2PO4 (mw: 136.086 g/mol) t 245 mg Milli-Q water Up to 1 L Heat the mixture until all the components dissolve, then measure the pH. 10 X SDS Running Buffer Reagent Final concentration Amount (1 L) add tris base (molecular weight (mw): 121.14 g/mol) 30.3 gm 0.0347 M Glycine (mw: 75.07 g/mol) 144.4 gm 1.924 M SDS (mw: 288.38 g/mol) 10 gm 0.0347 M Milli-Q water Up to 1 L Place the mixture on a hot plate magnetic stirrer to dissolve the reagents. 10 X TAE buffer Reagent Final concentration Amount (1 L) Tris base 48.5 g Glacial acetic acid 11.4 mL EDTA 0.5 M 20 mL Milli-Q water Up to 1 L Name Reagents Western blot reagents PBS-T 0.5% tween-20 in 1X PBS. 5% Blocking buffer 0.50 gm of Non-fat dry milk (NFDM), mixed with 10 mL of 0.5% tween-20 in 1 X PBS. 10% β-mercaptoethanol loading dye Mix 450 µL of 4X loading dye with 450 µL milli-Q water and add 90 µL β-mercaptoethanol in a microcentrifuge tube. 1 X Transfer buffer Mix 25 mL of NuPAGE transfer buffer (20X) into 475 mL of milli-Q water. 1% NP-40 lysis buffer (pH 7.4, 100 mL) Add 10 mL of 10% NP-40, 1 mL of EDTA 1 mM, 3 mL of 150 mM NaCl,2 mL of 20 mM tris Cl (7.4). Then add 50 mL milli-Q water, and measure the pH, until reaches 7.4 then add up to 100 mL Milli-Q water. 1.5 M Tris HCl pH 8.8 Weigh 27.23 gm of Tris base and add to a flask with magnetic stirrer, complete until 80 mL of Milli-Q water in magnetic stirrer, measure pH. Then, add HCL about 2 mL each time and measure pH until reaches 8.8. Complete with Milli- Q water until 150 mL. 0.5 M Tris HCl pH 6.8 Weigh 18.28 gm of Tris base, add in a flask with magnetic stirrer complete until 80 mL Milli-Q water, measure the pH, then, add HCL about 2 mL each time until pH reaches 6.8, then complete up to 150 mL Milli-Q water. APS (10%, 10 mL) Add 1 gm of Ammonium persulphate into 10 mL Milli-Q water in falcon tube, preferably freshly prepared, aliquot into 1.5 mL tubes and store at -20 °C for future use. Antibody diluent In a flacon tube, add 0.25 gm NFDM in 5 mL 0.5% tween in 1X PBS. IFA reagents 0.1% Triton X-100 . Add 20 µl triton x-100 in 20 mL milli Q-water, vortex to allow proper mixing. Blocking buffer, 0.5 % bovine serum albumin (BSA) In a 50 mL conical tube, weigh 0.25 gm BSA in 50 ml hot milli-Q water on magnetic stirrer to solubilize. Flow cytometry reagents Permeabilization Buffer (10 X) Prepare 1X permeabilization buffer (2 mL) by adding 200 µL in 1800 µL of 1X FCS buffer. Cloning of RV-G into pVSV-dG-GFP expression vector Timing : [5-6 days] 1. Day 1: To amplify the RV-G from the pCAGG-RV-G-HA-COOH vector, prepare the PCR reaction in 0.2 mL PCR tubes (on ice) using high fidelity (HF) Q5 DNA polymerase enzyme as follows: Reagent Amount (50 µL) DNA template (pCAGG-RV-G-HA vector) 500 ng Q5 HF DNA Polymerase 0.02 U/ µL 0.5 µL RV-G-F (10 µM) 2.5 µL RV-G R (10 µM) 2.5 µL 5X Q5 Reaction Buffer (1X) 10 µL 10 mM dNTPs 10 µL 5X Q5 High GC Enhancer (1X) 10 µL Nuclease-Free Water (NFW) up to 50 µL 2. Upon setting up the PCR reaction, gently mix the samples in a vortex, then transfer the samples to the thermocycler. Set the thermocycler conditions as follows: Steps Temperature Time Cycles Initial Denaturation 98 °C 3 min. 1 Denaturation 98 °C 30 sec 35-40 cycles Annealing 65 °C 1 min Extension 72 °C 2 min Final extension 72 °C 10 min 1 Final Hold 4 °C Critical : We recommend setting 3 min for the initial denaturation to ensure separation of the double strand DNA template to allow binding of primers to the target region and starting the extension. Critical: To determine the annealing temperature, we recommend using NEB Tm calculator to optimize the annealing temperature according to the polymerase enzyme and primers used in the PCR reaction (https://tmcalculator.neb.com/#!/main). 3. Upon amplification, perform agarose gel electrophoresis for confirmation and purification of the amplified PCR product as previously described 13 . To prepare 50 mL of 1X TAE buffer, add 5 mL of 10X TAE buffer stock solution in a bottle to 45 mL of milli-Q water. 4. Prepare 0.6% agarose gel by dissolving 0.3 grams of agarose low EEO gel in 50 mL of 1X TAE buffer. Heat the agarose solution in a microwave for 1 minute for solubilization. While leaving the agarose solution to cool down, assemble the gel casting tray, and place the comb. 5. Upon gel cooling, add gel red stain (nucleic acid stain) at a ratio of 10 μL per 50 mL of agarose solution. 6. Prepare the samples by mixing with 6X gel loading dye and load them into the wells (10 μL). Keep one well for loading the GeneRuler 1 kb DNA ladder. Cover the chamber and connect the apparatus to the power supply. Run the gel at 100 voltages for 30 minutes – 1 hour in 1 X TAE running buffer, visualize the gel using a Gel-doc machine (Figure 3 B). a. Purify the PCR product using the Gene JET Gel Extraction Kit following the manufacturer’s instructions. For cutting the bands, examine the gel using the UV transilluminator and excise the DNA band of interest using a razor blade. Then place the gel slice in a pre-weighed microcentrifuge tube with adding the binding buffer at 1:1 volume of buffer (μL): gel (mg). Incubate the gel mixture on a heat block at 65 °C till the gel completely dissolves. Followed by the transfer of the solubilized gel into Gene-JET purification column and centrifugation for 1 min. at 12,000 x g with discarding the flow through. Afterwards, add 700 μL of wash buffer to the column and re-centrifuge at the same speed while discarding the flow through. For removal of any residual washing buffer, re-centrifuge the empty column. Elute the purified DNA by adding 30-50 μL of warmed elution buffer at the centre of the column and incubate for 5 minutes at room temperature. Then centrifuge the tube at 12,000 x g for 2 minutes. Measure the purified DNA concentration using a Nano-Drop 2000c spectrophotometer. 7. For generating the compatible ends of RV-G amplicon and pVSV-dG-GFP, prepare two restriction digestion reactions with each of the pVSV-dG-GFP vector and the RV-G amplicon in 0.2 mL PCR tubes as follows : Critical: Prepare several restriction digestion reactions and elute in small volumes (20 µL) to obtain high DNA concentration for the ligation reactions: Reagent Amount (50 μL) RV-G amplicon or pVSV-dG-GFP plasmid (500 ng/ μL) MluI-HF enzyme 1 μL NheI-HF enzyme 1 μL 10X CutSmart® Buffer 5 μL NFW up to 50 μL 8. Incubate the restriction digestion reaction overnight at 37 °C. 9. Day 2: On the following day, heat inactivate the restriction digestion reaction at 80 °C for 20 minutes. In the meantime, prepare the agarose gel electrophoresis for confirmation and purification of the digested pVSV-dG-GFP and RV-G amplicon as described in steps 4-6 (Figure 3 C and D) . 10. Set up a ligation reaction in 0.2 mL PCR tubes as follows to ligate the digested RV-G amplicon into pVSV-dG-GFP: Reagent Amount (10 μL) pVSV-dG-RV-G-GFP plasmid 100 ng/ μL T4 DNA Ligase Buffer (10X) 1 μL DNA insert (RV-G amplicon) (1.5 kb) 11.28 ng (1:1) or 33.3 ng (5:1) T4 DNA Ligase 1 μL NFW (up to) 10 μL 11. Incubate the ligation reaction overnight at 16 °C. 12. Day 3: On the following day, heat inactivate the ligation reaction at 65 °C for 20 minutes. 13. For transformation of the ligation reaction, thaw the DH5-alpha E.coli competent cells from ˗80 °C into ice. Transform the ligation reaction into of 50 μL DH5-alpha E. coli competent cells in a circular manner, then incubate the transformation mixture for 20 min on ice. For heat shock, transfer the transformation mixture to 42 °C for 45 sec, then keep the samples on ice for 10 min. Mix the transformation mixture with pre-heated 250 μL of SOC medium, then incubate the mixture for 1 hr at 37 °C in a shaking incubator. 14. During the incubation, prepare LB agar plates with the selective bacterial medium by dissolving the LB agar in the microwave. When reaching 55 °C, add ampicillin at a final concentration of (100 μg/mL). 15. On clean bench, pour the LB gar into the petri dishes and keep until solidification at room temperature. After incubating the transformation mixture, plate 50 μL of the transformation mixture on the prepared LB agar plates and then incubate it overnight at 37 °C. Critical: Include control LB agar plates transformed with (1) uncut vector only (to ensure that the colonies are not due to vector recircularization), (2) cut vector only (to ensure viability of competent cells). 16. Day 4: On the next day, check the plates for the presence of colonies. Pick up separately the single, well-defined colonies, and incubate in 5 mL LB broth containing 100 μg/mL ampicillin overnight, in a shaking incubator at 37 °C. Troubleshooting 1 . 17. Day 5: The following day, use 4.5 mL of the bacterial culture for plasmid purification using Qiagen miniprep kit following the manual instructions. Critical: Purification of pVSV-dG-RV-G-GFP vector, using midi prep kit, resulted in very low plasmid concentrations. Thus, purification of pVSV-dG-RV-G-GFP was carried out using the mini-prep kit. 18. Mix the rest of the culture (0.5 mL) with the preservation medium (50% glycerol stock in milli-Q water) and keep at -80 °C for future use. 19. To validate proper cloning of the RV-G insert into pVSV-dG-GFP, perform colony PCR, and diagnostic restriction digestion. a. Colony PCR i. Transfer 1 mL of bacterial culture of each of the selected colonies separately into 1.5 mL microcentrifuge tubes, ii. Centrifuge the bacterial culture at 13,000 x g for 10 minutes, then discard the supernatant and resuspend the pellet in 40 μL NFW with mixing. Incubate the samples at 100 °C for 10 minutes in bench incubator, followed by centrifuging the samples at 13,000 x g for 5 minutes and transfer the DNA containing supernatant to a new microfuge tube, serving as the template DNA. Use RV-G gene specific primers (RV-G-F and RV-G-R), to perform the PCR reaction and visualize the amplified region with agarose gel electrophoresis as described in steps 3-6 (Figure 3 E) . b. Diagnostic restriction digestion i. Upon purification of plasmid DNA, set up a restriction digestion reaction as described in steps 7-9 ( Figure 3 F) . Rescue of pVSV-dG-RV-G-GFP Timing : [6-7 days] For the recovery of infectious virus from pVSV-dG-RV-G-GFP, co-transfect the modified pVSV-dG-RV-G-GFP along with the VSV helper plasmids as previously described 14 . 20. Day 1: In two six well plates, seed BHK-21 cells at a density of 0.3 X 10 6 cells/well in 1.5 mL growth medium, and incubate the plates at 37 °C /5% CO2 for 24 hrs. 21. Day 2: when the BHK-21 cells reach 80-90% confluency, aspirate the growth medium and wash the cells once with 1 X PBS. In the meantime, prepare the rFPV virus inoculum (at MOI of 2), by mixing with 800 µL DMEM in 1.5 mL Microcentrifuge tubes on ice. 22. Aspirate the PBS and inoculate the BHK-21 cells with the prepared rFPV inoculum as a source of T7 promoter. Incubate the infected cells at 37 °C for 2 hrs with shaking every 15-20 minutes, to allow uniform virus distribution. Critical: As a source of T7 polymerase, it is recommended to use rFPV instead of vaccinia virus, since infecting mammalian cells with rFPV would not result in production of infectious virus and in contrast to vaccinia virus, rFPV would not interfere with infection studies of other virus 20 23. During the incubation, prepare a transfection mixture including pVSV-dG-RV-G-FP along with VSV helper plasmids in 15 mL conical tube with the following ratios: Plasmid Concentration pVSV-dG-RV-G-GFP 2.5 μg pBS-N-ФT 0.75 μg pBS-P-ФT 1.25 μg pBS-L-ФT 0.5 μg pBS-G-ФT 2.5 μg 24. Mix the prepared plasmids with 22.5 µL of turbofect transfection reagent, diluted in 750 μL Opti-MEM, followed by vortexing the transfection mixture and incubate it at room temperature (RT) for 25 min. 25. After 2 hrs, remove the rFPV inoculum, and wash the infected cells 3 times with 1 X PBS. Remove the 1X PBS and add the transfection mixture in a dropwise manner to the cells with swirling the plates gently. Keep the plates at 37 °C/ 5% CO2 overnight (see Notes 7 and 8). Critical: Include control wells as follows: (1) wells infected with rFPV, then transfected with pCITE-GFP plasmid control (encodes the ORF of GFP under the control of T7 promoter), to ensure the efficiency of T7 promoter in rFPV virus. (2) wells transfected with pCAGG-GFP only. (3) wells infected with rFPV, then transfected with pVSV-dG-GFP and VSV helper plasmids. Critical: It is recommended to prepare 8 wells transfected with the prepared plasmids mixture to obtain enough volumes of the rescue viruses. 26. Check the GFP daily using fluorescence microscope and examine the cytopathic effect (CPE) evidenced by syncytia formation. Twenty-four hrs post transfection, GFP is observed in the following wells: wells transfected with pCAGG GFP only, wells infected with rFPV and transfected with pCITE GFP, wells infected with rFPV and transfected with pVSV-dG-GFP WT along with VSV helper plasmids (Figure 4 A-C) . Troubleshooting 2 . 27. After 96 hrs, the GFP is observed in wells infected with rFPV and transfected with pVSV-dG-RV-G-GFP. Once GFP is observed in cells transfected with pVSV-dG-RV-G-GFP. Freeze and thaw the plates 3 times for collecting the released virus. Centrifuge the recovered virus at 300 x g, collect the supernatant in sterile conical tubes, followed by passing the virus through 0.22 μm syringe filter to remove the recombinant fowl pox virus, then aliquot in sterile microcentrifuge tubes and keep at -80 °C for future use (Figure 4 D) . 28. Carry out further passaging of the rVSV-dG-RV-G-GFP, by inoculating the rescued VSV-dG-RV-G-GFP on BHK-21 cells to ensure the stability of the RV-G insert (Figure 4 E ). Troubleshooting 3 . Molecular characterization of rVSV-dG-RV-G-GFP Reverse transcription polymerase chain reaction (RT-PCR) Timing : [2 days] To confirm the stability of RV-G insert in the rVSV-dG-RV-G-GFP subsequent passages, carry out RT-PCR through the following steps. 29. Day 1: Viral RNA extraction a. Extract the viral RNA from the following wells: (1) viral supernatant of rVSV-dG-RV-G-GFP 3 rd passage and (2) viral supernatant of rVSV-GFP-WT, using QIAamp Viral RNA Mini Kit (QIAGEN) kit following the manufacturer's instructions. b. In 1.5 ml sterile, clearly labelled microcentrifuge tubes, add for each 140 μL viral supernatant, 560 μL lysis buffer AVL and 5.6 μL carrier RNA, mix with pulse vortexing for 15 s. Incubate the mixture at RT for 10 mins and briefly centrifuge to remove drops from the inside lid. c. Add 560 μL absolute ethanol to the mixture and mix by pulse-vortexing, then briefly centrifuge to remove drops from the lid. d. Label and prepare the QIAamp Mini column for each sample, transfer 630 μL of the lysate into the QIAamp Mini column, then centrifuge at 6000 x g for 1 min., followed by discarding the collection tube, and placing the column in a new collection tube. e. Repeat the previous step until the samples are fully loaded. f. Wash the column twice as follows: once with 500 μL AW1 Buffer and the next wash with 500 μL of Buffer AW2. After each wash, centrifuge the column at 6000 x g for 1 min in the initial wash and for 3 min at 20,000 x g in the second wash and then place into clean collection tube. g. Centrifuge the spin column for 1 min at full speed for removal of any residual washing buffer. h. To elute the viral RNA, add a volume of 30 µL AVE buffer to the centre of the membrane after setting in a sterile, labelled microfuge tube then incubate for 5 min at RT. i. After incubation, centrifuge the tubes at 6000 x g for 1 min. j. Quantify the extracted viral RNA using nanodrop spectrophotometer with checking and recording the RNA quality. Keep the viral RNA at -80 °C until use. 30. Day 2: Setting up the RT-PCR reaction. a. The extracted viral RNA is used as a template for RT-PCR. Prepare the cDNA synthesis mixture in 0.2 mL thin-walled PCR tube for each sample. Prepare a 20 µL reaction with the following components in two steps: b. Set up the following reaction mixture on ice to anneal the primer to template RNA (step 1): Component Volume 2 μM gene-specific reverse primer 1 μL 10 mM dNTP mix (10 mM each) 1 μL Template RNA (100 ng RNA) 8 μL DEPC-treated water 3 μL c. Mix the reaction components, then heat the template RNA primer mixture at 65 °C for 5 minutes and incubate on ice for 1 minute. d. Set up the RT reaction mixture (step 2) as follows: Component Volume 5× SSIV Buffer 4 μL 100 mM DTT 1 μL RNase-OUT™ Recombinant RNase Inhibitor 1 μL Super-Script® IV Reverse Transcriptase (200 U/ µL) 1 μL e. Mix the contents of both reactions and incubate at 55 °C for 10 minutes, followed by incubating the reaction at 80 °C for 10 minutes for reaction inactivation. f. Prepare the PCR reaction using VSV-up and VSV down primers as demonstrated in the schematic diagram (Figure 5 A) . Component Amount (25 μL ) Final concentration DNA template 1 μL 100 ng Dream-Taq Green PCR Master Mix (2X) 12.5 μL 0.02 U/μL 10 mM VSV-UP primer 0.625 μL 0.5 µM 10 mM VSV-Down primer 0.625 μL 0.5 μM NFW up to 25 μL g. Set up the PCR thermocycler at the following conditions: Steps Temperature Time Cycles Initial Denaturation 95 °C 3 min 1 Denaturation 95 °C 30 sec 35 cycles Annealing 67.8 °C 1 min Extension 68 °C 2 min Final extension 68 °C 10 min 1 Final Hold 4 °C h. Upon amplification, perform agarose gel electrophoresis (Figure. 5 B) . Sanger sequencing Timing : [3-4 days ] To verify the correct orientation and stability of RV-G insert in the rescued rVSV-dG-RV-G-GFP, prepare the concentration of primers (VSV-UP and VSV-down primers) and plasmids according to the sequencing company specifications. Analyse the sequence contigs using the NCBI BLAST tool (Figure 5 C) . Assessment of rVSV-dG-RV-G-GFP replication fitness Plaque assay Timing : [5-6 days ] Plaque assay represents a quantitative method for measuring the infectious virus progeny through plaques quantification of culture infected cells with serial dilution of the virus specimens 15 . While viral RNA quantification provides highly specific and sensitive method, it does not usually reflect whether all the replicating viral genome copies were capable of releasing infectious virus particles. Herein, we explain the plaque assay utilizing liquid overlay medium. 31. Day 1: In a 6 well plate, seed BHK-21 cells at a density of 0.3 x 10 6 cells/well. Incubate at 37° C with 5% CO2, until reaching 70-80% confluency. 32. On the same day, prepare 3% CMC, autoclave then keep the 3% CMC solution at RT until it cools down, then keep it overnight at 4 °C to allow solubilization. 33. Day 2: Next day in the morning, transfer the 3% CMC solution bottle from 4 °C to the bath bead, set the temperature at 37 °C to warm up. 34. In the safety cabinet, perform ten-fold serial dilution of the virus supernatants by adding 900 μL of infection medium in 1.5 mL tubes, then transfer 100 μL of each lower dilution specimen to the subsequent tube of higher dilution. Prepare the virus supernatant dilutions as follows: 10 −1 , 10 −2 , 10 −3 , 10 −4 , 10 −5 , and 10 −6 , followed by vertexing until reaching the final dilution. Critical: If the virus titre is too high, perform until the 10th dilution. Perform the specimens’ dilutions in triplicates and for each plate, set uninfected wells to serve as negative control. Properly label the six well plates with the corresponding dilutions. 35. After preparation of the serially diluted virus, remove the growth medium from BHK-21 cells and wash the cells once with 1 X PBS. 36. Aspirate the PBS, then add 900 μL of the prepared virus dilution designated for each well after vertexing each tube, then incubate the plates at 37 °C in a 5% CO2 incubator for 2 hrs, with shaking every 15-20 min. 37. During virus incubation, prepare the overlay medium and mix it with equal volume of 3% CMC solution to be used as plaque overlay medium and keep on magnetic stirrer for obtaining uniform plaque overlay medium. 38. After 2 hrs of virus infection, remove the plates from the incubator and in the biosafety cabinet, remove the diluted virus supernatants, wash the infected cells 3 times with 1 X PBS. 39. Aspirate, the PBS, then with a 25 mL stripettor, gently add 4 mL of the prepared plaque overlay medium/ well, starting from uninfected wells to wells infected with highest virus dilution, then finally to wells with the lowest virus dilutions. 40. Carefully, transfer the plates into 37 °C incubator with 5% CO 2 for 72 hrs. Check daily for plaque formation and for GFP. 41. After 72 hrs, transfer the plates from the incubator into biosafety cabinet class II, add 1 mL of 4% PFA for each well for fixation, begin with wells of uninfected cells, followed by wells of highest virus dilutions then lowest virus dilutions. 42. Place the plates on a shaker at RT for 1 hr to allow fixation. 43. After 1 hr, tilt the plates to your side and using a stripettor, gently aspirate the overlay medium from the plates and discard them in a bottle with detergent. Critical: Ensure not to disrupt the cell monolayer to maintain the rounded shape of formed plaques. 44. Upon removal of the overlay medium, stain the cells by adding 1 mL of 0.5% crystal violet and keep on a shaker for 1 hr at room temperature. 45. For counting the plaques, remove the stain and wash the wells gently with water until the rounded plaques appear in a purple monolayer. The uninfected reference control should appear as uniform monolayer without any plaques (Figure 6 A-B) . Count the plaques at the highest virus dilution with 5-100 plaques using the following equation: Virus titre PFU/mL)= Average number of plaques given by the identified virus dilution/ (dilution factor × volume of inoculum per plate). Troubleshooting 4 . 46. Dispose the plates in biohazardous waste for autoclaving, for liquid waste, incubate at RT overnight before disposal. Quantitative One step RT-qPCR (TaqMan™) Timing : [5-6 days] 47. Day 1-4 : Viral RNA extraction Extract the viral RNA of infected BHK-21 cells with both rVSV-dG-RV-G-GFP and rVSV-dG-GFP-WT as described above in step 29 (see molecular characterization, RT-PCR). 48. Day 5: Standard curve a. Upon extraction of the viral RNA, prepare different viral RNA concentrations and quantify the genomic viral RNA in each of the prepared samples, using the SuperScript™ III Platinum™ One-Step RT-qPCR Kit following the manufacturer’s instructions. b. Set up the RT-qPCR reactions on ice, prepare a master mix, followed by adding the reactions in plate wells on ice, add the template viral RNA at the end separately to each well. Each of the viral RNA concentrations is performed in triplicates. c. Set up the One-step RT-qPCR reaction in 96-well PCR plates as follows. Component Volume (50 μL) Final concentration SuperScript™III RT/Platinum™ Taq Mix 1 μL 2X Reaction Mix 25 μL FWD primer 1 μL 10 μM REV primer 1 μL 10 μM Fluorogenic probe 0.5 μL 10 μM RNaseOUT™ 1 μL RNA template 10 μL 1 pg to 1 μg DEPC-treated water Up to 50 μL d. Upon setting up the reactions, seal the 96 well plate with micro seal adhesive film, then collect the plate contents by brief centrifugation. Place the plate in CFX96 Real-Time system and set up the RT-qPCR profile of the quantitative One step RT-qPCR (TaqMan™) as follows: Temperature Duration No of cycles 50 °C 15 minutes 95 °C 2 minutes 95 °C 15 sec 40 60 °C 30 sec Melt curve 65 °C to 95 °C increment 0.5 for 0.05 +plate read e. Once the cycle ends, copy the files and analyse the data. f. In Excel file, generate two standard curves for each of rVSV-dG-RV-G-GFP and rVSV-GFP-WT, representing the log of copy number values (different dilutions) on the X -axis versus the CT values obtained for each of the viral RNA dilutions on the Y - axis (Figure 7 A-B) . g. From the plotted standard curve in Excel sheet, right click on the graph, select trendline option, click display equation then an equation appears as follows: h. Y, CT values= (-3.1452(m), slope) X, log quantity +21.74(b), intercept. i. For calculating the efficiency of qPCR reaction, the following equation is used: Efficiency;e = (10 (-1/m;slope) -1) x 100 , efficiency could also be calculated from this website by entering the slope https://www.agilent.com/store/biocalculators/calcSlopeEfficiency.jsp?_requestid=4967792. where: e = theoretical efficiency, Slope = the slope of the standard curve, plotted with the y axis as Ct and the x axis as log(quantity). For rVSV-dG-RV-G-GFP and rVSV-GFP-WT, the efficiency of qPCR was 94.24 and 107%; respectively. Typically, amplification efficiency ranges from 90-110%. j. To quantify the genomic viral RNA copies of rVSV-dG-RV-G-GFP and rVSV-GFP-WT in time dependent manner, infect BHK-21 cells (70-80 % confluency) with rVSV-dG-RV-G-GFP or rVSV-GFP-WT at MOI=1. Collect the viral supernatants at different time intervals from 6 hrs until 42 hpi, to comparatively assess the replication of both viruses and to determine the peak of virus replication. k. Extract the viral RNA from the collected viral supernatants and set up qRT-PCR reaction for all obtained specimens as described above. l. After obtaining the CT values of the samples, calculate their mean and standard error at the different time points. m. Quantify viral RNA copies of rVSV-dG-RV-G-GFP and rVSV-GFP-WT at the different time points using the following equation: T (quantity)=10 (CT(Cycle Threshold)-b(intercept)/m(slope) . Then calculate Log 10 of the obtained values and plot as growth curves in GraphPad Prism (Figure 7 C) . Structural characterization Immunofluorescence staining assay. Timing : [4-5 days ] To demonstrate the localization of VSV-M and RV-G proteins in each of rVSV-dG-RV-G-GFP and rVSV-dG-GFP-WT, perform IFA assay 18 as follows: 49. Day 1: In a 24 well plate, seed BHK-21 cells at a density of 5 × 10 4 cells/well on cover slips, incubate at 37 °C/5% CO2 for the next day. 50. Next day, upon reaching 70-80% cell confluency, wash the cells with 1 X PBS. 51. While washing the cells, prepare the virus inoculum of each of rVSV-dG-RV-G-GFP and rVSV-dG-GFP-WT by diluting in infection medium (MOI of 1). 52. Remove the PBS from the BHK-21 cells, then inoculate the prepared virus onto the cells, followed by incubating the plates at 37° C for 2 hrs with shaking. 53. Two hrs post infection, remove the virus inoculum and wash the cells 3 X with 1 X PBS, then aspirate the PBS and add the growth medium. 54. Day 3: Twenty-four hrs post infections, check the cells for GFP to ensure successful infection and wash the infected cells three times with 200 μL/well 1 X PBS. 55. Aspirate the PBS, then add 200 μL /well of 4% PFA at RT for each well to allow cell fixation. After 1 hr, remove the PFA and wash the cells with 1 X PBS. Critical: 36. Ensure proper rinsing after each step to avoid false positive results. Also, it is recommended to place the plate on a shaker to allow proper distribution of the reagents. Critical: Ensure proper rinsing after each step to avoid false positive results. Also, it is recommended to place the plate on a shaker to allow proper distribution of the reagents. 56. Upon PBS removal, permeabilize the cells by adding 200 μL/well of 0.1% Triton X-100 for 10 minutes. After 9 minutes, remove the triton and wash the cells 3 times with 1 X PBS, allow 5 min/wash to ensure removal of all traces of the Triton solution . Critical: Triton X-100 is recommended to be used as it permeabilize lipid bilayer and nuclear membrane. Ensure not to incubate triton with the cells for longer times or using high concentrations as it might destroy the cell membrane. 57. Aspirate the PBS, then add 200 μL/well of blocking buffer composed of 0.5% bovine serum albumin (BSA) for 1 hour at RT on a shaker, to block non-specific binding. 58. After 1 hr, remove the blocking solution, and prepare the primary antibody which is either targeting VSV-M or RV-G as follows: the monoclonal VSV M antibody (produced in mouse or the monoclonal RV-G antibody. Prepare VSV-M or RV-G antibody solutions at concentration of 1:400 for the primary antibodies by diluting 3 μL of the primary antibody in 1200 μL 0.5 % BSA solution, with adding 200 μL of the antibody solution / each well. Incubate the plate with the primary antibody, overnight at 4° C on a shaker, cover the plate with aluminium foil to prevent evaporation of the contents. 59. Day 4: Next day, remove the primary antibody solution. rinse the cells for 3 times with 1 X PBS, 5 min/wash for removal any excess of the primary antibody solution. 60. Prepare the secondary antibody solution as follows: Prepare a concentration of 1:800 for the secondary antibody solutions by diluting 1.5 μL of the secondary antibody goat anti-mouse IgG Alexa-Fluor 488 in 1200 μL 0.5 % BSA, with adding 200 μL of the antibody solution / each well, incubate for 1-2 hrs at RT on shaker with covering the plate with aluminium foil. 61. After 2 hrs, aspirate the secondary antibody solution, wash the cells with 1 X PBS for 3 times, 5 min/wash, and a final wash with distilled water, aspirate the distilled water. 62. Thereafter, for nuclei staining add 200 μL of 4’,6-diamidino-2-phenylindole (DAPI) for 30 minutes (1:10,000) on a shaker, covered with aluminium foil. In the meantime, prepare glass slides mounted with 1 drop of VECTASHIELD as the mounting medium. For each glass slide, mount 2 coverslips and clearly label them with the corresponding samples. 63. After nuclei staining, gently dislodge the coverslips form the plates using forceps, then dip the cover slips in Milli-Q water, followed by gently drying the coverslips’ edges in fibre free paper. 64. Carefully, invert the cover slides, so that the side with cultured cells, is in the bottom. To avoid any air bubbles, gently press the coverslip with the tip of a 1 μL pipette tip. 65. Seal the cover slip into the microscopic slides with a clear nail polish by gently adding one drop on each of the coverslip corners. Avoid dissemination of nail polish as that will interfere with visualization. To ensure dryness of the nail polish, keep the microscopic slides for around 30 minutes to dry, in a dark place. 66. Keep the slides at 4° C, covered, to be away from light, until imaging. Preferably, image the slides within 2 weeks since prolonged storage might result in dryness of the cells. 67. Acquire the images with laser confocal microscope, (LSM880). Execute and analyse the images using Zeiss software (Figure 8 A) . Western blot Timing : [6-7 days ] To confirm in frame cloning and expression of RV-G and to demonstrate the proper assembly of rVSV-dG-RV-G-GFP and rVSV-dG-GFP-WT, we assessed the expression of RV-G and VSV-M proteins by western blot as previously described 19 . 68. Samples preparation a. Day 1: In two six well plates, seed BHK-21 cells, at a density of 0.3 x 10 6 cells/well. Incubate the plates at 37 °C/ 5% CO2 until the following day. b. Day 2: On the following day, upon reaching the cells 70-80 % confluency, aspirate the growth medium and wash the cells once with 1 X PBS, then infect 3 wells with rVSV-dG-RV-G-GFP at MOI=1, other 3 wells with rVSV-dG-GFP WT at MOI=1 and keep 3 wells as mock control. c. Prepare the infection medium by diluting either the rVSV-dG-RV-G-GFP or rVSV-dG-GFP-WT in 900 μL DMEM only without serum or antibiotic and infect the cells with the inoculum, then incubate the plates for 2 hrs at 37 °C/5% CO 2 , with shaking every 15-20 min to allow even distribution of the virus into cells. d. After 2 hrs, remove the inoculum and wash the cells 3 times with 1 X PBS, then add the growth medium. e. Day 5 Thirty-six hours post infection, wash the cells 3 times with 1 X cold PBS, then add 200 uL of ice cold 1X PBS, scrape the cells using 1 mL pipette tip detach the cells. Critical: For BHK-21 cells, cell detachment is easily carried out by ice cold 1 X PBS. For other adherent cell lines, gentle dissociation reagents such as Accutase could be used. Preferably, from this step all subsequent steps for sample preparation to be carried out on ice. f. Collect the PBS scraped cells into the corresponding labelled 1.5 mL labelled Microcentrifuge tubes. g. Centrifuge the cells at 300 x g for 5 min, discard the supernatant and resuspend the cell pellet in 100 μL of 1% NP-40 lysis buffer added to it protease inhibitor tablet to obtain the whole cell lysates. h. Place the samples on ice and keep on a shaker for 30 min, then centrifuge the samples at 13000 x g for 20 min. i. Discard the pellet and transfer the supernatant into fresh new, labelled 1.5 mL Microcentrifuge tubes. 69. Gel casting and preparation. a. Assemble the casting stand, casting frame, small and large glass plates 1.5 mm for gel casting as follows: b. Initially place the large rectangular casting stand on a clean, dry surface. Align the bottom of small and large 1.5 mm glass spacers together, with the smaller plates facing the outside. Secure the aligned glass plates into the frame by pushing gates of the frame out to the sides. Assemble the casting frame with the glass plates into the casting stand. Critical: Check whether assembled plates in the casting stand are properly sealed, by pipetting 1 mL of water into the space between the plates, if no leaking, then it is ready to prepare the gels, pour the water added into a sink and dry the plates from any residual water. If leakage is observed, reassemble the plates in the casting frame within the casting stand. c. For SDS-PAGE, resolving and stacking gels are required. a resolving gel in which proteins are resolved based on their molecular weights (MWs) and a stacking gel in which proteins are concentrated before entering the resolving gel. Prepare the resolving and stacking gels as follows. Critical: If you need to prepare all the gels at the same time, you can do so, but do not add 10% SDS, 10% APS and TEMED until you are ready to pour the gels in the casting tray as this will result in gel polymerization and solidification. Critical: If needed to visualize proteins of different sizes in the same gel, prepare a gradient gel of two different concentration for example from 8-12%. Prepare 5 mL of each of the gel concentrations in separate conical tubes. Using a 10-mL serological pipette, pipette half the volume from the low gel concentration tube and then add to it the other half from the high gel concentration tube, aspirate air bubble up to the pipette, to allow mixing of the low and high gel concentrations. Slowly pipette the gradient solution into the gel cast, preferably use the serological pipette. Component Resolving gel 12% (10 mL) Resolving gel 8% (10 mL) Stacking gel (4%) (4 mL) Milli-Q water 33 mL 4.6 mL 2.7 mL 30% acrylamide-Bis acrylamide 4 mL 2.7 mL 670 μL 1.5 M Tris-HCL pH 8.8 25 mL 2.5 mL - 0.5 M Tris-HCL pH 6.8 - - 500 μL 10% SDS 100 μL 100 μL 40 μL 10% APS 100 μL 100 μL 40 μL TEMED 4 μL 6 μL 4 μL d. Upon assembly of the gel casting tray, pour the prepared resolving gel into the space between the assembled glass plates. Make sure to leave a space of around 2-4 mL for the stacking gel. e. Add 1 mL of Isopropanol over the resolving gel to ensure a uniform gel is formed, without any air bubbles. Wait for 30-45 min until gel solidification (can be checked by leaving some gel solution in the tube). f. Upon solidification of the resolving gel, remove the isopropanol by tilting the apparatus (also you can ensure no remaining isopropanol by drying in between the glass plates with filter paper), then pour the stacking gel and insert the 10-well, 1.5 mm comb. Leave the gel for solidification for approximately 30 min, then remove the comb. 70. Electrophoresis and blotting a. Remove the clamp assembly carrying the gel from the gel casting stand and place it into the electrode assembly. Pour 1 X SDS running buffer (prepared by diluting 10 mL of 10 X SDS buffer into 90 mL Milli-Q water, add the water first as SDS form foams) into the electrode assembly and in the buffer chamber at a level halfway between the short and the large plates. b. Initially run the gel for 30 minutes at low voltages (V) (60 V) for the separating gel, then apply higher voltages (100-120 V) for the stacking gel. Once the dye runs off the bottom of the gel, remove the electrode assembly. c. To prepare for gel blotting, activate the PVDF membrane (Thermo Scientific™), soaked in methanol for approximately 2 min. (Fisher Chemical) and immerse the filter paper in 1 X transfer buffer, then equilibrize the gel in transfer buffer. d. For blotting, arrange the gel in the Trans- blot turbo membrane blotter (Bio-Rad), by adding three layers of filter paper followed by the PVDF membrane (make notch in one corner to indicate orientation of gel – to indicate which side the ladder is and which way the membrane should face) then add the gel followed by other 3 layers of filter paper. Ensure there are no air bubbles while blotting the membranes, by gently using a roller over the membranes. Set the transfer conditions as follows: 1.3 A, 25 V for 30 minutes for the mini gel. e. Upon membrane blotting, carefully remove the filter papers and the gel, then gently trim the PVDF membrane with blotted proteins, and place the membrane (avoid membrane dryness in all steps) in a 50-mL conical tubes for blocking in 10 mL of 5% non-fat dry milk in PBST (0.5% tween-20 in 1X PBS) for 1 hour on a roller at RT. f. Afterwards, wash the membrane once with 10 mL of 0.5% tween 20 in 1X PBS. g. During washing, prepare the primary antibody solution with either the monoclonal VSV M antibody (Kerafast Cat# EB0011, RRID:AB_2734773) or the monoclonal RV-G antibody (Bio-Rad Cat# MCA2828, RRID:AB_1125351) produced in mouse. Prepare the primary antibody solution at a concentration of 1:2000, prepared by mixing in a conical tube 2.5 μL of the primary antibody in 5 mL of 5% non-fat dry milk in PBS-T. h. Remove the washing solution, then add the primary antibody to the membrane in the conical tube. i. Keep the membrane incubated with primary antibody at 4° C overnight on a roller, ensure to keep rolling the tube while moving it from RT to 4° C to avoid membrane dryness. j. Day 6: Next day at RT, wash the membrane 3 times in PBST (0.5% tween 20 in 1 X PBS), 5 min/wash. In the meantime, prepare the secondary antibody, polyclonal goat anti-mouse IgG (H&L) HRP at a concentration of 1:3000, prepared by mixing 1.7 μL of the secondary antibody in 5 mL of 5% non-fat dry milk in PBS-T. k. Remove the washing buffer, then add the secondary antibody to the membrane, cover the tubes with aluminium foil, then incubate the membrane in the conical tube for 2 hours at RT on a roller. Thereafter, remove the secondary antibody and wash the membrane 3 times with PBS-T (0.5% tween 20 in 1 X PBS). 71. Immunodetection a. Eventually, using a forceps, gently transfer the membrane from the conical tube to a square petri-dish. Prepare the pierce ECL Western Blotting Substrate by adding equal volumes of detection reagent 1 and detection reagent 2, then cover the Petri dish with aluminium foil and incubate for 1 min. b. Using a forceps, place the membrane into the ChemiDoc™ MP imaging System and adjust the imager to focus on the membrane edges and then start collecting the images using the following protocols: chemi hi sensitivity, chemi hi-resolution and multichannel protocols. Carry out subsequent image analysis using Image Lab software. c. As loading control, incubate the same protein lysate aliquots with rabbit polyclonal alpha tubulin antibody with goat anti-rabbit IgG H&L HRP conjugated as a secondary antibody (Figure 8 B-C) . Flow cytometry (FC) Timing : [4-5 days] Since both rVSV-dG-RV-G-GFP and rVSV-GFP WT encode GFP which serves as marker of infection, that could be used to determine the virus infection from the GFP expression levels in infected cells. To this end, flow cytometry serves as a useful tool to determine virus infection form the GFP expression levels in infected cells. 72. Day 1: Seed six well plates with BHK-21 cells at a density of 0.3 × 10 6 cells/well, incubate the plates at 37 °C /5% CO 2 until the following day. 73. Day 2: Upon reaching 70-80% confluency, infect the BHK-21 cells with each of rVSV-dG-RV-G-GFP and rVSV-GFP-WT at MOI of 1. Prepare triplicate wells of BHK-21 cells infected with each of rVSV-dG-RV-G-GFP and rVSV-GFP=WT, also keep 3 uninfected wells to serve as mock control. Incubate the plates at 37 °C for 2 hrs with shaking every 15-20 min. 74. After 2 hrs, remove the virus inoculum, wash the cells with 1 X PBS for 3 times, aspirate the PBS and add 1.5 mL of growth medium. 75. Day 4: Thirty hpi, remove the supernatant and wash the cells with 1 X PBS, followed by detaching the cells and transferring them into clearly labelled 1.5 mL Microcentrifuge tubes for FC analysis. For BHK-21 cells they are easily detached with 1X PBS only, while for other cell lines, trypsin or other reagents may be required such as accutase or versine. 76. To obtain the cell pellet, centrifuge the cells at 300 x g for 5 min, discard the supernatant and wash the cell pellet once with 1 X PBS. 77. After PBS removal, prepare the live dead marker by mixing 2 μL of LIVE/DEAD™ Fixable Violet Dead Cell Stain into 2 mL of FC buffer (2% FBS in 1 X PBS). For each specimen, add 200 μL of the prepared live dead marker solution and incubate on ice for 30 min, keep the samples away from light. Critical : If samples to be analysed on the same day, fixing the cells will not be necessary, however if samples will be analysed on a different day, fixing the cells in 4% PFA for 1 hr, will be required. 78. Pellet the cells, then wash once with 1X PBS, after cell pelleting, discard the PBS and add 200 μL of 1 X permeabilization buffer prepared by mixing 200 μL of 10X permeabilization buffer into 1800 mL of FC buffer. 79. Incubate the samples on ice and keep away from light for 15 min. After 15 min, centrifuge the samples and wash the cell pellet once with PBS. 80. Resuspend the pellet in 100 μL of FC buffer. For FC analysis, follow the start-up instruction of the CytoFLEX Flow Cytometer, followed by performing QC standardization with flow cytometry beads to calibrate the flow cytometry data. 81. In tube mode, place the tubes corresponding to each of the prepared samples with performing number of events ranging from 30,000-50,000 events/sample. 82. For each of the samples, plot pseudo colour plots as follows (Figure 9 A) . First: side scatter (SSC-A) vs PB450-A for gating live cells only. Second: forward scatter area (FSC-A) vs forward scatter height (FSC-H) for gating singlet cells from live cells. Third: side scatter area (SSC-A) vs FITC-A to gate cell populations expressing GFP, the FITC-A is variable according to the fluorescence tested. 83. Import the data to USB, then analyse them using CytExpert or FCS Express and plot the data in graph (Figure 9 B) . Troubleshooting 5 . Expected outcomes Our protocol describes the procedures to generate rcVSVs. The generated rVSV-dG-RV-G-GFP serves as a reliable model for studying the entry and internalization of rabies and thus allowing to study virus tropism. In addition, since the generated replication competent virus expresses green fluorescence protein (GFP), virus infection can be estimated from the level of GFP expression in the target cells, which can be measured by flow cytometry. Limitations · We prepared the rcVSV on BHK-21 cells, so we did not test the rescue process on other cell line. Thus, we recommend preparing the rcVSV on BHK-21 cells. · We passaged the generated rcVSV for 3 passages since the main aim was to study virus host interaction. However, if the generated rcVSV would be used for vaccine, it is preferred to do more passages and test the stability of the foreign insert during subsequent passages . Troubleshooting Problem 1: No colonies observed upon cloning RV-G insert into pVSV-dG-GFP (step 16). Potential solution: · Try different Ligation reactions with 1:1 and 5:1; insert: vector ratios, showed successful cloning, for calculation of the molar ratios, use the NEB calculator (https://nebiocalculator.neb.com/#!/ligation#!%2F). · Incubate the LB plates at 30 °C for overnight. Problem 2: No GFP observed upon co-transfecting pVSV-dG-RV-G-GFP and helper plasmids (step 26). Potential solution: · Try different plasmid ratios. · For splitting the BHK-21 cells. The day before co-transfection, use 1X PBS instead of trypsin. Problem 3: Cell death upon inoculating the recued rcVSV-dG-RV-G-GFP (step 28). Potential solution: · For further passaging of rVSV-dG-RV-G-GFP, try different concentrations during the inoculation of the rescue virus rVSV-dG-RV-G-GFP, since high concentrations might cause cell death, while low concentration might be insufficient. Problem 4: Absence of well-defined plaques (step 45). Potential solution: · Test 2 different overlay medium (semi-solid such as 3% CMC) and solid medium (1.6 %agarose) and compare them in terms of formation of defined plaques. Problem 5: No difference observed in the GFP % observed between infected and uninfected cells with rcVSV-dG-RV-GFP (step 83). Potential solution: · It is important to maintain a similar number of events for all samples to allow uniform comparative data analysis. · It is crucial to include a non-fluorescent control (mock cells), to analyse the fluorescent samples accordingly. Resource availability Lead contact: · Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, [Prof Muhammad Munir] ( [email protected] ). Technical contact: · Questions about the technical specifics of performing the protocol should be directed to and will be answered by the technical contact, [Dr Manar E. Khalifa], ( [email protected] ). Materials availability: · The pVSV-dG-RV-G-GFP plasmid and the rcVSV-dG-RV-G-GFP generated in this study are available upon request. Data and code availability: · This study did not generate any unique datasets or code . Declarations Acknowledgments This study was funded by the Biotechnology and Biological Sciences Research Council (BBSRC) (BB/M008681/1 and BBS/E/I/00001852) and the British Council (172710323 and 332228521). The Ph.D. studies of MEK have been financially supported by Newton Mosharafa-Fund (Bureau ID: NMM11/19) and the Egyptian Ministry of Higher Education and Scientific Research, Cultural Affairs and Mission Sector, Egypt. Authors would like to thank Kerafast for providing original working plasmids and Luis Martinez-Sobrido from Texas Biomedical Research Institute, USA for providing pCITE-GFP and pCAGG-GFP plasmids. Author contributions Conceptualization, M.E.K and M.M.; Formal analysis, M.E.K; Investigation and methodology, MEK; Validation of results and project administration M.E.K and M.M; Resources, M.M; Supervision., M.M; Funding acquisition, M.M and M.E.K; Original draft preparation M.E.K; Review and editing, M.M. All authors contributed to the article and approved the submitted version. Declaration of interests The authors declare no competing interests. References Tani, H., Morikawa, S., and Matsuura, Y. (2012). Development and applications of VSV vectors based on cell tropism. Frontiers in Microbiology 2 , 1–7. 10.3389/fmicb.2011.00272. Wertz, G.W., Moudy, R., and Ball, L.A. (2002). Adding Genes to the RNA Genome of Vesicular Stomatitis Virus: Positional Effects on Stability of Expression. Journal of Virology 76 , 7642–7650. 10.1128/jvi.76.15.7642-7650.2002. Hastie, E., Cataldi, M., Marriott, I., and Grdzelishvili, V.Z. (2013). Understanding and altering cell tropism of vesicular stomatitis virus. Virus Research 176 , 16–32. 10.1016/j.virusres.2013.06.003. Tell, J.G., Coller, B.G., Dubey, S.A., Jenal, U., Lapps, W., Wang, L., and Wolf, J. (2020). Environmental Risk Assessment for rVSV ∆ G-ZEBOV-GP, a Genetically Modified Live Vaccine for Ebola Virus Disease. Yahalom-Ronen, Y., Tamir, H., Melamed, S., Politi, B., Shifman, O., Achdout, H., Vitner, E.B., Israeli, O., Milrot, E., Stein, D., et al. (2020). A single dose of recombinant VSV-∆G-spike vaccine provides protection against SARS-CoV-2 challenge. Nature Communications 11 , 1–13. 10.1038/s41467-020-20228-7. Brown, K.S., Safronetz, D., Marzi, A., Ebihara, H., and Feldmann, H. (2011). Vesicular Stomatitis Virus-Based Vaccine Protects Hamsters against Lethal Challenge with Andes Virus. Journal of Virology 85 , 12781–12791. 10.1128/jvi.00794-11. Clarke, D.K., Cooper, D., Egan, M.A., Hendry, R.M., Parks, C.L., and Udem, S.A. (2006). Recombinant vesicular stomatitis virus as an HIV-1 vaccine vector. Sprimger semin Immun 28 , 239–253. 10.1007/s00281-006-0042-3. Zhang, Y.N., Chen, C., Deng, C.L., Zhang, C. guang, Li, N., Wang, Z., Zhao, L., and Zhang, B. (2020). A novel rabies vaccine based on infectious propagating particles derived from hybrid VEEV-Rabies replicon. EBioMedicine 56 . 10.1016/j.ebiom.2020.102819. Roberts, A., and Rose, J.K. (1998). Recovery of negative-strand RNA viruses from plasmid DNAs: A positive approach revitalizes a negative field. Virology 247 , 1–6. 10.1006/viro.1998.9250. Munis, A.M., Bentley, E.M., and Takeuchi, Y. (2020). A tool with many applications: vesicular stomatitis virus in research and medicine. Expert Opinion on Biological Therapy 20 , 1187–1201. 10.1080/14712598.2020.1787981. Lawson, N.D., Stillman, E.A., Whitt, M.A., and Rose, J.K. (1995). Recombinant vesicular stomatitis viruses from DNA. Proceedings of the National Academy of Sciences of the United States of America 92 , 4477–4481. 10.1073/pnas.92.10.4477. Perez, M., Clemente, R., Robison, C.S., Jeetendra, E., Jayakar, H.R., Whitt, M.A., and Torre, J.C. De (2007). Generation and Characterization of a Recombinant Vesicular Stomatitis Virus Expressing the Glycoprotein of Borna Disease Virus Journal of Virology 81 , 5527–5536. 10.1128/JVI.02586-06. Michael R. Green, J.S. (2012). Molecular Cloning. Whitt, M.A. (2010). Generation of VSV pseudotypes using recombinant ΔG-VSV for studies on virus entry, identification of entry inhibitors, and immune responses to vaccines. Journal of Virological Methods 169 , 365–374. 10.1016/j.jviromet.2010.08.006. Mendoza, E.J., Manguiat, K., Wood, H., and Drebot, M. (2020). Two Detailed Plaque Assay Protocols for the Quantification of Infectious SARS-CoV-2. Current Protocols in Microbiology 57 . 10.1002/cpmc.105. Hanke, L., Schmidt, F.I., Knockenhauer, K.E., Morin, B., Whelan, S.P., Schwartz, T.U., and Ploegh, H.L. (2017). Vesicular stomatitis virus N protein‐specific single‐domain antibody fragments inhibit replication. EMBO reports 18 , 1027–1037. 10.15252/embr.201643764. Rodríguez, A., Rodríguez, M., Córdoba, J.J., and Andrade, M.J. (2015). PCR Primer Design, Methods in Molecular Biology 10.1007/978-1-4939-2365-6. Flanagan, J., Middeldorp, J., and Sculley, T. (2003). Localization of the Epstein-Barr virus protein LMP 1 to exosomes. Journal of General Virology 84 , 1871–1879. 10.1099/vir.0.18944-0. Mahmood, T., and Yang, P. (2012). Western Blot: Technique, Theory, and Trouble Shooting. North American Journal of Medical Sciences 4 . 10.4103/1947-2714.100998. Britton, P., Green, P., Kottier, S., Mawditt, K.L., Penzes, Z., Cavanagh, D., and Skinner, M.A. (1996). Expression of bacteriophage T7 RNA polymerase in avian and mammalian cells by a recombinant fowlpox virus. Journal of General Virology 77 , 963–967. 10.1099/0022-1317-77-5-963. Supplementary Figures Supplementary Figure 1 is not available with this version Additional Declarations The authors declare no competing interests. Supplementary Files GA.png Graphical abstract Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4281071","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Method Article","associatedPublications":[],"authors":[{"id":292278203,"identity":"72dcbbe4-c446-4aa8-a144-ff640fc38599","order_by":0,"name":"Manar E. Khalifa","email":"","orcid":"","institution":"Lancaster University","correspondingAuthor":false,"prefix":"","firstName":"Manar","middleName":"E.","lastName":"Khalifa","suffix":""},{"id":292278204,"identity":"d3d4f6ea-bba4-4227-9f96-6b1d3f7a10fa","order_by":1,"name":"Muhammad Munir","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABG0lEQVRIie3PPUvEMBjA8UcKdXmgm1TinZ9AiBQicqWfJRLIlOrm4mBBcHUV9HN0cshRuFuKrjnq0CLc1EGdejhoTzkHr+c5OuQ/hLzwIwmAzfYvw89xI5mPHMKdH8d6LZFfy3b2RwKQrSd71/HwdaKiXrKVs7K6e0Dv5qJ6mTXhCWxmpYP5EmHmWJA4FUFC1AHl0wL9x1FAkMvDBCV10HQQRVviHLWE+VwXCEYBAZ5RAAUOPneR4C1OzxfkHneNcmYNf6fg1asIa2/JFkQjNcr1kWsK/vyWjoflNRvE6Ti4JPK0JQL3jWQDlIK6/pQObzu+P1ZBEadnvSsi0u1GR/2+EU+TJoyo54mqrEdL5Du3c0evBjabzWb7pQ/K/WnGDG/7jAAAAABJRU5ErkJggg==","orcid":"","institution":"Lancaster University","correspondingAuthor":true,"prefix":"","firstName":"Muhammad","middleName":"","lastName":"Munir","suffix":""}],"badges":[],"createdAt":"2024-04-17 09:59:33","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-4281071/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4281071/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":54922203,"identity":"b6205a6b-37ae-4013-af9c-e0fdf66920f2","added_by":"auto","created_at":"2024-04-18 15:34:15","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":506079,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic diagrams demonstrating the rVSV plasmids and the generation process of rVSV-dG-RV-G-GFP from pVSV-dG-RV-G-GFP. \u003cstrong\u003e(A). \u003c/strong\u003eSchematic diagram of the genomic organization of the pVSV-dG-GFP (top diagram) and rVSV-dG-RV-G-GFP (bottom diagram). Abbreviations: N; nucleoprotein, P; phosphoprotein, M; matrix, G; glycoprotein, GFP, green fluorescent protein, L large polymerase\u003cstrong\u003e. (B). \u003c/strong\u003eSchematic representation of the generation process of rVSV-dG-RV-G-GFP. Cloning of the RV-G gene from pCAGG RV-G-GHA plasmid into the pVSV-dG-GFP plasmid. BHK-21 cells were infected with rFPV-T7, followed by co transfection with pVSV-dG-RV-G-GFP, and VSV-system helper plasmids: pBS-N-ФT, pBS-P-ФT, pBS-L-ФT and pBS-G-ФT, resulted in generation of the rVSV-dG-RV-G-GFP.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4281071/v1/1297a6b0d83803ac2120fe27.png"},{"id":54922204,"identity":"60ab46e2-6d56-4356-bbae-9762edfaa8d9","added_by":"auto","created_at":"2024-04-18 15:34:15","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":388350,"visible":true,"origin":"","legend":"\u003cp\u003eReplication of the rVSV-dG-RV-G-GFP and rabies virus. \u003cstrong\u003e(A).\u003c/strong\u003eCycle during the rescue process of rVSV-dG-RV-G-GFP. The rescue process of the rVSV-dG-RV-G-GFP required the co-transfection of the pVSV-dG-RV-FG-GFP plasmid encoding the antigenome of the VSV after modification (incorporation of the rabies glycoprotein and GFP marker gene) along with the VSV helper plasmids (pBS-N, pBS-P, pBS-L\u0026amp; pBS-G). Upon co-transfection, the pVSV-dG-RV-FG-GFP was transcribed into the modified naked antigenome of VSV, and the helper plasmids were transcribed into the corresponding VSV viral proteins (N, P, L and G). Subsequently, the ribonucleoprotein complex formed of the nucleoprotein (N) along with the viral polymerase complex (Phosphoprotein (P) and polymerase (L)) together encapsulate the antigenomic RNA. The reconstituted encapsulated antigenome RNPs, acts as a template for the generation of the complementary RNA genome (negative strand), which is subsequently encapsulated in the RNP complex. Consequently, the normal replication cycle takes place in the cytoplasm of infected cells, resulting in the assembly and budding of the recombinant virions encapsulating the modified genomes of the VSV. \u003cstrong\u003e(B).\u003c/strong\u003e Natural replication cycle of rabies virus (1) Virus binding to the cellular receptors (2) Upon the binding of the virus surface G protein to the cellular receptors, the virus is internalized via receptor mediated endocytosis (3) Upon internalization into the endosomal compartments, the endosome low pH allows the fusion of the viral membrane into endosomal membrane (4) Subsequently, uncoating and release of viral RNA (-) occurs (5) Transcription of the genomic RNP into the antigenomic RNA (positive strand) (6) Translation of the viral proteins occurs in the (7) Genome replication, the antigenomic RNP acts as a template for replicating the RNA genomes which are encapsulated by the nucleoprotein (8) Assembly of the viral proteins and the RNA genome subsequently the release of the virus occurs by budding.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4281071/v1/3ba452ec2e4794e16ad41ac7.png"},{"id":54922208,"identity":"5d7cdf34-a15d-4ba1-9fad-1858e57e4bf6","added_by":"auto","created_at":"2024-04-18 15:34:15","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":691199,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCloning of the RV-G into the pVSV-dG-GFP backbone\u003c/strong\u003e. \u003cstrong\u003e(A). \u003c/strong\u003eSchematic diagram representation of the of the RV-G cloning into pVSV-dG-GFP; Firstly, the RV-G was amplified from the pCAGG-RV-G-HA-COOH vector, followed by restriction digestion of the RV-G amplicon and the pVSV-dG-GFP with MluI-HF and NheI-HF restrictions enzymes. Once the ends are compatible, the digested amplicon (RV-G) was ligated into the pVSV-dG-GFP. \u003cstrong\u003e(B).\u003c/strong\u003e Amplification of RV-G from pCAGG RV-G HA plasmid using primers with MluI and NheI restriction sites, Agarose gel electrophoresis showing the pCAGG-RV-G-HA-vector (left) and the PCR product of the RV-G ∼ 1.5 kb (Right) \u003cstrong\u003e(C).\u003c/strong\u003e Restriction digestion of the pVSV-dG-GFP with MluI-HF and NheI-HF enzymes; Agarose gel showing the uncut pVSV-dG-GFP (uncut vector, ∼ 13.4 kb, left side) and the linearized vector; ∼ 13.4 kb, right side). \u003cstrong\u003e(D).\u003c/strong\u003e Restriction digestion of the RV-G PCR amplicon with MluI-HF and NheI-HF restriction enzymes, Agarose gel showing the linearized RV-G amplicon 1.5 kb. \u003cstrong\u003e(E).\u003c/strong\u003eAgarose gel electrophoresis of colony PCR products upon ligation and transformation. Three colonies were analysed for the presence of the 1.5 kb insert corresponding to the RV-G. Positive colonies were shown in colonies 2.1.1 and 2.1.3. \u003cstrong\u003e(F).\u003c/strong\u003e Diagnostic restriction digestion to purified pVSV-dG-RV-G-GFP plasmid with MluI and NheI enzymes, to confirm the presence of the RV-G insert in the pVSV-dG-GFP backbone, the cloned plasmid from positive colonies, was purified and digested with MluI and NheI enzymes as demonstrated in agarose gel:pVSV-dG-GFP backbone. (13.4 kb) and the RV-G insert (1500 bp,) shown in the cut colonies 2.1.1 and 2.1.3, while the colony 2.1.2 showed no insert.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4281071/v1/5426fb2fdba92f3a23e56d94.png"},{"id":54922853,"identity":"3cf2da8f-85d7-4c57-a40c-0471f22376a1","added_by":"auto","created_at":"2024-04-18 15:42:15","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1515476,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTransfection and rFPV-T7 infection efficiencies. Representative microscopic fluorescent. (left) and bright (right) fields of BHK-21 cells.\u003c/strong\u003e \u003cstrong\u003e(A).\u003c/strong\u003e transfected with pCAGG-GFP (upper panel), \u003cstrong\u003e(B).\u003c/strong\u003e infected with rFPV-T7 and transfected with pCITE-GFP (lower panel) are illustrated as transfection controls. Constitutive GFP expression driven by pCAGGS is an indicator of transfection efficiency, whereas T7 promoter driven GFP expression by pCITE is a control for rFPV infection and T7 polymerase activity. \u003cstrong\u003e(C).\u003c/strong\u003e Representative microscopic fluorescent (left) and bright (right) fields of the BHK-21 cells 24 hours post transfection with the helper plasmids and pVSV-dG-GFP. \u003cstrong\u003e(D).\u003c/strong\u003e Representative microscopic fluorescent (left) and bright (right) of the BHK-21 cells 72 hours post transfection with the helper plasmids and rVSV-dG-RV-G-GFP (P0). \u003cstrong\u003e(E).\u003c/strong\u003eMicroscopic fluorescent (left) and bright (right) of the BHK-21 cells cytopathic effects appeared 72 hrs following the inoculation of the BHK-21 cells with the subsequent passages of the recovered VSV-dG-RV-G-GFP. Images representing the subsequent passages of rVSV-dG-RV-G-GFP; P1, P2 and P3. Scale bars 50 µm.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4281071/v1/78acfe1c995d99eb6a449960.png"},{"id":54922205,"identity":"1e7c617c-ad42-4e69-b00d-75f9e177e26d","added_by":"auto","created_at":"2024-04-18 15:34:15","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":395564,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGenetic stability of RV-G insert in rVSV-dG-RV-G-GFP.\u003c/strong\u003e \u003cstrong\u003e(A).\u003c/strong\u003e Schematic diagram representing the rVSV-dG-RV-G-GFP viral genome organization: 3’-N, P, M, G, GFP and L 5’, the FWD (VSV-Up) and REV primers (VSV down) designed to target the vector DNA flanking the RV-G insert. \u003cstrong\u003e(B). \u003c/strong\u003eRT-PCR analysis of RNA extracted from rVSV. Upon the passaging of the rVSV-dG-RV-G-GFP, the viral supernatant was collected and reverse transcribed, followed by amplification with the VSV UP and VSV down primers. Agarose gel electrophoresis showing the Lane 1, DNA ladder (1 Kb); Lane 2, rVSV-GFP WT and Lane 3, rVSV-dG-RV-G-GFP (P4) RV-G insert (1.9 Kb) \u003cstrong\u003e(C).\u003c/strong\u003e Forward Sanger sequencing for RV-G amplicon, amplified from the rVSV-dG-RV-G-GFP using the VSV up primer, indicating the start codon of RV-G with no deletions or insertions in the RV-G- gene.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4281071/v1/53d53e10bd524fb3276b44c6.png"},{"id":54922855,"identity":"218ec86c-512d-4742-8afd-68ad94591a0d","added_by":"auto","created_at":"2024-04-18 15:42:15","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":677529,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePlaque assay of rVSV-dG-RV-G-GFP and rVSV-GFP-WT in time dependent manner.\u003c/strong\u003e \u003cstrong\u003e(A).\u003c/strong\u003eRepresentative plaque counts of each of the BHK-21 cells infected with either rVSV-dG-RV-G-GFP and rVSV-dG-GFP at MOI =1. The plaques shown represent rVSV-GFP WT (upper panel) and rVSV-dG-RV-G-GFP (lower panel) replication in virus dilution in a time-dependent manner The progeny viruses were quantified on BHK-21 cells and stained with 0.5% crystal violet after 72 hpi. These experiments were performed three times independently (n=3).\u003cstrong\u003e (B).\u003c/strong\u003e Plaque assay-based quantifications of the progeny virus released from the BHK-21 cells infected with either the rVSV-dG-RV-G-GFP and rVSV-dG-GFP at MOI =1., in the viral supernatants were collected in a time-dependent manner (6 hpi -42 hpi). The data represented the mean of three biological replicates and the error bars represent the SEM.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4281071/v1/0f0fb89280da47be5a008942.png"},{"id":54922207,"identity":"cc70d442-bfbd-427d-abaf-7484a62427d4","added_by":"auto","created_at":"2024-04-18 15:34:15","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":127058,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGrowth kinetics of rVSV-dG-GFP and rVSV-RV-G-GFP in BHK-21 cells. \u003c/strong\u003eBHK cells infected with either rVSV-dG-RV-G-GFP and rVSV-dG-GFP at MOI =1. Viral supernatant was collected at different time points: 6 hrs, 12 hrs, 18 hrs. 24 hrs, 30 hrs, 36 hrs, and 42 hrs post infection. Viral RNA was extracted and assessed for the absolute quantities of the genomic RNA by qRT-PCR. \u003cstrong\u003e(A).\u003c/strong\u003eStandard curve of rVSV-GFP-WT and \u003cstrong\u003e(B).\u003c/strong\u003e rVSV-dG-RV-G-GFP for the quantification of viral copy number by real-time PCR. The used ten-fold dilutions ranged from 0.1 to 1000 ng were plotted as X-axis. CT values are indicated on Y-axis. \u003cstrong\u003e(C).\u003c/strong\u003e Absolute quantification of the viral RNA copies by qRT-PCR. BHK cells infected with either rVSV-dG-RV-G-GFP and rVSV-dG-GFP at MOI =1. Viral supernatants were collected at different time points: 6 hrs, 12 hrs, 18 hrs. 24 hrs, 30 hrs, 36 hrs, and 42 hrs post infection. Viral RNA was extracted and assessed for the absolute quantities of the genomic RNA by qRT-PCR targeting the VSV N gene, the data represents the mean values of three biological replicates. Error bars represent the SEM.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4281071/v1/34e75a9c2ff13f18d7766fff.png"},{"id":54922209,"identity":"79044ed8-da18-482c-8d9a-e0145fad0792","added_by":"auto","created_at":"2024-04-18 15:34:15","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":851509,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRV-G and VSV M proteins expression on BHK-21 infected cells.\u003c/strong\u003e \u003cstrong\u003e(A).\u003c/strong\u003e Immunofluorescence of the BHK-21 infected cells. BHK cells were infected with the rVSV-dG-RV-G-GFP and rVSV-GFP WT at MOI of 1. Twenty-four hours post infections, cells were fixed and stained with RV-G and VSV-M antibodies to detect the RV-G and VSV M proteins; respectively by immunofluorescence, followed by incubation with FITC conjugated antibodies (green), indicating the surface expression of the RV-G in rVSV-dG-RV-G-GFP infected cells and the Intracellular localization of VSV M in the rVSV-dG-RV-G-GFP and rVSV-GFP WT infected cells was indicated. Nucleus (blue) labelled with DAPI, the VSV-M and RV-G (green), Scale bars are 20 μm. Fluorescence signals were visualized by confocal immunofluorescence microscopy. Images analysed using the ZenCore 3.4 software. \u003cstrong\u003e(B).\u003c/strong\u003e Immunoblot analysis of the BHK-21 cell lysates. BHK-21 cells infected with VSV-GFP WT and rVSV-dG-RV-G-GFP at MOI =1, after 24 hpi, the cell lysates were collected, and blots were stained using antibodies against VSV M (upper panel) and RV-G (lower panel) on 8% non-reducing SDS-PAGA gel. Alpha tubulin was used as a loading control. The experiments were performed two times independently (n=2). Images were analysed using Image Lab software. Images of uncropped blots are shown in Supplementary figure 1.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-4281071/v1/ce4797b0e390f7c5cfe9d98e.png"},{"id":54922212,"identity":"4024225c-fb68-4749-b846-8472abda1c11","added_by":"auto","created_at":"2024-04-18 15:34:15","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":420700,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGFP expression on BHK-21 cells infected with rVSV-dG-RV-G-GFP and VSV-GFP-WT.\u003c/strong\u003e \u003cstrong\u003e(A).\u003c/strong\u003eRepresentative plots for the GFP percentage in BHK cell line. Cells were infected with GFP expressing viruses; rVSV-GFP-WT and rVSV-dG-RV-G-GFP (MOI 1), and the non-infected cell control was used, after 30 hpi, the cells were collected for GFP-positive cells were collected for flow cytometry. \u003cstrong\u003e(B).\u003c/strong\u003eMean fluorescence intensities of the BHK-21 cell population infected with rVSV-GFP-WT and rVSV-dG-RV-G-GFP MOI of 1 in comparison with the control cells. These experiments were performed three times independently (n=3). These data represent the average of three biological replicates with S.E.M. indicated. ****p \u0026lt; 0.0001 using one-way ANOVA and student’s t-test.\u003c/p\u003e","description":"","filename":"Figure9.png","url":"https://assets-eu.researchsquare.com/files/rs-4281071/v1/848dc0709c77d7d6085ea849.png"},{"id":54923754,"identity":"b114cb5c-8cb5-48b6-a85d-6d66ce2331ba","added_by":"auto","created_at":"2024-04-18 15:58:23","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6306466,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4281071/v1/5a0cf631-9678-4e96-9155-e92bdbb9d3a8.pdf"},{"id":54922206,"identity":"3dedbde8-6aba-4ece-ae26-b66ff3507d26","added_by":"auto","created_at":"2024-04-18 15:34:15","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":264164,"visible":true,"origin":"","legend":"\u003cp\u003eGraphical abstract\u003c/p\u003e","description":"","filename":"GA.png","url":"https://assets-eu.researchsquare.com/files/rs-4281071/v1/b5112ad36dc06a27e7051fd4.png"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eConstruction and Characterization of Recombinant Vectored Vaccines for Rabies Virus\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"Before you begin","content":"\u003cp\u003eVesicular stomatitis virus (VSV) is a non-segmented, and negative strand RNA virus belonging to the family \u003cem\u003eRhabdoviridae\u003c/em\u003e. VSV genome is 11-kb, and it encodes five structural genes including nucleoprotein (N) phosphoprotein (P) matrix (M) glycoprotein (G) and large polymerase (L)\u003csup\u003e1\u003c/sup\u003e. The VSV has been demonstrated as an efficient system for generating recombinant vaccines against viruses of animal and human origins\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003csup\u003e2\u003c/sup\u003e owing to its capability of stable maintenance and expression of transgenes Additionally, VSV offers a versatile tool to study virus host interactions due to its wide host spectrum\u0026nbsp;\u003csup\u003e3\u003c/sup\u003e\u003cstrong\u003e\u003cem\u003e.\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eThe\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eEbola rVSV-ZEBOV vaccine, based on recombinant VSV, has demonstrated high efficacy, safety, and rapid protective immunity against Ebola virus outbreaks\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003csup\u003e4\u003c/sup\u003e. Similarly, VSV vaccines have been engineered for SARS-COV-2\u0026nbsp;\u003csup\u003e5\u003c/sup\u003e, Andes virus\u0026nbsp;\u003csup\u003e6\u003c/sup\u003e and HIV\u0026nbsp;\u003csup\u003e7\u003c/sup\u003e\u003cstrong\u003e\u003cem\u003e.\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eRabies virus (RV) is a highly fatal disease causing approximately 59000 human deaths annually\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003csup\u003e8\u003c/sup\u003e. The remarkable diverse reservoir species of RV, render its control and prevention challenging. However, substantial decrease in human rabies cases could be achieved through development of novel vaccines targeting RV reservoirs.\u003c/p\u003e\n\u003cp\u003eTo successfully manipulate the VSV genome and to clone transgenes in compatibility, a sequential process is carried out as outlined in \u003cstrong\u003eFigure 1\u003c/strong\u003e. Mechanistically, the antigenomic cDNA of VSV can be manipulated to insert a transgene (exemplified here with full-length open reading frame (ORF) of the rabies virus surface glycoprotein (RV-G), derived from the Egyptian strain isolate (GenBank accession number MK760770.1). Therefore, RV-G can be inserted in the multiple cloning site of pVSV-dG-GFP between the M and the GFP genes using unique MluI and NheI restriction sites. Consecutively, VSV recovery involves the co-transfection of the full length antigenomic viral RNA of VSV (pVSV-dG-RV-G-GFP) along with plasmids encoding the viral ribonucleoprotein complex (RNP). The RNP is formed by P and L along with N proteins. Upon co-transfecting the RNP complex with the antigenome viral RNA, the RNA is transcribed by T7 polymerase; supplied by infecting the cells with the recombinant fowl pox virus (rFPV). Consequently, the translation of encoded proteins occurs, allowing the assembly of nucleoprotein around the antigenomic RNA and polymerase to replicate forming RNP containing the genomic RNA. The assembly of the infectious virus occurs following the transcription of the mRNA from the genomic RNP and its translation \u003csup\u003e9,10\u003c/sup\u003e \u003cstrong\u003e(Figure 2)\u003c/strong\u003e. The M protein required for assembly and budding is not provided in \u003cem\u003etrans\u003c/em\u003e since it is produced from the virally encoded M gene released from the generated infectious viral particles\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003csup\u003e11,12\u003c/sup\u003e. Since all the DNA constructs are under the control of T7 RNA polymerase promoter, the rFPV can be utilized to infect cells as a source of T7 RNA polymerase \u003cem\u003ein trans\u003c/em\u003e. The efficiency of T7 polymerase promoter infection can be assessed by transfecting the BHK-21 cells with pCITE GFP plasmid, which encodes GFP under the control of T7 promotor\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003csup\u003e11\u003c/sup\u003e\u003cstrong\u003e\u003cem\u003e.\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eCollectively, this protocol provides a detailed method for the generation of a replication competent VSV carrying a transgene of RV, with the potential to serve as a recombinant vaccine.\u003c/p\u003e\n\u003ch2\u003eBiosafety\u003c/h2\u003e\n\u003cp\u003eSince VSV is a biosafety level 2 pathogen, all experiments involving handling of VSV should be carried out in a certified biological safety cabinet in designated labs. Thus, before starting, it is necessary to obtain all required documentation to accomplish biosafety level-2 (BSL-2) work.\u003c/p\u003e\n\u003ch2\u003ePlasmids\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003eTiming\u003c/strong\u003e\u003cstrong\u003e: [4-5 days,]\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e1. \u0026nbsp; \u0026nbsp;To generate the pCAGG-RV-G-HA vector, retrieve the full codon sequence of RV-G gene from NCBI (GenBank accession number MK760770). Codon optimize the RV-G sequence for Homo sapiens and clone the synthesized RV-G in pCAGG vector with HA tag at the C-terminus, referred to as pCAGG-RV-G-HA plasmid.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.\u0026nbsp; \u0026nbsp;\u0026nbsp;For the generation of rVSVs, the following plasmids are required:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ei.\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;rVSV-dG-RV-G-GFP\u003c/p\u003e\n\u003cp\u003eii.\u0026nbsp; \u0026nbsp; \u0026nbsp;pBS-P-ФT Plasmid\u003c/p\u003e\n\u003cp\u003eiii.\u0026nbsp; \u0026nbsp;\u0026nbsp;pBS-L-ФT Plasmid\u003c/p\u003e\n\u003cp\u003eiv.\u0026nbsp; \u0026nbsp;pBS-N-ФT Plasmid\u003c/p\u003e\n\u003cp\u003ev.\u0026nbsp; \u0026nbsp;\u0026nbsp;pBS-G-ФT Plasmid\u003c/p\u003e\n\u003cp\u003e3.\u0026nbsp; \u0026nbsp;\u0026nbsp;Transform each of these plasmids into DH5 alpha competent cells using the heat shock transformation procedure.\u003c/p\u003e\n\u003cp\u003e4.\u0026nbsp; \u0026nbsp;\u0026nbsp;Grow the transformed bacteria on LB agar plates, supplemented with ampicillin (100 mg/mL) overnight (16 h) at 37\u0026nbsp;˚C.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCritical:\u0026nbsp;\u003c/strong\u003eIf no colonies are found, prepare duplicate LB plates of each plasmid, incubate one of them at 30\u0026nbsp;˚ C and the other plate at 37\u0026nbsp;˚C overnight.\u003c/p\u003e\n\u003cp\u003e5.\u0026nbsp; \u0026nbsp;\u0026nbsp;Pick a single colony and incubate it in 100 mL LB media supplemented with 100 mg/mL ampicillin overnight at 37\u0026nbsp;˚C\u0026nbsp;in shaker incubator.\u003c/p\u003e\n\u003cp\u003e6. \u0026nbsp; \u0026nbsp; Lyse the bacteria, extract and purify the plasmid DNAs using the Qiagen midi prep kit following the manufacturer instructions.\u003c/p\u003e\n\u003cp\u003e7. \u0026nbsp; \u0026nbsp;Determine the concentration of the plasmid DNAs by nanodrop method.\u003c/p\u003e\n\u003ch2\u003ePrimer and probe design\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003eTiming: [4 days\u003c/strong\u003e\u003cstrong\u003e]\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e8. \u0026nbsp; \u0026nbsp;For cloning the full codon optimized sequence of RV-G in the multiple cloning site of pVSV-dG-GFP (flanking the region between M and GFP genes using two restriction sites \u003cem\u003eMluI\u0026nbsp;\u003c/em\u003eand \u003cem\u003eNheI)\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e(Figure 3 A)\u003c/strong\u003e. Design the\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eforward and reverse primers as follows: The forward primer (RV-G F) contains \u003cem\u003eMluI\u0026nbsp;\u003c/em\u003esite (underlined, italic letters) and the first 20 nucleotides of the coding region of the G gene (bold letters), nucleotides before the restriction sites represented the complementary bases to the vector sequence. The reverse primer (RV-G R) contains the last 27 nucleotides of the G gene (bold letters) followed by \u003cem\u003eNheI\u003c/em\u003e site (underlined italic letters).\u003c/p\u003e\n\u003cp\u003e9.\u0026nbsp; \u0026nbsp;\u0026nbsp;Upon RV-G cloning into pVSV-dG-GFP and after the rVSV-dG-RV-G-GFP rescue, confirm the stability of RV-G insert by designing primers flanking the RV-G insert in the rVSV-dG-RV-G-GFP,so that the forward primer (VSV-up) encompass the last 33 nucleotides of M gene, and the reverse primer (VSV-down) flank the first 39 nucleotides of GFP gene as demonstrated in schematic diagram\u0026nbsp;\u003cstrong\u003e(Figure 5 A\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e10.\u0026nbsp;To assess the growth kinetics of the generated\u0026nbsp;rVSV-dG-RV-G-GFP compared to the rVSV-GFP WT, employ the absolute qPCR method to allow comparative quantification between the viral genomic RNA copies of both rVSV-dG-RV-G-GFP and rVSV-GFP-WT. The VSV N gene is targeted since VSV genome RNA replication is proportional to the amount of N protein synthesized\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003csup\u003e16\u003c/sup\u003e.\u0026nbsp;To this end, design and synthesize a VSV N probe, considering the following parameters as previously described\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003csup\u003e17\u003c/sup\u003e:\u003c/p\u003e\n\u003cp\u003ea.\u0026nbsp; \u0026nbsp;\u0026nbsp;Tm of the probe to be 8\u0026ndash;10 \u0026deg;C above Tm of the designed primers\u003c/p\u003e\n\u003cp\u003eb.\u0026nbsp; \u0026nbsp;\u0026nbsp;Avoid primer dimer, design the probe length to range from 18-30 bases.\u003c/p\u003e\n\u003cp\u003ec.\u0026nbsp; \u0026nbsp; \u0026nbsp;Ensure that the amplification product length does not exceed 150 bp to ensure high qPCR efficiency.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ed.\u0026nbsp; \u0026nbsp;\u0026nbsp; BLAST the amplicon product to ensure the specificity of the amplified region.\u003c/p\u003e\n\u003cp\u003ee. \u0026nbsp; \u0026nbsp;The following websites can be used to validate the designed primer/probe https://eu.idtdna.com/pages/tools/oligoanalyzer for primer/dimer detection, https://www.thermofisher.com/be/en/home/life-science/pcr/real-time-pcr/real-time-pcr-learning-center/real-time-pcr-basics/efficiency-real-time-pcr-qpcr.htmL\u003c/p\u003e\n\u003cp\u003ef. \u0026nbsp; \u0026nbsp; Synthesize and label the designed probes with FAM and TAMRA at the 5\u0026rsquo; end and 3\u0026rsquo; ends; respectively.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eCell line maintenance\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003eTiming: [2-3\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;days]\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e11. \u0026nbsp;Remove BHK-21 cells cryovial from liquid nitrogen and thaw at 37 ˚C immediately. Upon thawing, add 10 mL of pre-warmed growth medium slowly to the thawed cell suspension and centrifuge at 200 xg for 5 min. Discard the supernatant and resuspend the pellet in prewarmed growth medium. Incubate the cells in cell culture flasks at 37 ˚C with 5% CO2. The BHK-21 cells are routinely passaged 2-3 times /week when the cells are 80-90% confluent.\u003c/p\u003e\n\u003cp\u003e12. \u0026nbsp;Maintain the BHK-21 cells in DMEM with GlutaMAX, supplemented with 10% FBS, and 1X antibiotic antimycotic solution.\u003c/p\u003e"},{"header":"Key resources table","content":"\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"638\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\"\u003e\n \u003cp\u003e\u003cstrong\u003eREAGENT or RESOURCE\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\"\u003e\n \u003cp\u003e\u003cstrong\u003eSOURCE\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\"\u003e\n \u003cp\u003e\u003cstrong\u003eIDENTIFIER\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAntibodies\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eMouse RV Glycoprotein antibody\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eBio-Rad\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# MCA2828\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eMouse VSV M antibody\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eAbcam, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# EB0011\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eGoat anti-Mouse IgG (H+L) Secondary Antibody, HRP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eAbcam, UK\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# ab6789\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eAlexa-fluor goat anti-mouse IgG (468)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eInvitrogen, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# A11001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003eBacterial and virus strains\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eMAX Efficiency\u0026trade; DH5\u0026alpha; Competent Cells\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eThermo Scientific, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 18258012\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eChemicals, peptides, and recombinant proteins\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eAcrylamide/Bis Solution (30%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eBio-Rad, China\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 1610158\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eAgarose low EEO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eNBS-biologicals, Cambridge, UK (United Kingdom)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# R1040\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eAmmonium persulfate (APS)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eBio-Rad, Japan\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 1610700\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eAmpicillin-Na-salt\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSigma-Aldrich, St. Louis, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# A9518\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eAntibiotic-Antimycotic (100 X)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eGibco, Life Technologies, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 15240062\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eBSA (Albumin Bovine Fraction V)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSigma-Aldrich, St. Louis, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 05482\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eCarboxy-methyl-cellulose sodium salt\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSigma Aldrich\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# C4888-500G\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eCrystal Violet\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSigma-Aldrich, St. Louis, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# C0775\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eDAPI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eThermo Scientific, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 62247\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eDMEM, high glucose, GlutaMAX\u0026trade; Supplement pyruvate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eGibco, Thermo Fisher, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 10569010\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eEDTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eMillipore, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 324503\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eEthanol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eFisher Scientific, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 2107463\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eFetal bovine serum\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eGibco, Life Technologies, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 10500-64\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eGelRed\u0026reg; Nucleic Acid Stain 10000X Water\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eMillipore\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# SCT123\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eGeneRuler 1 kb DNA Ladder\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eThermo Scientific, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# SM0311\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eHEPES buffer (1M)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eGibco\u0026trade;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 15630080\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eL-glutamine (200 mM)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eGibco, life technologies, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 25030-081\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eLIVE/DEAD\u0026trade; Fixable Violet Dead Cell Stain Kit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eThermo Fisher, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# L34964\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eMEM (10 X)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eGibco, life technologies, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 21430-020\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eMethanol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eFisher Scientific, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 2196137\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eMluI-HF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eNew England Biolabs, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# R3198S\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eNheI-HF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eNew England Biolabs, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# R3131S\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eNon-Essential Amino Acids Solution (100X)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eGibco, Life Technologies, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 11140050\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eNP-40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eThermo Scientific, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 85124\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eNuclease free water\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eThermo Scientific, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 10977-035\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eNuPAGE (transfer buffer)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eNovex, Life Technologies, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 2270643\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eOpti-MEM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eGibco, life technologies, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 31985-070\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eParaformaldehyde (4%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eThermo Scientific, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# J19943-k2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003ePermeabilization buffer (10 X)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eThermo Scientific, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 00833356\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003ePierce Protease inhibitor tablet\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eThermo Scientific, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# A32963\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003ePierce\u0026trade; ECL western blotting substrate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eThermo Scientific, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 32106\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003ePotassium phosphate dibasic\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSigma-Aldrich, St. Louis, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# P0662\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003ePre-stained Protein Ladder (10-180 kDa)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eAbcam, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# ab116027\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eQ5-high fidelity DNA polymerase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eNew England Biolabs, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# M0491S\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eSDS-sample buffer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eLife Technologies, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 1597380\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eSDS-solution 10%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eBio-Rad, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 1610416\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eSkimmed milk powder\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eMillipore, Switzerland\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 70166\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eSodium bicarbonate solution (7.5%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSigma-Aldrich, St. Louis, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# S5761\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eSodium chloride\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSigma-Aldrich, St. Louis, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# S5886\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eSodium dodecyl sulphate (SDS)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSigma-Aldrich, St. Louis, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# L3771\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eSodium hydroxide\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSigma-Aldrich, St. Louis, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 221465\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eSodium phosphate dibasic\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSigma-Aldrich, St. Louis, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# S5136\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eT4 DNA ligase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eNew England Biolabs, UK\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# M0202\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eTEMED\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eBio-Rad, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 1610801\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eTris-base\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSigma-Aldrich, St. Louis, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 252859\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eTris-EDTA 1X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eFisher scientific, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# BP2473\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eTriton X-100\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSigma-Aldrich, St. Louis, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# T8787\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eTrizma hydrochloride\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSigma-Aldrich, St. Louis, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# RDD009\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eTrypsin 2.5%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eGibco, Thermo Fisher, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 15090-046\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eTurboFect \u0026trade;Transfection Reagent\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eThermo Scientific, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# R0532\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eTween -20\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSigma-Aldrich, St. Louis, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# P2287\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eVECTASHIELD antifade mounting buffer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eVector Laboratories, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# ZH1108\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026beta;-mercaptoethanol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eBio-Rad, China\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 1610710\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eCritical commercial assays\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eQIAamp \u0026reg; Viral RNA mini kit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eQIAGEN, Germany\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 52906\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eGeneJET Plasmid Midiprep Kit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eQIAGEN, Germany\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# K0482\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eGene JET Gel Extraction Kit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eThermo Fisher, Lithuania\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 01237174\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eSuperScript\u0026trade; III Platinum\u0026trade; One-Step RT-qPCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eInvitrogen, Thermo Fisher Scientific\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 11732088\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eExperimental models: Cell lines\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eBHK-21 cells\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eATCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eATCC No: CCL-10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003eOligonucleotides\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eRV-G F: TGTTTACGCGTCACTATGGTGCCCCAGGCCCTGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eInvitrogen, Thermo Fisher Scientific\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eRV-G R: ATGAAGAATCTGGCTAGCAGGATTTGAGTTACAGCCGTGTCTCGCCCCCGCTCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eInvitrogen, Thermo Fisher Scientific\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eVSV-UP:\u003c/p\u003e\n \u003cp\u003eGCCCACCATGGGAGCGTGGGTCCTGGATTCTATCAGCCACTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eInvitrogen, Thermo Fisher Scientific\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eVSV down:\u003c/p\u003e\n \u003cp\u003eTGGGACAACTCCAGTGAAAAGTTCTTCTCCTTTACTCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eInvitrogen, Thermo Fisher Scientific\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eqPCR-VSV N-F:\u003c/p\u003e\n \u003cp\u003eTGATCGACTTTGGATTGTCTTCTAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eInvitrogen, Thermo Fisher Scientific\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eqPCR-VSV-N R:\u003c/p\u003e\n \u003cp\u003eTCTGGTGGATCTGAGCAGAAGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eInvitrogen, Thermo Fisher Scientific\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eqPCR-VSV-N Probe:\u003c/p\u003e\n \u003cp\u003eFAM-ATATTCTTCCGTCAAAAACCCTGCCTTCCA-TAM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eInvitrogen, Thermo Fisher Scientific\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eRandom Hexamers (100 mL)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eInvitrogen, Thermo Fisher Scientific\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# N8080127\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eRecombinant DNA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003epBS-P-ФT Plasmid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eKerafast, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# EH1014\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003epBS-L-ФT Plasmid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eKerafast, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# EH1015\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003epBS-N-ФT Plasmid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eKerafast, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# EH1013\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003epBS-G-ФT Plasmid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eKerafast, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# EH1016\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eVSV-dG-GFP-2.6 plasmid expression vector\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eKerafast, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# EH1026\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003epCAGG-RV-G-HA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003epVSV-dG-RV-G-GFP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSoftware and algorithms\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eZEN Microscopy software\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eCarl Zeiss Imaging, Jena\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003e(blue) 3.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eGraphpad prism\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eGraphPad Software Inc.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eVersion 9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eCFX Manager\u0026trade; Software\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eBio-Rad, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eVersion 3.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eOther\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003e0.2 ml PCR tubes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eApplied Biosystem\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003e0.45-, 0.2 um filter\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSTAR LAB, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# E4780-1456\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003e1.5 ml microcentrifuge tubes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eMerck\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# HS4323\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003e6-Well cell culture plate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eGreiner\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 657160\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eAutoclave\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eAstell, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eBacterial incubator 37 oC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSANYO, Switzerland\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eBlotting papers\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eBio-Rad, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 170396\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eCell culture CO2 incubator\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003ePanasonic, Japan\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eCell culture flask with filter cap 75 cm2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eGreiner\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 658175\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eCentrifuge 5424 R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eEppendorf, Germany\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eCentrifuge Allegra X-30R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eBeckman Coulter, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eCentrifuge tube 50 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eGreiner\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 227261\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eCFX96 Real-Time system\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eBio-Rad, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eChemiDocTM MP imaging system\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eBio-Rad, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eCryovials, 1.8 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eCorning, Mexico\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eCytoFLEX Flow Cytometer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eBeckman Coulter, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eLatex gloves\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eFisher Scientific\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eNano-Drop 2000c spectrophotometer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eThermo Scientific\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat#ND2000CLAPTOP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eNunc\u0026trade; Thermanox\u0026trade; Coverslips\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eThermo Scientific\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 174942\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eParafilm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eStar lab, Hamburg\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 13080\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003ePetri dishes for bacteria, 100 mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSarstedt, Germany\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003ePipette tips 1 mL, 200 mL, 10 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSTAR LAB, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003ePipettes 200 \u0026micro;L-1 mL, 20\u0026ndash;200 \u0026micro;L and 0.5 mL\u0026ndash;1 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eGilson\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003ePTC-200 Peltier Thermal Cycler\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eUniversal Resource Trading Ltd, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003ePVDF membrane\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eThermo Scientific\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eCat# 88518\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eqPCR-tube 0.1 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eBio-Rad, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eSDS-PAGE system\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eBio-Rad, UK\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eStrippette, 5, 10, 25 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eCorning, Mexico\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eTrans- blot turbo membrane blotter\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eBio-Rad, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eUV transilluminator\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSyngene, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eVortex\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eSLS, lab basics, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"54.70219435736677%\" valign=\"top\"\u003e\n \u003cp\u003eZOETM fluorescent cell imager\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.510971786833856%\" valign=\"top\"\u003e\n \u003cp\u003eBio-Rad, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.786833855799372%\" valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Materials and equipment setup (optional)","content":"\u003cp\u003e\u003cstrong\u003ePlaque overlay medium.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"52.5089605734767%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eReagent\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.4910394265233%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAmount (500 mL)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"52.5089605734767%\" valign=\"top\"\u003e\n \u003cp\u003eSterile bottled water\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.4910394265233%\" valign=\"top\"\u003e\n \u003cp\u003e142 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"52.5089605734767%\" valign=\"top\"\u003e\n \u003cp\u003e10X MEM\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.4910394265233%\" valign=\"top\"\u003e\n \u003cp\u003e50 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"52.5089605734767%\" valign=\"top\"\u003e\n \u003cp\u003eSodium Bicarbonate Solution (7.5%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.4910394265233%\" valign=\"top\"\u003e\n \u003cp\u003e15 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"52.5089605734767%\" valign=\"top\"\u003e\n \u003cp\u003eL-glutamine/Gluta-Max\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.4910394265233%\" valign=\"top\"\u003e\n \u003cp\u003e5 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"52.5089605734767%\" valign=\"top\"\u003e\n \u003cp\u003eNon-Essential Amino Acids\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.4910394265233%\" valign=\"top\"\u003e\n \u003cp\u003e5 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"52.5089605734767%\" valign=\"top\"\u003e\n \u003cp\u003eHEPES (1M)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.4910394265233%\" valign=\"top\"\u003e\n \u003cp\u003e13 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"52.5089605734767%\" valign=\"top\"\u003e\n \u003cp\u003eFetal bovine serum\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.4910394265233%\" valign=\"top\"\u003e\n \u003cp\u003e20 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eCritical\u003c/strong\u003e: Firstly prepare 500 ml of 3% Carboxy methyl cellulose (CMC) in Millipore water, autoclave, then keep at room temperature to cool down, then place the CMC solution in cold room overnight to dissolve. On the day of plaque assay, add the above components (500 mL) to the dissolved 3% CMC (500 mL) solution and keep on magnetic stirrer to mix properly.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e1X Phosphate Buffered Saline (PBS) (pH, 7.4)\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.888888888888886%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eReagent\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.92831541218638%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eFinal concentration\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"31.182795698924732%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAmount (1 L)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.888888888888886%\" valign=\"top\"\u003e\n \u003cp\u003eKCl (mw: 74.551 g/mol)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.92831541218638%\" valign=\"top\"\u003e\n \u003cp\u003e200 mg\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"31.182795698924732%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.888888888888886%\" valign=\"top\"\u003e\n \u003cp\u003eNa2HPO4 (mw: 141.96 g/mol)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.92831541218638%\" valign=\"top\"\u003e\n \u003cp\u003e1.44 gm\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"31.182795698924732%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.888888888888886%\" valign=\"top\"\u003e\n \u003cp\u003eKH2PO4 (mw: 136.086 g/mol) t\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.92831541218638%\" valign=\"top\"\u003e\n \u003cp\u003e245 mg\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"31.182795698924732%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.888888888888886%\" valign=\"top\"\u003e\n \u003cp\u003eMilli-Q water\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.92831541218638%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"31.182795698924732%\" valign=\"top\"\u003e\n \u003cp\u003eUp to 1 L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eHeat the mixture until all the components dissolve, then measure the pH.\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e10 X SDS Running Buffer\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.888888888888886%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eReagent\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.92831541218638%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eFinal concentration\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"31.182795698924732%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAmount (1 L)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.888888888888886%\" valign=\"top\"\u003e\n \u003cp\u003eadd tris base (molecular weight (mw): 121.14 g/mol)\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.92831541218638%\" valign=\"top\"\u003e\n \u003cp\u003e30.3 gm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"31.182795698924732%\" valign=\"top\"\u003e\n \u003cp\u003e0.0347 M\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.888888888888886%\" valign=\"top\"\u003e\n \u003cp\u003eGlycine (mw: 75.07 g/mol)\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.92831541218638%\" valign=\"top\"\u003e\n \u003cp\u003e144.4 gm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"31.182795698924732%\" valign=\"top\"\u003e\n \u003cp\u003e1.924 M\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.888888888888886%\" valign=\"top\"\u003e\n \u003cp\u003eSDS (mw: 288.38 g/mol)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.92831541218638%\" valign=\"top\"\u003e\n \u003cp\u003e10 gm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"31.182795698924732%\" valign=\"top\"\u003e\n \u003cp\u003e0.0347 M\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.888888888888886%\" valign=\"top\"\u003e\n \u003cp\u003eMilli-Q water\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.92831541218638%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"31.182795698924732%\" valign=\"top\"\u003e\n \u003cp\u003eUp to 1 L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003ePlace the mixture on a hot plate magnetic stirrer to dissolve the reagents.\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e10 X TAE buffer\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.888888888888886%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eReagent\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.92831541218638%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eFinal concentration\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"31.182795698924732%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAmount (1 L)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.888888888888886%\" valign=\"top\"\u003e\n \u003cp\u003eTris base\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.92831541218638%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"31.182795698924732%\" valign=\"top\"\u003e\n \u003cp\u003e48.5 g\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.888888888888886%\" valign=\"top\"\u003e\n \u003cp\u003eGlacial acetic acid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.92831541218638%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"31.182795698924732%\" valign=\"top\"\u003e\n \u003cp\u003e11.4 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.888888888888886%\" valign=\"top\"\u003e\n \u003cp\u003eEDTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.92831541218638%\" valign=\"top\"\u003e\n \u003cp\u003e0.5 M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"31.182795698924732%\" valign=\"top\"\u003e\n \u003cp\u003e20 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.888888888888886%\" valign=\"top\"\u003e\n \u003cp\u003eMilli-Q water\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.92831541218638%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"31.182795698924732%\" valign=\"top\"\u003e\n \u003cp\u003eUp to 1 L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.493716337522443%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eName\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.50628366247756%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eReagents\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eWestern blot reagents\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.493716337522443%\" valign=\"top\"\u003e\n \u003cp\u003ePBS-T\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.50628366247756%\" valign=\"top\"\u003e\n \u003cp\u003e0.5% tween-20 in 1X PBS.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.493716337522443%\" valign=\"top\"\u003e\n \u003cp\u003e5% Blocking buffer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.50628366247756%\" valign=\"top\"\u003e\n \u003cp\u003e0.50 gm of Non-fat dry milk (NFDM), mixed with 10 mL of 0.5% tween-20 in 1 X PBS.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.493716337522443%\" valign=\"top\"\u003e\n \u003cp\u003e10% \u0026beta;-mercaptoethanol loading dye\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.50628366247756%\" valign=\"top\"\u003e\n \u003cp\u003eMix 450 \u0026micro;L of 4X loading dye with 450 \u0026micro;L milli-Q water and add 90 \u0026micro;L \u0026beta;-mercaptoethanol in a microcentrifuge tube.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.493716337522443%\" valign=\"top\"\u003e\n \u003cp\u003e1 X Transfer buffer\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.50628366247756%\" valign=\"top\"\u003e\n \u003cp\u003eMix 25 mL of NuPAGE transfer buffer (20X) into 475 mL of milli-Q water.\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.493716337522443%\" valign=\"top\"\u003e\n \u003cp\u003e1% NP-40 lysis buffer (pH 7.4, 100 mL)\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.50628366247756%\" valign=\"top\"\u003e\n \u003cp\u003eAdd 10 mL of 10% NP-40, 1 mL of EDTA 1 mM, 3 mL of 150 mM NaCl,2 mL of 20 mM tris Cl (7.4). Then add 50 mL milli-Q water, and measure the pH, until reaches 7.4 then add up to 100 mL Milli-Q water.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.493716337522443%\" valign=\"top\"\u003e\n \u003cp\u003e1.5 M Tris HCl pH 8.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.50628366247756%\" valign=\"top\"\u003e\n \u003cp\u003eWeigh 27.23 gm of Tris base and add to a flask with magnetic stirrer, complete until 80 mL of Milli-Q water in magnetic stirrer, measure pH. Then, add HCL about 2 mL each time and measure pH until reaches 8.8. Complete with Milli- Q water until 150 mL.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.493716337522443%\" valign=\"top\"\u003e\n \u003cp\u003e0.5 M Tris HCl pH 6.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.50628366247756%\" valign=\"top\"\u003e\n \u003cp\u003eWeigh 18.28 gm of Tris base, add in a flask with magnetic stirrer complete until 80 mL Milli-Q water, measure the pH, then, add HCL about 2 mL each time until pH reaches 6.8, then complete up to 150 mL Milli-Q water.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.493716337522443%\" valign=\"top\"\u003e\n \u003cp\u003eAPS (10%, 10 mL)\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.50628366247756%\" valign=\"top\"\u003e\n \u003cp\u003eAdd 1 gm of Ammonium persulphate into 10 mL Milli-Q water in falcon tube, preferably freshly prepared, aliquot into 1.5 mL tubes and store at -20 \u0026deg;C for future use.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.493716337522443%\" valign=\"top\"\u003e\n \u003cp\u003eAntibody diluent\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.50628366247756%\" valign=\"top\"\u003e\n \u003cp\u003eIn a flacon tube, add 0.25 gm NFDM in 5 mL 0.5% tween in 1X PBS.\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eIFA reagents\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.493716337522443%\" valign=\"top\"\u003e\n \u003cp\u003e0.1% Triton X-100\u003c/p\u003e\n \u003cp\u003e.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.50628366247756%\" valign=\"top\"\u003e\n \u003cp\u003eAdd 20 \u0026micro;l triton x-100 in 20 mL milli Q-water, vortex to allow proper mixing.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.493716337522443%\" valign=\"top\"\u003e\n \u003cp\u003eBlocking buffer, 0.5 % bovine serum albumin (BSA)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.50628366247756%\" valign=\"top\"\u003e\n \u003cp\u003eIn a 50 mL conical tube, weigh 0.25 gm BSA in 50 ml hot milli-Q water on magnetic stirrer to solubilize.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eFlow cytometry reagents\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.493716337522443%\" valign=\"top\"\u003e\n \u003cp\u003ePermeabilization Buffer (10 X)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"74.50628366247756%\" valign=\"top\"\u003e\n \u003cp\u003ePrepare 1X permeabilization buffer (2 mL) by adding 200 \u0026micro;L in 1800 \u0026micro;L of 1X FCS buffer.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003ch2\u003eCloning of RV-G into pVSV-dG-GFP expression vector\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003eTiming\u003c/strong\u003e\u003cstrong\u003e: [5-6\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;days]\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e1. \u0026nbsp; \u0026nbsp;Day 1: To amplify the RV-G from the pCAGG-RV-G-HA-COOH vector, prepare the PCR reaction in 0.2 mL PCR tubes (on ice) using high fidelity (HF) Q5 DNA polymerase enzyme as follows:\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"65.53191489361703%\" valign=\"top\"\u003e\n \u003cp\u003eReagent\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.46808510638298%\" valign=\"top\"\u003e\n \u003cp\u003eAmount (50 \u0026micro;L)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"65.53191489361703%\" valign=\"top\"\u003e\n \u003cp\u003eDNA template (pCAGG-RV-G-HA vector)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.46808510638298%\" valign=\"top\"\u003e\n \u003cp\u003e500 ng\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"65.53191489361703%\" valign=\"top\"\u003e\n \u003cp\u003eQ5 HF DNA Polymerase 0.02 U/ \u0026micro;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.46808510638298%\" valign=\"top\"\u003e\n \u003cp\u003e0.5 \u0026micro;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"65.53191489361703%\" valign=\"top\"\u003e\n \u003cp\u003eRV-G-F (10 \u0026micro;M)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.46808510638298%\" valign=\"top\"\u003e\n \u003cp\u003e2.5 \u0026micro;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"65.53191489361703%\" valign=\"top\"\u003e\n \u003cp\u003eRV-G R (10 \u0026micro;M)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.46808510638298%\" valign=\"top\"\u003e\n \u003cp\u003e2.5 \u0026micro;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"65.53191489361703%\" valign=\"top\"\u003e\n \u003cp\u003e5X Q5 Reaction Buffer (1X)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.46808510638298%\" valign=\"top\"\u003e\n \u003cp\u003e10 \u0026micro;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"65.53191489361703%\" valign=\"top\"\u003e\n \u003cp\u003e10 mM dNTPs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.46808510638298%\" valign=\"top\"\u003e\n \u003cp\u003e10 \u0026micro;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"65.53191489361703%\" valign=\"top\"\u003e\n \u003cp\u003e5X Q5 High GC Enhancer (1X)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.46808510638298%\" valign=\"top\"\u003e\n \u003cp\u003e10 \u0026micro;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"65.53191489361703%\" valign=\"top\"\u003e\n \u003cp\u003eNuclease-Free Water (NFW) up to\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.46808510638298%\" valign=\"top\"\u003e\n \u003cp\u003e50 \u0026micro;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e2. \u0026nbsp; \u0026nbsp;Upon setting up the PCR reaction, gently mix the samples in a vortex, then transfer the samples to the thermocycler. Set the thermocycler conditions as follows:\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"26.916221033868094%\" valign=\"top\"\u003e\n \u003cp\u003eSteps\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.25133689839572%\" valign=\"top\"\u003e\n \u003cp\u003eTemperature\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.916221033868094%\" valign=\"top\"\u003e\n \u003cp\u003eTime\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.916221033868094%\" valign=\"top\"\u003e\n \u003cp\u003eCycles\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"26.916221033868094%\" valign=\"top\"\u003e\n \u003cp\u003eInitial Denaturation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.25133689839572%\" valign=\"top\"\u003e\n \u003cp\u003e98 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.916221033868094%\" valign=\"top\"\u003e\n \u003cp\u003e3 min.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.916221033868094%\" valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"26.916221033868094%\" valign=\"top\"\u003e\n \u003cp\u003eDenaturation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.25133689839572%\" valign=\"top\"\u003e\n \u003cp\u003e98 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.916221033868094%\" valign=\"top\"\u003e\n \u003cp\u003e30 sec\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.916221033868094%\" rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e35-40 cycles\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"36.829268292682926%\" valign=\"top\"\u003e\n \u003cp\u003eAnnealing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.341463414634145%\" valign=\"top\"\u003e\n \u003cp\u003e65 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.829268292682926%\" valign=\"top\"\u003e\n \u003cp\u003e1 min\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"36.829268292682926%\" valign=\"top\"\u003e\n \u003cp\u003eExtension\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.341463414634145%\" valign=\"top\"\u003e\n \u003cp\u003e72 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.829268292682926%\" valign=\"top\"\u003e\n \u003cp\u003e2 min\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"26.916221033868094%\" valign=\"top\"\u003e\n \u003cp\u003eFinal extension\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.25133689839572%\" valign=\"top\"\u003e\n \u003cp\u003e72 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.916221033868094%\" valign=\"top\"\u003e\n \u003cp\u003e10 min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.916221033868094%\" valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"26.868327402135233%\" valign=\"top\"\u003e\n \u003cp\u003eFinal Hold\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.21708185053381%\" valign=\"top\"\u003e\n \u003cp\u003e4 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"53.91459074733096%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eCritical\u003c/strong\u003e: We recommend setting 3 min for the initial denaturation to ensure separation of the double strand DNA template to allow binding of primers to the target region and starting the extension.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCritical:\u003c/strong\u003e To determine the annealing temperature, we recommend using NEB Tm calculator to optimize the annealing temperature according to the polymerase enzyme and primers used in the PCR reaction (https://tmcalculator.neb.com/#!/main).\u003c/p\u003e\n\u003cp\u003e3.\u0026nbsp; \u0026nbsp;\u0026nbsp;Upon amplification, perform agarose gel electrophoresis for confirmation and purification of the amplified PCR product as previously described\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003csup\u003e13\u003c/sup\u003e. To prepare 50 mL of 1X TAE buffer, add 5 mL of 10X TAE buffer stock solution in a bottle to 45 mL of milli-Q water.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e4.\u0026nbsp; \u0026nbsp;\u0026nbsp;Prepare 0.6% agarose gel by dissolving 0.3 grams of agarose low EEO gel in 50 mL of 1X TAE buffer. Heat the agarose solution in a microwave for 1 minute for solubilization. While leaving the agarose solution to cool down, assemble the gel casting tray, and place the comb.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e5.\u0026nbsp; \u0026nbsp;\u0026nbsp;Upon gel cooling, add gel red stain (nucleic acid stain) at a ratio of 10 \u0026mu;L per 50 mL of agarose solution.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e6.\u0026nbsp; \u0026nbsp;\u0026nbsp;Prepare the samples by mixing with 6X gel loading dye and load them into the wells (10 \u0026mu;L). Keep one well for loading the GeneRuler 1 kb DNA ladder. Cover the chamber and connect the apparatus to the power supply. Run the gel at 100 voltages for 30 minutes \u0026ndash; 1 hour in 1 X TAE running buffer, visualize the gel using a Gel-doc machine \u003cstrong\u003e(Figure 3 B).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea.\u0026nbsp; \u0026nbsp;\u0026nbsp;Purify the PCR product using the Gene JET Gel Extraction Kit following the manufacturer\u0026rsquo;s instructions. For cutting the bands, examine the gel using the UV transilluminator and excise the DNA band of interest using a razor blade. Then place the gel slice in a pre-weighed microcentrifuge tube with adding the binding buffer at 1:1 volume of buffer (\u0026mu;L): gel (mg). Incubate the gel mixture on a heat block at 65 \u0026deg;C till the gel completely dissolves. Followed by the transfer of the solubilized gel into Gene-JET purification column and centrifugation for 1 min. at 12,000 x g with discarding the flow through. Afterwards, add 700 \u0026mu;L of wash buffer to the column and re-centrifuge at the same speed while discarding the flow through. For removal of any residual washing buffer, re-centrifuge the empty column. Elute the purified DNA by adding 30-50 \u0026mu;L of warmed elution buffer at the centre of the column and incubate for 5 minutes at room temperature. Then centrifuge the tube at 12,000 x g for 2 minutes. Measure the purified DNA concentration using a Nano-Drop 2000c spectrophotometer.\u003c/p\u003e\n\u003cp\u003e7. \u0026nbsp; \u0026nbsp;For generating the compatible ends of RV-G amplicon and pVSV-dG-GFP, prepare two restriction digestion reactions with each of the pVSV-dG-GFP vector and the RV-G amplicon in 0.2 mL PCR tubes as follows\u003cem\u003e:\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCritical:\u003c/strong\u003e Prepare several restriction digestion reactions and elute in small volumes (20 \u0026micro;L) to obtain high DNA concentration for the ligation reactions:\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"63.34841628959276%\" valign=\"top\"\u003e\n \u003cp\u003eReagent\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.65158371040724%\" valign=\"top\"\u003e\n \u003cp\u003eAmount (50 \u0026mu;L)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"63.34841628959276%\" valign=\"top\"\u003e\n \u003cp\u003eRV-G amplicon or pVSV-dG-GFP plasmid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.65158371040724%\" valign=\"top\"\u003e\n \u003cp\u003e(500 ng/ \u0026mu;L)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"63.34841628959276%\" valign=\"top\"\u003e\n \u003cp\u003eMluI-HF enzyme\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.65158371040724%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"63.34841628959276%\" valign=\"top\"\u003e\n \u003cp\u003eNheI-HF enzyme\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.65158371040724%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"63.34841628959276%\" valign=\"top\"\u003e\n \u003cp\u003e10X CutSmart\u0026reg; Buffer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.65158371040724%\" valign=\"top\"\u003e\n \u003cp\u003e5 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"63.34841628959276%\" valign=\"top\"\u003e\n \u003cp\u003eNFW up to\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.65158371040724%\" valign=\"top\"\u003e\n \u003cp\u003e50 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e8.\u0026nbsp; \u0026nbsp;\u0026nbsp;Incubate the restriction digestion reaction overnight at 37 \u0026deg;C.\u003c/p\u003e\n\u003cp\u003e9.\u0026nbsp; \u0026nbsp;\u0026nbsp;Day 2: On the following day, heat inactivate the restriction digestion reaction at 80 \u0026deg;C for 20 minutes. In the meantime, prepare the agarose gel electrophoresis for confirmation and purification of the digested pVSV-dG-GFP and RV-G amplicon as described in steps 4-6 \u003cstrong\u003e(Figure 3 C and D)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e10.\u0026nbsp;\u0026nbsp;Set up a ligation reaction in 0.2 mL PCR tubes as follows to ligate the digested RV-G amplicon into pVSV-dG-GFP:\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"62.5%\" valign=\"top\"\u003e\n \u003cp\u003eReagent\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"37.5%\" valign=\"top\"\u003e\n \u003cp\u003eAmount (10 \u0026mu;L)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"62.5%\" valign=\"top\"\u003e\n \u003cp\u003epVSV-dG-RV-G-GFP plasmid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"37.5%\" valign=\"top\"\u003e\n \u003cp\u003e100 ng/ \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"62.5%\" valign=\"top\"\u003e\n \u003cp\u003eT4 DNA Ligase Buffer (10X)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"37.5%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"62.5%\" valign=\"top\"\u003e\n \u003cp\u003eDNA insert (RV-G amplicon) (1.5 kb)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"37.5%\" valign=\"top\"\u003e\n \u003cp\u003e11.28 ng (1:1) or 33.3 ng (5:1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"62.5%\" valign=\"top\"\u003e\n \u003cp\u003eT4 DNA Ligase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"37.5%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"62.5%\" valign=\"top\"\u003e\n \u003cp\u003eNFW (up to)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"37.5%\" valign=\"top\"\u003e\n \u003cp\u003e10 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e11.\u0026nbsp;\u0026nbsp;Incubate the ligation reaction overnight at 16 \u0026deg;C.\u003c/p\u003e\n\u003cp\u003e12.\u0026nbsp;\u0026nbsp;Day 3: On the following day, heat inactivate the ligation reaction at 65 \u0026deg;C for 20 minutes.\u003c/p\u003e\n\u003cp\u003e13.\u0026nbsp;\u0026nbsp;For transformation of the ligation reaction, thaw the DH5-alpha E.coli competent cells from ˗80 \u0026deg;C into ice. Transform the ligation reaction into of 50 \u0026mu;L DH5-alpha E. coli competent cells in a circular manner, then incubate the transformation mixture for 20 min on ice. For heat shock, transfer the transformation mixture to 42 \u0026deg;C for 45 sec, then keep the samples on ice for 10 min. Mix the transformation mixture with pre-heated 250 \u0026mu;L of SOC medium, then incubate the mixture for 1 hr at 37 \u0026deg;C in a shaking incubator.\u003c/p\u003e\n\u003cp\u003e14.\u0026nbsp;\u0026nbsp;During the incubation, prepare LB agar plates with the selective bacterial medium by dissolving the LB agar in the microwave. When reaching 55 \u0026deg;C, add ampicillin at a final concentration of (100 \u0026mu;g/mL).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e15.\u0026nbsp;\u0026nbsp;On clean bench, pour the LB gar into the petri dishes and keep until solidification at room temperature. After incubating the transformation mixture, plate 50 \u0026mu;L of the transformation mixture on the prepared LB agar plates and then incubate it overnight at 37 \u0026deg;C.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCritical:\u003c/strong\u003e Include control LB agar plates transformed with (1) uncut vector only (to ensure that the colonies are not due to vector recircularization), (2) cut vector only (to ensure viability of competent cells).\u003c/p\u003e\n\u003cp\u003e16.\u0026nbsp;\u0026nbsp;Day 4: On the next day, check the plates for the presence of colonies. Pick up separately the single, well-defined colonies, and incubate in 5 mL LB broth containing 100 \u0026mu;g/mL ampicillin overnight, in a shaking incubator at 37 \u0026deg;C.\u0026nbsp;\u003cstrong\u003eTroubleshooting 1\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e17.\u0026nbsp;\u0026nbsp;Day 5: The following day, use 4.5 mL of the bacterial culture for plasmid purification using Qiagen miniprep kit following the manual instructions.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCritical:\u003c/strong\u003e Purification of pVSV-dG-RV-G-GFP vector, using midi prep kit, resulted in very low plasmid concentrations. Thus, purification of pVSV-dG-RV-G-GFP was carried out using the mini-prep kit.\u003c/p\u003e\n\u003cp\u003e18.\u0026nbsp;\u0026nbsp;Mix the rest of the culture (0.5 mL) with the preservation medium (50% glycerol stock in milli-Q water) and keep at -80 \u0026deg;C for future use.\u003c/p\u003e\n\u003cp\u003e19.\u0026nbsp;\u0026nbsp;To validate proper cloning of the RV-G insert into pVSV-dG-GFP, perform colony PCR, and diagnostic restriction digestion.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea.\u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eColony PCR\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ei.\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Transfer 1 mL of bacterial culture of each of the selected colonies separately into 1.5 mL microcentrifuge tubes,\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eii.\u0026nbsp; \u0026nbsp; \u0026nbsp;Centrifuge the bacterial culture at 13,000 x g for 10 minutes, then discard the supernatant and resuspend the pellet in 40 \u0026mu;L NFW with mixing. Incubate the samples at 100 \u0026deg;C for 10 minutes in bench incubator, followed by centrifuging the samples at 13,000 x g for 5 minutes and transfer the DNA containing supernatant to a new microfuge tube, serving as the template DNA. Use RV-G gene specific primers (RV-G-F and RV-G-R), to perform the PCR reaction and visualize the amplified region with agarose gel electrophoresis as described in steps 3-6 \u003cstrong\u003e(Figure 3 E)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb. \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eDiagnostic restriction digestion\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ei. \u0026nbsp; \u0026nbsp; \u0026nbsp;Upon purification of plasmid DNA, set up a restriction digestion reaction as described in steps 7-9 (\u003cstrong\u003eFigure 3 F)\u003c/strong\u003e.\u003c/p\u003e"},{"header":"Rescue of pVSV-dG-RV-G-GFP","content":"\u003cp\u003e\u003cstrong\u003eTiming\u003c/strong\u003e\u003cstrong\u003e: [6-7\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;days]\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor the recovery of infectious virus from pVSV-dG-RV-G-GFP, co-transfect the modified pVSV-dG-RV-G-GFP along with the VSV helper plasmids as previously described\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003csup\u003e14\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e20.\u0026nbsp;\u0026nbsp;Day 1: In two six well plates, seed BHK-21 cells at a density of 0.3 X 10\u003csup\u003e6\u003c/sup\u003e cells/well in 1.5 mL growth medium, and incubate the plates at 37 \u0026deg;C /5% CO2 for 24 hrs.\u003c/p\u003e\n\u003cp\u003e21.\u0026nbsp;\u0026nbsp;Day 2: when the BHK-21 cells reach 80-90% confluency, aspirate the growth medium and wash the cells once with 1 X PBS. In the meantime, prepare the rFPV virus inoculum (at MOI of 2), by mixing with 800 \u0026micro;L DMEM in 1.5 mL Microcentrifuge tubes on ice.\u003c/p\u003e\n\u003cp\u003e22.\u0026nbsp;\u0026nbsp;Aspirate the PBS and inoculate the BHK-21 cells with the prepared rFPV inoculum as a source of T7 promoter. Incubate the infected cells at 37 \u0026deg;C for 2 hrs with shaking every 15-20 minutes, to allow uniform virus distribution.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCritical:\u003c/strong\u003e As a source of T7 polymerase, it is recommended to use rFPV instead of vaccinia virus, since infecting mammalian cells with rFPV would not result in production of infectious virus and in contrast to vaccinia virus, rFPV would not interfere with infection studies of other virus\u0026nbsp;\u003csup\u003e20\u003c/sup\u003e\u003c/p\u003e\n\u003cp\u003e23.\u0026nbsp;\u0026nbsp;During the incubation, prepare a transfection mixture including pVSV-dG-RV-G-FP along with VSV helper plasmids in 15 mL conical tube with the following ratios:\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.04810996563574%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ePlasmid\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"53.95189003436426%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eConcentration\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.04810996563574%\" valign=\"top\"\u003e\n \u003cp\u003epVSV-dG-RV-G-GFP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"53.95189003436426%\" valign=\"top\"\u003e\n \u003cp\u003e2.5 \u0026mu;g\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.04810996563574%\" valign=\"top\"\u003e\n \u003cp\u003epBS-N-ФT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"53.95189003436426%\" valign=\"top\"\u003e\n \u003cp\u003e0.75 \u0026mu;g\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.04810996563574%\" valign=\"top\"\u003e\n \u003cp\u003epBS-P-ФT\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"53.95189003436426%\" valign=\"top\"\u003e\n \u003cp\u003e1.25 \u0026mu;g\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.04810996563574%\" valign=\"top\"\u003e\n \u003cp\u003epBS-L-ФT\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"53.95189003436426%\" valign=\"top\"\u003e\n \u003cp\u003e0.5 \u0026mu;g\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.04810996563574%\" valign=\"top\"\u003e\n \u003cp\u003epBS-G-ФT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"53.95189003436426%\" valign=\"top\"\u003e\n \u003cp\u003e2.5 \u0026mu;g\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e24.\u0026nbsp;\u0026nbsp;Mix the prepared plasmids with 22.5 \u0026micro;L of turbofect transfection reagent, diluted in 750 \u0026mu;L Opti-MEM, followed by vortexing the transfection mixture and incubate it at room temperature (RT) for 25 min.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e25.\u0026nbsp;\u0026nbsp;After 2 hrs, remove the rFPV inoculum, and wash the infected cells 3 times with 1 X PBS. Remove the 1X PBS and add the transfection mixture in a dropwise manner to the cells with swirling the plates gently. Keep the plates at 37 \u0026deg;C/ 5% CO2 overnight (see Notes 7 and 8).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCritical:\u0026nbsp;\u003c/strong\u003eInclude control wells as follows: (1) wells infected with rFPV, then transfected with pCITE-GFP plasmid control (encodes the ORF of GFP under the control of T7 promoter), to ensure the efficiency of T7 promoter in rFPV virus. (2) wells transfected with pCAGG-GFP only. (3) wells infected with rFPV, then transfected with pVSV-dG-GFP and VSV helper plasmids.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCritical:\u003c/strong\u003e It is recommended to prepare 8 wells transfected with the prepared plasmids mixture to obtain enough volumes of the rescue viruses.\u003c/p\u003e\n\u003cp\u003e26.\u0026nbsp;\u0026nbsp;Check the GFP daily using fluorescence microscope and examine the cytopathic effect (CPE) evidenced by syncytia formation. Twenty-four hrs post transfection, GFP is observed in the following wells: wells transfected with pCAGG GFP only, wells infected with rFPV and transfected with pCITE GFP, wells infected with rFPV and transfected with pVSV-dG-GFP WT along with VSV helper plasmids\u0026nbsp;\u003cstrong\u003e(Figure 4 A-C)\u003c/strong\u003e.\u0026nbsp;\u003cstrong\u003eTroubleshooting 2\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e27. \u0026nbsp;After 96 hrs, the GFP is observed in wells infected with rFPV and transfected with pVSV-dG-RV-G-GFP. Once GFP is observed in cells transfected with pVSV-dG-RV-G-GFP. Freeze and thaw the plates 3 times for collecting the released virus. Centrifuge the recovered virus at 300 x g, collect the supernatant in sterile conical tubes, followed by passing the virus through 0.22 \u0026mu;m syringe filter to remove the recombinant fowl pox virus, then aliquot in sterile microcentrifuge tubes and keep at -80 \u0026deg;C for future use \u003cstrong\u003e(Figure 4 D)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e28. \u0026nbsp;Carry out further passaging of the rVSV-dG-RV-G-GFP, by inoculating the rescued VSV-dG-RV-G-GFP on BHK-21 cells to ensure the stability of the RV-G insert \u003cstrong\u003e(Figure 4 E\u003c/strong\u003e). \u003cstrong\u003eTroubleshooting 3\u003c/strong\u003e.\u003c/p\u003e"},{"header":"Molecular characterization of rVSV-dG-RV-G-GFP","content":"\u003ch2\u003eReverse transcription polymerase chain reaction (RT-PCR)\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003eTiming\u003c/strong\u003e\u003cstrong\u003e: [2 days]\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo confirm the stability of RV-G insert in the rVSV-dG-RV-G-GFP subsequent passages, carry out RT-PCR through the following steps.\u003c/p\u003e\n\u003cp\u003e29.\u0026nbsp;\u0026nbsp;\u003cstrong\u003eDay 1: Viral RNA extraction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea.\u0026nbsp; \u0026nbsp;\u0026nbsp;Extract the viral RNA from the following wells: (1) viral supernatant of rVSV-dG-RV-G-GFP 3\u003csup\u003erd\u003c/sup\u003e passage and (2) viral supernatant of rVSV-GFP-WT, using QIAamp Viral RNA Mini Kit (QIAGEN) kit following the manufacturer\u0026apos;s instructions.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eb.\u0026nbsp; \u0026nbsp;\u0026nbsp;In 1.5 ml sterile, clearly labelled microcentrifuge tubes, add for each 140 \u0026mu;L viral supernatant, 560 \u0026mu;L lysis buffer AVL and 5.6 \u0026mu;L carrier RNA, mix with pulse vortexing for 15 s. Incubate the mixture at RT for 10 mins and briefly centrifuge to remove drops from the inside lid.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ec.\u0026nbsp; \u0026nbsp; \u0026nbsp;Add 560 \u0026mu;L absolute ethanol to the mixture and mix by pulse-vortexing, then briefly centrifuge to remove drops from the lid.\u003c/p\u003e\n\u003cp\u003ed.\u0026nbsp; \u0026nbsp;\u0026nbsp;Label and prepare the QIAamp Mini column for each sample, transfer 630 \u0026mu;L of the lysate into the QIAamp Mini column, then centrifuge at 6000 x g for 1 min., followed by discarding the collection tube, and placing the column in a new collection tube.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ee.\u0026nbsp; \u0026nbsp;\u0026nbsp;Repeat the previous step until the samples are fully loaded.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ef.\u0026nbsp; \u0026nbsp; \u0026nbsp;Wash the column twice as follows: once with 500 \u0026mu;L AW1 Buffer and the next wash with 500 \u0026mu;L of Buffer AW2. After each wash, centrifuge the column at 6000 x g for 1 min in the initial wash and for 3 min at 20,000 x g in the second wash and then place into clean collection tube.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eg.\u0026nbsp; \u0026nbsp;\u0026nbsp;Centrifuge the spin column for 1 min at full speed for removal of any residual washing buffer.\u003c/p\u003e\n\u003cp\u003eh.\u0026nbsp; \u0026nbsp;\u0026nbsp;To elute the viral RNA, add a volume of 30 \u0026micro;L AVE buffer to the centre of the membrane after setting in a sterile, labelled microfuge tube then incubate for 5 min at RT.\u003c/p\u003e\n\u003cp\u003ei.\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;After incubation, centrifuge the tubes at 6000 x g for 1 min.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ej.\u0026nbsp; \u0026nbsp; \u0026nbsp;Quantify the extracted viral RNA using nanodrop spectrophotometer with checking and recording the RNA quality. Keep the viral RNA at -80 \u0026deg;C until use.\u003c/p\u003e\n\u003cp\u003e30.\u0026nbsp;\u0026nbsp;\u003cstrong\u003eDay 2: Setting up the RT-PCR reaction.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea.\u0026nbsp; \u0026nbsp;\u0026nbsp;The extracted viral RNA is used as a template for RT-PCR. Prepare the cDNA synthesis mixture in 0.2 mL thin-walled PCR tube for each sample. Prepare a 20 \u0026micro;L reaction with the following components in two steps:\u003c/p\u003e\n\u003cp\u003eb.\u0026nbsp; \u0026nbsp;\u0026nbsp;Set up the following reaction mixture on ice to anneal the primer to template RNA (step 1):\u0026nbsp;\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"416\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"67.0673076923077%\" valign=\"top\"\u003e\n \u003cp\u003eComponent\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.93269230769231%\" valign=\"top\"\u003e\n \u003cp\u003eVolume\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"67.0673076923077%\" valign=\"top\"\u003e\n \u003cp\u003e2 \u0026mu;M gene-specific reverse primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.93269230769231%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"67.0673076923077%\" valign=\"top\"\u003e\n \u003cp\u003e10 mM dNTP mix (10 mM each)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.93269230769231%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"67.0673076923077%\" valign=\"top\"\u003e\n \u003cp\u003eTemplate RNA (100 ng RNA)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.93269230769231%\" valign=\"top\"\u003e\n \u003cp\u003e8 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"67.0673076923077%\" valign=\"top\"\u003e\n \u003cp\u003eDEPC-treated water\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.93269230769231%\" valign=\"top\"\u003e\n \u003cp\u003e3 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003ec.\u0026nbsp; \u0026nbsp; \u0026nbsp;Mix the reaction components, then heat the template RNA primer mixture at 65 \u0026deg;C for 5 minutes and incubate on ice for 1 minute.\u003c/p\u003e\n\u003cp\u003ed.\u0026nbsp; \u0026nbsp;\u0026nbsp;Set up the RT reaction mixture (step 2) as follows:\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"418\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"83.73205741626795%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eComponent\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.267942583732058%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eVolume\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"83.73205741626795%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026times; SSIV Buffer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.267942583732058%\" valign=\"top\"\u003e\n \u003cp\u003e4 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"83.73205741626795%\" valign=\"top\"\u003e\n \u003cp\u003e100 mM DTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.267942583732058%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"83.73205741626795%\" valign=\"top\"\u003e\n \u003cp\u003eRNase-OUT\u0026trade; Recombinant RNase Inhibitor\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.267942583732058%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"83.73205741626795%\" valign=\"top\"\u003e\n \u003cp\u003eSuper-Script\u0026reg; IV Reverse Transcriptase (200 U/ \u0026micro;L)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.267942583732058%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003ee.\u0026nbsp; \u0026nbsp;\u0026nbsp;Mix the contents of both reactions and incubate at 55 \u0026deg;C for 10 minutes, followed by incubating the reaction at 80 \u0026deg;C for 10 minutes for reaction inactivation.\u003c/p\u003e\n\u003cp\u003ef.\u0026nbsp; \u0026nbsp; \u0026nbsp;Prepare the PCR reaction using VSV-up and VSV down primers as demonstrated in the schematic diagram \u003cstrong\u003e(Figure 5 A)\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"519\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"41.811175337186896%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eComponent\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.094412331406552%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAmount (25 \u0026mu;L )\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.094412331406552%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eFinal concentration\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"41.811175337186896%\" valign=\"top\"\u003e\n \u003cp\u003eDNA template\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.094412331406552%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.094412331406552%\" valign=\"top\"\u003e\n \u003cp\u003e100 ng\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"41.811175337186896%\" valign=\"top\"\u003e\n \u003cp\u003eDream-Taq Green\u003c/p\u003e\n \u003cp\u003ePCR Master Mix (2X)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.094412331406552%\" valign=\"top\"\u003e\n \u003cp\u003e12.5 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.094412331406552%\" valign=\"top\"\u003e\n \u003cp\u003e0.02 U/\u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"41.811175337186896%\" valign=\"top\"\u003e\n \u003cp\u003e10 mM VSV-UP primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.094412331406552%\" valign=\"top\"\u003e\n \u003cp\u003e0.625 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.094412331406552%\" valign=\"top\"\u003e\n \u003cp\u003e0.5 \u0026micro;M\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"41.811175337186896%\" valign=\"top\"\u003e\n \u003cp\u003e10 mM VSV-Down primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.094412331406552%\" valign=\"top\"\u003e\n \u003cp\u003e0.625 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.094412331406552%\" valign=\"top\"\u003e\n \u003cp\u003e0.5 \u0026mu;M\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"41.811175337186896%\" valign=\"top\"\u003e\n \u003cp\u003eNFW\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.094412331406552%\" valign=\"top\"\u003e\n \u003cp\u003eup to 25 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.094412331406552%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eg. \u0026nbsp; \u0026nbsp;Set up the PCR thermocycler at the following conditions:\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.433526011560694%\" valign=\"top\"\u003e\n \u003cp\u003eSteps\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.470134874759154%\" valign=\"top\"\u003e\n \u003cp\u003eTemperature\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.094412331406552%\" valign=\"top\"\u003e\n \u003cp\u003eTime\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.001926782273603%\" valign=\"top\"\u003e\n \u003cp\u003eCycles\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.433526011560694%\" valign=\"top\"\u003e\n \u003cp\u003eInitial Denaturation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.470134874759154%\" valign=\"top\"\u003e\n \u003cp\u003e95 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.094412331406552%\" valign=\"top\"\u003e\n \u003cp\u003e3 min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.001926782273603%\" valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.433526011560694%\" valign=\"top\"\u003e\n \u003cp\u003eDenaturation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.470134874759154%\" valign=\"top\"\u003e\n \u003cp\u003e95 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.094412331406552%\" valign=\"top\"\u003e\n \u003cp\u003e30 sec\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.001926782273603%\" rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e35 cycles\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"32.19512195121951%\" valign=\"top\"\u003e\n \u003cp\u003eAnnealing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.975609756097562%\" valign=\"top\"\u003e\n \u003cp\u003e67.8 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.829268292682926%\" valign=\"top\"\u003e\n \u003cp\u003e1 min\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"32.19512195121951%\" valign=\"top\"\u003e\n \u003cp\u003eExtension\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.975609756097562%\" valign=\"top\"\u003e\n \u003cp\u003e68 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.829268292682926%\" valign=\"top\"\u003e\n \u003cp\u003e2 min\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.433526011560694%\" valign=\"top\"\u003e\n \u003cp\u003eFinal extension\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.470134874759154%\" valign=\"top\"\u003e\n \u003cp\u003e68 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.094412331406552%\" valign=\"top\"\u003e\n \u003cp\u003e10 min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.001926782273603%\" valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.433526011560694%\" valign=\"top\"\u003e\n \u003cp\u003eFinal Hold\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.470134874759154%\" valign=\"top\"\u003e\n \u003cp\u003e4 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.09633911368015%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eh. \u0026nbsp; \u0026nbsp;Upon amplification, perform agarose gel electrophoresis \u003cstrong\u003e(Figure. 5 B)\u003c/strong\u003e.\u003c/p\u003e\n\u003ch2\u003eSanger sequencing\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003eTiming\u003c/strong\u003e\u003cstrong\u003e: [3-4 days\u003c/strong\u003e\u003cstrong\u003e]\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo verify the correct orientation and stability of RV-G insert in the rescued rVSV-dG-RV-G-GFP, prepare the concentration of primers (VSV-UP and VSV-down primers) and plasmids according to the sequencing company specifications. Analyse the sequence contigs using the NCBI BLAST tool \u003cstrong\u003e(Figure 5 C)\u003c/strong\u003e.\u003c/p\u003e"},{"header":"Assessment of rVSV-dG-RV-G-GFP replication fitness","content":"\u003ch2\u003ePlaque assay\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003eTiming\u003c/strong\u003e\u003cstrong\u003e: [5-6 days\u003c/strong\u003e\u003cstrong\u003e]\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePlaque assay represents a quantitative method for measuring the infectious virus progeny through plaques quantification of culture infected cells with serial dilution of the virus specimens\u0026nbsp;\u003csup\u003e15\u003c/sup\u003e. While viral RNA quantification provides highly specific and sensitive method, it does not usually reflect whether all the replicating viral genome copies were capable of releasing infectious virus particles. Herein, we explain the plaque assay utilizing liquid overlay medium.\u003c/p\u003e\n\u003cp\u003e31.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Day 1: In a 6 well plate, seed BHK-21 cells at a density of 0.3 x 10\u003csup\u003e6\u003c/sup\u003e cells/well. Incubate at 37\u0026deg; C with 5% CO2, until reaching 70-80% confluency.\u003c/p\u003e\n\u003cp\u003e32.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;On the same day, prepare 3% CMC, autoclave then keep the 3% CMC solution at RT until it cools down, then keep it overnight at 4 \u0026deg;C to allow solubilization.\u003c/p\u003e\n\u003cp\u003e33.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Day 2: Next day in the morning, transfer the 3% CMC solution bottle from 4 \u0026deg;C to the bath bead, set the temperature at 37 \u0026deg;C to warm up.\u003c/p\u003e\n\u003cp\u003e34.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;In the safety cabinet, perform ten-fold serial dilution of the virus supernatants by adding 900 \u0026mu;L of infection medium in 1.5 mL tubes, then transfer 100 \u0026mu;L of each lower dilution specimen to the subsequent tube of higher dilution. Prepare the virus supernatant dilutions as follows: 10\u003csup\u003e\u0026minus;1\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;2\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;3\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;4\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;5\u003c/sup\u003e, and 10\u003csup\u003e\u0026minus;6\u003c/sup\u003e, followed by vertexing until reaching the final dilution.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCritical:\u003c/strong\u003e If the virus titre is too high, perform until the 10th dilution. Perform the specimens\u0026rsquo; dilutions in triplicates and for each plate, set uninfected wells to serve as negative control. Properly label the six well plates with the corresponding dilutions.\u003c/p\u003e\n\u003cp\u003e35.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;After preparation of the serially diluted virus, remove the growth medium from BHK-21 cells and wash the cells once with 1 X PBS.\u003c/p\u003e\n\u003cp\u003e36.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Aspirate the PBS, then add 900 \u0026mu;L of the prepared virus dilution designated for each well after vertexing each tube, then incubate the plates at 37 \u0026deg;C in a 5% CO2 incubator for 2 hrs, with shaking every 15-20 min.\u003c/p\u003e\n\u003cp\u003e37.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;During virus incubation, prepare the overlay medium and mix it with equal volume of 3% CMC solution to be used as plaque overlay medium and keep on magnetic stirrer for obtaining uniform plaque overlay medium.\u003c/p\u003e\n\u003cp\u003e38.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;After 2 hrs of virus infection, remove the plates from the incubator and in the biosafety cabinet, remove the diluted virus supernatants, wash the infected cells 3 times with 1 X PBS.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e39.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Aspirate, the PBS, then with a 25 mL stripettor, gently add 4 mL of the prepared plaque overlay medium/ well, starting from uninfected wells to wells infected with highest virus dilution, then finally to wells with the lowest virus dilutions.\u003c/p\u003e\n\u003cp\u003e40.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Carefully, transfer the plates into 37 \u0026deg;C incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e for 72 hrs. Check daily for plaque formation and for GFP.\u003c/p\u003e\n\u003cp\u003e41.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;After 72 hrs, transfer the plates from the incubator into biosafety cabinet class II, add 1 mL of 4% PFA for each well for fixation, begin with wells of uninfected cells, followed by wells of highest virus dilutions then lowest virus dilutions.\u003c/p\u003e\n\u003cp\u003e42.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Place the plates on a shaker at RT for 1 hr to allow fixation.\u003c/p\u003e\n\u003cp\u003e43.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;After 1 hr, tilt the plates to your side and using a stripettor, gently aspirate the overlay medium from the plates and discard them in a bottle with detergent.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCritical:\u003c/strong\u003e Ensure not to disrupt the cell monolayer to maintain the rounded shape of formed plaques.\u003c/p\u003e\n\u003cp\u003e44.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Upon removal of the overlay medium, stain the cells by adding 1 mL of 0.5% crystal violet and keep on a shaker for 1 hr at room temperature.\u003c/p\u003e\n\u003cp\u003e45.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;For counting the plaques, remove the stain and wash the wells gently with water until the rounded plaques appear in a purple monolayer. The uninfected reference control should appear as uniform monolayer without any plaques\u0026nbsp;\u003cstrong\u003e(Figure 6 A-B)\u003c/strong\u003e. Count the plaques at the highest virus dilution with 5-100 plaques using the following equation:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eVirus titre PFU/mL)= Average number of plaques given by the identified virus dilution/ (dilution factor \u0026times; volume of inoculum per plate). \u003cstrong\u003eTroubleshooting 4\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e46. \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Dispose the plates in biohazardous waste for autoclaving, for liquid waste, incubate at RT overnight before disposal.\u003c/p\u003e\n\u003ch2\u003eQuantitative One step RT-qPCR (TaqMan\u0026trade;)\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003eTiming\u003c/strong\u003e\u003cstrong\u003e: [5-6\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;days]\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e47. \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003cstrong\u003eDay 1-4\u003c/strong\u003e:\u003cstrong\u003e\u0026nbsp;Viral RNA extraction\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExtract the viral RNA of infected BHK-21 cells with both rVSV-dG-RV-G-GFP and rVSV-dG-GFP-WT as described above in step 29 (see molecular characterization, RT-PCR).\u003c/p\u003e\n\u003cp\u003e48.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003cstrong\u003eDay 5: Standard curve\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea.\u0026nbsp; \u0026nbsp;\u0026nbsp;Upon extraction of the viral RNA, prepare different viral RNA concentrations and quantify the genomic viral RNA in each of the prepared samples, using the SuperScript\u0026trade; III Platinum\u0026trade; One-Step RT-qPCR Kit following the manufacturer\u0026rsquo;s instructions.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eb.\u0026nbsp; \u0026nbsp;\u0026nbsp;Set up the RT-qPCR reactions on ice, prepare a master mix, followed by adding the reactions in plate wells on ice, add the template viral RNA at the end separately to each well. Each of the viral RNA concentrations is performed in triplicates.\u003c/p\u003e\n\u003cp\u003ec.\u0026nbsp; \u0026nbsp; \u0026nbsp;Set up the One-step RT-qPCR reaction in 96-well PCR plates as follows.\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"44.19551934826884%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eComponent\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.014256619144604%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eVolume (50 \u0026mu;L)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.79022403258656%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eFinal concentration\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"44.19551934826884%\" valign=\"top\"\u003e\n \u003cp\u003eSuperScript\u0026trade;III RT/Platinum\u0026trade; \u003cem\u003eTaq Mix\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.014256619144604%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.79022403258656%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"44.19551934826884%\" valign=\"top\"\u003e\n \u003cp\u003e2X Reaction Mix\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.014256619144604%\" valign=\"top\"\u003e\n \u003cp\u003e25 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.79022403258656%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"44.19551934826884%\" valign=\"top\"\u003e\n \u003cp\u003eFWD primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.014256619144604%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.79022403258656%\" valign=\"top\"\u003e\n \u003cp\u003e10 \u0026mu;M\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"44.19551934826884%\" valign=\"top\"\u003e\n \u003cp\u003eREV primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.014256619144604%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.79022403258656%\" valign=\"top\"\u003e\n \u003cp\u003e10 \u0026mu;M\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"44.19551934826884%\" valign=\"top\"\u003e\n \u003cp\u003eFluorogenic probe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.014256619144604%\" valign=\"top\"\u003e\n \u003cp\u003e0.5 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.79022403258656%\" valign=\"top\"\u003e\n \u003cp\u003e10 \u0026mu;M\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"44.19551934826884%\" valign=\"top\"\u003e\n \u003cp\u003eRNaseOUT\u0026trade;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.014256619144604%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.79022403258656%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"44.19551934826884%\" valign=\"top\"\u003e\n \u003cp\u003eRNA template\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.014256619144604%\" valign=\"top\"\u003e\n \u003cp\u003e10 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.79022403258656%\" valign=\"top\"\u003e\n \u003cp\u003e1 pg to 1 \u0026mu;g\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"44.19551934826884%\" valign=\"top\"\u003e\n \u003cp\u003eDEPC-treated water\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.014256619144604%\" valign=\"top\"\u003e\n \u003cp\u003eUp to 50 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.79022403258656%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003ed.\u0026nbsp; \u0026nbsp;\u0026nbsp;Upon setting up the reactions, seal the 96 well plate with micro seal adhesive film, then collect the plate contents by brief centrifugation. Place the plate in CFX96 Real-Time system and set up the RT-qPCR profile of the quantitative One step RT-qPCR (TaqMan\u0026trade;) as follows:\u0026nbsp;\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"41.61849710982659%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTemperature\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.22350674373796%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eDuration\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.15799614643545%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNo of cycles\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"41.61849710982659%\" valign=\"top\"\u003e\n \u003cp\u003e50 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.22350674373796%\" valign=\"top\"\u003e\n \u003cp\u003e15 minutes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.15799614643545%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"41.61849710982659%\" valign=\"top\"\u003e\n \u003cp\u003e95 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.22350674373796%\" valign=\"top\"\u003e\n \u003cp\u003e2 minutes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.15799614643545%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"41.61849710982659%\" valign=\"top\"\u003e\n \u003cp\u003e95 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.22350674373796%\" valign=\"top\"\u003e\n \u003cp\u003e15 sec\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.15799614643545%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e40\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"53.46534653465346%\" valign=\"top\"\u003e\n \u003cp\u003e60 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"46.53465346534654%\" valign=\"top\"\u003e\n \u003cp\u003e30 sec\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003eMelt curve 65 \u0026deg;C to 95 \u0026deg;C increment 0.5 for 0.05 +plate read\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003ee.\u0026nbsp; \u0026nbsp;\u0026nbsp;Once the cycle ends, copy the files and analyse the data.\u003c/p\u003e\n\u003cp\u003ef.\u0026nbsp; \u0026nbsp; \u0026nbsp;In Excel file, generate two standard curves for each of rVSV-dG-RV-G-GFP and rVSV-GFP-WT, representing the log of copy number values (different dilutions) on the \u003cem\u003eX\u003c/em\u003e-axis versus the CT values obtained for each of the viral RNA dilutions on the \u003cem\u003eY\u003c/em\u003e- axis \u003cstrong\u003e(Figure 7 A-B)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eg.\u0026nbsp; \u0026nbsp;\u0026nbsp;From the plotted standard curve in Excel sheet, right click on the graph, select trendline option, click display equation then an equation appears as follows:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eh.\u0026nbsp; \u0026nbsp;\u0026nbsp;Y, CT values= (-3.1452(m), slope) X, log quantity +21.74(b), intercept.\u003c/p\u003e\n\u003cp\u003ei.\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;For calculating the efficiency of qPCR reaction, the following equation is used:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEfficiency;e = (10\u003csup\u003e(-1/m;slope)\u003c/sup\u003e-1) x 100\u003c/strong\u003e, efficiency could also be calculated from this website by entering the slope https://www.agilent.com/store/biocalculators/calcSlopeEfficiency.jsp?_requestid=4967792. where: e = theoretical efficiency, Slope = the slope of the standard curve, plotted with the y axis as Ct and the x axis as log(quantity). For rVSV-dG-RV-G-GFP and rVSV-GFP-WT, the efficiency of qPCR was 94.24 and 107%; respectively. Typically, amplification efficiency ranges from 90-110%.\u003c/p\u003e\n\u003cp\u003ej.\u0026nbsp; \u0026nbsp; \u0026nbsp;To quantify the genomic viral RNA copies of rVSV-dG-RV-G-GFP and rVSV-GFP-WT in time dependent manner, infect BHK-21 cells (70-80 % confluency) with rVSV-dG-RV-G-GFP or rVSV-GFP-WT at MOI=1. Collect the viral supernatants at different time intervals from 6 hrs until 42 hpi, to comparatively assess the replication of both viruses and to determine the peak of virus replication.\u003c/p\u003e\n\u003cp\u003ek.\u0026nbsp; \u0026nbsp;\u0026nbsp;Extract the viral RNA from the collected viral supernatants and set up qRT-PCR reaction for all obtained specimens as described above.\u003c/p\u003e\n\u003cp\u003el. \u0026nbsp; \u0026nbsp; \u0026nbsp;After obtaining the CT values of the samples, calculate their mean and standard error at the different time points.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003em. \u0026nbsp; Quantify viral RNA copies of rVSV-dG-RV-G-GFP and rVSV-GFP-WT at the different time points using the following equation:\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003e\u003cem\u003eT (quantity)=10\u003csup\u003e\u0026nbsp;(CT(Cycle Threshold)-b(intercept)/m(slope)\u003c/sup\u003e\u003c/em\u003e\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThen calculate Log \u003csub\u003e10\u003c/sub\u003e of the obtained values and plot as growth curves in GraphPad Prism \u003cstrong\u003e(Figure 7 C)\u003c/strong\u003e.\u003c/p\u003e"},{"header":"Structural characterization","content":"\u003ch2\u003eImmunofluorescence staining assay.\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003eTiming\u003c/strong\u003e\u003cstrong\u003e: [4-5 days\u003c/strong\u003e\u003cstrong\u003e]\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo demonstrate the localization of VSV-M and RV-G proteins in each of rVSV-dG-RV-G-GFP and rVSV-dG-GFP-WT, perform IFA assay\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003csup\u003e18\u003c/sup\u003e as follows:\u003c/p\u003e\n\u003cp\u003e49.\u0026nbsp;\u0026nbsp;Day 1: In a 24 well plate, seed BHK-21 cells at a density of 5 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells/well on cover slips, incubate at 37 \u0026deg;C/5% CO2\u003csub\u003e\u0026nbsp;\u003c/sub\u003efor the next day.\u003c/p\u003e\n\u003cp\u003e50.\u0026nbsp;\u0026nbsp;Next day, upon reaching 70-80% cell confluency, wash the cells with 1 X PBS.\u003c/p\u003e\n\u003cp\u003e51.\u0026nbsp;\u0026nbsp;While washing the cells, prepare the virus inoculum of each of rVSV-dG-RV-G-GFP and rVSV-dG-GFP-WT by diluting in infection medium (MOI of 1).\u003c/p\u003e\n\u003cp\u003e52.\u0026nbsp;\u0026nbsp;Remove the PBS from the BHK-21 cells, then inoculate the prepared virus onto the cells, followed by incubating the plates at 37\u0026deg; C for 2 hrs with shaking.\u003c/p\u003e\n\u003cp\u003e53.\u0026nbsp;\u0026nbsp;Two hrs post infection, remove the virus inoculum and wash the cells 3 X with 1 X PBS, then aspirate the PBS and add the growth medium.\u003c/p\u003e\n\u003cp\u003e54.\u0026nbsp;\u0026nbsp;Day 3: Twenty-four hrs post infections, check the cells for GFP to ensure successful infection and wash the infected cells three times with 200 \u0026mu;L/well 1 X PBS.\u003c/p\u003e\n\u003cp\u003e55.\u0026nbsp;\u0026nbsp;Aspirate the PBS, then add 200 \u0026mu;L /well of 4% PFA at RT for each well to allow cell fixation. After 1 hr, remove the PFA and wash the cells with 1 X PBS. Critical: 36.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Ensure proper rinsing after each step to avoid false positive results. Also, it is recommended to place the plate on a shaker to allow proper distribution of the reagents.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCritical:\u003c/strong\u003e Ensure proper rinsing after each step to avoid false positive results. Also, it is recommended to place the plate on a shaker to allow proper distribution of the reagents.\u003c/p\u003e\n\u003cp\u003e56.\u0026nbsp;\u0026nbsp;Upon PBS removal, permeabilize the cells by adding 200 \u0026mu;L/well of 0.1% Triton X-100 for 10 minutes. After 9 minutes, remove the triton and wash the cells 3 times with 1 X PBS, allow 5 min/wash to ensure removal of all traces of the Triton solution\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCritical:\u0026nbsp;\u003c/strong\u003eTriton X-100 is recommended to be used as it permeabilize lipid bilayer and nuclear membrane. Ensure not to incubate triton with the cells for longer times or using high concentrations as it might destroy the cell membrane.\u003c/p\u003e\n\u003cp\u003e57.\u0026nbsp;\u0026nbsp;Aspirate the PBS, then add 200 \u0026mu;L/well of blocking buffer composed of 0.5% bovine serum albumin (BSA) for 1 hour at RT on a shaker, to block non-specific binding.\u003c/p\u003e\n\u003cp\u003e58.\u0026nbsp;\u0026nbsp;After 1 hr, remove the blocking solution, and prepare the primary antibody which is either targeting VSV-M or RV-G as follows: the monoclonal VSV M antibody (produced in mouse or the monoclonal RV-G antibody. Prepare VSV-M or RV-G antibody solutions at concentration of 1:400 for the primary antibodies by diluting 3 \u0026mu;L of the primary antibody in 1200 \u0026mu;L 0.5 % BSA solution, with adding 200 \u0026mu;L of the antibody solution / each well. Incubate the plate with the primary antibody, overnight at 4\u0026deg; C on a shaker, cover the plate with aluminium foil to prevent evaporation of the contents.\u003c/p\u003e\n\u003cp\u003e59.\u0026nbsp;\u0026nbsp;Day 4: Next day, remove the primary antibody solution. rinse the cells for 3 times with 1 X PBS, 5 min/wash for removal any excess of the primary antibody solution.\u003c/p\u003e\n\u003cp\u003e60.\u0026nbsp;\u0026nbsp;Prepare the secondary antibody solution as follows: Prepare a concentration of 1:800 for the secondary antibody solutions by diluting 1.5 \u0026mu;L of the secondary antibody goat anti-mouse IgG Alexa-Fluor 488 in 1200 \u0026mu;L 0.5 % BSA, with adding 200 \u0026mu;L of the antibody solution / each well, incubate for 1-2 hrs at RT on shaker with covering the plate with aluminium foil.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e61.\u0026nbsp;\u0026nbsp;After 2 hrs, aspirate the secondary antibody solution, wash the cells with 1 X PBS for 3 times, 5 min/wash, and a final wash with distilled water, aspirate the distilled water.\u003c/p\u003e\n\u003cp\u003e62.\u0026nbsp;\u0026nbsp;\u0026nbsp;Thereafter, for nuclei staining add 200 \u0026mu;L of 4\u0026rsquo;,6-diamidino-2-phenylindole (DAPI) for 30 minutes (1:10,000) on a shaker, covered with aluminium foil. In the meantime, prepare glass slides mounted with 1 drop of VECTASHIELD as the mounting medium. For each glass slide, mount 2 coverslips and clearly label them with the corresponding samples.\u003c/p\u003e\n\u003cp\u003e63.\u0026nbsp;\u0026nbsp;\u0026nbsp;After nuclei staining, gently dislodge the coverslips form the plates using forceps, then dip the cover slips in Milli-Q water, followed by gently drying the coverslips\u0026rsquo; edges in fibre free paper.\u003c/p\u003e\n\u003cp\u003e64.\u0026nbsp;\u0026nbsp;Carefully, invert the cover slides, so that the side with cultured cells, is in the bottom. To avoid any air bubbles, gently press the coverslip with the tip of a 1 \u0026mu;L pipette tip.\u003c/p\u003e\n\u003cp\u003e65.\u0026nbsp;\u0026nbsp;Seal the cover slip into the microscopic slides with a clear nail polish by gently adding one drop on each of the coverslip corners. Avoid dissemination of nail polish as that will interfere with visualization. To ensure dryness of the nail polish, keep the microscopic slides for around 30 minutes to dry, in a dark place.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e66. \u0026nbsp;Keep the slides at 4\u0026deg; C, covered, to be away from light, until imaging. Preferably, image the slides within 2 weeks since prolonged storage might result in dryness of the cells.\u003c/p\u003e\n\u003cp\u003e67. \u0026nbsp;Acquire the images with laser confocal microscope, (LSM880). Execute and analyse the images using Zeiss software \u003cstrong\u003e(Figure 8 A)\u003c/strong\u003e.\u003c/p\u003e\n\u003ch2\u003eWestern blot\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003eTiming\u003c/strong\u003e\u003cstrong\u003e: [6-7 days\u003c/strong\u003e\u003cstrong\u003e]\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo confirm in frame cloning and expression of RV-G and to demonstrate the proper assembly of rVSV-dG-RV-G-GFP and rVSV-dG-GFP-WT, we assessed the expression of RV-G and VSV-M proteins by western blot as previously described\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003csup\u003e19\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e68.\u0026nbsp;\u003cstrong\u003eSamples preparation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea.\u0026nbsp; \u0026nbsp;\u0026nbsp;Day 1: In two six well plates, seed BHK-21 cells, at a density of 0.3 x 10\u003csup\u003e6\u003c/sup\u003e cells/well. Incubate the plates at 37 \u0026deg;C/ 5% CO2\u003csub\u003e\u0026nbsp;\u003c/sub\u003euntil the following day.\u003c/p\u003e\n\u003cp\u003eb.\u0026nbsp; \u0026nbsp;\u0026nbsp;Day 2: On the following day, upon reaching the cells 70-80 % confluency, aspirate the growth medium and wash the cells once with 1 X PBS, then infect 3 wells with rVSV-dG-RV-G-GFP at MOI=1, other 3 wells with rVSV-dG-GFP WT at MOI=1 and keep 3 wells as mock control.\u003c/p\u003e\n\u003cp\u003ec.\u0026nbsp; \u0026nbsp; \u0026nbsp;Prepare the infection medium by diluting either the rVSV-dG-RV-G-GFP or rVSV-dG-GFP-WT in 900 \u0026mu;L DMEM only without serum or antibiotic and infect the cells with the inoculum, then incubate the plates for 2 hrs at 37 \u0026deg;C/5% CO\u003csub\u003e2\u003c/sub\u003e, with shaking every 15-20 min to allow even distribution of the virus into cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ed.\u0026nbsp; \u0026nbsp;\u0026nbsp;After 2 hrs, remove the inoculum and wash the cells 3 times with 1 X PBS, then add the growth medium.\u003c/p\u003e\n\u003cp\u003ee.\u0026nbsp; \u0026nbsp;\u0026nbsp;Day 5 Thirty-six hours post infection, wash the cells 3 times with 1 X cold PBS, then add 200 uL of ice cold 1X PBS, scrape the cells using 1 mL pipette tip detach the cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCritical:\u0026nbsp;\u003c/strong\u003eFor BHK-21 cells, cell detachment is easily carried out by ice cold 1 X PBS. For other adherent cell lines, gentle dissociation reagents such as Accutase could be used. Preferably, from this step all subsequent steps for sample preparation to be carried out on ice.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ef.\u0026nbsp; \u0026nbsp; \u0026nbsp;Collect the PBS scraped cells into the corresponding labelled 1.5 mL labelled Microcentrifuge tubes.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eg.\u0026nbsp; \u0026nbsp;\u0026nbsp;Centrifuge the cells at 300 x g for 5 min, discard the supernatant and resuspend the cell pellet in 100 \u0026mu;L of 1% NP-40 lysis buffer added to it protease inhibitor tablet to obtain the whole cell lysates.\u003c/p\u003e\n\u003cp\u003eh.\u0026nbsp; \u0026nbsp;\u0026nbsp;Place the samples on ice and keep on a shaker for 30 min, then centrifuge the samples at 13000 x g for 20 min.\u003c/p\u003e\n\u003cp\u003ei.\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Discard the pellet and transfer the supernatant into fresh new, labelled 1.5 mL Microcentrifuge tubes.\u003c/p\u003e\n\u003cp\u003e69.\u0026nbsp;\u003cstrong\u003eGel casting and preparation.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea.\u0026nbsp; \u0026nbsp;\u0026nbsp;Assemble the casting stand, casting frame, small and large glass plates 1.5 mm for gel casting as follows:\u003c/p\u003e\n\u003cp\u003eb.\u0026nbsp; \u0026nbsp;\u0026nbsp;Initially place the large rectangular casting stand on a clean, dry surface. Align the bottom of small and large 1.5 mm glass spacers together, with the smaller plates facing the outside. Secure the aligned glass plates into the frame by pushing gates of the frame out to the sides. Assemble the casting frame with the glass plates into the casting stand.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCritical:\u003c/strong\u003e Check whether assembled plates in the casting stand are properly sealed, by pipetting 1 mL of water into the space between the plates, if no leaking, then it is ready to prepare the gels, pour the water added into a sink and dry the plates from any residual water. If leakage is observed, reassemble the plates in the casting frame within the casting stand.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ec.\u0026nbsp; \u0026nbsp;For SDS-PAGE, resolving and stacking gels are required. a resolving gel in which proteins are resolved based on their molecular weights (MWs) and a stacking gel in which proteins are concentrated before entering the resolving gel. Prepare the resolving and stacking gels as follows.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCritical:\u003c/strong\u003e If you need to prepare all the gels at the same time, you can do so, but do not add 10% SDS, 10% APS and TEMED until you are ready to pour the gels in the casting tray as this will result in gel polymerization and solidification.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCritical:\u003c/strong\u003e If needed to visualize proteins of different sizes in the same gel, prepare a gradient gel of two different concentration for example from 8-12%. Prepare 5 mL of each of the gel concentrations in separate conical tubes. Using a 10-mL serological pipette, pipette half the volume from the low gel concentration tube and then add to it the other half from the high gel concentration tube, aspirate air bubble up to the pipette, to allow mixing of the low and high gel concentrations. Slowly pipette the gradient solution into the gel cast, preferably use the serological pipette.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.355072463768117%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eComponent\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.72463768115942%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eResolving gel 12%\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(10 mL)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.91304347826087%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eResolving gel 8%\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(10 mL)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.007246376811594%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eStacking gel (4%)\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(4 mL)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.355072463768117%\" valign=\"top\"\u003e\n \u003cp\u003eMilli-Q water\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.72463768115942%\" valign=\"top\"\u003e\n \u003cp\u003e33 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.91304347826087%\" valign=\"top\"\u003e\n \u003cp\u003e4.6 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.007246376811594%\" valign=\"top\"\u003e\n \u003cp\u003e2.7 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.355072463768117%\" valign=\"top\"\u003e\n \u003cp\u003e30% acrylamide-Bis acrylamide\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.72463768115942%\" valign=\"top\"\u003e\n \u003cp\u003e4 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.91304347826087%\" valign=\"top\"\u003e\n \u003cp\u003e2.7 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.007246376811594%\" valign=\"top\"\u003e\n \u003cp\u003e670 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.355072463768117%\" valign=\"top\"\u003e\n \u003cp\u003e1.5 M Tris-HCL pH 8.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.72463768115942%\" valign=\"top\"\u003e\n \u003cp\u003e25 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.91304347826087%\" valign=\"top\"\u003e\n \u003cp\u003e2.5 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.007246376811594%\" valign=\"top\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.355072463768117%\" valign=\"top\"\u003e\n \u003cp\u003e0.5 M Tris-HCL pH 6.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.72463768115942%\" valign=\"top\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.91304347826087%\" valign=\"top\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.007246376811594%\" valign=\"top\"\u003e\n \u003cp\u003e500 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.355072463768117%\" valign=\"top\"\u003e\n \u003cp\u003e10% SDS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.72463768115942%\" valign=\"top\"\u003e\n \u003cp\u003e100 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.91304347826087%\" valign=\"top\"\u003e\n \u003cp\u003e100 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.007246376811594%\" valign=\"top\"\u003e\n \u003cp\u003e40 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.355072463768117%\" valign=\"top\"\u003e\n \u003cp\u003e10% APS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.72463768115942%\" valign=\"top\"\u003e\n \u003cp\u003e100 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.91304347826087%\" valign=\"top\"\u003e\n \u003cp\u003e100 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.007246376811594%\" valign=\"top\"\u003e\n \u003cp\u003e40 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.355072463768117%\" valign=\"top\"\u003e\n \u003cp\u003eTEMED\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.72463768115942%\" valign=\"top\"\u003e\n \u003cp\u003e4 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.91304347826087%\" valign=\"top\"\u003e\n \u003cp\u003e6 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.007246376811594%\" valign=\"top\"\u003e\n \u003cp\u003e4 \u0026mu;L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003ed. \u0026nbsp;Upon assembly of the gel casting tray, pour the prepared resolving gel into the space between the assembled glass plates. Make sure to leave a space of around 2-4 mL for the stacking gel.\u003c/p\u003e\n\u003cp\u003ee. \u0026nbsp;Add 1 mL of Isopropanol over the resolving gel to ensure a uniform gel is formed, without any air bubbles. Wait for 30-45 min until gel solidification (can be checked by leaving some gel solution in the tube).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ef. \u0026nbsp; Upon solidification of the resolving gel, remove the isopropanol by tilting the apparatus (also you can ensure no remaining isopropanol by drying in between the glass plates with filter paper), then pour the stacking gel and insert the 10-well, 1.5 mm comb. Leave the gel for solidification for approximately 30 min, then remove the comb.\u003c/p\u003e\n\u003cp\u003e70. \u003cstrong\u003eElectrophoresis and blotting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea.\u0026nbsp; \u0026nbsp;\u0026nbsp;Remove the clamp assembly carrying the gel from the gel casting stand and place it into the electrode assembly. Pour 1 X SDS running buffer (prepared by diluting 10 mL of 10 X SDS buffer into 90 mL Milli-Q water, add the water first as SDS form foams) into the electrode assembly and in the buffer chamber at a level halfway between the short and the large plates.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eb.\u0026nbsp;\u0026nbsp;Initially run the gel for 30 minutes at low voltages (V) (60 V) for the separating gel, then apply higher voltages (100-120 V) for the stacking gel. Once the dye runs off the bottom of the gel, remove the electrode assembly.\u003c/p\u003e\n\u003cp\u003ec.\u0026nbsp; \u0026nbsp;To prepare for gel blotting, activate the PVDF membrane (Thermo Scientific\u0026trade;), soaked in methanol for approximately 2 min. (Fisher Chemical) and immerse the filter paper in 1 X transfer buffer, then equilibrize the gel in transfer buffer.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ed.\u0026nbsp;\u0026nbsp;For blotting, arrange the gel in the Trans- blot turbo membrane blotter (Bio-Rad), by adding three layers of filter paper followed by the PVDF membrane (make notch in one corner to indicate orientation of gel \u0026ndash; to indicate which side the ladder is and which way the membrane should face) then add the gel followed by other 3 layers of filter paper. Ensure there are no air bubbles while blotting the membranes, by gently using a roller over the membranes. Set the transfer conditions as follows: 1.3 A, 25 V for 30 minutes for the mini gel.\u003c/p\u003e\n\u003cp\u003ee.\u0026nbsp;\u0026nbsp;Upon membrane blotting, carefully remove the filter papers and the gel, then gently trim the PVDF membrane with blotted proteins, and place the membrane (avoid membrane dryness in all steps) in a 50-mL conical tubes for blocking in 10 mL of 5% non-fat dry milk in PBST (0.5% tween-20 in 1X PBS) for 1 hour on a roller at RT.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ef.\u0026nbsp; \u0026nbsp;Afterwards, wash the membrane once with 10 mL of 0.5% tween 20 in 1X PBS.\u003c/p\u003e\n\u003cp\u003eg.\u0026nbsp; \u0026nbsp;During washing, prepare the primary antibody solution with either the monoclonal VSV M antibody (Kerafast Cat# EB0011, RRID:AB_2734773) or the monoclonal RV-G antibody (Bio-Rad Cat# MCA2828, RRID:AB_1125351) produced in mouse. Prepare the primary antibody solution at a concentration of 1:2000, prepared by mixing in a conical tube 2.5 \u0026mu;L of the primary antibody in 5 mL of 5% non-fat dry milk in PBS-T.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eh.\u0026nbsp;\u0026nbsp;Remove the washing solution, then add the primary antibody to the membrane in the conical tube.\u003c/p\u003e\n\u003cp\u003ei.\u0026nbsp; \u0026nbsp;\u0026nbsp;Keep the membrane incubated with primary antibody at 4\u0026deg; C overnight on a roller, ensure to keep rolling the tube while moving it from RT to 4\u0026deg; C to avoid membrane dryness.\u003c/p\u003e\n\u003cp\u003ej. \u0026nbsp; \u0026nbsp;Day 6: Next day at RT, wash the membrane 3 times in PBST (0.5% tween 20 in 1 X PBS), 5 min/wash. In the meantime, prepare the secondary antibody, polyclonal goat anti-mouse IgG (H\u0026amp;L) HRP at a concentration of 1:3000, prepared by mixing 1.7 \u0026mu;L of the secondary antibody in 5 mL of 5% non-fat dry milk in PBS-T.\u003c/p\u003e\n\u003cp\u003ek. \u0026nbsp; Remove the washing buffer, then add the secondary antibody to the membrane, cover the tubes with aluminium foil, then incubate the membrane in the conical tube for 2 hours at RT on a roller. Thereafter, remove the secondary antibody and wash the membrane 3 times with PBS-T (0.5% tween 20 in 1 X PBS).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e71. \u003cstrong\u003eImmunodetection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea.\u0026nbsp; \u0026nbsp;\u0026nbsp;Eventually, using a forceps, gently transfer the membrane from the conical tube to a square petri-dish. Prepare the pierce ECL Western Blotting Substrate by adding equal volumes of detection reagent 1 and detection reagent 2, then cover the Petri dish with aluminium foil and incubate for 1 min.\u003c/p\u003e\n\u003cp\u003eb. \u0026nbsp; \u0026nbsp;Using a forceps, place the membrane into the ChemiDoc\u0026trade; MP imaging System and adjust the imager to focus on the membrane edges and then start collecting the images using the following protocols: chemi hi sensitivity, chemi hi-resolution and multichannel protocols. Carry out subsequent image analysis using Image Lab software.\u003c/p\u003e\n\u003cp\u003ec. \u0026nbsp; \u0026nbsp; As loading control, incubate the same protein lysate aliquots with rabbit polyclonal alpha tubulin antibody with goat anti-rabbit IgG H\u0026amp;L HRP conjugated as a secondary antibody \u003cstrong\u003e(Figure 8 B-C)\u003c/strong\u003e.\u003c/p\u003e\n\u003ch2\u003eFlow cytometry (FC)\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003eTiming\u003c/strong\u003e\u003cstrong\u003e: [4-5\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;days]\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSince both rVSV-dG-RV-G-GFP and rVSV-GFP WT encode GFP which serves as marker of infection, that could be used to determine the virus infection from the GFP expression levels in infected cells. To this end, flow cytometry serves as a useful tool to determine virus infection form the GFP expression levels in infected cells.\u003c/p\u003e\n\u003cp\u003e72.\u0026nbsp;\u0026nbsp;Day 1: Seed six well plates with BHK-21 cells at a density of 0.3 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells/well, incubate the plates at 37 \u0026deg;C /5% CO\u003csub\u003e2\u003c/sub\u003e until the following day.\u003c/p\u003e\n\u003cp\u003e73.\u0026nbsp;\u0026nbsp;Day 2: Upon reaching 70-80% confluency, infect the BHK-21 cells with each of rVSV-dG-RV-G-GFP and rVSV-GFP-WT at MOI of 1. Prepare triplicate wells of BHK-21 cells infected with each of rVSV-dG-RV-G-GFP and rVSV-GFP=WT, also keep 3 uninfected wells to serve as mock control. Incubate the plates at 37 \u0026deg;C for 2 hrs with shaking every 15-20 min.\u003c/p\u003e\n\u003cp\u003e74.\u0026nbsp;\u0026nbsp;After 2 hrs, remove the virus inoculum, wash the cells with 1 X PBS for 3 times, aspirate the PBS and add 1.5 mL of growth medium.\u003c/p\u003e\n\u003cp\u003e75.\u0026nbsp;\u0026nbsp;Day 4: Thirty hpi, remove the supernatant and wash the cells with 1 X PBS, followed by detaching the cells and transferring them into clearly labelled 1.5 mL Microcentrifuge tubes for FC analysis. For BHK-21 cells they are easily detached with 1X PBS only, while for other cell lines, trypsin or other reagents may be required such as accutase or versine.\u003c/p\u003e\n\u003cp\u003e76.\u0026nbsp;\u0026nbsp;To obtain the cell pellet, centrifuge the cells at 300 x g for 5 min, discard the supernatant and wash the cell pellet once with 1 X PBS.\u003c/p\u003e\n\u003cp\u003e77.\u0026nbsp;\u0026nbsp;After PBS removal, prepare the live dead marker by mixing 2 \u0026mu;L of LIVE/DEAD\u0026trade; Fixable Violet Dead Cell Stain into 2 mL of FC buffer (2% FBS in 1 X PBS). For each specimen, add 200 \u0026mu;L of the prepared live dead marker solution and incubate on ice for 30 min, keep the samples away from light.\u0026nbsp;\u003cstrong\u003eCritical\u003c/strong\u003e: If samples to be analysed on the same day, fixing the cells will not be necessary, however if samples will be analysed on a different day, fixing the cells in 4% PFA for 1 hr, will be required.\u003c/p\u003e\n\u003cp\u003e78.\u0026nbsp;\u0026nbsp;Pellet the cells, then wash once with 1X PBS, after cell pelleting, discard the PBS and add 200 \u0026mu;L of 1 X permeabilization buffer prepared by mixing 200 \u0026mu;L of 10X permeabilization buffer into 1800 mL of FC buffer.\u003c/p\u003e\n\u003cp\u003e79.\u0026nbsp;\u0026nbsp;Incubate the samples on ice and keep away from light for 15 min. After 15 min, centrifuge the samples and wash the cell pellet once with PBS.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e80.\u0026nbsp;\u0026nbsp;Resuspend the pellet in 100 \u0026mu;L of FC buffer. For FC analysis, follow the start-up instruction of the CytoFLEX Flow Cytometer, followed by performing QC standardization with flow cytometry beads to calibrate the flow cytometry data.\u003c/p\u003e\n\u003cp\u003e81.\u0026nbsp;\u0026nbsp;In tube mode, place the tubes corresponding to each of the prepared samples with performing number of events ranging from 30,000-50,000 events/sample.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e82.\u0026nbsp;\u0026nbsp;For each of the samples, plot pseudo colour plots as follows\u003cstrong\u003e\u0026nbsp;(Figure 9 A)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eFirst: side scatter (SSC-A) vs PB450-A for gating live cells only. Second: forward scatter area (FSC-A) vs forward scatter height (FSC-H) for gating singlet cells from live cells. Third: side scatter area (SSC-A) vs FITC-A to gate cell populations expressing GFP, the FITC-A is variable according to the fluorescence tested.\u003c/p\u003e\n\u003cp\u003e83. \u0026nbsp;Import the data to USB, then analyse them using CytExpert or FCS Express and plot the data in graph \u003cstrong\u003e(Figure 9 B)\u003c/strong\u003e. \u003cstrong\u003eTroubleshooting 5\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e"},{"header":"Expected outcomes","content":"\n\u003cp\u003eOur protocol describes the procedures to generate rcVSVs. The generated rVSV-dG-RV-G-GFP serves as a reliable model for studying the entry and internalization of rabies and thus allowing to study virus tropism. In addition, since the generated replication competent virus expresses green fluorescence protein (GFP), virus infection can be estimated from the level of GFP expression in the target cells, which can be measured by flow cytometry.\u003c/p\u003e"},{"header":"Limitations","content":"\n\u003cp\u003e\u0026middot; \u0026nbsp; \u0026nbsp;We prepared the rcVSV on BHK-21 cells, so we did not test the rescue process on other cell line. Thus, we recommend preparing the rcVSV on BHK-21 cells.\u003c/p\u003e\n\u003cp\u003e\u0026middot; \u0026nbsp; \u0026nbsp;We passaged the generated rcVSV for 3 passages since the main aim was to study virus host interaction. However, if the generated rcVSV would be used for vaccine, it is preferred to do more passages and test the stability of the foreign insert during subsequent passages\u003cem\u003e.\u0026nbsp;\u003c/em\u003e\u003c/p\u003e"},{"header":"Troubleshooting","content":"\u003ch2\u003eProblem 1:\u003c/h2\u003e\n\u003cp\u003eNo colonies observed upon cloning RV-G insert into pVSV-dG-GFP (step 16).\u003c/p\u003e\n\u003ch2\u003ePotential solution:\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003e\u0026middot; \u0026nbsp; \u0026nbsp; Try different Ligation reactions with 1:1 and 5:1; insert: vector ratios, showed successful cloning, for calculation of the molar ratios, use the NEB calculator (https://nebiocalculator.neb.com/#!/ligation#!%2F).\u003c/p\u003e\n\u003cp\u003e\u0026middot; \u0026nbsp; \u0026nbsp; Incubate the LB plates at 30 \u0026deg;C for overnight.\u003c/p\u003e\n\u003ch2\u003eProblem 2:\u003c/h2\u003e\n\u003cp\u003eNo GFP observed upon co-transfecting pVSV-dG-RV-G-GFP and helper plasmids (step 26).\u003c/p\u003e\n\u003ch2\u003ePotential solution:\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003e\u0026middot; \u0026nbsp; \u0026nbsp; Try different plasmid ratios. \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026middot; \u0026nbsp; \u0026nbsp;For splitting the BHK-21 cells. The day before co-transfection, use 1X PBS instead of trypsin.\u003c/p\u003e\n\u003ch2\u003eProblem 3:\u003c/h2\u003e\n\u003cp\u003eCell death upon inoculating the recued rcVSV-dG-RV-G-GFP (step 28).\u003c/p\u003e\n\u003ch2\u003ePotential solution:\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003e\u0026middot; \u0026nbsp; \u0026nbsp; For further passaging of rVSV-dG-RV-G-GFP, try different concentrations during the inoculation of the rescue virus rVSV-dG-RV-G-GFP, since high concentrations might cause cell death, while low concentration might be insufficient.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eProblem 4:\u003c/h2\u003e\n\u003cp\u003eAbsence of well-defined plaques (step 45).\u003c/p\u003e\n\u003ch2\u003ePotential solution:\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003e\u0026middot; \u0026nbsp; \u0026nbsp; Test 2 different overlay medium (semi-solid such as 3% CMC) and solid medium (1.6 %agarose) and compare them in terms of formation of defined plaques.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eProblem 5:\u003c/h2\u003e\n\u003cp\u003eNo difference observed in the GFP % observed between infected and uninfected cells with rcVSV-dG-RV-GFP (step 83).\u003c/p\u003e\n\u003ch2\u003ePotential solution:\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003e\u0026middot;\u0026nbsp; \u0026nbsp; \u0026nbsp;It is important to maintain a similar number of events for all samples to allow uniform comparative data analysis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026middot; \u0026nbsp; \u0026nbsp; It is crucial to include a non-fluorescent control (mock cells), to analyse the fluorescent samples accordingly.\u003c/p\u003e"},{"header":"Resource availability","content":"\u003cp\u003e\u003cstrong\u003eLead contact:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026middot;\u0026nbsp; \u0026nbsp;\u0026nbsp;Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, [Prof Muhammad Munir] ([email protected]).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTechnical contact:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026middot;\u0026nbsp; \u0026nbsp;\u0026nbsp;Questions about the technical specifics of performing the protocol\u0026nbsp;should be directed to and will be answered by the technical contact, [Dr Manar E. Khalifa], ([email protected]).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMaterials availability:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026middot;\u0026nbsp; \u0026nbsp;\u0026nbsp;The pVSV-dG-RV-G-GFP plasmid and the rcVSV-dG-RV-G-GFP generated in this study are available upon request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData and code availability:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026middot;\u0026nbsp; \u0026nbsp;\u0026nbsp;\u003cem\u003e\u0026nbsp;\u003c/em\u003eThis study did not generate any unique datasets or code\u003cem\u003e.\u003c/em\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by the Biotechnology and Biological Sciences Research Council (BBSRC) (BB/M008681/1 and BBS/E/I/00001852) and the British Council (172710323 and 332228521). The Ph.D. studies of MEK have been financially supported by Newton Mosharafa-Fund (Bureau ID: NMM11/19) and the Egyptian Ministry of Higher Education and Scientific Research, Cultural Affairs and Mission Sector, Egypt. Authors would like to thank Kerafast for providing original working plasmids and Luis Martinez-Sobrido from Texas Biomedical Research Institute, USA for providing\u0026nbsp;pCITE-GFP and pCAGG-GFP plasmids.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization, M.E.K and M.M.; Formal analysis, M.E.K; Investigation and methodology, MEK; Validation of results and project administration M.E.K and M.M; Resources, M.M; Supervision., M.M; Funding acquisition, M.M and M.E.K; Original draft preparation M.E.K; Review and editing, M.M. All authors contributed to the article and approved the submitted version.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eTani, H., Morikawa, S., and Matsuura, Y. (2012). Development and applications of VSV vectors based on cell tropism. Frontiers in Microbiology \u003cem\u003e2\u003c/em\u003e, 1\u0026ndash;7. 10.3389/fmicb.2011.00272.\u003c/li\u003e\n \u003cli\u003eWertz, G.W., Moudy, R., and Ball, L.A. (2002). Adding Genes to the RNA Genome of Vesicular Stomatitis Virus: Positional Effects on Stability of Expression. Journal of Virology \u003cem\u003e76\u003c/em\u003e, 7642\u0026ndash;7650. 10.1128/jvi.76.15.7642-7650.2002.\u003c/li\u003e\n \u003cli\u003eHastie, E., Cataldi, M., Marriott, I., and Grdzelishvili, V.Z. (2013). Understanding and altering cell tropism of vesicular stomatitis virus. Virus Research \u003cem\u003e176\u003c/em\u003e, 16\u0026ndash;32. 10.1016/j.virusres.2013.06.003.\u003c/li\u003e\n \u003cli\u003eTell, J.G., Coller, B.G., Dubey, S.A., Jenal, U., Lapps, W., Wang, L., and Wolf, J. (2020). Environmental Risk Assessment for rVSV ∆ G-ZEBOV-GP, a Genetically Modified Live Vaccine for Ebola Virus Disease.\u003c/li\u003e\n \u003cli\u003eYahalom-Ronen, Y., Tamir, H., Melamed, S., Politi, B., Shifman, O., Achdout, H., Vitner, E.B., Israeli, O., Milrot, E., Stein, D., et al. (2020). A single dose of recombinant VSV-∆G-spike vaccine provides protection against SARS-CoV-2 challenge. Nature Communications \u003cem\u003e11\u003c/em\u003e, 1\u0026ndash;13. 10.1038/s41467-020-20228-7.\u003c/li\u003e\n \u003cli\u003eBrown, K.S., Safronetz, D., Marzi, A., Ebihara, H., and Feldmann, H. (2011). Vesicular Stomatitis Virus-Based Vaccine Protects Hamsters against Lethal Challenge with Andes Virus. Journal of Virology \u003cem\u003e85\u003c/em\u003e, 12781\u0026ndash;12791. 10.1128/jvi.00794-11.\u003c/li\u003e\n \u003cli\u003eClarke, D.K., Cooper, D., Egan, M.A., Hendry, R.M., Parks, C.L., and Udem, S.A. (2006). Recombinant vesicular stomatitis virus as an HIV-1 vaccine vector. Sprimger semin Immun \u003cem\u003e28\u003c/em\u003e, 239\u0026ndash;253. 10.1007/s00281-006-0042-3.\u003c/li\u003e\n \u003cli\u003eZhang, Y.N., Chen, C., Deng, C.L., Zhang, C. guang, Li, N., Wang, Z., Zhao, L., and Zhang, B. (2020). A novel rabies vaccine based on infectious propagating particles derived from hybrid VEEV-Rabies replicon. EBioMedicine \u003cem\u003e56\u003c/em\u003e. 10.1016/j.ebiom.2020.102819.\u003c/li\u003e\n \u003cli\u003eRoberts, A., and Rose, J.K. (1998). Recovery of negative-strand RNA viruses from plasmid DNAs: A positive approach revitalizes a negative field. Virology \u003cem\u003e247\u003c/em\u003e, 1\u0026ndash;6. 10.1006/viro.1998.9250.\u003c/li\u003e\n \u003cli\u003eMunis, A.M., Bentley, E.M., and Takeuchi, Y. (2020). A tool with many applications: vesicular stomatitis virus in research and medicine. Expert Opinion on Biological Therapy \u003cem\u003e20\u003c/em\u003e, 1187\u0026ndash;1201. 10.1080/14712598.2020.1787981.\u003c/li\u003e\n \u003cli\u003eLawson, N.D., Stillman, E.A., Whitt, M.A., and Rose, J.K. (1995). Recombinant vesicular stomatitis viruses from DNA. Proceedings of the National Academy of Sciences of the United States of America \u003cem\u003e92\u003c/em\u003e, 4477\u0026ndash;4481. 10.1073/pnas.92.10.4477.\u003c/li\u003e\n \u003cli\u003ePerez, M., Clemente, R., Robison, C.S., Jeetendra, E., Jayakar, H.R., Whitt, M.A., and Torre, J.C. De (2007). Generation and Characterization of a Recombinant Vesicular Stomatitis Virus Expressing the Glycoprotein of Borna Disease Virus\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABUAAAATCAYAAAB/TkaLAAABC0lEQVQ4EeWSUQ2EMAyGZwENWMADEtAwCzjAwRygAAUYwAAO8NDLt6TLVpq73AP3ck0WRrd++/d3QR6I8ABTfgM9z1NijDKOo0zTJPu+l8us65rzrM3zLNd1lbV60ig9jkO6rsuDwr7vJYQg27bJsix5PgxDBpNnrwduoBQAqjeiVuEppSIIAYC5lY0C5dpsQlEdWowqGwC9fIHiHdDaQ4WQxw4baonN36D4Z0N9tPmPUHxEEV21gQUMG+q3zRelLGjH60bZAv3XHngiGqj66nVUYXw5FEtoEnAbDZRFHrg2xivgYH1i7K2Dm1J7gyoYFXhmAyDDeyVvoYC4otccL2cPdpXaTd/+/zn0BXhqh2V6aNHBAAAAAElFTkSuQmCC\" width=\"21\" height=\"19\"\u003e Journal of Virology \u003cem\u003e81\u003c/em\u003e, 5527\u0026ndash;5536. 10.1128/JVI.02586-06.\u003c/li\u003e\n \u003cli\u003eMichael R. Green, J.S. (2012). Molecular Cloning.\u003c/li\u003e\n \u003cli\u003eWhitt, M.A. (2010). Generation of VSV pseudotypes using recombinant \u0026Delta;G-VSV for studies on virus entry, identification of entry inhibitors, and immune responses to vaccines. Journal of Virological Methods \u003cem\u003e169\u003c/em\u003e, 365\u0026ndash;374. 10.1016/j.jviromet.2010.08.006.\u003c/li\u003e\n \u003cli\u003eMendoza, E.J., Manguiat, K., Wood, H., and Drebot, M. (2020). Two Detailed Plaque Assay Protocols for the Quantification of Infectious SARS-CoV-2. Current Protocols in Microbiology \u003cem\u003e57\u003c/em\u003e. 10.1002/cpmc.105.\u003c/li\u003e\n \u003cli\u003eHanke, L., Schmidt, F.I., Knockenhauer, K.E., Morin, B., Whelan, S.P., Schwartz, T.U., and Ploegh, H.L. (2017). Vesicular stomatitis virus N protein‐specific single‐domain antibody fragments inhibit replication. EMBO reports \u003cem\u003e18\u003c/em\u003e, 1027\u0026ndash;1037. 10.15252/embr.201643764.\u003c/li\u003e\n \u003cli\u003eRodr\u0026iacute;guez, A., Rodr\u0026iacute;guez, M., C\u0026oacute;rdoba, J.J., and Andrade, M.J. (2015). PCR Primer Design, Methods in Molecular Biology 10.1007/978-1-4939-2365-6.\u003c/li\u003e\n \u003cli\u003eFlanagan, J., Middeldorp, J., and Sculley, T. (2003). Localization of the Epstein-Barr virus protein LMP 1 to exosomes. Journal of General Virology \u003cem\u003e84\u003c/em\u003e, 1871\u0026ndash;1879. 10.1099/vir.0.18944-0.\u003c/li\u003e\n \u003cli\u003eMahmood, T., and Yang, P. (2012). Western Blot: Technique, Theory, and Trouble Shooting. North American Journal of Medical Sciences \u003cem\u003e4\u003c/em\u003e. 10.4103/1947-2714.100998.\u003c/li\u003e\n \u003cli\u003eBritton, P., Green, P., Kottier, S., Mawditt, K.L., Penzes, Z., Cavanagh, D., and Skinner, M.A. (1996). Expression of bacteriophage T7 RNA polymerase in avian and mammalian cells by a recombinant fowlpox virus. Journal of General Virology \u003cem\u003e77\u003c/em\u003e, 963\u0026ndash;967. 10.1099/0022-1317-77-5-963.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Supplementary Figures","content":"\u003cp\u003eSupplementary Figure 1 is not available with this version\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[{"identity":"7f51093e-9e8b-4709-928e-a7a433b69f44","identifier":"10.13039/501100000268","name":"Biotechnology and Biological Sciences Research Council","awardNumber":"BB/M008681/1 ","order_by":0},{"identity":"6363b318-716c-48c0-adc6-e950a2bd7d89","identifier":"10.13039/100010897","name":"Newton Fund","awardNumber":"NMM11/19","order_by":1}],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"Lancaster University","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"vaccines, VSV, Reverse genetics, Rabies","lastPublishedDoi":"10.21203/rs.3.rs-4281071/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4281071/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eRecombinant vectored vaccines offer trailer-made immunization strategies and are economical, quick to engineer and demand less laboratory infrastructures. Here we describe a detailed protocol for genetic manipulation of vesicular stomatitis virus (VSV) vector system encoding the antigenomic sense RNA of VSV by replacing VSV glycoprotein (VSV-G) with modular rabies virus glycoprotein (RV-G) gene. The production of replication competent recombinant VSV (rVSV) involves the transient transfection of BHK-21 cells with pVSV-expressing RV-G backbone along with transcriptional initiating helper plasmids under the control of T7 polymerase. In addition, we provide comprehensive guidelines on functional, molecular, and structural characterization of the recombinant rVSV-based rabies vaccine.\u003c/p\u003e","manuscriptTitle":"Construction and Characterization of Recombinant Vectored Vaccines for Rabies Virus","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-18 15:34:10","doi":"10.21203/rs.3.rs-4281071/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"38006b11-37e6-4a50-9aeb-562bf109467f","owner":[],"postedDate":"April 18th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":30791150,"name":"Virology"}],"tags":[],"updatedAt":"2024-04-18T15:34:10+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-18 15:34:10","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4281071","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4281071","identity":"rs-4281071","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}